Chronic ulcerative stomatitis: Clinical, histopathologic, and

immunopathologic findings
Lynn W. Solomon, DDS,a Alfredo Aguirre, DDS, MS,b Mirdza Neiders, DDS, MS,c Aymee
Costales-Spindler, DDS,d Glenn J. Jividen Jr, DDS,e Michael G. Zwick, PhD,f and
Vijay Kumar, PhD,g Buffalo, NY, Metairie, La, and Lexington, Ky
STATE UNIVERSITY OF NEW YORK, UNIVERSITY OF KENTUCKY, AND IMMCO DIAGNOSTICS INC

Chronic ulcerative stomatitis (CUS) is a mucocutaneous disease primarily involving mucosal surfaces, but
occasionally may involve the skin. Clinically, CUS patients exhibit erosive or ulcerative lesions of the oral mucosa that
resemble erosive oral lichen planus. Direct immunofluorescence (DIF) studies of mucosal or skin biopsies reveal a
unique pattern of IgG immunoglobulin bound to nuclei of keratinocytes of the basal and lower one third cell layers,
the stratified epithelial specific (SES) antinuclear antibody (ANA) pattern. Patient sera also exhibit circulating SES-ANA
reactions on indirect immunofluorescence (IIF) using an esophagus substrate. We report the clinical and
immunopathologic findings of 3 cases of CUS and demonstrate autoantibody recognition of the CUS antigen on
Western blot. An important reason to distinguish CUS from other oral ulcerative conditions is that it may be refractory
to standard treatments with topical corticosteroids, and favorable clinical responses may be achieved with
hydroxychloroquine pharmacotherapy. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;96:718-26)

Chronic ulcerative stomatitis (CUS) is a rare mucocu-
taneous disease that primarily involves mucosal sur-
faces and, occasionally, the skin. CUS is characterized
by the presence of oral erosive or ulcerative lesions that
display unique direct and indirect immunofluorescence
patterns.1 The tongue is the most common location for
CUS, followed by the buccal mucosa and the gingival
tissues. On the gingiva, the lesions may resemble des-
quamative gingivitis.2 Less frequently, CUS-associated
lesions may present on the labial mucosa and or hard
palate.3-5
Microscopically, CUS lesions usually are described
as suggestive of oral lichen planus (LP) and consist of
stratified squamous epithelium, exhibiting focal areas
a
Assistant Professor, Department of Oral Diagnostic Sciences, School
of Dental Medicine, University at Buffalo, SUNY, Buffalo.
b
Director, Advanced Oral and Maxillofacial Pathology Program, and
Professor, Department of Oral Diagnostic Sciences, School of Dental
Medicine, University at Buffalo, SUNY, Buffalo.
c
Distinguished Teaching Professor, Department of Oral Diagnostic
Sciences, School of Dental Medicine, University at Buffalo, SUNY,
Buffalo.
d
Private practice, Metairie.
e
Private practice, Dayton, Associate Professor, Section of Periodon-
tics, University of Kentucky College of Dentistry, Lexington.
f
Vice President, Research and Development, IMMCO Diagnostics,
Inc, Buffalo.
g
Director, IMMCO Diagnostics, Inc, Buffalo, and Departments of
Microbiology and Dermatology, University at Buffalo, SUNY, Buf-
falo.
Received for publication May 5, 2003; returned for revision Jun 9,
2003; accepted for publication Jul 14, 2003.
© 2003, Mosby, Inc. All rights reserved.
1079-2104/2003/$30.00 ⫹ 0
doi:10.1016/S1079-2104(03)00459-1
of basal cell degeneration with a mononuclear inflam-
matory cell infiltrate in the lamina propria that displays
a “band-like” pattern.3 In addition, subepithelial sepa-
ration and vertical clefting with stromal infiltrates of
lymphocytes, histiocytes, and plasma cells also have
been described.4,6
Direct immunofluorescence (DIF) of lesional and
perilesional oral mucosal and skin specimens reveals
a speckled, finely granular pattern of immunoglobu-
lin G (IgG) deposition in the nuclei of keratinocytes.
This stratified epithelial specific (SES) - antinuclear
antibody (ANA) signal is confined to the basal cells
and lower third of the Malphigian layers.3-5 How-
ever, DIF is an in situ test, if the epithelium is
atrophic or the section is cut tangentially, it may not
be possible to evaluate the location of the SES-
ANAs. Thus, a serum sample provides an additional
valuable diagnostic layer for CUS. Serum studies
employing indirect immunofluorescence (IIF), with
monkey and guinea pig esophagus as substrates,
show an SES-ANA reaction similar to that of DIF
and are used to confirm the diagnosis of CUS.3-5 The
antigenic target in CUS is the chronic ulcerative
stomatitis protein (CUSP), which was described in
1999.7 To demonstrate that immunoblotting is an
effective technique to detect patient autoantibodies
to CUSP, Western blots were performed using an in
vitro translated CUSP and sera from our 3 cases.
Because CUS may be refractory to treatment with
topical steroids, its distinction from other oral chronic
ulcerative conditions is warranted. In some cases, a
favorable clinical response is achieved with hydroxy-
chloroquine treatment. However, in other cases, a com-

718
ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
Volume 96, Number 6
Fig 1. Ulcerative lesions on the right (A) and left (B) buccal mucosae adjacent to molar areas (Case 1).
bination of small doses of steroids and hydroxychloro-
quine may be needed to induce remission.4-6,8,9 Only 31
cases of CUS have been reported in the literature.3-5 In
this article, we report 3 additional cases of CUS with
emphasis on the immunologic features.
CASE DESCRIPTIONS
Case #1
A 54-year-old Caucasian woman was referred to a
periodontist with a chief complaint of “gum soreness.”
Her past medical history was significant for 2 previous
episodes of bullous skin lesions at ages 38 and 51 that
were diagnosed clinically as LP by her primary physi-
cian and a dermatologist. The skin lesions were treated
with systemic and topical corticosteroids, although she
did not recall their names. She correlated the onset of
her oral symptoms with an increase in psychological
stress that occurred in the previous 2 months. The only
medication she was taking at that time was a conjugated
estrogen, for hormone replacement.
On oral examination, a prominent finding was the
bilateral presence of deeply erosive lesions on the buc-
cal mucosa adjacent to the molar areas (Fig 1). A
clinical diagnosis of erosive oral LP was made, and
lesional tissue biopsies were submitted for hematoxylin
and eosin (HE) and DIF. Histopathologic examination
showed a specimen that was devoid of epithelium and
covered by a fibrinopurulent exudate with a mixed
inflammatory infiltrate in the underlying connective
Solomon et al 719
tissue. The diagnosis was nonspecific ulceration of the
buccal mucosa.
DIF revealed an SES-ANA reaction in the lower
levels of the stratified squamous epithelium (Fig 2, A)
characteristic of CUS. Serum studies were requested
for IIF, and positive findings confirmed the diagnosis of
CUS (Table I).
The initial treatment consisted of scaling and pro-
phylaxis of the teeth and prescriptions for chlorhexidine
and 0.05% fluocinonide ointment. When the patient
returned for a 3-month follow-up, she had not filled the
prescriptions but reported that she currently was com-
fortable despite refractory areas of mucosal erosion. At
this visit, the patient reported feeling less stress, which
seemed to correlate with the symptomatic improvement
of her condition.
Case #2
A 71-year-old Caucasian woman with a several-year
history of the chief complaint of “sore mouth and
tongue and red gums” was referred to a periodontist.
The patient complained of tongue and gingival hyper-
sensitivity to spicy foods as well as xerostomia. Past
medical history was significant for hypertension and
“heartburn.” Her systemic medications included ateno-
lol, omeprazole, and hydrochlorothiazide with triam-
terene. Clinically the patient presented with multifocal
inflammation and prominent areas of desquamation of
the gingiva (Fig 3), buccal mucosae, and palate. In
addition, focal areas of the attached gingiva displayed
720 Solomon et al ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
December 2003

Fig 2. Direct immunofluorescence staining of nuclei of basal and epithelial cells in the lower third of the epithelium (A, Case 1;
B, Case 2) (fluorescent stain; original magnification ⫻200 and ⫻400 respectively).

Table I. Indirect immunofluorescence serum studies

Subtrate used
Case # Ab detected ME GPE MK HEp2
1 IgG ⱖ1:40 ⱖ1:320 ⬍1:10 ⬍1:10
positive positive negative negative
SES-ANA pattern SES-ANA pattern
2 IgG ⱖ1:1,280 ⱖ1:1,280 1:20 1:160
positive positive positive positive
SES-ANA pattern SES-ANA pattern
3 IgG 1:20 ⱖ1:320 ⬍1:10 1:160
positive positive negative positive
SES-ANA pattern SES-ANA pattern

Ab, antibody; IgG, immunoglobulin G; ME, monkey esophagus; SES-ANA, stratified epithelial specific-antinuclear antibody; GPE, guinea pig esophagus; MK,
mouse kidney; HEp2, human epithelial cell line.

white lichenoid striae. No history of skin lesions was
obtained nor evidence of cutaneous involvement was
seen at the time of examination.
A clinical diagnosis of oral LP was made and gingi-
val biopsies were taken for H&E and immunofluores-
cent examination. Histopathologic examination showed
features typical of oral LP. The parakeratinized, strati-
fied squamous epithelium was atrophic and a “band-
like” lymphocytic inflammatory infiltrate, containing
occasional plasma cells, was present in the papillary
lamina propria. In addition, basal cell hydropic degen-
eration and cytoid bodies were observed (Fig 4). Focal
areas of degeneration created splitting of the epithelial
connective tissue interface. The microscopic diagnosis
rendered was LP of maxillary gingiva.
DIF showed SES-ANA type deposits of IgG (Fig 2,
B) and IgA in the nuclei of the basal and parabasal
layers of the stratified squamous epithelium. Serum
studies were requested for IIF, and positive findings
confirmed the diagnosis of CUS (Table I).
The initial treatment consisted of topical applications
of 0.05% clobetasol propionate to areas of soreness
every 12 hours. This was discontinued after 10 days
because it did not provide relief and the patient experi-
enced side effects (burning tongue and throat and can-
didiasis). The patient’s primary care physician instituted
therapy with hydroxychloroquine (200 mg/day). After 7
months of treatment the patient reported a decrease in
gingival soreness, although she still experienced sensi-
tivity to spicy foods and the gingiva continued to be
erythematous. The patient discontinued the medication
on her physician’s advice 2 weeks before a periodontal
surgical procedure and the mucosa reverted to its ap-
pearance at the initial presentation. One month after
ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY Solomon et al 721
Volume 96, Number 6

Fig 3. Erosion and ulceration of buccal attached and interproximal gingiva (Case 2).

Fig 4. Histologic findings in biopsy from lesional attached gingiva. Insert shows a “band-like,” subepithelial inflammatory cell
infiltrate and parakeratosis. The square in the insert indicates the enlarged area that shows basal cell hydropic degeneration and
numerous intraepithelial cytoid bodies (Case 2) (hematoxylin-eosin; original magnification ⫻20 and ⫻100, respectively).

resuming hydroxychloroquine therapy, the patient re-
ported an increase in oral comfort and the tissues ap-
peared less inflamed and erythematous.
Case #3
A 39-year-old Caucasian female was referred to a
periodontist for evaluation of gingival lesions. She pre-
sented with a chief complaint of 2 months of progres-
sively worsening “sore gums.” Her medical history was
significant for Type I diabetes, hypertension, ehrlichio-
ses, and glaucoma. Her medications consisted of insu-
lin, lisinopril, atorvastatin calcium, and timolol. Clini-
cally, the patient presented with erythematous and flat
to slightly raised white lesions primarily localized to
722 Solomon et al ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
December 2003

Fig 5. Patchy white and erythematous changes of the buccal attached and interproximal gingival (case 3).

the maxillary and mandibular buccal attached gingiva MATERIALS AND METHODS
(Fig 5). The left buccal mucosa had a lichenoid pattern Indirect immunofluorescence
of white striae, erythema, and erosion adjacent to the HEp2 cells and 4-␮m frozen sections of monkey
molar and premolar area. No history of skin lesions was esophagus (ME), guinea pig esophagus (GPE), and
retrieved, nor evidence of cutaneous involvement was mouse kidney (MK) were obtained from IMMCO Di-
seen at the time of examination. agnostics, Buffalo, NY. IIF studies were performed as
A clinical diagnosis of oral LP was made and le- described by Beutner et al.10
sional and perilesional biopsies were taken for immu-
nological studies and H&E examination. Histopatho-
CUS protein preparation
logic examination showed a specimen surfaced by
The cDNA for the human cus, in pThioHis A (In-
stratified squamous epithelium with hyperorthokerato-
vitrogen, Carlsbad, Calif) was kindly provided by
sis and irregularly spaced rete ridges extending a short
Wendy C. Weinberg, PhD, Center for Biologics Eval-
distance into the subjacent stroma. In discrete areas
uation and Research, Food and Drug Administration.
there was a focal loss of the basal cell layer and
Plasmid DNA was prepared by transforming Se-
formation of “sawtooth” rete ridges, although these
lect96™ Competent Cells (cat. #L3300, Promega,
areas were not associated with a prominent inflamma-
Madison, Wisc) as per manufacturers instructions, re-
tory cell infiltrate. A patchy, predominantly lympho-
covered, then purified with the Wizard® Plus Midipreps
cytic, inflammatory cell infiltrate with scattered plasma
DNA purification System (cat. #A7640, Promega).
cells was seen in the deeper lamina propria. At one
Primers were designed for PCR amplfication using the
edge of the specimen the inflammatory cell infiltrate
published sequence.7 The primer sequences were as
was more dense and included occasional eosinophils
follows: ForwardGGATCCTAATACGACTCACTA-
and neutrophils. The diagnosis provided was chronic
TAGGGAACAGCTAACATGTTGTACCTGGAA
inflammation of the gingiva.
ReverseTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-
DIF revealed the SES-ANA pattern of IgG deposits
TCACTCCCCCTCCTCTTTGATGC.
that were most prominent in the nuclei of basal and
Gel purified primers were purchased from Integrated
parabasal epithelial cells. Serum studies were requested
DNA Technologies (Coralville, IA). Amplification us-
for IIF, and positive findings confirmed the diagnosis of
ing the AccuPrime polymerase chain reaction (PCR)
CUS (Table I). The patient has not returned to the office
system (cat. # 12342-010, Invitrogen), used as per
for follow-up or treatment.
manufacturers instructions, gave a 2-kb PCR product as
expected (data not shown). The TNT® T7 Quick for
SEROLOGIC STUDIES PCR System (cat. #L5540, Promega) was used as per
Serum samples were obtained from all 3 patients for manufacturer’s instructions, with the addition of 2 ␮L
IIF and immunoblotting. of the Transcend™ tRNA Translation Detection Sys-
ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
Volume 96, Number 6
Fig 6. Indirect immunofluorescence shows nuclear staining of basal and epithelial cells in the lower third of the epithelium on
guinea pig esophagus (A) and monkey esophagus (B) substrates incubated with CUS patient sera (Case 1) (fluorescent stain;
original magnification ⫻200).
tem (cat. #L5070, Promega), to express CUS protein
directly from the PCR product as a biotinylated in vitro
translated product (IVTP). A negative control was pre-
pared by performing the in vitro translation, without
addition of the PCR product.
Western blotting
For Western blotting, CUS IVTP protein was pre-
pared as described above and 2 ␮L of the biotinylated
CUS protein or the negative control reaction was loaded
onto each lane of a NuPAGE™ NOVEX 4-12% Bis-
Tris precast gel (cat. #NP0322, Invitrogen) for sodium
dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE),11 followed by immunoblotting.12 Direct
detection of the biotinylated CUS protein was accom-
plished with Western Blue® Stabilized Substrate for
Alkaline Phosphatase (cat. #S384C, Promega). For im-
munodetection of CUS autoantibodies, serum from all 3
cases was used at a 1:50 dilution. Alkaline phosphatase-
conjugated goat antihuman IgG (cat. #A3312, Sigma,
St. Louis, Mo) was used as the secondary antibody at a
1:100 dilution. Mouse antihuman p63 monoclonal anti-
body 4A4, specific for CUSP (the ⌬N isoform of p63)
was purchased (cat. #OP132, Oncogene Research Prod-
ucts, San Diego, Calif) and used at a dilution of 1:500.
Alkaline phosphatase-conjugated goat antimouse IgG
(cat. #115-055-062, Jackson ImmunoResearch Labora-
tories, Inc, West Grove, Pa) was used as the secondary
antibody at a 1:100 dilution. BCIP/NBT substrate was
used to develop the blots.
RESULTS
Indirect immunofluorescence
All 3 cases showed positive SES-ANA staining in the
basal epithelial layer of GPE, (Fig 6, A) and ME (Fig 6,
B). The antibody titers were generally higher on the
Solomon et al 723
GPE (Table I), which is in agreement with previous
cases reported in the literature.5,8 MK and HEp2 cells
usually yield negative or low antibody titers, findings
that were reflected in our series. Table 1 summarizes
these findings.
Western blotting
SDS-PAGE of the biotinylated in vitro translated
70-kD CUS protein and immunoblotting was per-
formed (Fig 7). Incubation with streptavidin alkaline
phosphatase conjugate and substrate (lane 1) demon-
strated that a protein with the predicted size of the CUS
protein was produced. The mouse antihuman p63
monoclonal antibody A4A confirmed that this protein
was CUS (lane 8). CUS sera from all 3 cases (lanes 3,
5, and 7) showed recognition of the CUS protein. None
of the sera from the 3 cases (lanes 2, 4, and 6) recog-
nized proteins in the negative control from the reticu-
locyte lysate.
DISCUSSION
CUS is typically a disease of middle-aged women
(average age at diagnosis of 58.9 years) character-
ized by the presence of atrophic or erosive lesions of
the oral mucosa that heal without scarring and dis-
play alternated periods of exacerbation and remis-
sion.5 CUS may be indistinguishable clinically from
oral LP, lichenoid stomatitis, mucous membrane
pemphigoid, dermatitis herpetiformis, linear IgA dis-
ease, pemphigus vulgaris, erythema multiforme, pyo-
stomatitis vegetans, and epidermolysis bullosa ac-
quisita.2 About 14% of CUS cases exhibited
concurrent, biopsy-proven, cutaneous LP.5,6,13 None
of our cases were accompanied by synchronous skin
lesions and all were diagnosed clinically as oral LP.
The light microscopic features (H&E) of CUS are
724 Solomon et al
Fig 7. Western blot of the 70-kd IVTP - CUS protein. Lane 1 shows the 70-kD CUS protein after incubation with streptavidin-
alkaline phosphatase. Lanes 3, 5, and 7 demonstrate recognition of the CUS protein by CUS sera from all cases, whereas none
of the patient sera recognized proteins in the negative control lanes 2, 4, and 6. Lane 8 shows recognition of the CUS protein by
the mouse antihuman p63 monoclonal antibody A4A.
reported to be reminiscent and in some cases, indistin-
guishable from oral LP.14 In our series, 1 case met the
microscopic criteria of oral LP while the other 2 cases
displayed nonspecific findings. The histopathological
variability of CUS and oral LP warrants the use of DIF.
Both circulating and tissue-bound IgG antibodies to
a keratinocyte nuclear antigen are required for the di-
agnosis of CUS.5 Only one case of a false negative
result on DIF of the 31 cases in the literature has been
reported. Because of the persistent nature of the disease
and recalcitrance to treatment in this case, a serum
sample was later examined and the diagnosis of CUS
was made.4
Preliminary diagnosis of CUS is nearly always made
when there are characteristic positive findings on DIF.
However, in vivo ANAs may be also be detected on
DIF of biopsies from patients with idiopathic connec-
tive tissue diseases, eg lupus erythematosus, systemic
sclerosis, and mixed connective tissue disease.15 The
DIF pattern of ANAs in idiopathic connective tissue
diseases is positive throughout the thickness of the
epithelium, not limited to the basal and parabasal layers
as in CUS. Because of the possibility of tangential
sectioning or atrophic epithelium, it may not be possi-
ble to evaluate the location of the SES-ANAs with
certainty. Thus, a false positive diagnosis for CUS
cannot be ruled out without a serum sample for IIF.
The IIF panel for SES-ANAs consists of HEp2 cells,
mouse kidney, and monkey and guinea pig esophagus
sections. SES-ANA, limited to basal and parabasal
epithelial cells on IIF using monkey and guinea pig
esophagus, is considered diagnostic for CUS; IIF is
negative or very low titer on HEp2 cells and mouse
kidney sections.8,9 A positive SES-ANA on DIF, with
a negative IIF, is indicative of a false positive DIF for
ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
December 2003
CUS. There are no reports in the literature regarding the
incidence of false positive cases of CUS on DIF.
In idiopathic connective tissue diseases IIF may be
positive for ANAs on HEp2 cells and mouse kidney
sections. In such cases, a positive SES-ANA on DIF
with positive IIF on HEp2 cells and mouse kidney
sections is inconsistent with a diagnosis of CUS (if the
IIF is negative on monkey and guinea pig esophagus).
In this situation, clinical correlations should be sought
and the patient’s physician notified of the results.
Conflicting evidence has been reported in the litera-
ture regarding the correlation of antibody titers with
disease activity in CUS.6,9 However, more recently,
Chorzelski et al5 concluded that, although the titers
show fluctuations and are frequently lower on improve-
ment, their levels do not correlate with clinical activity.
Several studies have reported clinical remission of
CUS, and even reduction in SES-ANA titers, with hy-
droxychloroquine (Plaquenil), a potent antimalarial drug.
It has been suggested that the mechanism of action of
hydroxychloroquine is an interference with the “antigen
processing” mechanisms of macrophages and other anti-
gen-presenting cells, resulting in down regulation of the
immune response against autoantigenic peptides.16 In ini-
tial data from human clinical trials, it has been shown to
inhibit the development of graft-versus-host disease in
bone marrow transplant patients.17
Caution should be exercised with this off-label use of
hydroxychloroquine because significant side effects
such as retinopathy, toxic psychosis, neuromyopathy,
agranulocytosis, and aplastic anemia may arise, neces-
sitating discontinuation of therapy. The neuromuscular
and hematologic complications usually are reversible
whereas the retinopathy is not. Therefore, close fol-
low-up of patients who take hydroxychloroquine is
warranted.18 Doses as low as 200 mg/day may induce
ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
Volume 96, Number 6
improvement (42% of patients) and in some cases
(23%) complete clearing of oral lesions.5,6,8,9
A variety of topical steroids such as fluocinonide,
betamethasone, clobetasol, dexamethasone elixir, and
dapsone also have been used to treat CUS. All of them
seem to improve symptoms. However, severe gastroin-
testinal side effects are commonly produced by dap-
sone.3,4,8,9,18
The antigenic target of CUS autoantibodies, the CUS
protein, has been identified as a 70-kd nontransactivat-
ing isoform of p63 (CUSP, ⌬Np63␣, p73L, p68AIS) and
its gene has been cloned.7,19,20 Several groups have
used immunoblotting to demonstrate the recognition of
a 70-kd protein by CUS patient sera, using extracts
from calf esophagus, cultured human keratinocytes, and
epidermis.7,13,17,21,22 COS cells, which normally do not
express CUS protein, were transfected with the CUS
cDNA and nuclear protein expression was confirmed
using CUS patient sera.7 On Western blots a mouse
antihuman p63 monoclonal antibody, and sera from all
3 of our cases, recognized the 70-kd CUS protein that
was translated in an in vitro system using the CUS
cDNA. At this time the diagnostic protocol for CUS
includes DIF and IIF, however these are in situ tech-
niques. Our results indicate that in the future, the avail-
ability of immunoblotting may provide a more specific
test to detect CUSP autoantibodies.
The CUS protein appears to be essential for epithelial
development and regeneration, and the presence of
autoantibodies in CUS raises the issue of whether they
may interfere with normal CUS protein function, po-
tentially leading to poor wound healing and chronic
ulcerations.23
Clinically diagnosed oral erosive and ulcerative le-
sions and biopsied lesions with nonspecific histopathol-
ogy that do not respond to standard therapies should be
biopsied for DIF in an effort to establish a definitive
diagnosis. A diagnosis of CUS on DIF should be fol-
lowed up with IIF for confirmation. This diagnostic
approach eliminates the need for numerous appoint-
ments with clinicians due to failure of treatment to
resolve the condition. In addition, the expense derived
from purchase of ineffective medications is eliminated.
The more widespread use of immunofluorescence stud-
ies for the evaluation of refractory atrophic and erosive
oral lesions may ascertain the real prevalence of CUS
and reduce morbidity from putative oral LP cases that
are actually undiagnosed CUS.
For technical assistance with SDS-PAGE and immuno-
blotting from Amy Kasianowicz and Jason Den Haese,
IMMCO Diagnostics, Inc.
Solomon et al 725
REFERENCES
1. Beutner EH, Jaremko WM, Kumar V, Kipping H, Condry P,
Kauffmann CL, et al. Stratified epithelium specific antinuclear
antibodies (SES-ANA) in chronic ulcerative stomatitis (CUS): is
SES associated CUS a new clinical entity? J Invest Dermatol
1989;92:403.
2. Scully C, Porter SR. The clinical spectrum of desquamative
gingivitis. Semin Cutan Med Surg 1997;16:308-13.
3. Lorenzana ER, Rees TD, Glass M, Detweiler JG. Chronic ulcer-
ative stomatitis: a case report. J Periodontol 2000;71:104-11.
4. Worle B, Wollenberg A, Schaller M, Kunzelmann KH, Plewig
G, Meurer M. Chronic ulcerative stomatitis. Br J Dermatol
1997;137:262-5.
5. Chorzelski TP, Olszewska M, Jarzabek-Chorzelska M, Jablonska
S. Is chronic ulcerative stomatitis an entity? Clinical and
immunological findings in 18 cases. Eur J Dermatol 1998;8:
261-5.
6. Lewis JE, Beutner EH, Rostami R, Chorzelski TP. Chronic
ulcerative stomatitis with stratified epithelium-specific antinu-
clear antibodies. Int J Dermatol 1996;35:272-5.
7. Lee LA, Walsh P, Prater CA, Su LJ, Marchbank A, Egbert TB,
et al. Characterization of an autoantigen associated with chronic
ulcerative stomatitis: the CUSP autoantigen is a member of the
p53 family. J Invest Dermatol 1999;113:146-51.
8. Jaremko WM, Beutner EH, Kumar V, Kipping H, Condry P,
Zeid MY, et al. Chronic ulcerative stomatitis associated with a
specific immunologic marker. J Am Acad Dermatol 1990;22:
215-20.
9. Beutner EH, Chorzelski TP, Parodi A, Schosser R, Guin J, Cardo
PP, et al. Ten cases of chronic ulcerative stomatitis with stratified
epithelium-specific antinuclear antibody. J Am Acad Dermatol
1991;24:781-2.
10. Beutner E, Chorzelski T, Kumar V. Defined immunofluorescence
in immunodermatology. In: Beutner EH, Kumar V, Krasny SA,
Chorzelski TP, Beutner EH, Kumar V, et al, editors. Immuno-
pathology of the skin. 3rd ed. New York: John Wiley and Sons,
Inc.; 1987. p. 3-40.
11. Laemmli UK. Cleavage of structural proteins during the as-
sembly of the head of bacteriophage T4. Nature 1970;227:
680-5.
12. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: pro-
cedure and some applications. Proc Natl Acad Sci U S A 1979;
76:4350-4.
13. Parodi A, Cardo PP. Patients with erosive lichen planus may
have antibodies directed to a nuclear antigen of epithelial
cells: a study on the antigen nature. J Invest Dermatol 1990;
94:689-93.
14. Scully C, Beyli M, Ferreiro MC, Ficarra G, Gill Y, Griffiths M,
et al. Update on oral lichen planus: etiopathogenesis and man-
agement. Crit Rev Oral Biol Med 1998;9:86-122.
15. McKee PH. Idiopathic connective tissue disorders. In: Pathology
of the skin with clinical correlations. 2nd ed. London: Mosby
International; 1996:11.1-11.38.
16. Fox RI. Mechanism of action of hydroxychloroquine as an an-
tirheumatic drug. Semin Arthritis Rheum 1993;23:82-91.
17. Schultz KR, Gilman AL. The lysosomotropic amines, chloro-
quine and hydroxychloroquine: a potentially novel therapy for
graft-versus-host disease. Leuk Lymphoma 1997;24:201-10.
18. Church LF Jr, Schosser RH. Chronic ulcerative stomatitis asso-
ciated with stratified epithelial specific antinuclear antibodies: a
case report of a newly described disease entity. Oral Surg Oral
Med Oral Pathol 1992;73:579-82.
19. Dellavalle RP, Egbert TB, Marchbank A, Su LJ, Lee LA, Walsh
P. CUSP/p63 expression in rat and human tissues. J Dermatol Sci
2001;27:82-7.
20. Hibi K, Trink B, Patturajan M, Westra WH, Caballero OL, Hill
DE, et al. AIS is an oncogene amplified in squamous cell carci-
noma. Proc Natl Acad Sci U S A 2000;97:5462-7.
726 Solomon et al ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY
December 2003

21. Parodi A, Cozzani E, Cacciapuoti M, Rebora A. Chronic ulcer- Reprint requests:

ative stomatitis: antibodies reacting with the 70-kDa molecule Lynn Solomon, DDS
react with epithelial nuclei. Br J Dermatol 2000;143:671-2.
Department of Oral Diagnostic Sciences
22. Parodi A, Cozzani E, Chorzelski TP, Beutner EH, Rebora A. A
molecule of about 70 kd is the immunologic marker of chronic School of Dental Medicine
ulcerative stomatitis. J Am Acad Dermatol 1998;38:1005-6. State University of New York at Buffalo
23. Yamaguchi K, Patturajan M, Trink B, Usadel H, Koch W, Jen J, 3435 Main Street
et al. Circulating antibodies to p40(AIS) in the sera of respiratory Buffalo, New York 14214
tract cancer patients. Int J Cancer 2000;89:524-8. lsolomon@buffalo.edu