Article

Herpes Simplex Virus 1 VP22 Inhibits AIM2-

Dependent Inflammasome Activation to Enable
Efficient Viral Replication
Graphical Abstract Authors
Yuhei Maruzuru, Takeshi Ichinohe,
Ryota Sato, ..., Jun Arii, Akihisa Kato,
Yasushi Kawaguchi

Correspondence
ykawagu@ims.u-tokyo.ac.jp

In Brief
Upon activation, the AIM2 inflammasome
induces the release of pro-inflammatory
cytokines IL-1b and IL-18, which are
critical mediators in anti-microbial
defense. Maruzuru et al. show that the
HSV-1 tegument protein VP22 inhibits the
AIM2 inflammasome by preventing its
oligomerization and that this evasion
strategy enables efficient viral replication
in vivo.

Highlights
d HSV-1 activates the AIM2 inflammasome and IL-1b secretion
in the absence of viral VP22

d HSV-1 VP22 inhibits AIM2 inflammasome activation and IL-1b

secretion

d VP22 interacts with AIM2 and blocks its oligomerization

d Inhibition of AIM2 inflammasome by VP22 promotes HSV-1

replication in vivo

Maruzuru et al., 2018, Cell Host & Microbe 23, 254–265

February 14, 2018 ª 2017 Elsevier Inc.
https://doi.org/10.1016/j.chom.2017.12.014
 Cell Host & Microbe

Article

Herpes Simplex Virus 1 VP22 Inhibits

AIM2-Dependent Inflammasome Activation
to Enable Efficient Viral Replication
Yuhei Maruzuru,1,2,3 Takeshi Ichinohe,2 Ryota Sato,4 Kensuke Miyake,4 Tokuju Okano,5 Toshihiko Suzuki,5
Takumi Koshiba,6 Naoto Koyanagi,1,2 Shumpei Tsuda,1,2 Mizuki Watanabe,1,2 Jun Arii,1,2 Akihisa Kato,1,2
and Yasushi Kawaguchi1,2,7,*
1Division of Molecular Virology, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo,

Minato-ku, Tokyo 108-8639, Japan

2Department of Infectious Disease Control, International Research Center for Infectious Diseases, The Institute of Medical Science, The University

of Tokyo, Minato-ku, Tokyo 108-8639, Japan

3Japan Society for the Promotion of Science, Chiyoda-ku, Tokyo 102-0083, Japan
4Division of Innate Immunity, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo,

Minato-ku, Tokyo 108-8639, Japan

5Department of Bacterial Pathogenesis, Infection and Host Response, Graduate School of Medical and Dental Sciences, Tokyo Medical and

Dental University, Bunkyo-ku, Tokyo 113-8549, Japan

6Department of Biology, Faculty of Science, Kyushu University, Nishi-ku, Fukuoka 819-0395, Japan
7Lead Contact

*Correspondence: ykawagu@ims.u-tokyo.ac.jp
https://doi.org/10.1016/j.chom.2017.12.014

SUMMARY cells infected with pathogens is tightly regulated by large

The AIM2 inflammasome is activated by DNA,
leading to caspase-1 activation and release of pro-
inflammatory cytokines interleukin 1b (IL-1b) and
IL-18, which are critical mediators in host innate im-
mune responses against various pathogens. Some
viruses employ strategies to counteract inflamma-
some-mediated induction of pro-inflammatory cyto-
kines, but their in vivo relevance is less well under-
stood. Here we show that the herpes simplex virus
1 (HSV-1) tegument protein VP22 inhibits AIM2-
dependent inflammasome activation. VP22 interacts
with AIM2 and prevents its oligomerization, an initial
step in AIM2 inflammasome activation. A mutant
virus lacking VP22 (HSV-1DVP22) activates AIM2
and induces IL-1b and IL-18 secretion, but these
responses are lost in the absence of AIM2. Addition-
ally, HSV-1DVP22 infection results in diminished viral
yields in vivo, but HSV-1DVP22 replication is largely
restored in AIM2-deficient mice. Collectively, these
findings reveal a mechanism of HSV-1 evasion of
the host immune response that enables efficient viral
replication in vivo.
INTRODUCTION
Pro-inflammatory cytokines interleukin 1b (IL-1b) and IL-18 are
primarily produced by macrophages and dendritic cells and
are important mediators in innate immune responses against
various invading pathogens (Garlanda et al., 2013; Gram et al.,
2012). Secretion of these pro-inflammatory cytokines from
cytosolic multiprotein complexes called inflammasomes. An
inflammasome typically consists of a sensor protein, an adaptor
apoptosis-associated speck-like protein containing a caspase-
recruitment domain (ASC), and the caspase-1 pro-inflammatory
caspase (Vanaja et al., 2015). Assembly of inflammasomes
(i.e., inflammasome activation) is triggered by recognition of
a variety of stimuli by sensor proteins. The activated sensor
protein oligomerizes and recruits pro-caspase-1 via ASC, lead-
ing to autocleavage of caspase-1 to yield an active capase-1
p10/p20 tetramer. The activated caspase-1 then cleaves inac-
tive pro-forms of IL-1b and IL-18 for secretion of these cytokines
(Vanaja et al., 2015). In general, there are three groups of sensor
proteins that induce the formation of inflammasomes: the Nod-
like receptor (NLR) and AIM2-like receptor (ALR) families and
pyrin (Vanaja et al., 2015). NLRs (including NLRP1, NLRP3,
NLRP6, NLRP12, and NLRC4) recognize viral and bacterial
components, toxins, crystalline microparticles, cellular stress,
and changes in ion concentrations caused by virus-encoded
ion channels. In contrast, ALRs (including AIM2 and IFI16) sense
viral and bacterial DNAs and self-DNAs from apoptotic cells
(de Zoete et al., 2014; Vanaja et al., 2015).
Although IL-1b and IL-18 are important for the control of infec-
tions of various pathogens as described above, pathogens
are still able to multiply and produce pathogenic effects in vivo
(Garlanda et al., 2013; Gram et al., 2012). These observations
imply that pathogens have evolved strategies to evade the pro-
tective innate immune responses mediated by pro-inflammatory
cytokines. In support of this hypothesis, various pathogen mech-
anisms to counteract inflammasome assembly, activity, and/or
effector functions in cell cultures have been reported (Gram
et al., 2012). However, it has not been determined whether the
mechanisms to reduce inflammasome assembly observed in
cell cultures also contribute to multiplication and pathogenicity
of pathogens in vivo.

254 Cell Host & Microbe 23, 254–265, February 14, 2018 ª 2017 Elsevier Inc.
 Herpes simplex virus 1 (HSV-1) is an etiological agent in
various human mucocutaneous diseases, such as herpes labia-
lis, genital herpes, herpetic whitlow, and keratitis (Roizman et al.,
2013). HSV-1 also causes herpes simplex encephalitis, which
can be lethal or result in severe neurological problems in a signif-
icant fraction of cases, even with anti-viral therapy (Roizman
et al., 2013). The HSV-1 genome is a 152 kbp linear double-
stranded DNA that encodes at least 84 viral proteins (Roizman
et al., 2013). The HSV-1 virion, like those of other herpesviruses,
has a unique tegument structure, which is a proteinaceous layer
consisting of at least 26 different viral proteins and located
between the nucleocapsid containing the viral genome and the
virion envelope (Roizman et al., 2013). Upon HSV-1 entry into a
cell, some tegument proteins are released into the cytoplasm
and function to establish an environment for effective initiation
of very early viral infection, including evasion of innate immune
responses (Cotter et al., 2011; Roizman et al., 2013).
During HSV-1 infection in macrophages, the cellular ubiquitin
protease machinery has been reported to degrade the HSV-1
nucleocapsid in the cytoplasm, thereby releasing viral DNA
into the cytoplasm, which is a target for a cytoplasmic DNA
sensor that induces innate immune responses (Horan et al.,
2013). However, the HSV-1 infection of macrophages induces
inflammasome activation, but it is cytoplasmic DNA sensor
AIM2-independent (Rathinam et al., 2010). It is interesting that
infection of these cells with murine cytomegalovirus, another
herpesvirus, efficiently induced AIM2-dependent inflammasome
activation (Rathinam et al., 2010). Based on these observations,
it has long been hypothesized that HSV-1 has evolved a
mechanism(s) for evasion of AIM2-dependent inflammasome
activation. In this study, we investigated this hypothesis.
RESULTS
Identification of an HSV-1 Protein that Specifically
Inhibited Activation of AIM2-Dependent Inflammasomes
To identify HSV-1 proteins that may inhibit AIM2-dependent
inflammasome activation, we tested the effect of each of the
72 expression plasmids that encoded an HSV-1 protein on
AIM2 and NLRP3 inflammasome activation in transfected
293FT cells by IL-1b secretion assays (Figures S1A and S1B).
As shown in Figure 1A, transfection with the expression
plasmid containing the HSV-1 UL49 gene encoding VP22, a
major HSV-1 tegument protein, preferentially inhibited AIM2-
dependent IL-1b secretion. Subsequent experiments confirmed
that ectopic expression of Flag-tagged VP22 (Flag-VP22)
significantly inhibited IL-1b secretion, pro-caspase-1 cleavage,
and IL-1b maturation in the AIM2 inflammasome reconstitution
system, but not in the NLRP3 inflammasome reconstitution
system (Figures 1B, 1C, and S1C). These results indicated
that HSV-1 VP22 was sufficient for inhibition of AIM2-depen-
dent inflammasome activation.
HSV-1 belongs to the Alphaherpesvirinae subfamily of herpes-
viruses. As shown in Figures S2A and S2B, Flag-tagged VP22
homologs of other members of Alphaherpesvirinae, including
HSV-2 and pseudorabies virus (PRV), significantly inhibited
IL-1b secretion, pro-caspase-1 cleavage, and IL-1b maturation
in the AIM2 inflammasome reconstitution system. These
results indicated that the inhibitory function of HSV-1 VP22 on
AIM2-dependent inflammasome activation was conserved in
the HSV-2 and PRV VP22 homologs.
ASC forms speck-like structures, designated pyroptosomes,
upon activation of inflammasomes (Fernandes-Alnemri et al.,
2007). It has been reported that ASC forms specks when
ASC is ectopically expressed in combination with AIM2 or
NLRP3, and ASC speck formation correlates with IL-1b pro-
cessing (Bu €mmer et al., 2009; Moriyama et al., 2016).
€rckstu
We investigated whether VP22 inhibited ASC speck formation.
As shown in Figures 1D and 1E, speck formation induced by
co-transfection of 293FT cells with the ASC and AIM2 expres-
sion plasmids was significantly impaired by further transfection
with the VP22 expression plasmid. However, speck formation
induced by co-transfection with the ASC and NLRP3 expres-
sion plasmids was not affected by further transfection with
the VP22 expression plasmid (Figures S2C and S2D). These
results indicated that VP22 acted at or prior to ASC and
AIM2 speck formation.
VP22 Blocked DNA-Mediated Inflammasome Activation
As described above, AIM2-dependent inflammasome activa-
tion was triggered by double-stranded DNAs; therefore, we
investigated whether VP22 inhibited DNA-mediated inflamma-
some activation. For this study, the J774A.1 mouse macro-
phage cell line stably expressing VP22 (J774/VP22) and
puromycin-resistant control cells (J774/Ct) (Figure 2A) were
transfected with poly(dA-dT), a synthetic analog of B-DNA
and an agonist of AIM2, or treated with ATP, an activator of
NLRP3, in the presence or absence of lipopolysaccharide
(LPS). Secretion of processed IL-1b and caspase-1 maturation
was analyzed in these cells. As shown in Figures 2B and 2C,
J774/VP22 cells secreted significantly less IL-1b and produced
significantly less mature caspase-1 in response to LPS treat-
ment plus poly(dA-dT) transfection than J774/Ct cells did,
without affecting the levels of expression of pro-caspase-1
and pro-IL-1b in these cells. In contrast, both J774/VP22 and
J774/Ct cells secreted similar levels of the inflammasome-
independent cytokines IL-6 and TNF-a in the presence of
LPS plus poly(dA-dT). J774/VP22 and J774/Ct cells also
secreted and produced similar levels of IL-1b and mature
caspase-1 in response to LPS plus ATP (Figures S3A and
S3B). In addition, we examined the effect of VP22 on IL-1b
secretion in human monocytic THP-1 cells stably expressing
VP22 (THP-1/VP22) and puromycin-resistant control cells
(THP-1/Ct) (Figure S3C). Phorbol 12-myristate 13-acetate
(PMA)-differentiated THP-1/VP22 cells secreted significantly
less IL-1b in response to LPS treatment plus poly(dA-dT) trans-
fection (Figure S3D). These results indicated that VP22 was
sufficient to inhibit DNA-mediated inflammasome activation.
Effect of VP22 on Innate Immune Pathways Mediated by
Other DNA Sensors
To examine whether VP22 inhibits innate immune pathways
mediated by cellular DNA sensors other than AIM2, we investi-
gated the effect of VP22 on the cGAS/STING pathway. As
shown in Figures S4A and S4B, the ectopic expression of
Flag-VP22 had little (1.4-fold) effect on the cGAS/STING-
mediated activation of the IFN-b promoter. In contrast, the
ectopic expression of Flag-tagged UL24, which was reported
Cell Host & Microbe 23, 254–265, February 14, 2018 255

to inhibit the cGAS/STING pathway (Xu et al., 2017), efficiently
(5.6-fold) inhibited the cGAS/STING-mediated activation of the
IFN-b promoter. We also investigated the effect of transfection
of J774/VP22 or J774/Ct cells with interferon-stimulatory DNA
(ISD; double-stranded, 45-base-pair oligonucleotides) or treat-
ment of these cells with cGAMP, a second messenger synthe-
sized by cGAS that activates STING, on the secretion of IFN-b.
As shown in Figure S4C, J774/VP22 and J774/Ct cells secreted
similar levels of IFN-b mediated by ISD transfection or
cGAMP treatment. These results indicated that VP22 did not
non-specifically inhibit innate immune pathways mediated by
cellular DNA sensors.
256 Cell Host & Microbe 23, 254–265, February 14, 2018
Figure 1. Identification of HSV-1 VP22 as an
Inhibitor of AIM2-Dependent Inflammasome
Activation
(A) The inhibitory effect of each HSV-1 protein on
AIM2-dependent inflammasome-mediated IL-1b
secretion was calculated by dividing the mean
value (Figure S1A) for the effect of each HSV-1
protein on IL-1b secretion in the presence of
NLRP3 by the mean value (Figure S1A) in the
presence of AIM2.
(B and C) The inhibitory effect of VP22 on IL-1b
secretion was analyzed in the AIM2 or NLRP3
inflammasome reconstitution system (B). Expres-
sion levels of the indicated proteins were analyzed
by immunoblotting (C).
(D) 293FT cells transfected with expression plas-
mids encoding ASC alone or both ASC and AIM2,
along with expression plasmids encoding VP22 or
an empty plasmid for 24 hr, were examined by
confocal microscopy. Bars, 5 mm.
(E) Percentage of cells with ASC speck structures
in the experiments in (D).
Each value is the mean ± standard error of the
results of three independent experiments (B and
E). Statistical analysis was performed by the two-
tailed Student’s t test. n.s., not statistically signifi-
cant; **p < 0.01. The data are representative of at
least three independent experiments (C and D).
See also Figures S1 and S2.
VP22 Was Required for Inhibition of
AIM2-Dependent Inflammasome
Activation in HSV-1-Infected Cells
To examine the effect of VP22 on inflam-
masome activation in HSV-1-infected
cells, bone marrow macrophages derived
from wild-type mice (WT BMMs) were
mock infected or infected with WT
HSV-1(F), a recombinant HSV-1 carrying
a VP22 null mutation (HSV-1DVP22), or
a recombinant HSV-1 in which the
mutation in HSV-1DVP22 was repaired
(HSV-1DVP22-repair) (Figure S5A), and
pro-caspase-1 processing and IL-1b
secretion in these cells were analyzed.
As shown in Figure 3B, although the level
of pro-caspase-1 expression in mock-
infected and WT HSV-1-, HSV-1DVP22-,
and HSV-1DVP22-repair-infected cells
was similar, pro-caspase-1 processing was barely detectable
in mock-infected, WT HSV-1-infected, and HSV-1DVP22-
repair-infected cells. However, definite pro-caspase-1 process-
ing was observed in cells infected with HSV-1DVP22. In
agreement with these results, WT BMMs infected with
HSV-1DVP22 secreted a significant level of IL-1b, but WT
BMMs infected with WT HSV-1 or HSV-1DVP22-repair did not
secrete detectable levels of IL-1b (Figure 3C). Similarly, the levels
of pro-caspase-1 processing and IL-1b secretion in J774.A1
cells infected with HSV-1DVP22 were significantly higher than
in cells infected with WT HSV-1 or HSV-1DVP22-repair (Figures
S6C and S6D). These results indicated that HSV-1 infection
Figure 2. VP22 Blocked DNA-Mediated Inflammasome Activation
(A) J774/VP22 and J774/Ct cells were analyzed by immunoblotting.
(B) J774/Ct and J774/VP22 cells were stimulated by treatment with LPS (1 mg/mL) and transfection with poly(dA-dT) (10 mg/mL) for 18 hr, and cell-free
supernatants (sup) and cells (cell) were analyzed by immunoblotting.
(C) J774/Ct and J774/VP22 cells were stimulated by treatment with LPS (1 mg/mL) and transfection with poly(dA-dT) (10 mg/mL) for 18 hr. The release of IL-1b,
IL-6, and TNF-a into the supernatants was analyzed by ELISA. Each value is the mean ± standard error of the results of four independent experiments.
Statistical analysis was performed by the two-tailed Student’s t test. n.s., not statistically significant; *p < 0.05 (C). The data are representative of at least three
independent experiments (A and B). See also Figures S3 and S4.

efficiently induced inflammasome activation in the absence
of VP22 and that VP22 was required for inhibition of HSV-1-
mediated inflammasome activation in infected macrophages.
We also found that pro-IL-1b accumulated in the absence of
VP22 in HSV-1-infected WT BMMs and J774.A1cells, although
the absence of VP22 had no obvious effect on pro-caspase-1
accumulation (Figures 3A–3E and S6D), indicating that VP22
was required for the inhibition of pro-IL-1b accumulation in
HSV-1-infected cells. Pro-IL-1b accumulation was also observed
in J774.A1 cells infected with a recombinant virus in which HSV-1
VP22 was tagged with Flag (HSV-1/VP22[F]) (Figures S5A and
S6D). However, pro-caspase-1 processing and IL-1b secretion
were barely detectable in J774.A1 cells infected with HSV-1/
VP22(F), as observed with cells infected with WT HSV-1 or
HSV-1DVP22-repair (Figure S6C). These results indicated that
the VP22 Flag tag impaired VP22 inhibition of pro-IL-1b accumu-
lation but had no effect on VP22 inhibition of inflammasome
activation in these infected cells. These results eliminated the
possibility that pro-IL-1b accumulation without inflammasome
activation was sufficient for the elevated level of IL-1b secretion
observed in cells infected with HSV-1DVP22.
We then examined whether the inhibitory effect of VP22
on inflammasome activation in HSV-1-infected cells was
AIM2 dependent using BMMs derived from AIM2-deficient
mice (AIM2
/
BMMs). As shown in Figures 3D–3F, very low
levels of pro-caspase-1 processing and IL-1b secretion were
detected in AIM2
/
BMMs mock infected or infected with
WT HSV-1 or HSV-1DVP22-repair similar to AIM2+/+ WT
BMMs mock infected or infected with WT HSV-1 or
HSV-1DVP22-repair. In contrast, although significant pro-cas-
pase-1 processing and IL-1b secretion were detected in
HSV-1DVP22-infected AIM2+/+ WT BMMs, these were present
at very low levels in HSV-1DVP22-infected AIM2
/
BMMs. The
level of pro-caspase-1 accumulation in these infected cells was
similar. Like that observed for IL-1b secretion, significant IL-18
secretion was detected in HSV-1DVP22-infected AIM2
/

BMMs, whereas it was very low in WT BMMs and AIM2
/

BMMs mock infected or infected with WT HSV-1 or
HSV-1DVP22-repair (Figure S5D). Furthermore, as observed
with HSV-1DVP22-infected WT BMMs and J774.A.1 cells
(Figures 3A and S6D), pro-IL-1b accumulated in HSV-1-
infected AIM2
/
BMMs in the absence of VP22.

Cell Host & Microbe 23, 254–265, February 14, 2018 257
Figure 3. The VP22 Null Mutation Augmented AIM2-Dependent Inflammasome Activation in HSV-1-Infected Cells
(A and B) BMMs mock infected or infected with HSV-1 (WT), HSV-1DVP22 (DVP22), or HSV-1DVP22-repair (DVP22-repair) at an MOI of 3 for 12 hr were analyzed
by immunoblotting.
(C) IL-1b secretion in experiments (A and B) was measured by ELISA. The dotted line indicates the detection limit (7.8 pg/mL) of the ELISA assays.
(D and E) WT (AIM2+/+) and AIM2
/
BMMs mock infected or infected with HSV-1 (WT), HSV-1DVP22 (DVP22), or HSV-1DVP22-repair (DVP22-repair) at an
MOI of 3 for 12 hr were analyzed by immunoblotting.
(F and G) WT (AIM2+/+) and AIM2
/
BMMs were mock infected or infected with HSV-1 (WT), HSV-1DVP22 (DVP22), or HSV-1DVP22-repair (DVP22-repair) at
an MOI of 3 for 12 hr in the absence (F) or presence (G) of 0.75 mg LPS/mL. IL-1b secretion was measured by ELISA. The dotted line indicates the detection limit
(7.8 pg/mL) of the ELISA assays.
The data are representative of at least three independent experiments (A, B, D, and E). Each value is the mean ± standard error of the results of four independent
experiments (C, F, and G). Statistical analysis was performed by one-way ANOVA and Tukey’s test (C) or the two-tailed Student’s t test (F and G). n.s., not
statistically significant; *p < 0.05, ***p < 0.001. See also Figures S5 and S6.

Notably, the virus yields of WT or AIM2
/
BMMs infected with
WT HSV-1, HSV-1DVP22, or HSV-1DVP22-repair at the time
point when inflammasome activation was examined were
similar (Figure S5B). This indicated that a lack of VP22 in virions
and infected cells had no effect on viral infection efficiency and
eliminated the possibility that the differences in inflammasome
activation were due to viral infection efficiency.
We also tested the effect of VP22 on IL-1b secretion in HSV-1-
infected BMMs derived from NLRP3-deficient mice (NLRP3
/

BMMs). As shown in Figure S5E, significant IL-1b secretion

258 Cell Host & Microbe 23, 254–265, February 14, 2018

was observed in BMMs derived from NLRP3-deficient mice
(NLRP3
/
BMMs) infected with HSV-1DVP22, similar to WT
BMMs infected with the mutant virus. In these experiments, pol-
y(dA-dT) transfection, an AIM2-specific stimulus, induced IL-1b
secretion in BMMs that were AIM2 dependent.
Furthermore, the VP22 null mutation significantly augmented
the secretion of IL-1b in HSV-1-infected THP-1 cells where
NLRP3 was depleted by siRNA and in cells treated with control
siRNA (Figures S6A and S6B). In contrast, the VP22 null mutation
had no obvious effect on the secretion of IL-1b in HSV-1-infected
THP-1 cells where AIM2 was depleted by siRNA. These results
indicated that HSV-1 infection efficiently activated AIM2-depen-
dent inflammasomes in the absence of VP22 and that VP22 was
required for the inhibition of AIM2-dependent inflammasome
activation in HSV-1-infected cells.
It has been reported that WT HSV-1 is a potent inducer of IL-1b
secretion in LPS-treated murine macrophages and that this ef-
fect is independent of AIM2 (Rathinam et al., 2010). Therefore,
we also examined the effect of VP22 on IL-1b secretion in LPS-
treated and HSV-1-infected BMMs. As shown in Figure 3G, WT
HSV-1 and HSV-1DVP22-repair induced IL-1b secretion in
LPS-treated WT BMMs at levels similar to those in AIM2
/

BMMs infected with each of the viruses. In contrast, the VP22
null mutation significantly augmented IL-1b secretion in LPS-
treated HSV-1-infected BMMs, which was dependent on AIM2.
Similarly, THP-1 cells infected with WT HSV-1 or HSV-1DVP22-
repair secreted higher levels of IL-1b secretion than mock-
infected cells (Figure S6B). These results were in agreement
Figure 4. Virion-Associated VP22 Inhibited
Inflammasome Activation in BMMs
(A) Schematic diagram of the procedure to pro-
duce HSV-1DVP22+/
(DVP22+/
) and HSV-
1DVP22
/
(DVP22
/
).
(B) Vero/EGFP or Vero/VP22 cells were infected
with HSV-1DVP22 at an MOI of 0.05 for 48 hr.
Extracellular virions purified from the supernatants
(Virion) and cell lysates (Cell) were analyzed by
immunoblotting.
(C) Vero/VP22 cells were infected with
HSV-1DVP22 (DVP22), and Vero/EGFP cells were
infected with HSV-1 (WT), HSV-1DVP22 (DVP22),
or HSV-1DVP22-repair (DVP22-repair) at an MOI
of 0.05 for 48 hr. Extracellular virions purified
from the supernatants were analyzed by immu-
noblotting.
(D and E) BMMs were mock -infected or
infected with HSV-1DVP22+/
(DVP22+/
) or
HSV-1DVP22
/
(DVP22
/
) at an MOI of 3 for
12 hr. Infected cells were analyzed by immuno-
blotting (D) and IL-1b secretion was measured by
ELISA (E). The dotted line indicates the IL-1b
detection limit (7.8 pg/mL) of the ELISA assays (E).
Each value is the mean ± standard error of the
results of five independent experiments.
Statistical significance was determined by the
two-tailed Student’s t test, *p < 0.05. The data
are representative of two (C) or three (B and D)
independent experiments.
with a previous study that reported that HSV-1 infection activated
multiple inflammasomes other than the AIM2 inflammasome
(Johnson et al., 2013; Rathinam et al., 2010).
Effect of VP22 in the Virion Tegument on Inflammasome
Activation
To investigate whether VP22 released from a virion after virus
entry can affect inflammasome activation, we prepared two
HSV-1DVP22 strains, HSV-1DVP22+/
and HSV-1DVP22
/

(Figure 4A). HSV-1DVP22+/
virions can contain VP22, but
HSV-1DVP22
/
virions cannot (Figure 4B). These virions
contain the same viral genomes with the null mutation in the
VP22 gene, so these strains cannot synthesize de novo VP22
in infected cells. We noted that the level of incorporation of
VP22 into DVP22+/
virions was much lower than that into
WT HSV-1 virions (Figure 4C). We then infected WT BMMs
with HSV-1DVP22+/
or HSV-1DVP22
/
and analyzed pro-cas-
pase-1 processing and IL-1b secretion in the infected cells.
BMM cells infected with HSV-1DVP22+/
produced significantly
less caspase-1 and secreted less IL-1b than cells infected
with HSV-1DVP22
/
, although the levels of expression of pro-
caspase-1 and pro-IL-1b in these infected cells was not affected
(Figures 4D and 4E). These results suggested that VP22 released
from virions after virus entry was able to inhibit inflammasome
activation. However, VP22 released from virions could not inhibit
pro-IL-1b accumulation in our experiments, indicating that either
VP22 that was incorporated into virions was unable to inhibit
pro-IL-1b accumulation or that the amount of VP22 incorporated
Cell Host & Microbe 23, 254–265, February 14, 2018 259

Figure 5. VP22 Was Required for Efficient Viral Replication in
AIM2+/+ Mice but Not in AIM2–/– Mice
5- to 7-week-old female WT (AIM2+/+) and AIM2
/
mice were inoculated
intracranially with 105 PFU HSV-1DVP22 or HSV-1DVP22-repair. At 4 days
post infection, the brains of infected mice were harvested and virus titers
were assayed. Each data point is the virus titer in the brain of one
infected mouse: 15 WT (AIM2+/+) mice were infected with HSV-1DVP22,
14 AIM2
/
mice were infected with HSV-1DVP22, 11 WT (AIM2+/+) mice were
infected with HSV-1DVP22-repair, and 8 AIM2
/
mice were infected with
HSV-1DVP22-repair. The dashed line indicates the limit of detection (18 PFU/
brain). The horizontal bar indicates the mean ± standard error for each group.
Statistical significance was determined by the two-tailed Student’s t test
with the Bonferroni adjustment for the four comparison analyses. n.s., not
statistically significant; **p < 0.0083 (0.05/6). See also Figure S7.
into HSV-1DVP22+/
virions in these experiments was insuffi-
cient to inhibit pro-IL-1b accumulation.
Effect of AIM2 on HSV-1 Replication in the Presence and
Absence of VP22 In Vivo
To examine the effect of VP22-mediated inhibition of AIM2-
dependent inflammasome activation on HSV-1 replication
in vivo, we intracranially infected WT (AIM2+/+) and AIM2
/

mice with HSV-1DVP22 or HSV-1DVP22-repair, and viral titers
in the brains of infected mice were determined. As shown in
Figure 5, viral yields in the brains of WT (AIM2+/+) mice infected
with HSV-1DVP22 were 14-fold lower than in WT (AIM2+/+)
mice infected with HSV-1DVP22-repair. The viral yield in
HSV-1DVP22-infected AIM2
/
mice was significantly greater
(23-fold) than in HSV-1DVP22-infected AIM2+/+ mice and was
comparable to that in WT (AIM2+/+) mice infected with
HSV-1DVP22-repair (Figure 5). In contrast, the viral yields in
AIM2
/
and AIM2+/+ mice infected with HSV-1DVP22-repair
were similar. We also analyzed the expression levels of
HSV-1 transcripts (HSV-1 ICP27 mRNA) in WT (AIM2+/+) or
AIM2
/
mice infected intracranially with HSV-1DVP22 or
HSV-1DVP22-repair. As shown in Figures S7A and S7B, AIM2
deficiency significantly increased the levels of ICP27 mRNAs
in HSV-1DVP22-infected mice but not in HSV-1DVP22-repair-
260 Cell Host & Microbe 23, 254–265, February 14, 2018
infected mice. These results indicated that AIM2 was required
for the viral replication defect caused by the VP22 null mutation
in mice following intracranial inoculation and suggested
that VP22 promoted viral replication in vivo by inhibiting an
AIM2-dependent host response(s) against HSV-1 infection.
VP22 Interacted with AIM2 and Blocked Oligomerization
of AIM2
Finally, we attempted to clarify the mechanism by which VP22
inhibited AIM2-dependent inflammasome activation.
We first investigated whether VP22 interacted with AIM2,
based on the results above (Figure 1D), showing that ectopically
co-expressed AIM2-Flag and VP22 were efficiently co-localized
in the cytoplasm. As shown in Figure 6A, when AIM2 and VP22
were ectopically co-expressed in 293FT cells, anti-AIM2 anti-
body co-precipitated VP22 with AIM2, but the antibody did not
precipitate VP22 when VP22 alone was ectopically expressed
in these cells. Furthermore, anti-Flag antibody co-precipitated
AIM2 with Flag-VP22 from lysates of J774.A1 cells infected
with HSV-1/VP22(F) but not from J774.A1 cells infected with
WT HSV-1 (Figure 6B). These results indicated that VP22 inter-
acted with AIM2 in HSV-1-infected cells.
AIM2 contains a C-terminal DNA-binding HIN domain and
an N-terminal pyrin domain that belongs to the death domain
superfamily of signaling modules (Figure 6C) (Schattgen and
Fitzgerald, 2011). To investigate the AIM2 domain(s) responsible
for its interaction with VP22, we tested mutants of AIM2 fused to
glutathione S-transferase (GST-AIM2) lacking the HIN (GST-
AIM2DHIN) or pyrin domain (GST-AIM2Dpyrin), respectively (Fig-
ure 6C), in GST pull-down assays. GST-AIM2 efficiently pulled
down Flag-VP22 from lysates of 293FT cells ectopically express-
ing Flag-VP22, but GST alone only pulled down a barely detect-
able amount of Flag-VP22 (Figure 6D). GST-AIM2Dpyrin pulled
down Flag-VP22 from lysates of cells expressing Flag-VP22 as
efficiently as GST-AIM2, but GST-AIM2DHIN only pulled down
a barely detectable amount of Flag-VP22, as was observed
with GST alone (Figure 6D). We also tested a HIN or pyrin domain
fused to GST (GST-AIM2-HIN or GST-AIM2-pyrin, respectively)
(Figure 6C) and showed that the HIN domain of AIM2 alone but
not the pyrin domain of AIM2 pulled down Flag-VP22 (Fig-
ure S7C). These results indicated that the AIM2 HIN domain
was necessary and sufficient for AIM2 interaction with VP22.
To investigate the relevance of the interaction between VP22
and AIM2 in the VP22-mediated inhibition of AIM2 inflamma-
some activation, we tested a series of 50 and 30 sequential dele-
tion mutants of Flag-VP22 (Figure 6E) in GST pull-down assays
and the AIM2 inflammasome reconstitution assay. As shown in
Figure 6F, VP22 mutants with a deletion of 34 residues from
the C terminus of VP22 and those of 39, 79, and 119 residues
from the N terminus of VP22 were pulled down by GST-AIM2-
HIN as efficiently as WT VP22. In contrast, VP22 mutants with
deletions of 75, 109, and 141 residues from the C terminus of
VP22 were barely pulled down by GST-AIM2-HIN (Figure 6F).
Notably, all mutants of VP22 shown to interact with AIM2
retained the ability to inhibit AIM2 inflammasome activation,
whereas those shown not to interact with AIM2 did not (Fig-
ure 6G). These results suggest that the interaction between
VP22 and AIM2 HIN domain is involved in the VP22-mediated
inhibition of AIM2 inflammasome activation.

The results above (Figures 1D and 1E), indicating that VP22 in-
hibited AIM2-dependent inflammasome activation at or prior to
ASC and AIM2 speck formation, suggested that VP22 inhibited
oligomerization of AIM2 and/or ASC recruitment to AIM2 oligo-
mers. Next, we investigated whether VP22 inhibited oligomeriza-
tion of AIM2. It has been reported that overexpression of AIM2 in
293T cells led AIM2 to form filamentous structures, that were
considered to be AIM2 oligomers (Lu et al., 2014). Therefore,
Figure 6. VP22 Interacted with AIM2
(A) 293FT cells co-transfected with expression
plasmids encoding AIM2 and VP22 for 24 hr were
lysed, immunoprecipitated (IP), and analyzed by
immunoblotting.
(B) J774.A1 cells infected with WT HSV-1(F) or
HSV-1/VP22(F) at an MOI 3 for 8 hr were lysed,
immunoprecipitated, and analyzed by immuno-
blotting.
(C) Schematic diagrams showing the domain
structures of AIM2 and the truncated mutants used
in Figures 6D, 6F, 7D–7F, and S7C.
(D) The indicated GST fusion proteins immobilized
on glutathione-Sepharose beads were reacted
with lysates of 293FT cells transfected with an
expression plasmid encoding Flag-VP22. The
beads were analyzed by immunoblotting (top gel)
and were also electrophoretically separated in
a denaturing gel and stained with Coomassie
brilliant blue (CBB; bottom gel).
(E) Schematic diagrams showing the truncated
mutants of VP22 used in Figures 6F and 6G.
(F) GST-AIM2-HIN immobilized on glutathione-
Sepharose beads were reacted with lysates of
293FT cells transfected with an expression
plasmid encoding each of the indicated truncated
mutants of Flag-VP22. The beads were then
processed as described in (D).
(G) 293FT cells were transfected with expression
plasmids encoding AIM2, ASC, pro-caspase-1,
and pro-IL-1b together with Flag-EGFP or each of
the indicated truncated mutants of Flag-VP22 for
24 hr. IL-1b secretion was analyzed by ELISA. Each
value is the mean ± standard error of triplicate
experiments.
The data are representative of at least three
independent experiments (A, B, D, F, and G). See
also Figure S7.
we examined the effect of VP22 on AIM2
filament formation in 293FT cells overex-
pressing AIM2 tagged with Flag (AIM2-
Flag). As shown in Figures 7A and 7B,
when 293FT cells were transfected with
an AIM2-Flag expression plasmid in com-
bination with an empty expression
plasmid or an expression plasmid for
EGFP, most of the transfected cells had
filamentous AIM2-Flag structures in their
cytoplasm. In contrast, when 293FT cells
were transfected with the AIM2-Flag
expression plasmid in combination with
an expression plasmid for VP22, only
11.4% of the transfected cells had fila-
mentous AIM2-Flag structures, and AIM2-Flag was dispersed
throughout the cytoplasm in most transfected cells.
We next examined the effect of VP22 on formation of high-
order AIM2 complexes in 293FT cells overexpressing AIM2 by
sucrose density gradient sedimentations. As shown in Figure 7C,
when 293FT cells were co-transfected with the AIM2 and EGFP
expression plasmids, AIM2 was mainly detected in the higher-
density fractions, with the greatest amount of AIM2 in fraction
Cell Host & Microbe 23, 254–265, February 14, 2018 261

9. In contrast, when 293FT cells were co-transfected with the
AIM2 and VP22 expression plasmids, AIM2 was present in the
two peaks in lower-density fractions, a small peak in fraction 7
and a peak with more AIM2 in fraction 2. To investigate whether
VP22 inhibits the oligomerization of endogenous AIM2, we
stimulated J774/VP22 and J774/Ct cells by transfection with
poly(dA-dT), then lysed and subjected to sucrose density
gradient sedimentations. As shown in Figure S7D, AIM2 from
the lysates of J774/Ct cells was detected in higher-density
fractions than AIM2 from the lysates of J774/VP22 cells. Taken
together, these results indicated that VP22 inhibited oligomeriza-
tion of AIM2.
Previous reports showed that overexpression of an AIM2
mutant containing only the HIN (AIM2-HIN) or pyrin (AIM2-pyrin)
domain in 293T cells induced aggregates or filamentous struc-
tures of AIM2, respectively, in the cytoplasm: both structures
are considered to be AIM2 oligomers (Jin et al., 2012; Lu et al.,
2014). To clarify the linkage between the VP22 interaction with
262 Cell Host & Microbe 23, 254–265, February 14, 2018
Figure 7. VP22 Interacted with the AIM2 HIN
Domain but Not the Pyrin Domain to Block
Oligomerization
(A) 293FT cells co-transfected with an expression
plasmid encoding AIM2-Flag and an expression
plasmid encoding either VP22 or EGFP or with an
expression plasmid encoding AIM2-Flag and an
empty plasmid for 24 hr were examined by
confocal microscopy. Bars, 5 mm.
(B) Percentage of cells with AIM2 filamentous
aggregates in the experiments in (A).
(C) 293FT cells co-transfected with an expression
plasmid encoding AIM2 and an expression
plasmid encoding either VP22 or EGFP for 48 hr
were subjected to sucrose density gradient
sedimentations.
(D) 293FT cells co-transfected with an expression
plasmid encoding AIM2-HIN-Flag or AIM2-pyrin-
Flag and with an expression plasmid encoding
VP22 or an empty plasmid for 24 hr were examined
by confocal microscopy.
(E and F) Percentage of cells with AIM2-HIN-Flag
(E) or AIM2-pyrin-Flag (F) aggregates in the cyto-
plasm in the experiments in (D).
Each value is the mean ± standard error of the
results of three independent experiments (B, E,
and F). Statistical analysis was performed by one-
way ANOVA and Tukey’s test (B) or the two-tailed
Student’s t test (E and F). n.s., not statistically
significant; **p < 0.01, ****p < 0.0001. The data are
representative of at least three independent
experiments (A, C, and D). See also Figure S7.
AIM2 and the ability of VP22 to block
AIM2 oligomerization, we examined the
effect of VP22 on the formation of AIM2
aggregates and filamentous structures
induced by overexpression of AIM2-
Flag mutants containing only AIM2-HIN
(AIM2-HIN-Flag) or AIM2-pyrin (AIM2-
pyrin-Flag) (Figure 6C). As shown in Fig-
ures 7D–7F, ectopic expression of VP22
significantly impaired formation of the
AIM2 aggregates in the cytoplasm induced by AIM2-HIN-Flag,
but VP22 had no obvious effect on the AIM2 filamentous struc-
tures induced by AIM2-pyrin-Flag. These results suggested
that VP22 interacted with the AIM2 HIN domain and that this
interaction inhibited AIM2 oligomerization.
Taken together, these series of observations suggest that
VP22 interacted with AIM2 and inhibited oligomerization of
AIM2, thereby inhibiting AIM2 inflammasome activations.
DISCUSSION
Hosts and pathogens co-evolve, with natural selection produc-
ing a fine balance between the ability of a host to defend against
a pathogen and the ability of a pathogen to evade host defenses
(Casadevall and Pirofski, 1999). Data have accumulated sug-
gesting that the secretion of pro-inflammatory cytokines IL-1b
and IL-18, as a result of inflammasome activation, may be a
critical component of a host’s innate immune response against
infections of various pathogens (Garlanda et al., 2013; Gram
et al., 2012). These pro-inflammatory cytokines activate immune
cells and upregulate adhesion molecules on endothelial cells,
thereby targeting activated immune cells to sites of infection
(Garlanda et al., 2013). In addition, the pro-inflammatory cyto-
kines activate the NF-kB, p38, and JNK pathways, resulting in
expression of multiple genes, including other pro-inflammatory
cytokines, which contribute to immune responses against infec-
tions of pathogens at the sites of infections (Dinarello, 2009).
Numerous reports have shown that components of various path-
ogens are recognized by sensor proteins for inflammasomes,
thereby inducing inflammasome activation and secretion of
pro-inflammatory cytokines (de Zoete et al., 2014; Vanaja
et al., 2015). Moreover, depletion and administration of pro-
inflammatory cytokines have been shown to increase and
reduce, respectively, the load and/or pathogenicity of various
pathogens in vivo (Gram et al., 2012). The balance between
host defenses and their evasion by pathogens depends on the
interactions between hosts and pathogens and can be resolved
only when both the mechanisms for host immune defense and its
evasion by pathogens have been clarified and the pathogen load
and pathogenicity are studied in an in vivo model(s).
In this study, we clarified an HSV-1 immune evasion mecha-
nism in which HSV-1 VP22 inhibited AIM2-dependent inflamma-
some activation and IL-1b secretion in infected macrophages.
Although pathogen evasion strategies for inflammasome activa-
tion that target NLRs and IFI16 have been reported (Gram et al.,
2012; Johnson et al., 2013), a strategy that targets AIM2 has
not been reported. Therefore, this is the unique finding of a
pathogen’s strategy to evade inflammasome activation by
targeting AIM2. More importantly, we have also shown here
that the in vivo effect of VP22 on HSV-1 replication in mice was
totally dependent on AIM2. These observations suggested that
VP22 promoted HSV-1 replication in vivo by inhibiting an
AIM2-dependent host response(s) against viral infection. It has
been reported that depletion and administration of IL-1b or
IL-18, which are downstream effectors of AIM2-dependent
inflammasomes, augmented and impaired HSV-1 replication
and/or pathogenicity in mouse models, respectively (Fujioka
et al., 1999; Sergerie et al., 2007). This suggested that AIM2-
dependent inflammasome activation is the host’s innate
immune response against HSV-1 infection in vivo. Furthermore,
AIM2-dependent host responses other than inflammasome
activation that inhibit HSV-1 infection in vivo have not been
reported thus far. Based on these data, we propose that VP22-
mediated evasion of AIM2-dependent inflammasome activation
contributes to HSV-1 replication in vivo.
The unique HSV-1 evasion mechanism in macrophages
described here revealed an intrinsic immune mechanism against
HSV-1 infection in these cells. Thus, we have shown that infec-
tion of macrophages with the HSV-1 VP22 null mutant induced
significant AIM2-dependent inflammasome activation and
IL-1b secretion. This indicated that macrophages have evolved
a mechanism to sense HSV-1 infection using AIM2, thereby
inducing inflammasome activation and secretion of pro-
inflammatory cytokines. The finding here that host macrophages
sense HSV-1 infection and activate AIM2-dependent inflamma-
somes could not be observed without elucidating, as shown in
this study, HSV-1 VP22-mediated evasion of AIM2-dependent
inflammasome activation and inhibiting this process. The inhibi-
tory effect of HSV-1 VP22 appeared to be remarkably efficient,
and HSV-1 VP22 almost completely suppressed AIM2-depen-
dent inflammasome activation in HSV-1-infected macrophages.
In agreement with these results, it has been reported that
knockout of AIM2 had no effect on inflammasome activation
and IL-1b secretion in macrophages infected with WT HSV-1
(Rathinam et al., 2010). In addition, macrophages have been
reported to express intrinsic restriction factor SAMHD1 that
dramatically limits HSV-1 replication by depleting cellular dNTP
pools, as also reported for retroviruses including human immu-
nodeficiency virus 1 (Kim et al., 2013). Macrophages may
restrict HSV-1 replication using SAMHD1 to prevent lytic viral
infection because these cells play critical roles in innate immune
responses against HSV-1 (Ellermann-Eriksen, 2005). Even when
HSV-1 replication may be limited, macrophages appear to be
able to induce AIM2-dependent inflammasome activation by
sensing HSV-1 infection; therefore, HSV-1 VP22 may have
evolved to antagonize this intrinsic immune mechanism. VP22-
mediated immune evasion may suppress the anti-HSV-1 innate
immune response at the site of infection, thereby enabling effi-
cient viral replication in cell types other than macrophages,
such as the epithelial and neural cells that are the main targets
of HSV-1 infection. Thus, this study clarified the interesting
balance between the ability of hosts to clear HSV-1 and the
ability of HSV-1 to evade host innate immune responses.
It has been reported that the wild-type HSV-1 virion tegument
contains approximately 2,000 copies of VP22 (Heine et al., 1974)
and that VP22 can be efficiently released from virions during very
early HSV-1 infection (Morrison et al., 1998). In this study, we
show that VP22 in virions was able to inhibit inflammasome
activation in BMMs. As described above, HSV-1 nucleocapsids
are degraded in the cytoplasm of infected macrophages (Horan
et al., 2013). Therefore, a fraction of the incoming HSV-1
nucleocapsids in infected host cells may be degraded and their
genomes sensed by AIM2, leading to rapid activation of inflam-
masomes. HSV-1 VP22 appears to have evolved and been
retained in the virion tegument to enable evasion of a rapid
host immune response before de novo synthesis of VP22 during
very early HSV-1 infection. Similarly, HSV-1 virions contain a
virion host shutoff protein (VHS), which is a viral endoribonu-
clease in the virion tegument: VHS in the virion tegument has
been reported to block the activation of dendritic cells
(Cotter et al., 2011). VHS has also been shown to counteract
various anti-viral immune responses against HSV-1 infection
by downregulating expression of DNA sensors including IFI16
and cGAS (Orzalli et al., 2016; Su and Zheng, 2017). Thus,
HSV-1 virions appear to contain multiple viral proteins in their
tegument to counteract host anti-viral immune responses imme-
diately upon infection.
VP22-mediated inhibition of AIM2-dependent inflammasome
activation, a mechanism that appears to be shared by other
herpesviruses, indicates the significance of the selective pres-
sure for an inhibitor of inflammasome activation in the evolution
of these viruses. We have shown here that the inhibitory effect of
HSV-1 VP22 on AIM2-dependent inflammasome activation has
been conserved in VP22 homologs of other alphaherpesviruses,
including HSV-2 and PRV. Moreover, it has been reported that a
gammaherpesvirus, Kaposi’s sarcoma-associated herpesvirus
Cell Host & Microbe 23, 254–265, February 14, 2018 263
(KSHV), encodes NLR homolog ORF63 that inhibits inflamma- d METHOD DETAILS
some activation (Gregory et al., 2011). Interestingly, KSHV B Plasmids
ORF63 inhibits inflammasome activation in ways similar to B Generation of Recombinant HSV-1
VP22. KSHV ORF63 is a virion tegument protein that interacts B Screening for HSV-1 Inhibitors of AIM2
with NLRP1, an inflammasome sensor protein, and prevents its B Inflammasome Reconstitution Assays
oligomerization, thereby inhibiting inflammasome activation B ELISA
(Gregory et al., 2011). These observations suggested that B Immunofluorescence
evasion of inflammasome activation may play a key role in infec- B Immunoblotting
tions of various herpesviruses. In support of this hypothesis, B Cell Lines Stably Expressing VP22
polymorphisms in regulatory proteins in the IL-18 pathway, B Luciferase Assay
including the IL-18 receptor and IL-18 receptor accessory pro- B Cell Stimulation
tein, have been reported to be associated with seropositive B Virus Infection
HSV-1, HSV-2, and human cytomegalovirus (Shirts et al., 2008). B Knockdown of AIM2 and NLRP3 Using siRNAs
In this study, we demonstrated that VP22 was required for the B Virion Purification
inhibition of pro-IL-1b accumulation in HSV-1-infected cells. At B Animal Studies
present, the mechanism(s) by which VP22 mediates pro-IL-1b B Immunoprecipitation
expression remains unknown. It was reported that pro-IL-1b is B GST Pull-Down Assays
induced by the activation of NF-kB/MAP kinase signaling path- B Sucrose Density Gradient Sedimentation
ways (Baker et al., 2011; Kyriakis and Avruch, 2012) and that d QUANTIFICATION AND STATISTICAL ANALYSIS
WT HSV-1 infection also induced the activation of these path-
ways (Cotter et al., 2011; Zachos et al., 1999). Interestingly, the SUPPLEMENTAL INFORMATION
expression levels of IL-6 mRNA, which was also reported to be
regulated by these pathways (Baker et al., 2011; Kyriakis and Supplemental Information includes seven figures and can be found with this
article online at https://doi.org/10.1016/j.chom.2017.12.014.
Avruch, 2012), in WT BMMs infected with HSV-1DVP22 were
significantly higher than those in WT BMMs infected with WT
ACKNOWLEDGMENTS
HSV-1 or HSV-1DVP22-repair (Figure S5C). These observations
raised an interesting possibility that VP22 acts as an inhibitor for
We thank Tomoko Ando, Yoshie Asakura, Sachi Matsumoto, Zhuoming Liu,
NF-kB and/or MAP kinase signaling pathway(s) that is activated Yasuko Mori, and Tadatsugu Taniguchi for their excellent technical assistance
in HSV-1-infected cells. Notably, we showed that the ectopic and/or sharing their reagents with us. This study was supported by Grants for
expression of VP22 alone had no obvious effect on the expres- Scientific Research from the Japan Society for the Promotion of Science
sion of pro-IL-1b, IL-6, and TNF-a, all of which are regulated (JSPS), grants for Scientific Research on Innovative Areas from the Ministry
by NF-kB/MAP kinase signaling pathways. This suggests that of Education, Culture, Science, Sports and Technology (MEXT) of Japan
(16H06433, 16H06429, 16K21723), a contract research fund from the Program
VP22 in the absence of other HSV-1 proteins was unable to
of Japan Initiative for Global Research Network on Infectious Diseases
inhibit NF-kB and/or MAP kinase signaling pathway(s) and that (J-GRID) from the Japan Agency for Medical Research and Development
(an)other HSV-1 protein(s) was/were required for the VP22- (AMED), and grants from the Takeda Science Foundation and the Mitsubishi
mediated inhibition of these signaling pathways. In support of Foundation.
this hypothesis, it was reported that VP22 alone did not inhibit
the NF-kB signaling pathway (Stroh et al., 2003) and that VP22 AUTHOR CONTRIBUTIONS
interacted with VHS (Taddeo et al., 2007), which was required
Y.M. and Y.K. designed experiments; Y.M., T.I., R.S., T.O., T.K., S.T., and
for the efficient inhibition of the NF-kB signaling pathway M.W. performed experiments; T.I., K.M., T.S., and T.K. provided critical re-
activated by HSV-1 infection (Cotter et al., 2011). Thus, VP22 agents and scientific insight; Y.M., T.I., R.S., N.K., J.A., A.K., and Y.K. analyzed
appears to play multiple roles in counteracting innate immune data; Y.M. and Y.K. wrote the manuscript.
responses against HSV-1 infection. VP22 was reported to
possess the unusual property of being able to move between DECLARATION OF INTERESTS
cells (Elliott and O’Hare, 1997). This intercellular trafficking activ-
The authors declare no competing interests.
ity may contribute to the efficient blockage of pro-inflammatory
responses in uninfected cells surrounding infected cells. Received: July 21, 2017
Revised: October 24, 2017
STAR+METHODS Accepted: December 20, 2017
Published: February 14, 2018

Detailed methods are provided in the online version of this paper

REFERENCES
and include the following:
Baker, R.G., Hayden, M.S., and Ghosh, S. (2011). NF-kB, inflammation, and
d KEY RESOURCES TABLE
metabolic disease. Cell Metab. 13, 11–22.
d CONTACT FOR REAGENT AND RESOURCE SHARING
€rckstu
Bu €mmer, T., Baumann, C., Blu €ml, S., Dixit, E., Du
€rnberger, G., Jahn,
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
H., Planyavsky, M., Bilban, M., Colinge, J., Bennett, K.L., and Superti-
B Cells Furga, G. (2009). An orthogonal proteomic-genomic screen identifies AIM2
B Viruses as a cytoplasmic DNA sensor for the inflammasome. Nat. Immunol. 10,
B Mice 266–272.

264 Cell Host & Microbe 23, 254–265, February 14, 2018
Casadevall, A., and Pirofski, L.A. (1999). Host-pathogen interactions: redefin-
ing the basic concepts of virulence and pathogenicity. Infect. Immun. 67,
3703–3713.
Cotter, C.R., Kim, W.K., Nguyen, M.L., Yount, J.S., López, C.B., Blaho, J.A.,
and Moran, T.M. (2011). The virion host shutoff protein of herpes simplex virus
1 blocks the replication-independent activation of NF-kB in dendritic cells in
the absence of type I interferon signaling. J. Virol. 85, 12662–12672.
de Zoete, M.R., Palm, N.W., Zhu, S., and Flavell, R.A. (2014). Inflammasomes.
Cold Spring Harb. Perspect. Biol. 6, a016287.
Dinarello, C.A. (2009). Immunological and inflammatory functions of the inter-
leukin-1 family. Annu. Rev. Immunol. 27, 519–550.
Ellermann-Eriksen, S. (2005). Macrophages and cytokines in the early defence
against herpes simplex virus. Virol. J. 2, 59.
Elliott, G., and O’Hare, P. (1997). Intercellular trafficking and protein delivery by
a herpesvirus structural protein. Cell 88, 223–233.
Fernandes-Alnemri, T., Wu, J., Yu, J.W., Datta, P., Miller, B., Jankowski, W.,
Rosenberg, S., Zhang, J., and Alnemri, E.S. (2007). The pyroptosome: a supra-
molecular assembly of ASC dimers mediating inflammatory cell death via
caspase-1 activation. Cell Death Differ. 14, 1590–1604.
Fujioka, N., Akazawa, R., Ohashi, K., Fujii, M., Ikeda, M., and Kurimoto, M.
(1999). Interleukin-18 protects mice against acute herpes simplex virus type
1 infection. J. Virol. 73, 2401–2409.
Garlanda, C., Dinarello, C.A., and Mantovani, A. (2013). The interleukin-1
family: back to the future. Immunity 39, 1003–1018.
Gram, A.M., Frenkel, J., and Ressing, M.E. (2012). Inflammasomes and
viruses: cellular defence versus viral offence. J. Gen. Virol. 93, 2063–2075.
Gregory, S.M., Davis, B.K., West, J.A., Taxman, D.J., Matsuzawa, S., Reed,
J.C., Ting, J.P., and Damania, B. (2011). Discovery of a viral NLR homolog
that inhibits the inflammasome. Science 331, 330–334.
Heine, J.W., Honess, R.W., Cassai, E., and Roizman, B. (1974). Proteins
specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains.
J. Virol. 14, 640–651.
Horan, K.A., Hansen, K., Jakobsen, M.R., Holm, C.K., Søby, S., Unterholzner,
L., Thompson, M., West, J.A., Iversen, M.B., Rasmussen, S.B., et al. (2013).
Proteasomal degradation of herpes simplex virus capsids in macrophages
releases DNA to the cytosol for recognition by DNA sensors. J. Immunol.
190, 2311–2319.
Jin, T., Perry, A., Jiang, J., Smith, P., Curry, J.A., Unterholzner, L., Jiang, Z.,
Horvath, G., Rathinam, V.A., Johnstone, R.W., et al. (2012). Structures of the
HIN domain: DNA complexes reveal ligand binding and activation mechanisms
of the AIM2 inflammasome and IFI16 receptor. Immunity 36, 561–571.
Johnson, K.E., Chikoti, L., and Chandran, B. (2013). Herpes simplex virus 1
infection induces activation and subsequent inhibition of the IFI16 and
NLRP3 inflammasomes. J. Virol. 87, 5005–5018.
Kato, A., Arii, J., Shiratori, I., Akashi, H., Arase, H., and Kawaguchi, Y. (2009).
Herpes simplex virus 1 protein kinase Us3 phosphorylates viral envelope
glycoprotein B and regulates its expression on the cell surface. J. Virol. 83,
250–261.
Kawaguchi, Y., Van Sant, C., and Roizman, B. (1997). Herpes simplex virus 1
alpha regulatory protein ICP0 interacts with and stabilizes the cell cycle
regulator cyclin D3. J. Virol. 71, 7328–7336.
Kim, E.T., White, T.E., Brandariz-Núñez, A., Diaz-Griffero, F., and Weitzman,
M.D. (2013). SAMHD1 restricts herpes simplex virus 1 in macrophages by
limiting DNA replication. J. Virol. 87, 12949–12956.
Kyriakis, J.M., and Avruch, J. (2012). Mammalian MAPK signal transduction
pathways activated by stress and inflammation: a 10-year update. Physiol.
Rev. 92, 689–737.
Lu, A., Kabaleeswaran, V., Fu, T., Magupalli, V.G., and Wu, H. (2014). Crystal
structure of the F27G AIM2 PYD mutant and similarities of its self-association
to DED/DED interactions. J. Mol. Biol. 426, 1420–1427.
Martinon, F., Pétrilli, V., Mayor, A., Tardivel, A., and Tschopp, J. (2006). Gout-
associated uric acid crystals activate the NALP3 inflammasome. Nature 440,
237–241.
Morimoto, T., Arii, J., Tanaka, M., Sata, T., Akashi, H., Yamada, M., Nishiyama,
Y., Uema, M., and Kawaguchi, Y. (2009). Differences in the regulatory and
functional effects of the Us3 protein kinase activities of herpes simplex virus
1 and 2. J. Virol. 83, 11624–11634.
Moriyama, M., Chen, I.Y., Kawaguchi, A., Koshiba, T., Nagata, K., Takeyama,
H., Hasegawa, H., and Ichinohe, T. (2016). The RNA- and TRIM25-binding
domains of influenza virus NS1 protein are essential for suppression of
NLRP3 inflammasome-mediated interleukin-1b secretion. J. Virol. 90,
4105–4114.
Morrison, E.E., Wang, Y.F., and Meredith, D.M. (1998). Phosphorylation of
structural components promotes dissociation of the herpes simplex virus
type 1 tegument. J. Virol. 72, 7108–7114.
Nagaike, K., Mori, Y., Gomi, Y., Yoshii, H., Takahashi, M., Wagner, M.,
Koszinowski, U., and Yamanishi, K. (2004). Cloning of the varicella-zoster virus
genome as an infectious bacterial artificial chromosome in Escherichia coli.
Vaccine 22, 4069–4074.
Orzalli, M.H., Broekema, N.M., and Knipe, D.M. (2016). Relative contributions
of herpes simplex virus 1 ICP0 and vhs to loss of cellular IFI16 vary in different
human cell types. J. Virol. 90, 8351–8359.
Rathinam, V.A., Jiang, Z., Waggoner, S.N., Sharma, S., Cole, L.E., Waggoner,
L., Vanaja, S.K., Monks, B.G., Ganesan, S., Latz, E., et al. (2010). The AIM2
inflammasome is essential for host defense against cytosolic bacteria and
DNA viruses. Nat. Immunol. 11, 395–402.
Roizman, B., Knipe, D.M., and Whitley, R.J. (2013). Herpes simplex viruses. In
Fields Virology, D.M. Knipe, P.M. Howley, J.I. Cohen, D.E. Griffin, R.A. Lamb,
M.A. Martin, V.R. Racaniello, and B. Roizman, eds. (Lippincott-Williams &
Wilkins), pp. 1823–1897.
Schattgen, S.A., and Fitzgerald, K.A. (2011). The PYHIN protein family as
mediators of host defenses. Immunol. Rev. 243, 109–118.
Sergerie, Y., Rivest, S., and Boivin, G. (2007). Tumor necrosis factor-alpha and
interleukin-1 beta play a critical role in the resistance against lethal herpes
simplex virus encephalitis. J. Infect. Dis. 196, 853–860.
Shirts, B.H., Wood, J., Yolken, R.H., and Nimgaonkar, V.L. (2008).
Comprehensive evaluation of positional candidates in the IL-18 pathway
reveals suggestive associations with schizophrenia and herpes virus seropos-
itivity. Am. J. Med. Genet. B. Neuropsychiatr. Genet. 147, 343–350.
Stroh, C., Held, J., Samraj, A.K., and Schulze-Osthoff, K. (2003). Specific
inhibition of transcription factor NF-kappaB through intracellular protein
delivery of I kappaBalpha by the Herpes virus protein VP22. Oncogene 22,
5367–5373.
Su, C., and Zheng, C. (2017). Herpes simplex virus 1 abrogates the cGAS/
STING-mediated cytosolic DNA-sensing pathway via its virion host shutoff
protein, UL41. J. Virol. 91, e02414-16.
Taddeo, B., Sciortino, M.T., Zhang, W., and Roizman, B. (2007). Interaction
of herpes simplex virus RNase with VP16 and VP22 is required for the accumu-
lation of the protein but not for accumulation of mRNA. Proc. Natl. Acad. Sci.
USA 104, 12163–12168.
Tanaka, M., Kato, A., Satoh, Y., Ide, T., Sagou, K., Kimura, K., Hasegawa, H.,
and Kawaguchi, Y. (2012). Herpes simplex virus 1 VP22 regulates transloca-
tion of multiple viral and cellular proteins and promotes neurovirulence.
J. Virol. 86, 5264–5277.
Vanaja, S.K., Rathinam, V.A., and Fitzgerald, K.A. (2015). Mechanisms of
inflammasome activation: recent advances and novel insights. Trends Cell
Biol. 25, 308–315.
Xu, H., Su, C., Pearson, A., Mody, C.H., and Zheng, C. (2017). Herpes simplex
virus 1 UL24 abrogates the DNA sensing signal pathway by inhibiting NF-kB
activation. J. Virol. 91, e00025-17.
Yasukawa, K., Oshiumi, H., Takeda, M., Ishihara, N., Yanagi, Y., Seya, T.,
Kawabata, S., and Koshiba, T. (2009). Mitofusin 2 inhibits mitochondrial
antiviral signaling. Sci. Signal. 2, ra47.
Zachos, G., Clements, B., and Conner, J. (1999). Herpes simplex virus type 1
infection stimulates p38/c-Jun N-terminal mitogen-activated protein kinase
pathways and activates transcription factor AP-1. J. Biol. Chem. 274,
5097–5103.
Cell Host & Microbe 23, 254–265, February 14, 2018 265
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse monoclonal anti-NLRP3 (Cryo-2) Adipogen Cat# AG-20B-0014; RRID: AB_2490202
Mouse monoclonal anti-human-AIM2 (3B10) Adipogen Cat# AG-20B-0040; RRID: AB_2490245
Mouse monoclonal anti-Flag (M2) Sigma-Aldrich Cat# F1804; RRID: AB_262044
Mouse monoclonal anti-a-tubulin (DM1A) Sigma-Aldrich Cat# T9026; RRID: AB_477593
Mouse monoclonal anti-VP5 (3B6) Virusys Cat# HA018-100; RRID: AB_2713935
Mouse monoclonal anti-ICP8 (10A3) Chemicon Cat# MAB8672; RRID: AB_11211216
Mouse monoclonal anti-Myc (PL14) MBL Cat# M047-3; RRID: AB_591112
Rabbit polyclonal anti-HA MBL Cat# 561; RRID: AB_591839
Rabbit polyclonal anti-ASC Santa Cruz Cat# sc-22514-R
Biotechnology
Rabbit polyclonal anti-mouse-caspase-1 Santa Cruz Cat# sc-514; RRID: AB_2068895
Biotechnology
Rabbit polyclonal anti-human-IL-1b Abcam Cat# ab2105; RRID: AB_302842
Rabbit polyclonal anti-mouse-IL-1b Chemicon Cat# AB1413; RRID: AB_2124630
Rabbit polyclonal anti-VP23 CosmoBio Cat# CAC-CT-HSV-UL18
Rabbit monoclonal anti-human-caspase-1 Cell Signaling Cat# 3866S; RRID: AB_2069051
Technology
Rabbit monoclonal anti-mouse-AIM2 Cell Signaling Cat# 13095
Technology
Rabbit polyclonal anti-VP22 Tanaka et al., 2012 N/A
Armenian hamster monoclonal anti-mouse/rat-IL-1b eBioscience Cat# 14-7012-85; RRID: AB_468397
Armenian hamster monoclonal anti-mouse/rat-TNF-a eBioscience Cat# 14-7423-81; RRID: AB_468491
Rat monoclonal anti-mouse-IL-6 eBioscience Cat# 14-7061-81; RRID: AB_468422
Mouse monoclonal anti-human-IL-1b eBioscience Cat# 14-7018-85; RRID: AB_468401
Rat monoclonal anti-mouse-IL-18 MBL Cat# D047-3; RRID: AB_592016
Rabbit polyclonal biotin-anti-mouse-IL-1b eBioscience Cat# 13-7112-85; RRID: AB_466925
Rabbit polyclonal biotin-anti-mouse/rat-TNF-a eBioscience Cat# 13-7341-81; RRID: AB_466950
Rat monoclonal biotin-anti-mouse-IL-6 eBioscience Cat# 13-7062-81; RRID: AB_466910
Mouse monoclonal biotin-anti-human-IL-1b eBioscience Cat# 13-7016-85; RRID: AB_466895
Rat monoclonal biotin-anti-mouse-IL-18 MBL Cat# D048-6; RRID: AB_592012
Anti-mouse IgG, HRP-Linked F (ab’)2 fragment GE Healthcare Cat# NA9310; RRID: AB_772193
Anti-rabbit IgG, HRP-Linked F (ab’)2 Fragment GE Healthcare Cat# NA9340; RRID: AB_772191
Anti-mouse Alexa fluor-488-conjugated secondary antibody Invitrogen Cat# A11017; RRID: AB_2534084
Anti-rabbit Alexa fluor-546-conjugated secondary antibody Invitrogen Cat# A11071; RRID: AB_2534115
Anti-mouse Alexa fluor-546-conjugated secondary antibody Invitrogen Cat# A11018; RRID: AB_2534085
Anti-rabbit Alexa fluor-488-conjugated secondary antibody Invitrogen Cat# A11070; RRID: AB_2534114
Bacterial and Virus Strains
HSV-1 (F) Tanaka et al., 2012 N/A
HSV-1 DVP22 (YK451) Tanaka et al., 2012 N/A
HSV-1DVP22-repair (YK452) Tanaka et al., 2012 N/A
HSV-1/VP22(F) (YK460) This study N/A
PRV (Indiana) Laboratory of H. Ohtsuka N/A
Chemicals, Peptides, and Recombinant Proteins
Avidin-HRP eBioscience #Cat 18-4100-51
13 TMB ELISA substrate solution eBioscience #Cat 00-4201-56
(Continued on next page)

e1 Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Interferon Stimulatory DNA (ISD) Invivogen #Cat tlrl-isdn
cGAMP Invivogen #Cat tlrl-nacga
LPS Invivogen #Cat tlrl-eblps
poly(dA:dT)/LyoVec Invivogen #Cat tlrl-patc
ATP Sigma-Aldrich #Cat A6419
Polyethylenimine Max (PEI MAX) PSI #Cat 24765-1
HiPerFect transfection reagent QIAGEN #Cat 301705
Lipofectamine 2000 Invitrogen #Cat 11668019
poly(dA:dT) Sigma-Aldrich #Cat P0883
Critical Commercial Assays
mouse IFN-b ELISA Kit PBL #Cat 42400
Dual luciferase reporter assay system Promega #Cat E1910
Experimental Models: Cell Lines
Vero Laboratory of N/A
Bernard Roizman
L929 Laboratory of N/A
Akiko Iwasaki
J774.A1 Laboratory of N/A
Yasunobu Yoshikai
THP-1 Laboratory of N/A
Yusuke Yanagi
Rabbit skin cell Laboratory of N/A
Bernard Roizman
PLAT-gp Laboratory of N/A
Toshio Kitamura
293FT (derivative of HEK293 cell line) Invitrogen Cat# R700-07
Experimental Models: Organisms/Strains
Mouse: C57BL/6J The Jackson Laboratory JAX: 000664
(Charles River Japan)
Mouse: AIM2
/
: B6.129P2-Aim2Gt(CSG445)Byg/J The Jackson Laboratory JAX: 013144

/

Mouse: NLRP3 Martinon et al., 2006 N/A
Oligonucleotides
ICP27 qPCR forward: 50 -TCCGACAGCGATCTGGAC-30 FASMAC N/A
ICP27 qPCR reverse: 50 -TCCGACGAGGAACACTCC-30 FASMAC N/A
Murine IL-6 qPCR forward: 50 -TCTAATTCATATCTTC FASMAC N/A
AACCAAGAGG-30
Murine IL-6 qPCR reverse: 50 -TGGTCCTTAGCCACTCCTTC-30 FASMAC N/A
18 s rRNA qPCR forward: 50 -GCAATTATTCCCCATGAACG-30 FASMAC N/A
18 s rRNA qPCR reverse: 50 -GGGACTTAATCAACGCAAGC-30 FASMAC N/A
Universal ProbeLibrary Set, Human Roche Cat# 04683633001
For HSV-1/VP22(F) production forward: 50 -CCGCCGTCCGAA FASMAC N/A
CCCAGGCCTAATTGTCCGCGCATCCGACCCTAGCGTGTTC
GTGGAACCATGGACTACAAAGACGATGACGACAAGATGAC
CTAGGATGACGACGATAAGTAGGG-30
For HSV-1/VP22(F) production reverse: 50 -CTCGTACTCATCGC FASMAC N/A
GCGGAACCTCCCGCGGACCCGACTTCACGGAGCGGCGAGA
GGTCATCTTGTCGTCATCGTCTTTGTAGTCCATGGTTCCCAAC
CAATTAACCAATTCTGATTAG-30
Recombinant DNA
Plasmid: pCA7-NLRP3 Moriyama et al., 2016 N/A
Plasmid: pCA7-ASC Moriyama et al., 2016 N/A
(Continued on next page)

Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Plasmid: pCA7-pro-IL-1b Moriyama et al., 2016 N/A
Plasmid: pCA7-pro-caspase-1 Moriyama et al., 2016 N/A
Plasmid: pCA7-Flag-NLRP3 Moriyama et al., 2016 N/A
Plasmid: pCA7-AIM2 This study N/A
Plasmid: pCA7 Moriyama et al., 2016 N/A
Plasmid: pcDNA3.1-VP22 This study N/A
Plasmid: pcDNA3.1-EGFP This study N/A
Cosmid: pBC1007 Kawaguchi et al., 1997 N/A
Plasmid: pcDNA3.1-AIM2-Flag This study N/A
Plasmid: pcDNA3.1-AIM2-HIN-Flag This study N/A
Plasmid: pcDNA3.1-AIM2-pyrin-Flag This study N/A
Plasmid: pGEX4T-AIM2 This study N/A
Plasmid: pGEX4T-AIM2DHIN This study N/A
Plasmid: pGEX4T-AIM2Dpyrin This study N/A
Plasmid: pGEX4T-AIM2-pyrin This study N/A
Plasmid: pGEX4T-AIM2-HIN This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22 This study N/A
Plasmid: pFlag-CMV2-HSV-2/VP22 This study N/A
Plasmid: pFlag-CMV2-PRV/VP22 This study N/A
Plasmid: pFlag-CMV2-VZV/VP22 This study N/A
Bacmid: pYEbac356 Morimoto et al., 2009 N/A
Bacmid: pOka BAC Nagaike et al., 2004 N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(40-301) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(80-301) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(120-301) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(1-267) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(1-226) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(1-192) This study N/A
Plasmid: pFlag-CMV2-HSV-1/VP22(1-160) This study N/A
Plasmid: pMxs-puro-VP22 This study N/A
Plasmid: pMxs-puro-EGFP This study N/A
Plasmid: pcDNA3.1-STING-myc This study N/A
Plasmid: pcDNA3.1-3xHA-cGAS This study N/A
Plasmid: pcDNA3.1-Nterminal-3xHA Yasukawa et al., 2009 N/A
Plasmid: pMxs-puro Kato et al., 2009 N/A
Bacmid: pYEbac102 Tanaka et al., 2012 N/A
Software and Algorithms
Prism GraphPad Software https://www.graphpad.com
ZEN Carl Zeiss Microscopy https://www.zeiss.com/
microscopy/int/products/
microscope-software/zen-lite.html
Other
Dynabeads protein G Novex Cat# 2015-11

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yasushi
Kawaguchi (ykawagu@ims.u-tokyo.ac.jp).

e3 Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cells
Vero cells (obtained from laboratory of Bernard Roizman, species: African green monkey, gender: unknown) were cultured in
Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 5% calf serum (CS). PLAT-gp (obtained from laboratory of Toshio
Kitamura, species: human, gender: unknown), L929 (obtained from laboratory of Akiko Iwasaki, species: mouse, gender: unknown),
J774.A1 (obtained from laboratory of Yasunobu Yoshikai, species: mouse, gender: unknown) and 293FT (obtained from Invitrogen,
species: human, gender: unknown) cells were cultured in DMEM supplemented with 10% fetal calf serum (FCS). Rabbit skin
cells (obtained from laboratory of Bernard Roizman, species: rabbit, gender: unknown) were cultured in DMEM supplemented
with 5% FCS. Human monocytic THP-1 (obtained from laboratory of Yusuke Yanagi, species: human, gender: unknown) cells
were cultured in RPMI 1640 medium supplemented with 10% FCS and 2-mercaptoethanol (50 mM). To prepare BMMs, bone
marrow from the tibias and femurs of 5-to-12-wk-old, female mice were flushed with DMEM. The BMMs were cultured with
DMEM supplemented with 20% FCS and 30% L929 cell supernatant containing the macrophage colony-stimulating factor at
37 C for 5 d. For differentiation into adherent macrophage-like cells, THP-1 cells were treated with PMA (Sigma-Aldrich) (100 nM)
at 37 C for 3 h. All cells were incubated at 37 C with 5% CO2. Cells have not been authenticated.

Viruses
HSV-1 wild-type strain HSV-1(F) (Tanaka et al., 2012); recombinant virus strain HSV-1DVP22 (YK451) (Tanaka et al., 2012), in which
the UL49 gene encoding VP22 was disrupted by the insertion of a foreign gene cassette carrying a stop codon (TGA) just downstream
of the UL49 start codon, an I-SceI site, and a kanamycin resistance gene; recombinant virus strain HSV-1DVP22-repair (YK452)
(Tanaka et al., 2012), in which the foreign gene cassette inserted into the UL49 locus of YK451 was excised, were propagated in
Vero cells.

Mice
Age matched female 5-12 week old mice on C57BL/6 background were used in all experiments. AIM2
/
mice (Aim2Gt(CSG445)Byg,
JAX: 013144) were obtained from The Jackson Laboratory and were maintained in the Institute of Medical Science, The University
of Tokyo. NLRP3
/
mice (Martinon et al., 2006) were maintained in Graduate School of Medical and Dental Sciences, Tokyo Medical
and Dental University. Female C57BL/6 mice (JAX: 000664) purchased from Charles River were used as WT controls. AIM2
/
mice
and WT control mice were bred and maintained under conventional conditions. NLRP3
/
mice were bred and maintained under
specific pathogen-free conditions. All animal experiments were carried out in accordance with the Guidelines for Proper Conduct
of Animal Experiments of the Science Council of Japan. The protocol was approved by the Institutional Animal Care and Use
Committee, Institute of Medical Science, the University of Tokyo (IACUC protocol approvals 19-26, PA11-81, PH12-10,
PA27-113, PA15-62, and PM29-16), and Animal Care and Use Committee of Tokyo Medical and Dental University (A2017-022C2).

METHOD DETAILS

Plasmids
pCA7-NLRP3, pCA7-ASC, pCA7-pro-IL-1b, pCA7-pro-caspase-1, and pCA7-Flag-NLRP3 were described previously (Moriyama
et al., 2016). pCA7-AIM2 was constructed by amplifying the AIM2 ORF by PCR from cDNA synthesized from the total RNA of
LPS-stimulated THP-1 cells and cloning it into pCA7 (Moriyama et al., 2016). pcDNA3.1-VP22 and pcDNA3.1-EGFP were
constructed by amplifying their ORFs by PCR from pBC1007 (Kawaguchi et al., 1997) and pEGFPC1 (Clontech), respectively, and
cloning them into pcDNA3.1 (Invitrogen). To construct pcDNA3.1-AIM2-Flag, pcDNA3.1-AIM2-HIN-Flag and pcDNA3.1-AIM2-
pyrin-Flag encoding AIM2 codons 1-343, codons 144-343 and codons 1-107, respectively, fused to Flag at their C terminus,
each of the AIM2 domains was amplified by PCR from pCA7-AIM2 and cloned into pcDNA3.1. pGEX4T-AIM2, pGEX4T-AIM2DHIN,
pGEX4T-AIM2Dpyrin, pGEX4T-AIM2-pyrin and pGEX4T-AIM2-HIN were constructed by amplifying AIM2 codons 1-343, codons
1-143, codons 108-343, codons 1-107 and codons 144-343, respectively, by PCR from pCA7-AIM2 and cloning each into pGEX4T
(GE Healthcare). To construct pFlag-CMV2-HSV-1/VP22, pFlag-CMV2-HSV-2/VP22, pFlag-CMV2-PRV/VP22 and pFlag-CMV2-
VZV/VP22 expressing Flag-tagged VP22 homologs, their ORFs were amplified by PCR from the HSV-1 (F) genome, pYEbac356
(Morimoto et al., 2009), the PRV (Indiana) genome, and pOka BAC (a generous gift from Y. Mori) (Nagaike et al., 2004), respectively,
and cloned into pFlag-CMV2 (Sigma-Aldrich). pFlag-CMV2-HSV-1/VP22(40-301), pFlag-CMV2-HSV-1/VP22(80-301), pFlag-CMV2-
HSV-1/VP22(120-301), pFlag-CMV2-HSV-1/VP22(1-267), pFlag-CMV2-HSV-1/VP22(1-226), pFlag-CMV2-HSV-1/VP22(1-192) and
pFlag-CMV2-HSV-1/VP22(1-160) were constructed by amplifying VP22 codons 40-301, codons 80-301, codons 1-267, codons
1-226, codons 1-192 and codons 1-160 respectively, by PCR of pFlag-CMV2-HSV-1/VP22 and cloning each into pFlag-CMV2.
To construct pMxs-puro-VP22 and pMxs-puro-EGFP, the EcoRI-NotI fragments of pcDNA3.1-VP22 and pcDNA3.1-EGFP, respec-
tively, were inserted into pMxs-puro (Kato et al., 2009). pcDNA3.1-STING-myc was constructed by amplifying the STING ORF which
was fused to myc at their C terminus by PCR from cDNA synthesized from the total RNA of HEK293 cells and cloning it into pcDNA3.1.
pcDNA3.1-3xHA-cGAS was constructed by amplifying the cGAS ORF by PCR from cDNA cynthesized from the total RNA of THP-1
cells and cloning it into pcDNA3.1-Nterminal-3xHA in frame with 3xHA (Yasukawa et al., 2009).

Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018 e4

Generation of Recombinant HSV-1
To generate recombinant virus HSV-1/VP22(F) (YK460) expressing VP22 fused to a Flag-tag, a two-step Red-mediated mutagenesis
procedure was carried out using E. coli GS1783 containing pYEbac102, a full-length infectious HSV-1(F) clone, as described previ-
ously (Tanaka et al., 2012), except with primers 50 -CCGCCGTCCGAACCCAGGCCTAATTGTCCGCGCATCCGACCCTAG
CGTGTTCGTGGAACCATGGACTACAAAGACGATGACGACAAGATGACCTAGGATGACGACGATAAGTAGGG-3 0 and 50 -CTCGTAC
TCATCGCGCGGAACCTCCCGCGGACCCGACTTCACGGAGCGGCGAGAGGTCATCTTGTCGTCATCGTCTTTGTAGTCCATGGTTC
CCAACCAATTAACCAATTCTGATTAG- 30 were used and rabbit skin cells were transfected with pYEbac102 carrying the UL49 ORF
in frame with Flag-tag using calcium phosphate precipitation technique, as described previously (Kawaguchi et al., 1997). At 4 to
5 days post transfection, the transfected cells were harvested and subjected to freeze-thawing. Then cell lysates were inoculated
to Vero cells for propagations and obtained HSV-1/VP22(F).

Screening for HSV-1 Inhibitors of AIM2

DNAs and cDNAs encoding 73 HSV-1 proteins and EGFP tagged with Flag or MEF (Myc, the tobacco etch virus protease cleavage
site, and Flag) were cloned into expression plasmids by standard molecular biology techniques. 293FT cells in 24-well cluster plates
were transfected with pCA7-ASC (5 ng), pCA7-pro-caspase-1 (5 ng), and pCA7-pro-IL-1b (150 ng) in combination with pCA7-AIM2 or
pCA7-NLRP3 (30 ng), and an HSV-1 protein or EGFP expression plasmid (1 mg) using polyethylenimine (PEI) Max (PSI). Cell-free
supernatants were collected 24 h post-transfection and IL-1b levels were measured by enzyme-linked immunosorbent assays
(ELISA). The effect of each HSV-1 protein on IL-1b secretion was calculated relative to the effect of EGFP on IL-1b secretion (Fig-
ure S1A). The inhibitory effect of each HSV-1 protein on AIM2 inflammasome-mediated IL-1b secretion was then calculated relative
to that of NLRP3-mediated IL-1b secretion as shown in Figure 1. The results for HSV-1 proteins for which IL-1b secretion with NLRP3
and AIM2 were below 0.1 were excluded.

Inflammasome Reconstitution Assays

293FT cells in 24-well cluster plates, were transfected with pCA7-ASC (5 ng), pCA7-pro-caspase-1 (5 ng), pCA7-pro-IL-1b (150 ng),
in combination with pCA7-AIM2 or pCA7-NLRP3 (30 ng), and 300 ng pFLAG-CMV-2-EGFP or pFLAG-CMV-2-VP22 using PEI Max.
Cell-free supernatants were collected 24 h post-transfection, and IL-1b levels were measured by ELISA. To analyze the expression
level of the transfected plasmids, cell lysates were collected 24 h post-transfection and samples were analyzed by immunoblotting
with the indicated antibodies.

ELISA
Human-IL-1b, mouse-IL-1b, mouse-IL-18, mouse-IL-6 and mouse-TNF-a in the culture supernatants were quantitated by ELISA.
Nunc-Immuno plates (Thermo scientific) coated with the indicated capture antibodies were blocked with 2% FCS in PBS and cell
culture supernatant were added to the plates. The indicated biotin-conjugated detection antibodies, avidin-HRP (eBioscience)
and TMB solution (eBioscience) were further added to the plates and the captured cytokines were detected by a Perkin Elmer
EnSpire multimode plate reader.

Immunofluorescence
293FT cells cultured on 35-mm-diameter glass-bottom dishes (Matsunami) were transfected with pCA7-ASC (20 ng), pCA7-AIM2
(360 ng) or pCA7-Flag-NLRP3 (120 ng) together with 1.2 mg pcDNA3.1 VP22 or pcDNA3.1 (empty vector). At 24 h post-transfection,
cells were fixed with 4% formaldehyde in PBS, permeabilized with 0.1% Triton X-100 in PBS, blocked with 10% human serum
(Sigma-Aldrich) in PBS, reacted with indicated antibodies, reacted with anti-mouse Alexa fluor-488-conjugated and anti-
rabbit Alexa fluor-546-conjugated secondary antibodies (Invitrogen) and examined with a Zeiss LSM800 laser scanning confocal
microscope. To analyze the subcellular localization of AIM2 and its truncated mutants in the absence of ASC, 293FT cells cultured
on 35-mm-diameter glass-bottom dishes were transfected with 1 mg pcDNA3.1-AIM2-Flag, pcDNA3.1-AIM2-HIN-Flag, or
pcDNA3.1-AIM2-pyrin-Flag together with 1 mg pcDNA3.1-VP22, pcDNA3.1 EGFP or empty vector. At 24 h post-transfection, the
cells were fixed, permeabilized and stained with the indicated antibodies as described above except that anti-rabbit Alexa fluor-
488-conjugated and anti-mouse Alexa fluor-546-conjugated secondary antibodies (Invitrogen) were used as secondary antibodies.

Immunoblotting
Cell lysates were electrophoretically separated in denaturing gels, transferred to polyvinyldifluoride membranes (Millipore), blocked
with 5% skim milk in PBS containing 0.1% Tween 20 and reacted with each of the indicated primary antibodies, reacted with anti-
mouse or anti-rabbit IgG conjugated to horseradish peroxidase (GE Healthcare), and developed by using the ECL chemiluminescence
reagent (GE Healthcare).

Cell Lines Stably Expressing VP22

J774.A1 and THP-1 cells were transduced by infection with retrovirus-containing supernatants of Plat-GP cells that had been trans-
fected with pMxs-puro-VP22 or pMxs-puro in combination with pMDG and then selected with 2 mg puromycin/mL (J774.A1) or 0.5 mg
puromycin/mL (THP-1), which led to the isolation of J774/VP22, J774/Ct, THP-1/VP22 and THP-1/Ct cells. Vero cells were
transduced by infection with retrovirus-containing supernatants of Plat-GP cells that had been transfected with pMXs-VP22 or

e5 Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018

pMXs-EGFP in combination with pMDG and then selected with 5 mg puromycin/mL, which led to the isolation of Vero/VP22 and Vero/
EGFP cells, respectively.

Luciferase Assay
293FT cells in 24-well cluster plates were transfected with p125-luc (100 ng), phRL-TK (2.5 ng), pcDNA3.1-STING-myc (250 ng) and
pcDNA3.1-cGAS-HA (250 ng) together with pFLAG-CMV2-EGFP, pFLAG-CMV2-VP22 or pFLAG-CMV2-UL24. At 24 h after trans-
fection, firefly and Renilla luciferase activities were independently assayed using the dual luciferase reporter assay system (Promega)
according to the manufacturer’s instructions. Relative promoter activity was calculated as firefly luciferase activity/Renilla luciferase
activity.

Cell Stimulation
J774/VP22 and J774/Ct cells were treated with 1 mg LPS/mL for 6 h, and 2 mM ATP (Sigma-Aldrich) was then added and the cells
were incubated for an additional 4 h. Then, 10 mg poly(dA:dT)/LyoVec (Invivogen)/mL and 1 mg LPS/mL were added simultaneously to
the J774/VP22 and J774/Ct cells, and the cells were incubated for 18 h. LyoVec is a transfection reagent and therefore, the cells were
transfected with poly(dA:dT). Poly(dA:dT) was only introduced into J774/VP22 and J774/Ct cells by transfection using PEI Max in the
experiments in Figure S7D. THP-1/VP22 and THP-1/Ct cells were treated with 2.5 mg poly(dA:dT)/LyoVec/mL and 1 mg LPS/mL
simultaneously and the cells were incubated for 12 h. To analyze the secretion of IFN-b, J774/VP22 and J774/Ct cells were trans-
fected with 1 mg ISD (Invivogen)/mL using Lipofectamine 2000 (Invitrogen) or treated with 7 mM of cGAMP (Invivogen), and the cells
were incubated for 20 h.

Virus Infection
BMMs or J774.A1 cells in 24-well cluster plates were infected with each of the recombinant viruses in 100 mL 0.1% BSA in phosphate-
buffered saline (PBS) at an MOI of 3. After adsorption for 1 h at 37 C, the cell monolayers were overlaid with 300 mL DMEM
supplemented with 10% FCS. For LPS stimulation, BMMs were overlaid with 300 ml DMEM supplemented with 10% FCS containing
1 mg/mL of LPS (Invivogen) after adsorption.

Knockdown of AIM2 and NLRP3 Using siRNAs

PMA-differentiated THP-1 cells in 24-well cluster plates were transfected with 1.9 mg/mL of siRNAs targeting AIM2, NLRP3 and
nontargeting negative-control siRNA (GE Healthcare Dharmacon, Inc.) using HiPerFect Transfection Reagent (QIAGEN). At 48 h
post-transfection, cells were infected with the indicated viruses.

Virion Purification
Vero/VP22 and Vero/EGFP cells were infected with YK451 (DVP22) at an MOI of 0.05. At 48 h post-infection, cell culture supernatants
were harvested by low-speed centrifugation. The HSV-containing supernatant was centrifuged for 1 h at 87,300 3 g in an P28S rotor
(Hitachi). The pellet was resuspended in 1 mL of TBSal (200 mM NaCl, 2.6 mM KCl, 10 mM Tris-HCl [pH 7.5], 20 mM MgCl2, 1.8 mM
CaCl2), layered onto a 9 mL discontinuous sucrose gradient (30%, 40%, and 50%) in TBSal, and centrifuged for 2 h at 71,000 3 g in a
P40ST rotor (Hitachi). Aliquots of peak virion-containing fractions were pelleted by centrifugation for 2 h at 86,000 3 g in a P40ST rotor
(Hitachi).

Animal Studies
For intracranial infections, 5-to-7-wk-old female AIM2
/
or AIM2+/+ mice were injected intracranially with 105 PFU HSV-1DVP22
(YK451) or HSV-1DVP22-repair (YK452). At 4 d post-infection, the mice were sacrificed, and whole brains were removed, sonicated
in 1 mL of 199 medium containing 1% FCS and antibiotics. Viral titers in the supernatants obtained after centrifugation of the samples
were determined by standard plaque assays on Vero cells.

Immunoprecipitation
Infected and transfected cells were lysed in the NP-40 buffer containing the protease inhibitor cocktail. The supernatants obtained
after centrifugation of the cell lysates were precleared by incubation with protein Dynabeads protein G (Novex) at 4 C for 30 min and
then reacted with the indicated antibodies bound to Dynabeads protein G at 4 C for overnight. The beads were washed extensively
with NP-40 buffer, and analyzed by immunoblotting with the indicated antibodies.

GST Pull-Down Assays

293FT cells were transfected with pFLAG-CMV2-VP22 or each of its deletion mutants using PEI Max and harvested 48 h post-
transfection. Cells were then lysed in NP-40 buffer (120 mM NaCl, 50 mM Tris-HCl [pH 8.0], 0.5% NP-40, 50 mM NaF) containing
a proteinase inhibitor cocktail (Nacalai Tesque). GST and fusion proteins GST-AIM2DHIN, GST-AIM2Dpyrin, and GST-AIM2 were
expressed in E. coli that had been transformed with pGEX4T, pGEX4T-AIM2DHIN, pGEX4T-AIM2Dpyrin and pGEX4T-AIM2, respec-
tively, and purified using glutathione-Sepharose resin (GE Healthcare). The transfected cell lysates were precleared by incubation
with glutathione-Sepharose resin and then reacted with purified GST, GST-AIM2DHIN, GST-AIM2Dpyrin, GST-AIM2, GST-AIM2-HIN
or GST-AIM2-pyrin immobilized on glutathione-Sepharose resin for 2 h at 4 C. After extensive washing of the resin with NP-40 buffer,

Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018 e6

the resin was divided into two parts. One part was analyzed by immunoblotting with anti-Flag antibody and the other was electro-
phoretically separated in a denaturing gel and stained with Coomassie brilliant blue (CBB).

Sucrose Density Gradient Sedimentation

293FT cells cultured on 10 cm dishes were transfected with pCA7-AIM2 (6 mg) in combination with 6 mg pcDNA3.1 EGFP or pcDNA3.1
VP22 by PEI MAX. At 48 h post-transfection, cells were harvested, washed with PBS, resuspended in 0.15 M NaCl and homogenized
using a syringe with a 26G needle. Cell debris was cleared by centrifugation (500 3 g for 5 min at 4 C) and supernatants were layered
onto a 20%–50% (wt/wt) sucrose gradient (in 0.15M NaCl) and centrifuged at 220,000 3 g for 4 h at 4 C in a P40ST rotor (Hitachi).
After centrifugation, 0.75 mL fractions were collected from the top of each tube. Trichloroacetic acid (TCA) was added to each
fraction to a final concentration of 10% TCA and the fractions were incubated overnight at 4 C. Precipitated proteins were then
pelleted by centrifugation at 21,000 3 g for 20 min at 4 C, washed three times with ethanol, dried and analyzed by immunoblotting.
To analyze the oligomerization of endogenous AIM2, J774/Ct and J774/VP22 cells cultured on 10 cm dishes were transfected with
120 mg poly(dA-dT) using PEI MAX. At 2 h post-transfection, cells were harvested, washed, homogenized and fractionated as
described above.

QUANTIFICATION AND STATISTICAL ANALYSIS

Two-tailed Student’s t test were used for comparing data from single comparisons. One-way ANOVA or t test with Bonferroni
adjustments were performed on data for multiple comparisons. All statistical analysis was performed in Prism (GraphPad Software).
Data are presented as mean ± standard error. The statistical tests used and the number of biological replicates is indicated in each
figure legend. Statistical significance was defined as a p value of 0.05. No methods were used to determine whether the data meet
assumptions of the statistical approach.

e7 Cell Host & Microbe 23, 254–265.e1–e7, February 14, 2018