Research Journal of Biotechnology
10 (4) April (2015)
Bioprospecting for extracellular hydrolytic enzymes
from culturable thermotolerant bacteria isolated from
Manikaran thermal springs
Suman Archna*, Verma Priyank, Yadav Ajar Nath and Saxena Anil Kumar
Division of Microbiology, Indian Agricultural Research Institute, New Delhi- 110012, INDIA
*archsuman@yahoo.com
Abstract
Microbial enzymes play a major role in hydrolysis of
lignocellulosic compounds to fermentable sugars. In
order to isolate thermotolerant bacterial isolates in
Manikaran hot springs having potential to produce
extracellular hydrolytic enzymes were analyzed using
different nutrient combinations. Of 120 isolates,
twenty strains showed hydrolytic enzymes production
at >70 C. Phylogenetic analysis of positive strains,
based on 16S rDNA sequences indicated that isolates
were clustered within 48% Proteobacteria, 33%
Firmicutes and 19% Actinobacteria. Evaluation of
hydrolytic enzymes production under submerged and
solid state fermentation was done using paddy straw
as sole carbon source. Out of twenty, seven bacterial
isolates were found to be novel and efficient for the
production of hydrolytic enzymes.
A large variation was observed among different
isolates for hydrolytic enzymes production. Seven
isolates Lysinibacillus sp., Enterobacter cloacae,
Rhodococcus qingshengii, Paenibacillus pabuli,
Bacillus pumilus, Micrococcus indicus and
Pseudomonas fragi based on their maximum
production on all different temperature especially
70°C were evaluated in terms of enzyme properties
and kinetics. The enzyme of above seven isolates is
active over broad range of high temperature. Such
thermo stable isolates have potential to be used to
develop as consortia for bioconversion of
lignocellulosic residue to fermentable sugars
preferably at high temperature.
Keywords: Hydrolytic enzymes, Thermotolerant bacteria,
Manikaran, 16S rRNA gene.
Introduction
Cellulose is the most abundant and renewable biological
carbon resource on earth. In nature, cellulases from bacteria
and fungi hydrolyze crystalline cellulose into
oligosaccharides which are ultimately hydrolyzed into
glucose by the synergistic action of at least three types of
cellulolytic enzymes, namely, endo-1,4-b-D-glucanase,
cellobiohydrolases and β-glucosidase45 while hemicellulase
mainly includes xylan which is the second most abundant
natural polysaccharide on earth. Xylanase refers to a class
33
Vol.
Res. J. Biotech
of enzymes that specifically degrade xylan into
oligosaccharides and xylose5,9. Hydrolysis of xylan is
undoubtedly an important step toward proper utilization of
abundantly available lignocellulosic material in nature.
Xylan hydrolysis using enzymes such as xylanases
provides a viable alternative to chemical hydrolysis as it is
highly specific in nature apart from being an environment
friendly process20.
Cellulase and xylanase have been widely used in energy,
food, animal feed, medical, papermaking and textile
industries10. In all such industries thermostable enzymes
active at alkaline pH are of great importance. Exotic niches
such as thermal springs, harbor populations of
microorganisms can be source of commercially important
products like enzymes, sugars, compatible solutes and
antibiotics35,32. Thermal springs are manifestation of
geological activity and represent aquatic microcosms that
are produced by the emergence of geothermally heated
groundwater from the Earth’s crust. Prokaryotes are the
major component of most ecosystems, being ubiquitous in
nature because of their small size, easy dispersal, metabolic
versatility, ability to utilize a broad range of nutrients and
tolerance to unfavorable and extreme conditions. Thermal
springs are, therefore, no exception to colonization by
prokaryotes.
Diversity analysis of such extreme environments has grown
in significance because of their diverse and unusual
chemistry and the opportunity they provide to identify rare
compounds and genes19. In recent years, interest in
production of cellulases has increased due to thrust on
production of second generation biofuel from
lignocellulosic biomass. Besides their use for biofuel
production, cellulases are being used in textile industry for
cotton softening and denim finishing and in detergent
markets for colour care, cleaning and anti-redeposition in
washing powders8. Since then researchers worldwide have
focussed their attention toward newer microbial isolates,
the xylanases from which can be used in the pulp and paper
industries. The scientific interest in this field is reflected by
the number of research papers published during recent
years describing numerous xylanases from newer sources,
as well as bleaching experiments reported using various
hemicellulases, pulps and bleaching sequence.
The xylanases have been reported mainly from bacteria38,
fungi38, actinomycetes4 and yeast25. Bacteria, having high
growth rate as compared to fungi have a better potential to
replace later for commercial cellulase production. Although
Research Journal of Biotechnology
application of bacteria in producing cellulase is less
investigated, however cellulases produced by bacteria are
often more effective catalysts due to less feedback
inhibition.
The aim of the present study was to isolate thermotolerant
bacteria from the Manikaran thermal springs (≥95 °C) of
Himachal Pradesh, India. Sequencing of 16S rRNA gene of
representative thermotolerant strains was undertaken for
identification. Representative strain from each operational
taxonomical unit (OTUs) was screened in vitro for
hydrolytic enzymes at high temperature which included
production of xylanase and carboxymethylcellulase
(CMCase). Filter paperase (FPase) activity was determined
by using CMC and Whatmann no. 1 filter paper
respectively as substrate and measuring the amount of
reducing sugars. β-glucosidase activity was assayed by
measuring the amount of p-nitrophenol released from p-
nitrophenyl-β-D- glucopyranoside. Thermo tolerable
bacterial isolates may have some industrial applications of
microbial xylanolytic and cellulolytic enzymes.
Material and Methods
Sampling site and isolation of culturable thermotolerant
bacteria: Water and sediment samples of Manikaran
thermal spring (32° 01' 60 N: 77° 20' 60 E), Himachal
Pradesh in India, were collected in sterile thermal flasks for
isolation of thermotolerant bacteria. The temperature of the
thermal spring was between 90-95 °C. For enumeration and
isolation from water and sediments, the samples were
placed on five different media using a standard spread plate
technique and incubated at 45°C, 55°C and 65 °C for 2-3
days. The media used were nutrient agar (peptone 0.5 %,
beef extract 0.3 %, NaCl 0.5 % and agar 1.8 %), thermus
agar (peptone 0.5 %, yeast extract 0.2 %, beef extract 0.4
%, NaCl 0.5 % and agar 1.8 %), R2A medium (proteose
peptone 0.05 %, casamino acid 0.05 %, yeast extract 0.05
%, dextrose 0.05 %, soluble starch 0.05 %, dipotassium
hydrogen phosphate 0.03 %, sodium pyruvate 0.03 %,
magnesium sulfate heptahydrate 0.005 %), King’s B
medium (protease peptone 2 %, dipotassium hydrogen
phosphate 0.15 %, magnesium sulfate 0.15 % and agar 1.8
%) and Thermos peptone meat extract yeast extract
medium (TPMY: peptone 0.35 %, meat extract 0.5 % yeast
extract 0.2 % NaCl 0.15 % and agar 1.8 %).
After incubation, plates were constantly observed for the
appearance of bacterial colonies and the total viable count
was recorded for each sample in the different media
employed. Single colonies with distinct morphology were
selected from each of the plates. Based on differences in
colony morphologies, 120 morphotypes were picked up
from different plates. The cultures were maintained at 25 %
glycerol stocks at -80 °C for further use.
Screening of bacterial isolates for tolerance to
temperature: All the 120 bacterial isolates were screened
for tolerance to temperature (40 °C-80 °C). The bacterial
34
Vol. 10 (4) April (2015)
Res. J. Biotech
isolates were screened for temperatures using spot plate
technique as described earlier44. Cultures tolerant to 50 °C
were screened further by inoculating in broth and
incubating in a shaker at 150 rpm for 72 h at 60 °C, 70 °C
and 80 °C. The optical density of the broth was measured at
600 nm and compared with growth at 37 °C.
Qualitative screening of hydrolytic enzymes production:
All the isolates were screened for the presence of
lignocelluloses activity on Reese’s minimal media (RMM)
containing 1 % caboxymethylcellulose (CMC) and 1 %
xylanase40. The plates were incubated at 50 C for 48 h. To
visualize the hydrolysis zone, the plates were flooded with
an aqueous solution of 0.1 % Congo red for 15 m and
washed with 1 M NaCl. Hydrolyzing capacity index (HCI)
for all the isolates was calculated by dividing the diameter
of clear zone around colony with the bacterial colony
diameter. These isolates that showed the maximum activity
for the production of different hydrolytic enzymes were
selected for quantitative assay. The seven qualitative
positive isolates were cultured at different temperatures 45,
55 and 65 C with paddy straw as sole carbon source at pH
7.0± 0.2 for enzyme production in RMM supplemented to
solid state and submerged fermentation. Nutrient broth
cultures after 72 h of incubation period were subjected to
centrifugation at 10000 g for 15 min at 4 C. Supernatant
was collected and stored as crude enzyme preparation at
4C for further enzyme assays.
Submerged Fermentation: The standard semi-synthetic
submerged fermentation (SmF) Reese minimal medium33
was used in this work, 100 mL in 250 mL Erlenmeyer
flasks were sterilized at 120C for 20m (autoclave pressure:
0.14 MPa). Sterile paddy straw was added to the sterile
medium prior to inoculation. Fermentations were carried
out on an orbital shaker incubator (New Brunswick
Scientific).
Solid-state Fermentation: Solid-state fermentations (SSF)
were carried out in 250 ml Erlenmeyer flasks, in controlled
temperature chambers, at 45-65 C. The solid substrate
contained 15 g per 5 ml in flask: paddy straw and paddy
husk. Sterilization was done at 120C for 20m. The
moisture content was adjusted by addition of sterile water
prior to inoculation to 53 %. Three ml of the liquid shake
flask culture was used to inoculate the solid-substrate flask.
72 h old liquid shake flask cultures were used as inoculate
for all solid-state fermentations.
Enzyme extraction and enzyme assay: The amount of
cellular proteins was taken as an index of bacterial growth,
for this purpose, 5 ml of samples were withdrawn from the
cultures at regular intervals and centrifuged for 30 min at
12000 g. The separated cells were suspended in 1 ml of
NaOH (1 N) and incubated at 100 C for 10 m for cell
lysis. The cell debris was separated by centrifugation at
10000 g for 10 m and proteins in supernatant were
estimated by Lowry’s method using bovine serum albumin
Research Journal of Biotechnology
as the protein standard. The activities of hydrolytic
enzymes xylanase and carboxymethylcellulase (CMCase)
and filter paperase (FPase) activity were determined by
using CMC and Whatmann no. 1 filter paper respectively
as substrate14 and measuring the amount of reducing
sugars27 whereas β-glucosidase activity was assayed by
measuring the amount of p-nitrophenol released from p-
nitrophenyl-β-D- glucopyranoside.
One unit (IU) of enzyme activity was defined as the
amount of enzyme releasing 1 μmole of reducing sugar per
min. Based on the quantitative screening of isolates; seven
isolates were selected for further work. All substrates were
purchased from Sigma–Aldrich and filter papers from
grade 1 Whatmann and fluka respectively. All enzymatic
activities were determined at different temperature and
interval used for lignocellulosic hydrolysis.
Characterization of crude lignocelluloses of isolates and
thermal stability of enzymes: The optimum temperatures
were determined ranging from 45 to 65 C with 10 C
increments by conducting enzyme assays. The reducing
sugars released from lignocelluloses during the reactions
were measured by the DNS method27. The heat stability of
the enzyme was studied by both submerged and solid state
fermentation with paddy straw as supplemented substrate
for different time interval at temperatures ranging from 50
to 70 C. The residual activities were then measured by the
DNS method27.
PCR amplification of 16S rDNA and amplified rDNA
restriction analysis (ARDRA): The genomic DNA was
extracted as described earlier42. Primers pA
(5’AGAGTTTGATCCTGGCTCAG3’) and pH (5’AAGG
AGGTGATCCAGCCGCA3’) were used for the
amplification of 16S rDNA43. The amplification was
carried out in a 100 μL volume by mixing 50-90 ng
template DNA with the polymerase reaction buffer (10X);
100 μM (each) dATP, dCTP, dTTP and dGTP; primers pA
and pH (100 ng each) and 1.0 U Taq polymerase. The
amplification conditions were as follows: initial
denaturation of 5 min at 94 °C followed by 39 cycles of 40
s at 94 °C, 40 s at 50 °C and 1 m 30 s at 72 °C and a final
extension period of 10 minutes at 72 °C. After
amplification the PCR product was resolved by
electrophoresis in 1.2 % agarose gel in 1 X TAE buffer.
Gels were stained with ethidium bromide (10 mg ml–1) and
visualized on a gel documentation system (Alpha-Imager)
and gel images were digitalized.
Purified PCR products were digested separately with three
restriction endonucleases Alu I, Msp I and Hae III in a 30
μl reaction volume, using recommended buffers at 37 °C.
Restricted PCR products were resolved by electrophoresis
at 45 V for 1.5 to 2 h in 2.5 % agarose gels in 1X TAE
buffer for ARDRA. The numerical taxonomy analysis
program (NTYSIS) package (version 2.02e, Exeter
Software, Setauket, NY) was used to score similarity and
35
Vol. 10 (4) April (2015)
Res. J. Biotech
clustering analysis using the binary data. Jaccard’s
coefficient was used to calculate the similarity among the
isolates and dendrogram was constructed using the
UPGMA method29.
16S rDNA Sequencing and phylogenetic analysis: The
amplified PCR product 16S rDNA were purified with a
Quaquick purification kit (Qiagen). The DNA sequence
was double checked by sequencing both strands using
primers pA and pH for forward and reverse reaction
respectively. The nucleotide sequences were di-deoxy cycle
sequenced with fluorescent terminators (Big Dye, Applied
Biosystems) and run in 3130xl Applied Biosystems ABI
prism automated DNA sequencer. The partial 16S rDNA
sequences of the isolated strains were compared with those
available in the databases. Identification to the species level
was determined as a 16S rDNA sequence similarity of
≥99% with that of a prototype strain sequence in the
GenBank. The phylogenetic tree was constructed on the
aligned datasets using neighbor joining (NJ) method using
the program MEGA 4.0.239. Bootstrap analysis was
performed as described by Felsenstein13. The sequences
were submitted to GenBank and the accession numbers
were assigned for isolates.
Statistical analysis of data using SPSS software: The
quantitative data obtained from the enzymatic activities
were used as the basis of numerical analyses. Principal
component analyses (PCA) of the enzymatic activities
profiles were carried out using the SPSS Software.
Kinetic characterization of Celluloses: To determine the
kinetics celluloses hydrolysis, two promising strains (IARI-
M-20 and IARI-M-10) were grown at 70 °C in 100 ml of
medium containing cellulose (0.5 g/l) and the cellulase
enzyme assays were carried out from 15 and 30 day old
cultures. The kinetics of cellulase enzymes were
characterized in terms of Michaelis-Menten kinetic
constants (Km and Vmax) using the Lineweaver-Burk
plots25 by assaying the enzymes at cellulase concentrations
ranging from 1.25 to 226 mg/ml.
Activity of the enzyme on various lignocellulosic
substrates: The substrate specificity of the crude enzyme
was determined by performing the assay with different
temperatures; 45 °C, 55 °C and 65 °C with paddy straw.
The Xylanase and Cellulose (FPase, CMCase and β-
glucosidase) activity of the enzyme was determined using
DNS method27 in 50 mM citrate-phosphate buffer (pH 6.5)
containing 1 % (w/v) of each substrate. The reactions were
conducted with paddy straw after 15 and 30 days interval.
All assay results were expressed as units per gram of initial
dry carbon sources.
Results and Discussion
Enumeration and isolation of culturable bacteria: The
population of aerobic heterotrophic bacteria in the water
and sediment samples of Manikaran thermal springs ranged
Research Journal of Biotechnology
from 9.1×105 to 2.6×106 cfu ml-1 of water and 3.3×104 to
1.7×105 cfu g-1 of sediment. Among the media used, the
highest population of 2.6×106 cfu/ml was recorded on
nutrient agar medium. A total of 120 isolates was selected
based on colony morphology among which 67 isolates
were from nutrient agar medium, 17 from thermus agar
medium, 10 from Kings’B medium and 13 each from
TPMY and R2A media (Table 1).
Tolerance of isolates to temperature: All 120 isolates
were screened for temperature tolerance of which 95
isolates were found to tolerate 50°C and 20 isolates could
tolerate 70 °C while 7 isolates could tolerate >80 °C.
Isolates was found to be most high temperature tolerant,
exhibiting more than 70 % growth when compared to its
growth at 37 °C. Evaluation of temperature tolerance of the
isolates revealed that only 7 isolates were thermotolerant to
>80 °C. These isolates were termed as high temperature
tolerant (HTT).
Screening of HTT bacterial isolates for cellulase
activity: A total of 20 HTT bacterial morphotypes were
screened for cellulase activity. Out of 20 HTT isolates, only
13 isolates showed clear halo zone around the colony on
CMC agar and 11 isolates on xylanase agar while only 7
isolates showed both cellulase and xylanase activity. The
HCI of each positive isolate was calculated and it was
observed that hydrolyzing capacity index of IARI-M-20
was highest followed by IARI-M-2, IARI-M-3, IARI-M-9,
IARI-M-10, IARI-M-14 and IARI-M-17 (Fig. 1).
Effect of temperature on activity and stability of
lignocelluloses: Out of 20 HTT isolates, lignocelluloses
producer seven HTT isolates were selected for quantitative
estimation for hydrolytic enzyme production. These seven
lignocellulase producer HTT isolates were analyzed at
different temperatures 50, 60 and 70 C with paddy straw
as sole carbon source18 at pH 7.0± 0.2 for enzyme
production in RMM supplemented with both solid and
submerged fermentation. IARI-M-20 was found to be the
best cellulase producer at 70 C with highest CMCase
activity (198 IUmg/g), FPase (145 IU/ml) and β-
glucosidase activity (80 IU/ml) while IARI-M-10 was best
xylanase producer with highest activity of 136 IU/ml
respectively with submerged fermentation (Fig 2a-d).
Among different temperatures tested, 70 C was found to
be the optimum temperature for production of CMCase,
FPase, β-glucosidase and xylanase by all HTT isolates.
However, IARI-M-20 was found to produce appreciable
amount of cellulase while IARI-M-10 was xylanase on
substrate paddy straw as well. The results also indicated
that all isolates less β-glucosidase activity (Fig 1). IARI-M-
20 and IARI-M-10 when grown at 70°C gave high activity
and stability of cellulase and xylanase enzymes.
Optimization of fermentation medium for lignocellulase
production: Regarding to the fact that cellulase and
36
Vol. 10 (4) April (2015)
Res. J. Biotech
xylanase categorized as an important industrial enzyme, it
can be produced successfully by SmF and SSF28. Time
course experiments indicated that the enzyme production
reached to maximum after 15 days of SmF in the presence
of paddy straw best substrate for enzyme production,
displaying the maximum enzyme activity equal to 205.415
IU/ml, closely followed by SSF which results in enzyme
activity equal to 200.321 IU/ml after 30 days fermentation
(Fig. 3a-d). In our study, IARI M-20 and IARI-M-10, when
grown by SmF, had greater catalytic affinity for cellulases
secreted by these two isolates could be categorized as
endoglucanases as they showed lower exoglucanase
activity. Our results show that SmF is the best fermentation
for production of lignocellulase. It was also observed that
on SSF, all isolates gave lower CMCase, FPase, β-
glucosidase and xylanase activity which might be due to
high temperatures.
During the growth phase of these isolates, protein content
was very low at 30 °C (data not shown) as compared to
protein content on 70 °C. This reveals that isolates could
degrade substrate paddy straw efficiently for their biomass
production. In the current study, paddy straw was found to
be a good carbon source for production of cellulase and
xylanase. There are reports on cellulose degradation by
different bacteria22, however these studies utilized either
purified cellulases or optimized-medium conditions to
assay the cellulase activities23, Our data on FPase, CMCase
and β-glucosidase activities from IARI-M-20 and xylanase
activity from IARI-M-10 was generated from crude culture
supernatants and under optimized fermentation conditions.
16S rRNA gene sequencing and phylogenetic analysis:
16S rRNA gene sequencing and phylogenetic analysis of a
representative isolate from each cluster revealed that all the
isolates showed >97 to 100% similarity with the sequences
within the GenBank (Table 2). A phylogenetic tree was
constructed using twenty isolates along with the closest
sequences in the NCBI GenBank. It also shows that isolates
were phylogenetically clustered within Actinobacteria,
Firmicutes and Proteobacteria (Fig. 4). The closest
phylogenetic neighbors according to the 16S rDNA
sequence data for the seven isolates IARI-M-2, IARI-M-3,
IARI-M-9, IARI-M-10, IARI-M-14, IARI-M-17 and IARI-
M-20 were Lysinibacillus sp., Enterobacter cloacae,
Rhodococcus qingshengii, Paenibacillus pabuli, Bacillus
pumilus, Micrococcus indicus and Pseudomonas fragi
respectively.
Statistical analysis of data using SPSS software: The
data analysis of two different variables (temperature and
days), three replications, seven microbial cultures (IARI-
M-2, IARI-M-3, IARI-M-9, IARI-M-10, IARI-M-14,
IARI-M-17 and IARI-M-20) and 4 different hydrolytic
enzymes (xylanase, CMcase, Fpase and cellobiase) is
analyzed by principal component analysis (PCA). Principal
component I represents maximum activity of enzymes
hence termed as nature of enzymes. The Component II
Research Journal of Biotechnology
represents abiotic factors, the component III represents
microbial cultures hence termed as biotic factors and
component IV represents stability of the experiment (Fig.
5). Nature of enzymes (component I) explains 41 %
variation in data and represents variables viz. xylanase
0.792, CMCase 0.936 and Fpase 0.929. Abiotic factors
(component II) representing days 0.662 and temperature
0.707, explained 24% variation in data. Biotic factors
(component III) represented 12% variation in microbial
cultures 0.736. Principal component IV explained the
stability of replicated data 0.947 and 7 % variation of the
experiment.
Kinetic characterization of cellulases: Km and Vmax values
for the two isolates were calculated using Line weaver-
Burk plots. In case of IARI-M-20, the Km and Vmax values
at optimum temperature 70 °C were 4.13 mg/ml and 0.76
U/ml respectively while for IARI-M-10 they were 2.08
mg/ml and 1.07 U/ml respectively. Higher Km values
reflect lower affinity between temperature and enzyme
indicating that the high temperature IARI-M-20 had lower
affinity for enzyme compared to the IARI-M-10 enzyme. In
our study, the Km for substrate was determined by assaying
the crude lignocelluloses from a cell-free culture
supernatant. Literature suggests that the kinetic behavior of
lignocelluloses might be affected in the presence of other
proteins (or other substances) in the medium6.
Effect of temperature and time interval on enzyme
activity: Both isolates IARI-M-20 and IARI-M-10
produced maximum lignocellulase activity at 70 °C and the
enzyme activity indicated a steady linear decrease
thereafter. The highest cellulase activity of IARI-M-20 and
xylanase activity IARI-M-10 was observed to be at 70 °C
after 15 days interval respectively (Fig.4b). IARI-M-20
retained about 90 % of activity at 70 °C. Thermal stability
curve indicates that the enzyme of both isolates was stable
at 30, 40 and 50°C but enzyme activity of isolate IARI-M-
20 increasing sharply after 60°C whereas IARI-M-20
retained about 90 %, 80 % and 20 % of activity at 70 °C,
60 °C and 50 °C respectively (Fig. 4c).
However, this may be an indication of the thermophillic
nature of the cellulases. Thermophilic cellulases are
required for many industrial applications and only a few
reports on themophilic cellulases from mesophilic
organisms are available till date. In addition, thermal
stability is another important characteristic of industrial
enzymes. The crude cellulase of Bacillus sp. had lower
thermal stability than cellulase of Pseudomonas fragi
which might be due to high temperature. Few thermophilic
cellulases with high thermal stability have been isolated
from bacilli and Pseudomonas related genera.
Thermal springs represent extreme niches whose pristine
quality is maintained over a period of time. The terrestrial
hot springs that exist on Earth41 represent hot spots for
37
Vol. 10 (4) April (2015)
Res. J. Biotech
unusual forms of life, genes and metabolites. In the last two
decades, a number of researchers have investigated various
facets of the bacterial diversity in hot springs of different
parts of world16,21,26. Microbial hemicelluloses productions
have important applications in the biodegradation of
hemicelluloses. Thermo stable enzymes active at alkaline
pH are of significant importance in paper and pulp
industry17. Thermal springs represent extreme niches that
have maintained some degree of pristine quality and their
biotechnological potential has remained unrealized.
In the last one-decade, several attempts have been made for
phylogenetic characterization of micro flora from thermal
springs in different parts of the world11,34,36. There are
reports of isolation of hemicellulose degrading alkali
tolerant thermophiles from the hot springs in Bulgaria12 and
Portugal3. Manikaran thermal springs located in Himachal
Pradesh, India are famous for its hot water springs where
the temperature is near boiling. It was pertinent to isolate
thermo tolerant hemicellulolytic bacteria from these springs
as they have earlier been reported to be a good source of
thermotolernat amylolytic bacteria37.
Sixty percent of the isolates described in present study
belong to Bacilli while thirty percent belong to
Pseudomonas. Many workers have described the bacterial
genetic diversity from different ecological niches but to our
knowledge no earlier study had listed such a diverse group
of lignocellulase producing bacteria from high
temperatures. This observation is in agreement with Kim18
who had reported that an endoglucanase from Bacillus
circulans had highest activity with CMC as substrate.
There are reports on cellulose degradation by different
bacteria; however these studies utilized either purified
cellulases or optimized-medium conditions to assay the
cellulase activities. Maximum cellulase activity (0.26
U/ml) was detected in a Bacillus sp. when the culture was
grown in CMC supplemented Luria broth which is lower
that the values reported in this study.
Apart from this, many Bacillus derived genera like
Brevibacillus, Aneurinibacillus and Lysinibacillus were
also recorded. Gram positive prokaryotes, especially the
Firmicutes and Actinobacteria, are known to be
comparatively stress resistant, besides being long range
migrants7. Because of their temperature tolerance, which is
an inherent trait also attributed to this genus,1 the genus
Bacillus and its related genera have been explored
extensively for their applications in industry and
agriculture, especially as a source of hydrolytic enzymes.
The members of this genus are spore formers and also
produce a number of biocidal metabolites/enzymes which
make them a common inhabitant of diverse extreme
habitats30.
Research Journal of Biotechnology Vol. 10 (4) April (2015)
Res. J. Biotech
Table 1
Total viable count of bacteria isolated from Manikaran hot spring of India
Samples Total viable count (cfu g-1 sediment or ml-1 water × 106) on different media
NA KB T3A R2A TPYM
S-1 3.3 1.6 2.7 1.7 2.1
S-2 2.3 2.8 2.3 1.9 1.8
W-1 9.1 5.4 3.4 2.6 4.3
W-2 8.3 4.8 4.1 3.8 2.9
M# 67 12 17 13 11
#,Total morphotypes of thermotolerant bacteria from Manikaran hot spring

Table 2
Identification and characterization of the bacterial isolates from Manikaran hot spring of India
Strain Accession Nearest phylogenetic Temperature Xylanolytic Cellulolytic
number Number relative tolerance activity activity
IARI-M-1 KF054976 Klebsiella sp. 70 oC + -
IARI-M-2 KF054977 Lysinibacillus sp. 70 oC + +
IARI-M-3 KF054978 Enterobacter cloacae 70 oC + +
IARI-M-4 JF343224 Exiguobacterium indicum 70 oC + -
o
IARI-M-5 JF343225 Stenotrophomonas 70 C + -
maltophilia
IARI-M-6 JF343226 Acinetobacter baumannii 50 oC - -
IARI-M-7 JF343227 Acinetobacter baumannii 50 oC + -
IARI-M-8 JF343228 Acinetobacter sp. 50 oC + -
IARI-M-9 JF343229 Rhodococcus qingshengii 70 oC + +
IARI-M-10 JF343230 Paenibacillus pabuli 50 oC + +
o
IARI-M-11 JF343231 Acinetobacter baumannii 50 C - +
IARI-M-12 KF054979 Bacillus licheniformis 50 oC - +
IARI-M-13 JF343232 Microbacterium oxydans 70 oC - +
IARI-M-14 KF054980 Bacillus pumilus 50 oC + +
IARI-M-15 JF343233 Bacillus subtilis 50 oC - -
IARI-M-16 JF343234 Rhodococcus qingshengii 70 oC - +
IARI-M-17 KF054981 Micrococcus indicus 50 oC + +
o
IARI-M-18 JF343235 Paenibacillus tylopili 70 C - -
IARI-M-19 JF343236 Pseudomonas reactans 70 oC + -
IARI-M-20 JF343237 Pseudomonas fragi 70 oC + +

Fig. 1: Hydrolyzing capacity index of the bacterial isolates on 70°C for the enzyme lignocellulase.

38
Research Journal of Biotechnology Vol. 10 (4) April (2015)
Res. J. Biotech

Fig. 2: Quantitatively production of hydrolytic enzymes of thermotolerant bacterial isolates in solid state
fermentation (a) Xylanase (b) CMCase (c) Cellobiase (d) FPase.

Fig. 3: Quantitatively production of hydrolytic enzymes of thermotolerant bacterial isolates in submerged

fermentation (a) Xylanase (b) CMCase (c) Cellobiase (d) FPase.

39
Research Journal of Biotechnology Vol. 10 (4) April (2015)
Res. J. Biotech

Fig. 4: Phylogenetic tree showing the relationship among 20 thermotolerant bacteria isolates, 16S rRNA gene
sequences with reference sequences obtained through BLAST analysis. The sequence alignment was performed using
the CLUSTAL W program and trees were constructed using Neighbor Joining with algorithm using MEGA4
software. The tree was rooted using Sphingobacterium sp. as the out group.

Fig. 5: Principal component analyses (PCA) of the enzymatic activities profiles were carried out
using the SPSS Software.

Enough evidence from recent studies has accumulated Amphibacillus, Virgibacillus, Alicyclobacillus,
based on the data of 16S rRNA gene sequence analysis for Paenibacillus, Halobacillus and Geobacillus2. This
the reclassification of thermophilic bacteria in the genus supports the presence of genera Brevibacillus and
Bacillus into Brevibacillus, Aneurinibacillus, Aneurinibacillus in the hot springs in our study. The

40
Research Journal of Biotechnology
presence of genera like Micrococcus, Microbacterium,
Staphylococcus, Kocuria and Exiguobacterium as thermo
resistant aquatic bacteria in our investigation is supported
by the work7. Phylogenetic analyses of bacterial
communities in hot springs from low and high elevations of
the Tibetan peninsula revealed no significant influence of
elevation on diversity15. This illustrates the predominance
of Bacillus as an aggressive colonizer of high temperature
habitats of the world.
Conclusion
The most promising cultures were identified as
Painibacillus pabuli IARI-M-10, Pseudomonas fragi IARI-
M-20 and Rhodococcus globules IARI-M-9. Preliminary
analysis of samples taken after 15 days of paddy straw
decomposition by submerged and solid state fermentation
under laboratory conditions revealed that maximum loss of
dry matter was achieved when inoculation was made with
mixed cultures of bacteria. Therefore, the consortium with
all the seven bacterial cultures was used for composting of
paddy straw. There was not much variation in the cellulose
content of paddy straw but lignin content of latter was
almost three times to that of former. Hemicellulose content
of submerged paddy straw was almost double to that of
solid state paddy straw. Therefore, it was used as a carbon
source in some treatments.
Acknowledgement
The authors are grateful to the Division of Microbiology,
Indian Agricultural Research Institute (IARI), New Delhi
and National Agricultural Innovation Project (NAIP),
Indian Council of Agricultural Research for providing the
facilities and financial support, to undertake the
investigations.
Reference
1. Archana A. and Satyanarayana T., Purification and
characterization of a cellulase-free xylanase of a moderate
thermophile Bacillus licheniformis A99, World J. Microbiol.
Biotechnol., 19, 53 (2003)
2. Bae S. S., Lee J. H. and Kim S. J., Bacillus alveayuensis sp.
nov., a thermophilic bacterium isolated from deep-sea sediments
of the Ayu Trough, Int. J. Syst. Evol. Microbiol., 55, 1211 (2005)
3. Bataillon M., Cardinali A. P. and Duchiron F., Production of
xylanases from a newly isolated alkalophilic thermophilic
Bacillus sp., Biotechnol. Lett., 20, 1067 (1998)
4. Beg Q., Bhushan B., Kapoor M. and Hoondal G., Production
and characterization of thermostable xylanase and pectinase from
Streptomyces sp. QG-11-3, J. Ind. Microbiol. Biotechnol., 24, 396
(2000)
5. Beg Q., Kapoor M., Mahajan L. and Hoondal G., Microbial
xylanases and their industrial applications, a review, Appl.
Microbiol. and Biotechnol., 56, 326 (2001)
41
Vol. 10 (4) April (2015)
Res. J. Biotech
6. Cascalheira J. F. and Queiroz J. A., Kinetic study of the
cellobiase activity of Trichoderma reesei cellulase complex at
high substrate concentrations, Biotechnol. Lett., 21, 651 (1999)
7. Cerritos R., Eguiarte L. E., Avitia M., Siefert J., Travisano
M., Rodríguez-Verdugo A. and Souza V., Diversity of culturable
thermo-resistant aquatic bacteria along an environmental gradient
in Cuatro Ciénegas, Coahuila, México, Antonie Van
Leeuwenhoek, 99, 303 (2011)
8. Cherry J. R. and Fidantsef A. L., Directed evolution of
industrial enzymes: an update, Curr. Opin. Biotechnol., 14, 438
(2003)
9. Collins T., Gerday C. and Feller G., Xylanases, xylanase
families and extremophilic xylanases, FEMS Microbiol. Rev., 29,
3 (2005)
10. Demain A. L., Newcomb M. and Wu J. D., Cellulase,
clostridia and ethanol, Microbiol. Mol. Biol. Rev., 69, 124 (2005)
11. Derekova A., Sjoholm C., Mandeva R. and Kambourova M.,
Anoxybacillus rupiensis sp. nov., a novel thermophilic bacterium
isolated from Rupi basin (Bulgaria), Extremophiles, 11, 577
(2007)
12. Dimitrov P. L., Kambourova M. S., Mandeva R. D. and
Emanuilova E. I., Isolation and characterization of xylan‐
degrading alkali‐tolerant thermophiles, FEMS Microbiol. Lett.,
157, 27 (1997)
13. Felsenstein J., Phylogenies and the comparative method,
American Naturalist, 125, 1 (1985)
14. Ghose T., Measurement of cellulase activities, Pure Appl.
Chem., 59, 257 (1987)
15. Huang Q., Dong C. Z., Dong R. M., Jiang H., Wang S.,
Wang G., Fang B., Ding X., Niu L. and Li X., Archaeal and
bacterial diversity in hot springs on the Tibetan Plateau, China,
Extremophiles, 15, 549 (2011)
16. Kanokratana P., Chanapan S., Pootanakit K. and
Eurwilaichitr L., Diversity and abundance of Bacteria and
Archaea in the Bor Khlueng hot spring in Thailand, J. Basic
Microbiol., 44, 430 (2004)
17. Khandeparkar R. and Bhosle N., Isolation, purification and
characterization of the xylanase produced by Arthrobacter sp.
MTCC 5214 when grown in solid-state fermentation, Enzyme
Microb. Technol., 39, 732 (2006)
18. Kim C.H., Characterization and substrate specificity of an
endo-beta-1, 4-D-glucanase I (Avicelase I) from an extracellular
multienzyme complex of Bacillus circulans, Appl. Env.
Microbiol., 61, 959 (1995)
19. Kuddus M. and Ramteke P. W., Recent developments in
production and biotechnological applications of cold-active
microbial proteases, Crit. Rev. Microbiol, 38, 330 (2012)
20. Kuhad R. C., Singh A. and Eriksson K. E. L.,
Microorganisms and enzymes involved in the degradation of
Research Journal of Biotechnology
plant fiber cell walls, In Biotechnology in the pulp and paper
industry, Springer, 45 (1997)
21. Kumar M., Yadav A. N., Tiwari R., Prasanna R. and Saxena
A. K., Deciphering the diversity of culturable thermotolerant
bacteria from Manikaran hot springs, Ann. Microbiol., 64, 741
(2014)
22. Lee Y. J., Kim B. K., Lee B. H., Jo K. I., Lee N. K., Chung
C. H., Lee Y. C. and Lee J. W., Purification and characterization
of cellulase produced by Bacillus amyoliquefaciens DL-3
utilizing rice hull, Bioresour. Technol., 99, 378 (2008)
23. Li W., Zhang W. W., Yang M. M. and Chen Y. L., Cloning
of the thermostable cellulase gene from newly isolated Bacillus
subtilis and its expression in Escherichia coli, Mol. Biotechnol.,
40, 195 (2008)
24. Lineweaver H. and Burk D., The determination of enzyme
dissociation constants, J. American Chem. Soc., 56, 658 (1934)
25. Liu W., Zhu W., Lu Y., Kong J. and Ma G., Production,
partial purification and characterization of xylanase from
Trichosporon cutaneum SL409, Process Biochem., 33, 331
(1998)
26. Meyer‐Dombard D., Shock E. and Amend J., Archaeal and
bacterial communities in geochemically diverse hot springs of
Yellowstone National Park, USA, Geobiology, 3, 211 (2005)
27. Miller G. L., Use of dinitrosalicylic acid reagent for
determination of reducing sugar, Analytical chem., 31, 426 (1959)
28. Muthezhilan R., Ashok R. and Jayalakshmi S., Production
and optimization of thermostable alkaline xylanase by
Penicillium oxalicum in solid state fermentation, African J.
Microbiol. Res., 1, 20 (2007)
29. Nei M. and Li W. H., Mathematical model for studying
genetic variation in terms of restriction endonucleases, Proc. Nat.
Acad. Sci., 76, 5269 (1979)
30. Nicholson W. L., Munakata N., Horneck G., Melosh H. J.
and Setlow P., Resistance of Bacillus endospores to extreme
terrestrial and extraterrestrial environments, Microbiol. Mol. Biol.
Rev., 64, 548 (2000)
31. Pagaling E., Grant W. D., Cowan D. A., Jones B. E., Ma Y.,
Ventosa A. and Heaphy S., Bacterial and archaeal diversity in
two hot spring microbial mats from the geothermal region of
Tengchong, China, Extremophiles, 16, 607 (2012)
32. Pandey S., Singh S., Yadav A. N., Nain L. and Saxena A. K.,
Phylogenetic diversity and characterization of novel and efficient
cellulase producing bacterial isolates from various extreme
environments, Biosci. Biotechnol. Biochem., 77, 1474 (2013)
33. Reese E. T., Enzymatic hydrolysis of cellulose, Appl.
Microbiol., 4, 39 (1956)
42
Vol. 10 (4) April (2015)
Res. J. Biotech
34. Reysenbach A. L., Banta A. B., Boone D. R., Cary S. C. and
Luther G. W., Biogeochemistry, microbial essentials at
hydrothermal vents, Nature, 404, 835 (2000)
35. Satyanarayana T., Raghukumar C. and Shivaji S.,
Extremophilic microbes, Diversity and perspectives, Curr. Sci.,
89, 78 (2005)
36. Skirnisdottir S., Hreggvidsson G. O., Hjorleifsdottir S.,
Marteinsson V. T., Petursdottir S. K., Holst O. and Kristjansson J.
K., Influence of sulfide and temperature on species composition
and community structure of hot spring microbial mats, Appl.
Environ. Microbiol., 66, 2835 (2000)
37. Sodhi H. K., Sharma K., Gupta J. K. and Soni S. K.,
Production of a thermostable α-amylase from Bacillus sp. PS-7
by solid state fermentation and its synergistic use in the
hydrolysis of malt starch for alcohol production, Process
Biochem., 40, 525 (2005)
38. Sunna A. and Antranikian G., Xylanolytic enzymes from
fungi and bacteria, Cri. Rev. Biotechnol., 17(1), 39-67 (1997)
39. Tamura K., Dudley J., Nei M. and Kumar S., MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) Software
Version 4.0, Mol. Biol. Evol, 24, 1596 (2007)
40. Teather R. M. and Wood P. J., Use of Congo red-
polysaccharide interactions in enumeration and characterization
of cellulolytic bacteria from the bovine rumen, Appl. Environ.
Microbiol., 43, 777 (1982)
41. Tobler D. J. and Benning L. G., Bacterial diversity in five
Icelandic geothermal waters, temperature and sinter growth rate
effects, Extremophiles, 15, 473 (2011)
42. Verma P., Yadav A. N., Kazy S. K., Saxena A. K. and
Suman A., Elucidating the diversity and plant growth promoting
attributes of wheat (Triticum aestivum) associated acidotolerant
bacteria from southern hills zone of India, Natl. J. Life Sci., 10,
219 (2013)
43. Verma P., Yadav A. N., Kazy S. K., Saxena A. K. and
Suman A., Evaluating the diversity and phylogeny of plant
growth promoting bacteria associated with wheat (Triticum
aestivum) growing in central zone of India, Int. J. Curr.
Microbiol. App. Sci., 3, 432 (2014)
44. Yadav A. N., Verma P., Kumar M., Pal K. K., Dey R., Gupta
A., Padaria J. C., Gujar G. T., Kumar S., Suman A., Prasanna R.
and Saxena A. K., Diversity and phylogenetic profiling of niche-
specific Bacilli from extreme environments of India, Ann.
Microbiol., doi:10.1007/s13213-014-0897-9 (2014)
45. Zhang Y. H. P. and Lynd L. R., Toward an aggregated
understanding of enzymatic hydrolysis of cellulose,
noncomplexed cellulase systems, Biotechnol. Bioeng., 88, 797
(2004).
(Received 27th May 2014, revised 15th October 2014,
accepted 20th January 2015)