Sie sind auf Seite 1von 3

>SarculCOI JX987057.

1 Sarcophaga cultellata isolate A2 cytochrome oxidase subunit I


(COI) gene, partial cds; mitochondrial
AACTTTATATTTTATCTTCGGAGCTTGAGCAGGAATAGTAGGAACTTCACTAAGAATTCTTATTCGAGCA
GAATTAGGTCATCCTGGTGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTT
TTATTATAATTTTTTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCAATTAT
ACTAGGAGCTCCAGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCAGCATTA
ACACTACTTCTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTAT
CATCTAATATTGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTC
TTCAATTTTAGGTGCAGTAAATTTTATTACTACAGTAATTAATATACGATCTACAGGAATTACCTTTGAT
CGAATGCCTTTATTTGTTTGATCAGTAGTAATTACAGCTCTACTTTTACTTTTATCTTTACCTGTACTTG
CAGGAGCTATCACTATATTATTAACTGACCGAAATATTAATACTTCCTTCTTTGATCCAGCAGGAGGAGG
AGATCCCATCTTATATCAACACCTATTT

>SartibCOI JX987058.1 Sarcophaga tibialis isolate C6 cytochrome oxidase subunit I


(COI) gene, partial cds; mitochondrial
AACTCTATATTTTATTTTCGGAGCTTGAGCAGGTATAGTAGGAACTTCTCTAAGAATTCTTATTCGAGCA
GAATTAGGTCATCCTGGTGCATTAATTGGTGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCCT
TTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCAATTAT
ATTAGGAGCACCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCAGCATTA
ACATTATTACTAGTAAGCAGTATAGTAGAAAATGGAGCTGGAACAGGGTGAACTGTTTACCCACCTTTAT
CTTCTAATATTGCTCACGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCATTACATCTAGCTGGAATTTC
CTCAATTCTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGATCAACTGGTATTACATTTGAC
CGAATACCTTTATTTGTATGATCAGTAGTAATTACAGCACTACTCTTATTATTATCTTTACCTGTACTTG
CTGGAGCAATTACTATATTATTAACTGATCGAAATATTAATACATCATTCTTTGATCCTGCAGGAGGAGG
AGATCCAATTCTATACCAACATTTATTT

>CallvicCOI JN257222.1 Calliphora vicina haplotype 1 cytochrome oxidase subunit 1


(COI) gene, partial cds; mitochondrial
AATTCGAGCCGAACTAGGGCATCCTGGAGCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACA
GCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAG
TCCCTTTAATATTAGGAGCTCCAGATATAGCCTTCCCTCGGATAAACAATATAAGTTTCTGACTTTTACC
TCCTGCATTAACTTTACTATTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTTTAC
CCACCTTTATCTTCTAATATCGCTCATGGAGGAGCTTCTGTTGATCTAGCTATTTTTTCTTTACACTTAG
CAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAAT
TACATTCGACCGAATACCATTATTTGTTTGATCTGTAGTAATTACAGCTTTATTACTTTTATTATCTTTA
CCAGTATTAGCAGGTGCTATT

>LucsilCOI JN257230.1 Lucilia silvarum cytochrome oxidase subunit 1 (COI) gene,


partial cds; mitochondrial
AATTCGAGCCGAATTAGGACACCCTGGAGCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACA
GCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAATTGATTAG
TTCCATTAATACTAGGAGCTCCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACC
TCCTGCATTAACTTTATTATTAGTTAGTAGTATAGTAGAAAACGGGGCTGGAACAGGATGAACAGTTTAC
CCACCTCTATCTTCTAATATCGCCCATGGAGGAGCTTCTGTAGATTTAGCTATTTTCTCTCTCCACTTAG
CAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAAT
TACTTTTGACCGAATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTACTTTTATTATCATTA
CCTGTATTAGCAGGGGCTATT

>LucserCOI JN257225.1 Lucilia sericata cytochrome oxidase subunit 1 (COI) gene,


partial cds; mitochondrial
AATTCGAGCTGAATTAGGACATCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTTACA
GCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAG
TTCCATTAATACTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACC
TCCTGCATTAACTTTATTATTAGTTAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACAGTTTAC
CCTCCTCTATCTTCTAATATTGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTCTCTCTTCATTTAG
CAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAAT
TACTTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCTTTATTACTTTTATTATCATTA
CCAGTATTAGCAGGAGCTATT
>PhoregCOI JN257239.1 Phormia regina haplotype 1 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
AATTCGAGCTGAACTAGGACATCCCGGAGCTCTAATTGGAGATGACCAAATTTATAATGTAATTGTAACA
GCTCATGCTTTTATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAG
TTCCTTTAATACTAGGGGCACCTGATATAGCTTTCCCACGAATAAACAATATAAGTTTCTGACTTTTACC
CCCCGCATTAACTCTATTGTTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTAC
CCACCCTTATCATCTAATATTGCCCATGGAGGAGCATCTGTTGATCTGGCTATTTTCTCTCTTCACTTAG
CAGGAATTTCTTCAATTTTAGGGGCTGTAAATTTCATTACGACTGTAATTAATATACGATCAACTGGAAT
TACATTTGATCGAATACCTCTATTTGTTTGATCTGTAGTTATTACTGCTCTATTACTTTTATTATCTTTA
CCTGTATTAGCAGGTGCTATT

>HydsimCOI JN257246.1 Hydrotaea similis cytochrome oxidase subunit 1 (COI) gene,


partial cds; mitochondrial
AATTCGAGCTGAATTAGGTCATCCTGGTGCATTAATTGGTAATGATCAAATTTATAATGTAATTGTAACA
GCTCATGCTTTTATTATGATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAG
TTCCTTTAATATTAGGAGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGACTTTTACC
TCCTGCTTTAACTTTACTTTTAGTAAGTAGAATAGTTGAAAATGGAGCTGGTACAGGTTGAACTGTTTAT
CCTCCATTATCATCTAATATTGCTCATGGAGGTGCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAG
CAGGAATTTCCTCAATTCTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACTGGAAT
TACTTTTGATCGAATACCTTTATTTGTTTGATCTGTAGTAATTACAGCTCTTTTATTATTATTATCATTA
CCAGTTTTAGCTGGAGCAATT

>SynnudCOI KY228381.1 Synthesiomyia nudiseta isolate 683 cytochrome oxidase subunit


I (COI) gene, partial cds; mitochondrial
GGAGCTGATCCGGATAGTAGGAACCTCTCTAAGAATTTTAATTCGTGCTGAATTAGGACATCCTGGAGCA
CTTATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCCCACGCTTTTATTATAATTTTTTTTATAG
TAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCTGATATAGC
TTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCTCCTGCTTTAACATTACTATTAGTTAGTAGA
ATAGTAGAAAATGGAGCTGGAACTGGTTGAACTGTTTACCCTCCTTTATCTTCAAATATTGCACATGGAG
GAGCCTCAGTAGATTTAGCTATTTTTTCTCTTCACTTAGCAGGAATTTCTTCTATTTTAGGTGCAGTAAA
TTTTATTACAACAGTAATTAATATACGATCAACAGGTATTACATTTGATCGAATACCTTTATTCGTTTGA
TCTGTAGTAATTACAGCTTTATTATTATTATTATCATTACCTGTACTTGCAGGAGCAATTACTATATTAT
TAACAGACCGAAACCTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACA
TTTATTTTGATTCTTTGGCAA

>CocmacCOI KC617815.1 Cochliomyia macellaria cytochrome oxidase subunit 1 (COI)


gene, partial cds; mitochondrial
TACTTTATATTTCATTTTTGGAGCTTGATCTGGAATAGTAGGAACTTCTCTAAGAATTCTAATTCGAGCA
GAATTAGGACATCCTGGAGCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCACGCTT
TTATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAAT
ACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCATTA
ACTTTATTATTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTAT
CTTCTAATATTGCTCATGGAGGAGCTTCAGTTGATCTAGCTATTTTCTCTCTTCATTTAGCCGGAATTTC
ATCAATTTTAGGAGCAGTAAATTTCATTACAACTGTAATTAATATACGATCAACAGGAATTACATTCGAT
CGAATGCCTTTATTCGTATGATCAGTAGTAATTACTGCTCTTTTACTTTTATTATCTTTACCAGTTTTAG
CCGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCCGGAGGAGG
AGATCCAATTTTATATCAACACTTATTT

>PecchrCOI KX054333.1 Peckia chrysostoma voucher sc_03654 cytochrome oxidase


subunit 1 (COI) gene, partial cds; mitochondrial
AACATTATATTTCATTTTTGGAGCTTGAGCAGGTATAGTAGGAACATCTCTAAGAATTCTTATTCGAGCC
GAATTAGGTCATCCAGGAGCTCTAATTGGAGATGATCAAATTTATAATGTAATTGTCACAGCTCATGCTT
TTATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGTGGATTTGGAAATTGACTAGTACCAATTAT
ATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGACTTTTACCTCCAGCATTA
ACATTACTTTTAGTAAGCAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCACCATTAT
CTTCTAATATTGCTCATGGAGGGGCTTCTGTTGATTTAGCGATTTTTTCTCTTCATTTAGCAGGAATTTC
TTCAATTTTAGGGGCAGTAAATTTTATTACAACAGTAATTAATATACGATCGACAGGAATTACCTTTGAT
CGAATACCTTTATTTGTTTGATCTGTGGTTATTACAGCCTTATTATTACTTCTTTCTTTACCAGTACTTG
CAGGAGCAATTACAATATTATTAACAGATCGAAATATTAATACATCATTCTTTGATCCAGCTGGAGGAGG
AGATCCTATTCTTTATCAACATTTATTC