Jake Hobson

Chris Kenney
Jack Mulligan
Gigi Vasquez
Alzheimer's
List of Tasks:
1. Start researching and “divide and conquer” and start researching
2. Jake- What the disease is, The protein that is effected?
Chris- What part of the body does it affect? Symptoms?
Jack-Who gets the disease? And cure/treatment?
Gigi- barriers and current research
3. Combine research and create overall claim
4. Start presentation: poster + oral report
5. Create speaking parts and practice presentation

Research In Order by Person:

Jake
- Alzheimer’s is a degenerative disease that causes dementia and grows worse over time
- The protein that is affected is ​ the amyloid beta protein, and tau protein in the brain.
- {ASP}{ALA}{GLU}{PHE}{ARG}{HIS}{ASP}{SER}{GLY}{TYR}{GLU}{VAL}
{HIS}{HIS}{GLN}{LYS}{LEU}{VAL}{PHE}{PHE}{ALA}{GLU}{ASP}{VAL}
{GLY}{SER}{ASN}{LYS}{GLY}{ALA}{ILE}{ILE}{GLY}{LEU}{MET}{VAL}{G
LY}{GLY}{VAL}{VAL}{ILE}{ALA}
- Genetic, biochemical, and behavioral research suggest that physiologic generation of the
neurotoxic Aβ peptide from sequential amyloid precursor protein (APP) proteolysis is the
crucial step in the development of AD.
-

Chris
Q: What part of the body does Alzheimer's affect?
A:​ Alzheimer's affect the brain. More specifically the hippocampus, the part of the brain
responsible for forming memories initially. As more neurons die, more parts if the brain are
affected. In the final stages, the brain will have shrunk significantly in size because much of the
brain’s tissue has died.
Symptoms:
→ For most, it doesn't begin with memory problems but with visual/spatial issues, impaired
reasoning and judgement.
→ MCI (Mild cognitive impairment) which is when people have more memory problems
consistent for their age but it does NOT interfere with their everyday lives. This can be an sign
but can possibly unrelated to alzheimer’s.
→ Once Alzheimer’s is in its mild stage, it is most identifiable. People with mild alzheimer’s
may wander and get lost, trouble handling pills, money or smaller objects, taking longer time to
do normal daily tasks, and personality or behavioral changes.
→ Moderate Alzheimer’s patients will experience Hallucinations, delusions, paranoia as well as
an increase in previous symptoms like confusion, and memory loss.
→ Severe Alzheimer’s patients see symptoms worsen to the point where they can no longer
communicate and become completely reliant on others to take care of them. Towards the end of
their life they must stay in bed as their body shuts down.

DNA chain: Starting at base 26, 025, 040

TACCTGTAGATTTAAATTAAGGTCTTTAGTTTCGATACCA
ATGGACATCTAAATTTAATTCCAGAAATCAAAGCTATGGT
Jack
Jack-Who gets the disease? And cure/treatment?

Alzheimer's disease. Most people with Alzheimer's disease develop it after the age of 65,
but people under this age can also develop it. This is called early-onset Alzheimer's disease, a
type of young-onset dementia. In the UK there are over 40,000 people under the age of 65 with
dementia.

Treatment
There is no known cure for Alzheimer's. The death of brain cells cannot be reversed.

However, there are therapeutic interventions that ​can make it easier​ for people to live with the
disease.

According to the Alzheimer's Association, the following are important elements of dementia
care:

● effective management of any conditions occurring alongside the Alzheimer's

● activities and day-care programs
● involvement of support groups and services

Drug therapy 4
No disease-modifying drugs are available for Alzheimer's disease, but some options may reduce
the symptoms and help improve quality of life.

Cholinesterase inhibitors that are approved for symptomatic relief in the U.S. ​include​:

● Donepezil (Aricept)
● Rivastigmine (Exelon)
● Tacrine (Cognex)

A different kind of drug, memantine (Namenda), an NMDA receptor antagonist, ​may also be
used​, alone or in combination with a cholinesterase inhibitor.

Gigi
● “Studies in genetics; basic biology; drug discovery; and translational, clinical, behavioral,
and social science research have helped redefine the disease and clarify ways to approach
the study of treatments and prevention” (Watson)
● “thousands of volunteers who participate in epidemiological and clinical studies, taking
part in neuropsychological tests of memory and cognitive function; contributing DNA,
blood, and cerebrospinal fluid samples; and undergoing brain scans.” (Watson)
● One barrier: they need to test solutions nationwide on volunteers with Alzheimer’s, but
there are never enough volunteers to record accurate data
● physicians are unaware of cognitive impairment in more than 40 percent of their
cognitively impaired patients.
● No cure because cells cannot be repaired from the plaque, very limited treatments, none
that work universally
● Current studies are through observations of brain tissue of people who have Alzheimer’s
Protein affected: Beta Amyloid
“Alzheimer‘s is the sixth leading cause of death in the United States. Affecting over 5 million
Americans, the disease is incurable and untreatable.” ​(Sauer)
Amyloidosis: the group of wrongly folded proteins that includes the result of Alzheimer’s

Websites used:
https://www.alz.org/national/documents/topicsheet_betaamyloid.pdf​ - chris
https://www.nia.nih.gov/health/alzheimers-disease-fact-sheet​ -chris
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4167360/​ -gigi
https://ghr.nlm.nih.gov/condition/alzheimer-disease​ -jake
https://www.medicalnewstoday.com/articles/159442.php​ - jack
https://www.alzheimers.net/2014-04-07/beta-amyloid-wrong-protein/​ -gigi
https://www.genscript.com/peptide/RP10017-_Amyloid_1_42_human.html​ -Jake
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5498849/​ -gigi (current Alzheimer’s study)
https://www.ncbi.nlm.nih.gov/gene/351​ - Jake

Poster Rough draft:

Work cited page
 
Altered mechanisms of protein synthesis in frontal cortex in Alzheimer disease and a mouse model, U ​ .S. National 
Institute of Medicine, Esparacia, Paula, 15 Jun. 2017​, h ​ ttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5498849/  
 
Alzheimer's Disease Fact Sheet.​, National Institute on Aging, U.S. Department of Health and Human Services, 17 Aug. 
2016, ​www.nia.nih.gov/health/alzheimers-disease-fact-sheet​.  
 
Alzheimer’s Disease, G​ enetics Home Reference, U.S. National Library of Medicine, 4 Dec. 2018, 
https://ghr.nlm.nih.gov/condition/alzheimer-disease  
 
APP amyloid beta precursor protein [ Homo sapiens (human) ], ​National Center for Biology Technology, 2 Dec 2018, 
https://www.ncbi.nlm.nih.gov/gene/351  
 
β-Amyloid (1-42), human, G​ enscript, 2018,​ h
​ ttps://www.genscript.com/peptide/RP10017-_Amyloid_1_42_human.html  
 
Beta- Amyloid and the Amyloid Hypothesis​. Alzheimer's Association , Mar. 2017 
www.alz.org/national/documents/topicsheet_betaamyloid.pdf​.   
 
Has Alzheimer’s Research Been Wrong for 20 Years?, A ​ lzheimer’s Research, Alzheimer’s.net, Sauer, Alissa, 15 May 
2017, ​https://www.alzheimers.net/2014-04-07/beta-amyloid-wrong-protein/  
 
Obstacles and Opportunities in Alzheimer’s Clinical Trial Recruitment​, U.S. National Library of Medicine, 1 April 2014, 
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4167360/  
 
What’s to know about Alzheimer’s Disease?, M ​ edical News Today, MacGill, Markus, 13 Feb. 2018, 
https://www.medicalnewstoday.com/articles/159442.p​hp