In Vitro Cellular & Developmental Biology - Plant

https://doi.org/10.1007/s11627-018-9937-7

PLANT TISSUE CULTURE

Validation of reference genes for gene expression analysis of response

to anthocyanin induction in cell cultures of Vitis davidii (Rom. Caill.)
Foëx
Chengchun Lai 1,2,3 & Hong Pan 1 & Xiangui Huang 1 & Lihua Fan 1 & Changqing Duan 2 & Shaozhen Li 3

Received: 22 December 2017 / Accepted: 17 September 2018 / Editor: Charles Armstrong

# The Society for In Vitro Biology 2018

Abstract
Real-time quantitative polymerase chain reaction (RT-qPCR) is an effective method for detecting changes of gene expression in
plant cell metabolic regulation. A set of 15 reference gene candidates were selected for the present study of anthocyanin
biosynthesis regulation, and stability. The suitability of their expression was evaluated in eight different experimental treatments
in spine grape (Vitis davidii [Rom. Caill.] Foëx.) cell cultures. The results indicated that SAND family protein (SAND) and V-type
proton ATPase subunit G (VAG) were the most stable reference genes for culture duration, tubulin alpha-3/alpha-5 chain (α-
tubulin) and tubulin beta-1 chain (β-tubulin) for illumination conditions, ubiquitin-conjugating enzyme E2-17 kDa (UBQ) and
VAG for UVB treatment, VAG and 60S ribosomal protein L18-2 (60SRP) for temperature treatment, AP47, clathrin adaptor
complex subunit mu (AP-2) and 60SRP for cinnamic acid treatment, α-tubulin and UBQ for chitosan treatment, actin and alcohol
dehydrogenase 2 (ADH2) for kinetin treatment, and β-tubulin and elongation factor 1-α (EF1-α) for cell line. Finally, the
reliability of the selected reference genes was confirmed by investigating the expression profiles of the target gene dihydrofla-
vonol 4-reductase (DFR) in spine grape cell cultures. The results of the present study offer the most robust platform for the most
precise and broad application of RT-qPCR to investigate gene expression associated with anthocyanin biosynthesis in spine grape
cell cultures.

Keywords Spine grape (Vitis davidii [Rom. Caill.] Foëx.) . Cell culture . Gene expression . Reference gene . Real-time quantitative
PCR

Introduction repulsion of herbivores and parasites; the provision of anti-

Anthocyanins are a group of flavonoids that are responsible
for various colors in plant organs, and a high level of diversi-
fication in Plantae (Wrolstad 2004; Landi et al. 2015;
Mushtaq et al. 2016). They play a significant role in the at-
traction of pollinators, frugivores, and dispersers; the
* Chengchun Lai
lccisland@163.com
1 natural products and are in large demand for their medicinal
Institute of Agricultural Engineering and Technology, Fujian
Academy of Agricultural Sciences, Fuzhou 350003, China
2 urally produce anthocyanins, their widespread use is limited
Center for Viticulture and Enology, College of Food Science &
Nutritional Engineering, China Agricultural University,
Beijing 100083, China
3
Beijing Huiyuan Food & Beverage Co., Ltd., Shunyi District
BeiXiaoYing Town, Beijing 101305, China
viral and anti-microbial activities, and resistance to the harm-
ful effects of ultraviolet light (Schaefer et al. 2004; Stintzing
and Carle 2004; Wrolstad 2004). These secondary metabolites
are also essential to the color quality of fresh and processed
fruits and vegetables and have been extensively studied by
horticulturists and food scientists. Moreover, naturally occur-
ring anthocyanins in plants have been given wide attention in
recent years (Hidalgo and Almajano 2017), and are recog-
nized for their high antioxidant capacity and reported positive
human health effects (Guerrero et al. 2010; Wallace 2011;
Bochi et al. 2015). Anthocyanins have become sought-after
and industrial uses. However, because only a few plants nat-
(Petrella et al. 2016). This limitation has prompted researchers
to seek alternative renewable resources for anthocyanin bio-
synthesis and other plant secondary metabolites. Studies have
shown that plant cell culture could be a useful method for
 LAI ET AL.
producing natural secondary metabolites, and is also a perfect
model system to study the biosynthesis of plant secondary
metabolites (Dörnenburg and Knorr 1995; Oksman-
Caldentey and Inzé 2004; Isah et al. 2018). Therefore, antho-
cyanin production in plant cell culture is an achievable tech-
nology that is being pursued industrially and academically
(Zhang and Furusaki 1999; Davis et al. 2012; Simões et al.
2012; Karaaslan et al. 2013).
Spine grape (Vitis davidii [Rom. Caill.] Foëx.), also called
the Chinese bramble grape and Davids Rebe, is a wild East
Asian grape species (Meng et al. 2012). A majority of spine
grape fruits are violet black and contain abundant flavonoids,
especially anthocyanins, which is an excellent material for
fruit processing and wine making. To take advantage of this
valuable wild grape, a previous attempt was made to produce
anthocyanins in cell culture. Two cell lines were obtained
from young embryo-derived callus tissue, which could be
subcultured in the long term and thrived during long-term
maintenance (Lai et al. 2014). A few studies have reported
that secondary metabolites, such as anthocyanins, were pro-
duced in grape cell cultures (Decendit and Mérillon 1996;
Sato et al. 1996; Zhang and Furusaki 1999; Simões et al.
2012). As in other plant cell culture systems, several barriers
to commercial utilization have not been overcome in grape
cell culture, such as slow plant cell growth, low production
rates, metabolite channeling, and poor metabolic regulation
under certain conditions (Abdullah et al. 2005), which almost
certainly reflects the lack of knowledge of the basic regulation
of secondary metabolism in cultured plant cells, and anthocy-
anin production (Decendit and Mérillon 1996; Sato et al.
1996). Anthocyanins are derived from the flavonoid biosyn-
thetic pathway. The anthocyanin biosynthetic pathway may be
the most studied secondary metabolite pathway in plants, and
the genes associated with anthocyanin biosynthesis, can be
obtained from almost every biosynthetic step (Holton and
Cornish 1995; Winkel-Shirley 2001; Solfanelli et al. 2006;
He et al. 2010). Little is known about the mechanisms that
govern the function and interaction of the structural genes and
regulatory factors of anthocyanin biosynthesis in the cell, es-
pecially when cultured under specific conditions. Therefore,
research on molecular regulatory mechanisms of structural
genes and regulatory factors associated with anthocyanin bio-
synthesis at a cellular level is significant for both fundamental
and applied issues.
Gene expression analyses are currently used to study the
regulatory mechanisms of secondary metabolite pathways in
plants. Real-time quantitative polymerase chain reaction (RT-
qPCR) has been used in many analyses at the transcription
level and is the most appropriate method for detecting changes
in gene expression, because it has good repeatability, specific-
ity, high sensitivity, and a wide dynamic range (Pfaffl and
Hageleit 2001; Ginzinger 2002; Gutierrez et al. 2008;
Freitas et al. 2017). However, substantial problems that affect
the experimental data are inherent in RT-qPCR. One strategy
to reduce potential errors is the introduction of reference genes
to calibrate the RT-qPCR data (Ginzinger 2002; Huggett et al.
2005; Borges et al. 2012). A variety of housekeeping genes,
such as actin, 18S rRNA, glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), tubulin, and elongation factor
1-α (EF1-α), have been commonly used as reference genes
(Libault et al. 2008; Hu et al. 2009). However, several studies
have indicated that the expression of housekeeping genes
could vary with different experimental treatments, and mis-
represent the nature of the expression of a gene of interest
(Thellin et al. 1999; Nicot et al. 2005; Jian et al. 2008).
Thus, it is critical to systematically select one or more appro-
priate stably expressed reference genes to accurately quanti-
tate gene expression for a specific treatment. To address this
issue, two spine grape cell lines were used to establish a model
system to study the production of anthocyanin and some other
secondary metabolites. The expression profiles of the genes
associated with the anthocyanin biosynthesis pathway were
analyzed by RT-qPCR to facilitate understanding of the mech-
anisms involved in this process at the cellular level. Almost all
current RT-qPCR studies in grapes used a tree or part of a tree
as the plant material and used reference genes for normaliza-
tion (Bogs et al. 2006; Reid et al. 2006; Espinoza et al. 2007;
Gutha et al. 2010; Gamm et al. 2011; González-Agüero et al.
2013; Monteiro et al. 2013; Borges et al. 2014). There has not
been a study to date that has identified a particular set of stable
reference genes for grape cell culture. Thus, it was necessary
to confirm the most stable reference gene(s) for future gene
expression studies of spine grape cells under specific experi-
mental conditions.
In the present study, the expression stability of 15 reference
gene candidates was assessed using RT-qPCR with eight dif-
ferent experimental treatments of spine grape cells, and reli-
able reference genes to normalize the relative gene expression
were confirmed.
Materials and methods
Spine grape cell lines Two cell lines, designated as DLR and
DLW, were obtained from spine grape (Vitis davidii [Rom.
Caill.] Foëx.) callus tissue. These calluses had been
subcultured in vitro for over 2000 d (96 generations) and were
induced from one spine grape immature embryo as described
by Lai et al. (2014). DLR is red-mauve in color, and DLW is
light yellow-green (Fig. 1).
Experimental treatments The expression stability of the refer-
ence gene candidates was assessed in eight independent ex-
periments. (1) The cell cultures were cultured on Murashige
and Skoog (MS) solid medium (Murashige and Skoog 1962)
with 1.0 mg L−1 2,4-dichlorophenoxyacetic acid (2,4-D; Bio
 IN VITRO PRESERVATION OF OREOCHARIS MILEENSE
a b
Figure 1. Two cell lines of spine grape (Vitis davidii [Rom. Caill.] Foëx.). (a) DLR cell line with red-mauve color. (b) DLW cell line with light yellow-
green color.
Basic Inc., Markham, ON, Canada) and harvested at 15, 25,
35, 45, or 55 d. All of the harvested cells were immediately
frozen in liquid nitrogen and stored at − 80°C. (2) The cell
cultures were cultured on MS solid medium with 1.0 mg L−1
2,4-D under white light (color temperature is 6500 K,
62.5 μm m−2 s−1; Philips, Shanghai, China), warm light (color
temperature is 3000 K, 62.5 μm m−2 s−1; Philips) and dark-
ness for 25 d. All of the harvested cells were immediately
frozen in liquid nitrogen and stored at − 80°C. (3) The cell
cultures were cultured on MS solid medium with 1.0 mg L−1
2,4-D for 23 d and irradiated with ultraviolet B (HuaQiang,
Nanjing, China) for 0 h, 3 h, or 6 h at an intensity of
110 μW m−1, and then cultured for another 48 h. All of the
harvested cells were immediately frozen in liquid nitrogen and
stored at − 80°C. (4) The cell cultures were cultured in MS
solid medium with 1.0 mg L−1 2,4-D and removed from cul-
ture room (temperature 25°C) on day 23, and then cultured at
4°C, 25°C, or 37°C for 48 h. All of the harvested cells were
immediately frozen in liquid nitrogen and stored at − 80°C. (5)
The cell cultures were removed from MS solid medium with
1.0 mg L−1 2,4-D on day 23, and cultured in MS liquid me-
dium with 0 mg L−1, 20 mg L−1, or 40 mg L−1 cinnamic acid
(Sangon Biotech, Shanghai, China) for 48 h. All of the har-
vested cells were immediately frozen in liquid nitrogen and
stored at − 80°C. (6) The cell cultures were transferred from
MS solid medium with 1.0 mg L−1 2,4-D on day 23 and
cultured in MS liquid medium supplemented with 0 mg L−1,
400 mg L−1, or 800 mg L−1 chitosan (Bio Basic Inc.) and
harvested after 48 h in the presence of chitosan. All of the
harvested cells were immediately frozen in liquid nitrogen
and stored at − 80°C. (7) The DLR cell line was subcultured
on MS solid medium with 1.0 mg L−1 2,4-D and 0.0 mg L−1,
0.05 mg L−1, 0.5 mg L−1, or 1.5 mg L−1 kinetin (KT; Bio Basic
Inc.) and harvested on day 25. All of the harvested cells were
immediately frozen in liquid nitrogen and stored at − 80°C. (8)
Two different cell lines (DLR and DLW cell lines) were both
cultured on MS solid medium with 1.0 mg L−1 2,4-D and
harvested on day 25 and day 35. All of the harvested cells
were immediately frozen in liquid nitrogen and stored at −
80°C. Total RNA was isolated from all eight independent ex-
periments for the following experiments. Three biological rep-
lications were performed for each treatment for all samples.
All of MS solid media were supplemented with 30 g L−1 su-
crose (Sinopharm Chemical Reagent Co., Ltd., Shanghai,
China), 6 g L−1 Agar powder (AOBOX, Beijing, China). All
of MS liquid media were supplemented with 30 g L sucrose.
All media were adjusted to pH 5.8 using 1.0 mol L−1 NaOH
and were autoclaved (G154DW; Zealway Instruments, Inc.,
Wilmington, DE) at 121°C, 0.11 MPa for 20 min.
Total RNA isolation and cDNA synthesis Of the harvested cells,
0.1 g was used for the following total RNA isolation. Total
RNA was isolated using a Plant RNA Extraction Kit
(Applygen Technologies, Inc., Beijing, China) according to
the manufacturer’s instructions. Removal of the residual ge-
nomic DNA was done with an RQ1 RNase-Free DNase Kit
(Promega®, Madison, WI). The RNA purity and concentra-
tion were automatically calculated at 260/280 nm using a
NanoDrop™-2000 spectrophotometer (Thermo-Fisher
Scientific®, Waltham, MA), and the RNA integrity was con-
firmed by agarose gel electrophoresis on a 1.5% (w/v) agarose
gel (BIOWEST®, Nuaillé, France). For each treatment in-
cluding the control, three biological replicate RNA samples
were isolated from each mixed cell culture, and equal amounts
were pooled to form the test sample. According to the manu-
facturer’s instructions, cDNA from each representative sample
was synthesized from 1000 ng of total RNA using a
PrimeScript™ RT reagent Kit (Perfect Real Time; Takara
Bio, Inc., Shiga, Japan) anchored with an oligo(dT)18 primer
in a 20-μL volume reaction.
 LAI ET AL.
Selection of candidate genes A total of 22 reference gene
candidates were selected according to previous studies in
Vitis vinifera, including actin (actin-7, other hits include
ACT1, ACT2), clathrin adaptor complex subunit mu (AP-2,
AP47), peptidyl-prolyl cis-trans isomerase (Cyclophilin),
SAND family protein (SAND), V-type proton ATPase subunit
G (VAG), EF1-α, GAPDH, tubulin alpha-3/alpha-5 chain (α-
tubulin), tubulin beta-1 chain (β-Tubulin), ubiquitin-60S ribo-
somal protein L40 (UBQ-L40), phosphoenolpyruvate carbox-
ylase, housekeeping isozyme (PEP), peptidyl-prolyl cis-trans
isomerase CYP20-2 (CYP), NADH dehydrogenase subunit 5
(NAD5), Alcohol dehydrogenase 2 (ADH2), 60S ribosomal
protein L18-2 (60SRP), ubiquinol-cytochrome-c reductase
complex assembly factor 1 (UQCC), V-type proton ATPase
16-kDa proteolipid subunit (VATP16), 18S ribosomal RNA
(18S rRNA), T-complex protein 1 subunit beta (VvTCPB),
small nuclear ribonucleoprotein (SMD3), ubiquitin carrier
protein E2 C (UBE2), and ubiquitin-conjugating enzyme E2-
17 kDa (UBQ). This group of genes was investigated as the
associated reference genes in each experiment.
Design of RT-qPCR primers and validation of gene amplifica-
tion Primers for some of the candidate genes in this experi-
ment were available from the literature, and others were de-
signed according to de novo assembly sequences from the
transcriptome of spine grape cell cultures (data not shown).
These latter primer pairs were designed using the online pro-
gram Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/
primer-blast/), with an optimal Tm of 60°C, GC% between
40 and 60%, primer length of 18–24 bp, and amplicon length
between 104 and 287 bp. The specificity of all primer pairs
was initially assessed by RT-qPCR and indicated by a melting-
curve with a single peak. A single amplification band of the
expected size for each gene was further checked by 2.0% (w/v)
agarose gel electrophoresis with ethidium bromide (EB) stain-
ing. The electrophoretic bands and melting-curve were the
criteria used to select 15 reference gene candidates from the
22 preliminary candidate genes. The expression profiles of
these 15 genes, actin, AP-2, cyclophilin, EF1-α, GAPDH,
VAG, SAND, α-tubulin, β-tubulin, UBQ-L40, NAD5, ADH2,
60SRP, 18S rRNA, and UBQ, were further analyzed in subse-
quent experiments. The primer pair sequences, melting tem-
perature, amplicon size, and amplification efficiency are
shown in Table 1.
Real-time quantitative PCR Real-time quantitative polymerase
chain reactions were performed in 96-well microtiter plates
with the Light Cycler® 480II System (Roche, Basle,
Switzerland) using the SYBR® Premix Ex Taq™ II Kit
(Takara Bio, Inc., Shiga, Japan) to verify dsDNA synthesis.
The PCR reactions were completed in 20-μL volumes, and
each reaction contained 10 μL of SYBR® Premix Ex Taq™ II
(Takara Bio Inc.), 1.0 μL each of the upstream and
downstream primer (10 μM), 2 μL of cDNA, and 4 μL of
sterile nuclease-free water. The RT-qPCR reaction conditions
were as follows for PCR tubes in 96-well plates: a denatur-
ation step at 95°C for 30 s; 40 cycles of 5 s at 95°C, and 30 s at
60°C; then, the melting-curve with denaturation at 95°C for
5 s, cooling at 60°C for 1 min, and gradual heating at 0.11°C
per s, up to 95°C, and finally rapid cooling, at 2.2°C s−1, down
to 50°C. All RT-qPCR reactions were carried out with three
replicates, and each primer pair was checked with a non-
template control (NTC).
The expression stability of the 15 reference gene candidates
was determined by RT-qPCR. The LightCycler® 480
Software Version 1.5 (Roche) automatically determined each
gene crossing point (Cp), and the amplification efficiency (E).
Standard curves were produced with RT-qPCR using 5-fold
serially diluted mixed cDNAs from all experimental samples
as the templates. Table 1 shows a summary of the results.
Statistical analyses and validation of the reference genes Data
analysis was performed for the eight treatments. The RT-
qPCR Cp data were obtained using LightCycler® 480
Software Version 1.5 (Roche, Basle, Switzerland). The ex-
pression stability of the 15 reference gene candidates for each
experimental group was analyzed with three statistical
methods, including geNorm (Vandesompele et al. 2002),
NormFinder (Andersen et al. 2004), and BestKeeper (Pfaffl
et al. 2004), and the stability rankings of the 15 reference gene
candidates were comprehensively assessed using RefFinder
(http://150.216.56.64/referencegene.php) for the different
sample datasets. Finally, geNorm was used to calculate the
pairwise variation of two sequential normalization factors
(V(n/n + 1)) as the standard deviation of the logarithmically
transformed NFn/NFn + 1 ratios, and the optimal number of
reference genes to accurately normalize the RT-qPCR data
was confirmed. A threshold value of 0.15 was recommended
by geNorm to standardize the expression stability. It has been
proposed that a pairwise variation value for n genes of less
than 0.15 indicated that it was unnecessary to add another
reference gene.
Normalization of DFR Dihydroflavonol 4-reductase gene
(DFR; GenBank accession number KF915803) was cloned
from spine grape cell cultures and was used as a gene of
interest to investigate the availability of the selected reference
genes in RT-qPCR. In different cell cultures of spine grape
with different concentrations of cinnamic acid for different
durations (two of eight experimental conditions were random-
ly selected), the relative expression of DFR was analyzed
using one, two, or three of the most stable reference genes,
in addition to the least stable reference gene, to normalize the
data. These reference genes were comprehensively ranked and
validated as indicated by RefFinder. The primer pair was de-
signed forward: 5-ACCAACTGCCAGTGTACGATGA-3
 IN VITRO PRESERVATION OF OREOCHARIS MILEENSE

Table 1. List of candidate genes, primers, and amplicon characteristics

Gene Locus description Primer pair (forward/reverse, 5′ → 3′) Tma Amplicon RT-qPCR
name (°C) size(bp) efficiencyb

Actin Actin-7, other hits include ACT1, ACT2 CTTGCATCCCTCAGCACCTT/ 62.7 82 1.903
TCCTGTGGACAATGGATGGA 62.3
AP-2 AP47, clathrin adaptor complex subunit mu GGTTCCCATGTTTACAGCATCTG/ 62.8 86 2.004
GCACCCACTCAACGGTATTGTAC 62.7
Cyclophilin Peptidyl-prolyl cis-trans isomerase GCCTCTGCACTACAAGGGATCT/ 62.0 96 1.938
TTCGCCACCAGTACCGTTTC 63.3
EF1-α Elongation factor 1-alpha CGCCTGTCAATCTTGGTCAGTAT/ 60.7 83 2.010
AATGGCTATGCCCCTGTTCTG 60.4
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, TCAAGGTCAAGGACTCTAACACC 59.7 226 1.982
cytosolic CCAACAACGAACATAGGAGCA 61.1
VAG V-type proton ATPase subunit G TCTTTGCCTGTGTCTCTTGTTCA/ 60.4 115 2.004
GAGATTGCTGCTTACCGAGC 59.1
SAND SAND family protein GCATTTGATCCACTTGCAGATAAG/ 62.3 76 2.019
CAACATCCTT TACCCATTGA CAGA 62.1
α-Tubulin Tubulin alpha-3/ GTTCTCGCGCATTGACCATA/ CAGCCAGA 62.1 119 2.015
alpha-5 chain TCTTCACGAGCTT 62.0
β-Tubulin Tubulin beta-1 chain TGAACCACTTGATCTCTGCGACTA/ 63.4 86 1.998
CAGCTTGCGGAGGTCTGAGT 63
UBQ-L40 Ubiquitin-60S ribosomal protein L40 GGCTTTGGCACGCAAATACA/ 60.0 161 2.071
AAAACCAACAGCCACCCAGA 60.0
PEP Phosphoenolpyruvate carboxylase, ATGGCTGTTGTTGCTACGGA/ 60.0 164 –
housekeeping isozyme GCACGGAGCGATTCAATTCC 60.0
CYP Peptidyl-prolyl cis-trans isomerase CYP20-2 TTTCGTCTGGTGCCTCTCAC/ 60.0 174 –
AATCCGTCCAACGACCTTCC 60.0
NAD5 NADH dehydrogenase subunit 5 GTCGGTGCGGTTGCTAAATC/ 60.0 83 2.042
GCCGAAATAGGAGTAGGCCC 60.0
ADH2 Alcohol dehydrogenase 2 GGTTATACGCTGCAAAGCCG/ 60.0 136 2.007
AACATCGGTGTGGCAGAGAG 60.0
VATP16 V-type proton ATPase 16-kDa proteolipid TGGTCATGGCTGGTGTCTTG/ 60.2 135 –
subunit GACCACAAGCGAGTCCAGAA 60.0
60SRP 60S ribosomal protein L18-2 CTGGTACGGAGAACCGGAAG/ 59.8 179 2.000
GGCACCTCATAGACCCGAAG 60.0
UQCC Ubiquinol-cytochrome-c reductase complex ATTCGAGGGGCAAATGTGGT/ 59.6 239 –
assembly factor 1 TTAACCCCAGCCTTCGACAC 59.6
18S rRNA 18S ribosomal RNA GCCCTATCAACTTTCGATGG/ 59.5 109 1.995
TGGATGTGGTAGCCGTTTCT 60.5
VvTCPB T-complex protein 1 subunit beta AGACAGTGATTGACAGCCGAGTT/ 62.5 238 –
ATCCCTGCGTGGCTTTCTTCC 66.9
SMD3 Small nuclear ribonucleoprotein GGCAGTTCCTTTTGAGCGTG/ 58.3 99 –
TTCGCATAACGCAAGGCAAC 57.6
UBE2 Ubiquitin carrier protein E2 C TTGGCACAATCATGGGTGGA/ 60.0 96 –
GGGGTGGCTTGAAAGGGTAG 60.3
UBQ Ubiquitin-conjugating enzyme E2-17 kDa GAGGGTCGTCAGGATTTGGA/ 62.4 75 2.056
GCCCTGCACTTACCATCTCTAAG 61.3
a
The melting temperature of specific PCR product was calculated by DNAMAN8.0 software
b
The RT-qPCR efficiency was automatically determined using the LightCycler® 480 Software Version 1.5 (Roche). The genes without displayed
efficiency values were not selected for further analysis of expression stability

and reverse: 5-GCTTGCTCAGCCAGTGTCTTG-3, to deter-
mine the quantitative expression of DFR.
Results and discussion
Real-time quantitative polymerase chain reaction is an impor-
tant method and efficient tool for the study of gene expression
profiles (Nolan et al. 2006). However, the reliability of RT-
qPCR data depends extensively on the appropriate reference
gene(s), and the expression of these reference gene(s) must not
change with different experimental conditions (Czechowski et
al. 2005). However, because of the complexity of experimen-
tal treatments, one gene cannot maintain constant expression
under all conditions (Wong and Medrano 2005). For example,
EF1-α, GAPDH, actin, and SAND were recommended as ref-
erence genes for normalization in grape berry development
studies (Reid et al. 2006), UBC, VAG, and PEP were used
 LAI ET AL.

in grapevine leaves, and EF1, CYP, and UBC were the most
stable internal genes for use in grapevine leaves treated with P.
chlamydospora (Borges et al. 2014). In another experiment,
NAD5 and Actin were used as the most stable genes to nor-
malize the gene expression data from grapevine leaves (Gutha
et al. 2010). Therefore, stable reference gene(s) for RT-qPCR
must be identified for each new set of treatments (Wu et al.
2016).
Grapes are an economically important fruit crop world-
wide. Many studies of grape molecular biology, including Figure 2. Specificity of real-time quantitative polymerase chain reaction
amplification and amplicon length. The amplicons of 22 genes were
gene expression studies, were done during the last few de- separated by 2.5% (w/v) agarose gel electrophoresis with ethidium
cades. Some reference genes have been validated to normalize bromide staining. M represents DL2000 DNA marker (TaKaRa). 1~22
the target gene expression data in grape gene expression stud- represents, actin-7 (actin, other hits include ACT1, ACT2), AP47 (AP-2,
ies (Selim et al. 2012; Upadhyay et al. 2015; Tashiro et al. clathrin adaptor complex subunit mu), cyclophilin (peptidyl-prolyl cis-
trans isomerase), elongation factor 1-α (EF1-α), glyceraldehyde-3-
2016; Katayama-Ikegami et al. 2016). However, an analysis phosphate dehydrogenase (GAPDH), V-type proton ATPase subunit G
of gene expression at the transcriptional level in spine grape (VAG), SAND family protein (SAND), tubulin alpha-3/alpha-5 chain (α-
using RT-qPCR has not yet been reported in the literature. The tubulin), tubulin beta-1 chain (β-tubulin), ubiquitin-60S ribosomal
present study is the first effort focused on systematically val- protein L40 (UBQ-L40), phosphoenolpyruvate carboxylase,
housekeeping isozyme (PEP), peptidyl-prolyl cis-trans isomerase
idating stable reference genes for RT-qPCR analysis in spine CYP20-2 (CYP), NADH dehydrogenase subunit 5 (NAD5), alcohol
grapes, particularly in cell culture. dehydrogenase 2 (ADH2), V-type proton ATPase 16-kDa proteolipid
subunit (VATP16), 60S ribosomal protein L18-2 (60SRP), ubiquinol-
Reference gene candidates and their amplification efficiency cytochrome-c reductase complex assembly factor 1 (UQCC), 18S
ribosomal RNA (18S rRNA), T-complex protein 1 subunit beta
Twenty-two candidate genes were selected for investigation (VvTCPB), small nuclear ribonucleoprotein (SMD3), ubiquitin carrier
from the relevant literature (actin, AP-2, cyclophilin, EF1-α, protein E2 C (UBE2), and ubiquitin-conjugating enzyme E2-17 kDa
GAPDH, VAG, SAND, α-tubulin, β-tubulin, UBQ-L40, PEP, (UBQ), respectively.
CYP, NAD5, ADH2, VATP16, 60SRP, UQCC, 18S rRNA,
VvTCPB, SMD3, UBE2, and UBQ). These genes had been a mean Cp of 9.4, and SAND had the lowest expression with a
successfully used to normalize RT-qPCR data in previous mean Cp of 29.9. The mean Cp values of the other genes
studies with Vitis vinifera (Table 1). Primers were used for ranged from 23.1 to 29.8. In general, the lowest range of
some candidate genes that were available from sources in variation is the most favorable. The range of variation of the
the literature (actin, AP-2, GAPDH, β-tubulin, 18S rRNA, Cp values of 18s rRNA was less than three amplification cy-
VvTCPB, and UBQ), and others were designed from the tran- cles, and it was less than four cycles for cyclophilin. The
scriptome de novo assembly sequences from spine grape cell largest variance was for AP-2, with more than 12 cycles.
cultures (data not shown). The amplification specificity of the
22 reference gene candidates was assessed by RT-qPCR using
a similar pooled cDNA sample, which consisted of a mixture
of equal amounts of each sample. Fifteen genes were selected
from the 22 genes for an expression stability analysis as indi-
cated by the specific amplification, the expected length of the
single products in agarose gel electrophoresis with EB stain-
ing (Fig. 2), and a melting-curve with a single peak. The 15
genes selected were actin, AP-2, cyclophilin, EF1-α,
GAPDH, VAG, SAND, α-tubulin, β-tubulin, UBQ-L40,
NAD5, ADH2, 60SRP, 18S rRNA, and UBQ. Standard curves
for these 15 genes were constructed using five-fold serial di-
lutions of a pooled cDNA sample. The PCR amplification
efficiencies varied from 1.903 to 2.071 (Table 1).

Expression profiling of the selected reference genes To deter-

mine the range of variation of the selected reference genes, the
expression profiles of all 15 reference genes were analyzed
according to their crossing point (Cp) for all samples (Fig. 3).
The 18s rRNA gene had the highest abundant expression with
Figure 3. Real-time quantitative polymerase chain reaction crossing
point (Cp) values for 15 selected reference genes. Values are given in
the form of Cp values across all experimental samples. The boxes
represent mean Cp values, the bars represent standard deviations.
 IN VITRO PRESERVATION OF OREOCHARIS MILEENSE
The variation of the Cp values in the others was between four
and eight cycles. The analysis revealed obvious changes in the
expression of the selected reference genes in each treatment.
To ensure the reliability of these reference genes, the data had
to be grouped according to treatment.
Expression stability of the 15 reference genes The expression
of the 15 reference genes varied extensively by treatment,
therefore, a statistical analysis was necessary to investigate
the stability of these genes, and to ascertain the optimal num-
ber of reference genes needed to calibrate the gene expression
for each treatment. To obtain more detailed expression profiles
for the selected reference genes, all samples were grouped into
eight treatments according to culture duration, illumination
conditions, UVB exposure duration, temperature, cinnamic
acid, chitosan, KT concentrations, and cell lines. The expres-
sion stability of the 15 reference genes for the eight treatments
was calculated using geNorm, NormFinder, and BestKeeper
statistical algorithms. The appropriateness of the genes was
comprehensively evaluated with RefFinder, which is an inte-
grated tool combining geNorm, Normfinder, comparative
Delta Ct, and BestKeeper. The geometric mean of the individ-
ual gene weights was used to evaluate the comprehensive
ranking of the reference genes, which considered each
method’s rank and stability value.
GeNorm analysis GeNorm software was used to evaluate the
expression stability of the 15 reference genes, and these values
(M) are displayed in Table 2. Gene expression stability is
inversely correlated with the M value, in which a lower M
value indicates more stable expression, while a higher M value
indicates less stable expression. For culture duration, the M
value of ADH2 was the highest, and that of AP-2 and SAND
was the lowest, which showed that ADH2 was the most un-
stable gene, while AP-2 and SAND were the most stable. For
illumination conditions, 60SRP and 18S rRNA had the most
stable expression, and UBQ-L40 was the most unstable. For
UVB exposure, AP-2 and VAG had the most stable expression,
and ADH2 was the most unstable. For temperature differ-
ences, VAG and 60SRP had the most stable expression, and
cyclophilin was the most unstable. For cinnamic acid expo-
sure, AP-2 and 60SRP had the most stable expression, and
cyclophilin was the most unstable. For chitosan treatments,
VAG and α-tubulin had the most stable expression, and AP-2
was the most unstable. For KT exposure, ADH2 and α-tubulin
had the most stable expression, and cyclophilin was the most
unstable. In general, EF1-α and β-tubulin were the most sta-
ble genes among the 15 reference genes, but ADH2 was the
least stable gene in different cell line samples of spine grape.
NormFinder analysis The data for the eight treatments were
further assessed with NormFinder software and compared
with the geNorm results, which indicated that the lower the
expression stability values, the more stable the gene expres-
sion. Table 3 shows that the top five most stable genes were α-
tubulin, EF1-α, VAG, SAND, and AP-2 for culture duration,
while the most unstable gene was ADH2. The geNorm results
for the top five stable genes were in excellent agreement with
NormFinder, but the rank order was different. However, the
most unstable gene was the same. For most other treatments,
NormFinder and geNorm both identified the same top five
stable genes, except for illumination conditions, UVB expo-
sure, and KT treatment (Tables 2 and 3). Interestingly, the
changes in the rank order did not affect the agreement regard-
ing the least stable gene by the two software packages for any
treatment.
BestKeeper analysis The reference gene expression stability
was ranked by the BestKeeper algorithm on the basis of the
standard deviation (SD) and the variation coefficient of the Cp
value. A lower SD value indicated more stable gene expres-
sion, and a higher value indicated greater instability. If the SD
value was greater than 1.0, it was considered inappropriate as
a reference gene. The results of BestKeeper analysis of the
eight data groups are displayed in Table 4. For culture dura-
tion, SD values of the 14 reference genes were less than 1.0,
which indicated little variation in gene expression, and ADH2
with an SD of 1.48 was the most variable. For illumination
conditions, UVB treatment, and temperature, all of the refer-
ence gene candidates showed SD values less than 1.0. For
cinnamic acid exposure, cyclophilin, 18S rRNA, ADH2, β-
tubulin, NAD5, and 60SRP genes had SD values less than
1.0. For chitosan, 14 reference gene candidates had SD values
less than 1.0, but AP-2 with an SD of 4.24 was the most
unstable. For KT treatments, the SD values of cyclophilin,
18S rRNA, and NAD5 were less than 1.0, but the other genes
had SD values greater than 1.0. For the cell lines, actin, 18S
rRNA, cyclophilin, SAND, GAPDH, and EF1-α had SD
values less than 1.0, while SD values of the other genes were
greater than 1.0. The reference gene ranks according to
BestKeeper were different than those ranked by geNorm and
NormFinder (Tables 2, 3, and 4).
RefFinder analysis The reference gene rankings among the
above three algorithms were different; therefore, it was not
possible to find an ideal all-purpose statistical method, so an-
other method was necessary to optimize the data. The com-
prehensive algorithm RefFinder was utilized to assess the
geNorm, NormFinder, and BestKeeper results. RefFinder is
a practical online integrated tool, which is a collection of four
currently available algorithms, including the comparative
ΔΔCt method, geNorm, Normfinder, and BestKeeper.
RefFinder was used to provide an overall final ranking of
the expression stability for the reference genes in all of the
treatments according to the weighted geometric mean of the
rankings of each individual algorithm. The rankings of the
Table 2. Ranking of 15 candidate reference genes in eight subsets of spine grape (Vitis davidii [Rom. Caill.] Foëx.) cell cultures as calculated by geNorm

Rank Differences in culture Illumination conditions UVB exposure Temperature Cinnamic acid Chitosan Kinetin (KT) Cell lines
duration duration concentrations

Genes M Genes M Genes M Genes M Genes M Genes M Genes M Genes M

1 AP-2/SAND 0.11 60SRP/18SrRNA 0.072 AP-2/VAG 0.009 VAG/60SRP 0.048 AP-2/60SRP 0.032 VAG/α-Tubulin 0.045 α-Tubulin/ADH2 0.084 EF1-α/β-Tubulin 0.140
3 VAG 0.185 ADH2 0.106 EF1-α 0.034 SAND 0.069 UBQ-L40 0.104 UBQ 0.207 VAG 0.152 α-Tubulin 0.180
4 EF1-α 0.209 β-Tubulin 0.124 SAND 0.070 Actin 0.103 GAPDH 0.127 SAND 0.228 UBQ 0.179 AP-2 0.240
5 α-Tubulin 0.229 Cyclophilin 0.160 GAPDH 0.096 AP-2 0.168 VAG 0.147 GAPDH 0.278 AP-2 0.228 UBQ-L40 0.261
6 UBQ 0.283 GAPDH 0.202 UBQ 0.124 α-Tubulin 0.196 UBQ 0.162 EF1-α 0.311 Actin 0.252 UBQ 0.291
7 NAD5 0.316 EF1-α 0.239 18SrRNA 0.152 GAPDH 0.212 α-Tubulin 0.176 Actin 0.327 GAPDH 0.276 SAND 0.34
LAI ET AL.

8 Actin 0.344 α-Tubulin 0.259 α-Tubulin 0.168 EF1-α 0.234 EF1-α 0.200 18SrRNA 0.34 SAND 0.300 VAG 0.414
9 Cyclophilin 0.363 AP-2 0.300 Cyclophilin 0.195 NAD5 0.253 NAD5 0.237 60SRP 0.373 EF1-α 0.333 60SRP 0.486
10 UBQ-L40 0.382 NAD5 0.326 β-Tubulin 0.218 ADH2 0.289 β-Tubulin 0.257 Cyclophilin 0.412 60SRP 0.378 NAD5 0.534
11 β-Tubulin 0.416 Actin 0.345 Actin 0.267 UBQ-L40 0.319 SAND 0.310 UBQ-L40 0.442 UBQ-L40 0.406 GAPDH 0.595
12 18SrRNA 0.441 UBQ 0.370 NAD5 0.309 UBQ 0.356 Actin 0.348 β-Tubulin 0.527 β-Tubulin 0.443 18SrRNA 0.646
13 GAPDH 0.46 SAND 0.391 UBQ-L40 0.360 β-Tubulin 0.395 ADH2 0.403 NAD5 0.593 NAD5 0.528 Cyclophilin 0.697
14 60SRP 0.484 VAG 0.416 60SRP 0.407 18SrRNA 0.424 18SrRNA 0.452 ADH2 0.688 18SrRNA 0.594 Actin 0.754
15 ADH2 0.575 UBQ-L40 0.438 ADH2 0.458 Cyclophilin 0.454 Cyclophilin 0.528 AP-2 1.390 Cyclophilin 0.662 ADH2 0.811

M Expression stability value

Table 3. Ranking of 15 candidate reference genes in eight subsets of spine grape (Vitis davidii [Rom. Caill.] Foëx.) cell cultures as calculated by Normfinder

Rank Differences in culture duration Illumination conditions UVB exposure duration Temperature Cinnamic acid Chitosan Kinetin (KT) concentrations Cell lines

Genes SV Genes SV Genes SV Genes SV Genes SV Genes SV Genes SV Genes SV

1 α-Tubulin 0.038 α-Tubulin 0.070 UBQ 0.021 VAG 0.031 AP-2 0.016 α-Tubulin 0.022 SAND 0.072 β-Tubulin 0.07
2 EF1-α 0.076 EF1-α 0.105 α-Tubulin 0.050 EF1-α 0.089 60SRP 0.026 UBQ 0.077 Actin 0.109 EF1-α 0.07
3 VAG 0.091 β-Tubulin 0.167 18SrRNA 0.084 60SRP 0.108 GAPDH 0.166 SAND 0.084 AP-2 0.165 α-Tubulin 0.087
4 SAND 0.176 AP-2 0.209 Cyclophilin 0.132 SAND 0.154 NAD5 0.178 VAG 0.172 ADH2 0.233 AP-2 0.192
5 AP-2 0.207 18SrRNA 0.264 SAND 0.150 Actin 0.181 UBQ-L40 0.186 UBQ-L40 0.275 UBQ 0.275 UBQ-L40 0.219
6 UBQ-L40 0.308 NAD5 0.299 EF1-α 0.197 NAD5 0.257 β-Tubulin 0.186 Cyclophilin 0.371 α-Tubulin 0.317 UBQ 0.328
7 GAPDH 0.36 UBQ 0.318 VAG 0.201 α-Tubulin 0.279 VAG 0.209 18SrRNA 0.447 β-Tubulin 0.326 SAND 0.440
8 NAD5 0.379 60SRP 0.331 AP-2 0.202 AP-2 0.286 UBQ 0.228 Actin 0.504 EF1-α 0.343 GAPDH 0.628
9 UBQ 0.463 ADH2 0.336 GAPDH 0.204 UBQ 0.363 EF1-α 0.234 EF1-α 0.560 VAG 0.425 VAG 0.651
10 18SrRNA 0.463 Actin 0.367 β-Tubulin 0.255 GAPDH 0.379 α-Tubulin 0.305 60SRP 0.582 GAPDH 0.428 18SrRNA 0.738
11 Cyclophilin 0.473 GAPDH 0.395 UBQ-L40 0.501 UBQ-L40 0.436 ADH2 0.542 GAPDH 0.583 UBQ-L40 0.700 60SRP 0.785
12 β-Tubulin 0.495 SAND 0.395 Actin 0.566 18SrRNA 0.502 SAND 0.635 NAD5 0.805 60SRP 0.735 Cyclophilin 0.854
13 60SRP 0.500 VAG 0.485 60SRP 0.607 β-Tubulin 0.503 18SrRNA 0.639 β-Tubulin 1.066 NAD5 0.815 NAD5 0.862
IN VITRO PRESERVATION OF OREOCHARIS MILEENSE

14 Actin 0.521 Cyclophilin 0.492 NAD5 0.607 ADH2 0.565 Actin 0.667 ADH2 1.082 18SrRNA 0.865 ADH2 1.068
15 ADH2 1.132 UBQ-L40 0.518 ADH2 0.773 Cyclophilin 0.591 Cyclophilin 1.013 AP-2 5.929 Cyclophilin 1.086 Actin 1.080

SV stability value
Table 4. Ranking of 15 candidate reference genes in eight subsets of spine grape (Vitis davidii [Rom. Caill.] Foëx.) cell cultures as calculated by Bestkeeper

Rank Differences in culture duration Illumination conditions UVB exposure duration Temperature Cinnamic acid Chitosan Kinetin (KT) concentrations Cell lines

Genes SD Genes SD Genes SD Genes SD Genes SD Genes SD Genes SD Genes SD

1 Actin 0.26 α-Tubulin 0.16 NAD5 0.17 Cyclophilin 0.22 Cyclophilin 0.28 UBQ-L40 0.26 Cyclophilin 0.56 Actin 0.24
2 UBQ 0.24 18SrRNA 0.16 β-Tubulin 0.21 18SrRNA 0.36 18SrRNA 0.57 SAND 0.27 18SrRNA 0.66 18SrRNA 0.50
3 AP-2 0.31 β-Tubulin 0.18 18SrRNA 0.31 UBQ 0.52 ADH2 0.60 α-Tubulin 0.3 NAD5 0.69 Cyclophilin 0.72
4 SAND 0.31 60SRP 0.19 Actin 0.33 β-Tubulin 0.53 β-Tubulin 0.88 Cyclophilin 0.31 β-Tubulin 1.03 SAND 0.80
5 Cyclophilin 0.36 UBQ 0.21 SAND 0.33 EF1-α 0.6 NAD5 0.90 VAG 0.33 SAND 1.21 GAPDH 0.9
6 NAD5 0.37 EF1-α 0.22 EF1-α 0.4 α-Tubulin 0.61 60SRP 0.99 UBQ 0.35 Actin 1.32 EF1-α 0.99
7 β-Tubulin 0.43 ADH2 0.23 AP-2 0.42 VAG 0.64 AP-2 1.01 60SRP 0.46 EF1-α 1.35 β-Tubulin 1.04
LAI ET AL.

8 α-Tubulin 0.45 UBQ-L40 0.27 VAG 0.42 AP-2 0.66 UBQ-L40 1.10 EF1-α 0.52 AP-2 1.36 UBQ 1.08
9 EF1-α 0.48 AP-2 0.28 Cyclophilin 0.43 60SRP 0.66 EF1-α 1.12 Actin 0.55 UBQ 1.46 AP-2 1.18
10 VAG 0.48 SAND 0.32 α-Tubulin 0.44 Actin 0.7 GAPDH 1.13 GAPDH 0.55 ADH2 1.51 α-Tubulin 1.18
11 18SrRNA 0.52 Cyclophilin 0.33 GAPDH 0.47 SAND 0.7 α-Tubulin 1.14 18SrRNA 0.56 α-Tubulin 1.57 UBQ-L40 1.31
12 UBQ-L40 0.61 VAG 0.37 UBQ 0.47 NAD5 0.73 VAG 1.16 ADH2 0.62 GAPDH 1.62 VAG 1.61
13 GAPDH 0.70 GAPDH 0.38 UBQ-L40 0.7 GAPDH 0.78 UBQ 1.17 NAD5 0.74 VAG 1.62 ADH2 1.66
14 60SRP 0.82 NAD5 0.38 60SRP 0.7 UBQ-L40 0.85 SAND 1.29 β-Tubulin 0.95 UBQ-L40 1.69 NAD5 1.73
15 ADH2 1.04 Actin 0.42 ADH2 0.81 ADH2 0.93 Actin 1.47 AP-2 4.24 60SRP 1.82 60SRP 1.75

SD standard deviation
Table 5. The comprehensive ranking of 15 candidate reference genes in eight subsets of spine grape (Vitis davidii [Rom. Caill.] Foëx.) cell cultures calculated by RefFinder

Rank Differences in culture duration Illumination conditions UVB exposure duration Temperature Cinnamic acid Chitosan Kinetin (KT) concentrations Cell lines

Genes GRV Genes GRV Genes GRV Genes GRV Genes GRV Genes GRV Genes GRV Genes GRV

1 SAND 2.45 α-Tubulin 2.00 UBQ 2.85 VAG 1.63 AP-2 1.63 α-Tubulin 1.73 Actin 2.91 β-Tubulin 2.14
2 VAG 3 18SrRNA 2.24 18SrRNA 3.98 60SRP 2.63 60SRP 2.45 UBQ 2.45 ADH2 2.99 EF1-α 2.21
3 AP-2 3.16 β-Tubulin 3.22 VAG 4.14 EF1-α 4.23 GAPDH 3.94 VAG 2.51 SAND 3.56 α-Tubulin 3.08
4 α-Tubulin 3.56 EF1-α 3.60 SAND 4.16 SAND 4.36 UBQ-L40 4.68 SAND 3.13 α-Tubulin 4.26 AP-2 4.90
5 EF1-α 3.56 60SRP 4.00 α-Tubulin 4.23 Actin 5.76 NAD5 5.96 UBQ-L40 4.96 AP-2 4.36 SAND 6.09
6 UBQ 4.7 ADH2 5.80 AP-2 4.60 α-Tubulin 6.70 VAG 6.77 EF1-α 6.82 UBQ 5.73 UBQ-L40 6.09
7 NAD5 6.96 AP-2 6.00 EF1-α 4.82 AP-2 7.09 β-Tubulin 6.82 Cyclophilin 7.00 VAG 7.04 UBQ 6.45
8 Actin 7.05 UBQ 7.84 β-Tubulin 6.69 UBQ 7.54 Cyclophilin 7.62 Actin 7.61 β-Tubulin 7.61 18SrRNA 7.00
9 UBQ-L40 8.11 NAD5 8.6 NAD5 6.84 Cyclophilin 7.62 UBQ 7.82 GAPDH 7.67 Cyclophilin 7.62 Actin 7.36
10 Cyclophilin 8.39 Cyclophilin 10.00 Cyclophilin 7.35 NAD5 7.90 ADH2 8.29 18SrRNA 8.38 EF1-α 8.21 GAPDH 7.93
11 GAPDH 9.86 GAPDH 10.04 GAPDH 8.11 18SrRNA 7.97 18SrRNA 8.45 60SRP 8.68 18SrRNA 8.61 Cyclophilin 8.83
12 β-Tubulin 10.47 Actin 11.33 Actin 8.92 GAPDH 9.51 EF1-α 8.49 NAD5 12.49 NAD5 9.01 VAG 9.12
13 18SrRNA 11.22 SAND 11.70 UBQ-L40 12.18 β-Tubulin 9.68 α-Tubulin 9.37 β-Tubulin 12.98 GAPDH 9.05 60SRP 11.31
IN VITRO PRESERVATION OF OREOCHARIS MILEENSE

14 60SRP 13.74 UBQ-L40 12.82 60SRP 13.49 UBQ-L40 11.68 SAND 12.2 ADH2 13.47 UBQ-L40 11.68 NAD5 12.16
15 ADH2 15.00 VAG 13.22 ADH2 15.00 ADH2 13.09 Actin 13.45 AP-2 15.00 60SRP 12.12 ADH2 14.23

GRV geomean of ranking values

 LAI ET AL.

Figure 4. Pairwise variation (V(n/

n + 1))
analysis of the candidate
reference genes. Determination of
the optimal number of reference
genes for normalization via
pairwise variation (V(n/n + 1))
calculated by geNorm software.
A threshold value of 0.15 was
adopted below, which represents
n genes adequate for
normalization.

reference genes from four algorithms, and the comprehensive
RefFinder ranking were obtained by inputting the Cp values
into this integrated tool. The results from all treatments ac-
cording to RefFinder are shown in Table 5. The stability rank-
ings of the reference gene candidates for each treatment by
RefFinder shared a high uniformity with the rankings obtained
from geNorm and Normfinder (Tables 2 and 3). The top four
or five genes were basically the same with slight differences in
the ranking. However, some obvious differences were appar-
ent between the RefFinder and BestKeeper rankings (Table 4).
These analyses illustrated that the geNorm and Normfinder
rankings satisfied the accuracy requirements of RT-qPCR.
These analyses also indicated the potential value of
RefFinder for optimizing reference gene choices for RT-
qPCR.
Confirmation of the optimal number of reference genes To
enhance the applicability of reference gene candidates obtain-
ed by the above-combined analyses, the optimal number of
reference genes required for accurate normalization was sug-
gested by geNorm and was based on the pairwise variation
(V(n/n + 1)) between two sequential normalization factors NFn
and NFn + 1. More reference genes are recommended until the
V (n/n + 1) value reaches a threshold of less than 0.15
(Vandesompele et al. 2002). The optimal number of reference
genes for the eight treatments is shown in Fig. 4. The analysis
indicated that the pairwise variation of the V2/3 values for the
eight treatments was less than the threshold of 0.15. Therefore,
the two most stable reference genes for the eight test groups
are shown in Table 6, based on the above analyses, thus elim-
inating obstacles from genes with large expression variability.
The ideal reference gene combinations for culture duration
were SAND and VAG, and α-tubulin and β-tubulin for illumi-
nation conditions, UBQ and VAG for UVB exposure, VAG and
60SRP for temperature, AP-2 and 60SRP for cinnamic acid, α-
tubulin and UBQ for chitosan, actin and ADH2 for KT, and β-
tubulin and EF1-α for the cell lines.
These ideal reference gene combinations for eight different
experimental treatments at the cellular level were obviously
different from the predecessor’s researches in grape plants.
For example, some reference genes were utilized for normal-
ization in grape berry development studies (Reid et al. 2006),
such as α-tubulin, actin, AP-2, cyclophilin, EF1-α, GAPDH,
SAND, β-tubulin, and UBQ-L40. Three genes, VAG, CYP, and
PEP, were the most stable reference genes to be used under
biotic and abiotic stress in Vitis vinifera (Borges et al. 2014).
The gene NAD5 was validated as a stable reference gene for
grapevine leaves (Gutha et al. 2010). The expression stability
of seven genes was studied in pterostilbene synthesis of grape-
vine (Gamm et al. 2011), including ADH2, UBE2, VATP16,
60SRP, UQCC, SMD3, and 18S rRNA. The gene VvTCPB was
found to be the most stable gene to study grape genotypes and

Table 6. The most stable reference genes and the best combinations for eight experimental groups

Subsets Top most stable gene Optimal number Two most stable combination The least stable gene

Differences in culture duration SAND, VAG, AP-2, α-Tubulin, EF1-α V2/3 SAND, VAG, ADH2
Illumination conditions α-Tubulin, β-Tubulin, EF1-α, 60SRP V2/3 α-Tubulin, β-Tubulin VAG
UVB exposure duration UBQ, VAG, SAND, α-Tubulin V2/3 UBQ, VAG ADH2
Temperature VAG, 60SRP, EF1-α, SAND, Actin V2/3 VAG, 60SRP ADH2
Cinnamic acid AP-2, 60SRP, GAPDH, UBQ-L40, NAD5 V2/3 AP-2, 60SRP Actin
Chitosan α-Tubulin, UBQ, VAG, SAND, UBQ-L40 V2/3 α-Tubulin, UBQ AP-2
Kinetin (KT) concentrations Actin, ADH2, SAND, α-Tubulin, AP-2 V2/3 Actin, ADH2 60SRP
Cell lines β-Tubulin, EF1-α, α-Tubulin, AP-2, SAND V2/3 β-Tubulin, EF1-α ADH2
 IN VITRO PRESERVATION OF OREOCHARIS MILEENSE

Figure 5. Relative expression

levels of the target gene
dihydroflavonol 4-reductase
(DFR) normalized with different
reference gene(s). (a, b, c, d)
Relative expression of DFR in
different spine grape (Vitis davidii
[Rom. Caill.] Foëx.) cell lines at
different culture times. (e, f, g, h)
Relative expression of DFR under
different concentrations of
cinnamic acid.

phenological stages (Monteiro et al. 2013) and GAPDH and
UBQ were the most reliable genes to study the effect of geno-
type in susceptible and resistant Vitis vinifera cultivars
(Monteiro et al. 2013). Therefore, it was very necessary to
validate the most stable reference gene(s) before trials are
conducted under different experimental conditions. It was in-
teresting that the 18S rRNA gene showed highly stable
expression under illumination conditions or with UVB treat-
ment, but also had a low Cp value (< 10 cycles) with the large
quantity transcripts in these samples. Previous studies showed
that some problems might be encountered when using this
gene as a reference in gene expression analysis of chicory
(Maroufi et al. 2010). Therefore, the 18S rRNA gene was
not used as a reference gene in the following study.
 LAI ET AL.
Demonstration of the usefulness of the recommended refer-
ence genes Dihydroflavonol 4-reductase (DFR, GenBank ac-
cession number KF915803), is a member of the short-chain
dehydrogenase family, and catalyzes the NADPH-dependent
reduction of dihydroflavonols to flavan 3,4-diols (Petit et al.
2007), which is the last common step in the biosynthesis of
flavan-3-ols and condensed tannins (Trabelsi et al. 2011). For
different cell cultures of spine grape with different culture
durations, SAND, VAG, and AP-2 were used as the most stable
reference genes, while ADH2 was the most unstable gene. The
expression profiles of DFR showed similar variation with little
differences when normalized with SAND and SAND + VAG
(Fig. 5a, b). The trend of DFR expression first decreased, then
increased, and decreased again, which indicated that two sta-
ble reference genes were adequate for valid normalization.
When normalized with SAND + VAG + AP-2, the expression
profiles of DFR increased at 45 d (Fig. 5c), which illustrated
that the precision of RT-qPCR could be reduced when an
unnecessary reference gene was added. However, the opposite
result was obtained with ADH2 as the reference gene, that is,
the expression of DFR was increased at first and then de-
creased (Fig. 5d), which showed that it is necessary to select
reliable reference genes for normalization.
For different cell cultures of spine grape grown in different
concentrations of cinnamic acid, AP-2, 60SRP, and GAPDH
were utilized as the three most stable genes for normalization,
while Actin was the lowest ranked gene. The expression pro-
files of DFR indicated similar variation when AP-2, AP-2 +
60SRP, AP-2 + 60SRP + GAPDH, or actin were used as the
reference gene(s) (Fig. 5e–h). A higher concentration of
cinnamic acid led to greater expression of DFR. The expres-
sion of DFR was slightly different when normalized with AP-
2, AP-2 + 60SRP, and AP-2 + 60SRP + GAPDH. However,
DFR expression was over-estimated more than two-fold in
cell cultures with 20 mg L−1 or 40 mg L−1 cinnamic acid when
normalized with Actin, which illustrated that normalization
with an inappropriate reference gene had an adverse impact
on the reliability of the experimental results.
According to the above testing, the DFR expression pro-
files were almost the same when one or two of the most stable
reference genes were utilized. To improve the veracity of RT-
qPCR, the number of reference genes must be considered in
the standard revision of the test results. However, when the
pairwise variation V2/3 values were less than the threshold of
0.15, no additional reference genes should be introduced. The
precision of RT-qPCR could even be reduced if unnecessary
reference genes are added. In the present study, a combination
of two stable reference genes was confirmed for specific ex-
periments. The DFR expression profiles changed if inappro-
priate reference genes were used, which indicated that differ-
ent reference gene(s) were necessary to normalize data for
different treatments because factors such as the RNA quantity
and quality, reverse transcription efficiency, and PCR
amplification will all affect the accuracy of the RT-qPCR.
The use of inappropriate reference genes may cause bias and
even result in misleading conclusions.
Conclusions
This study is the first attempt to identify reference genes for
RT-qPCR in cell cultures of spine grape. The expression sta-
bility of 15 reference gene candidates was surveyed using a
large number of test samples from eight treatments. The re-
sults showed that different appropriate reference genes and
different numbers of reference genes must be used to normal-
ize the data. The DFR expression analysis verified the reliabil-
ity of the validated reference genes and confirmed that vali-
dated reference genes were essential to improve the accuracy
of RT-qPCR. The results of the present study offer the most
robust platform for the most precise and broad application of
RT-qPCR to investigate gene expression associated with an-
thocyanin biosynthesis in spine grape cell cultures.
Funding information This work was supported by Fujian provincial nat-
ural science fund subject (no. 2016J01126), Fujian Provincial Department
of Science and Technology of special public-funded projects (no.
2016R1014-1), and FAAS Scientific and Technological Innovation
Team (grant no. STIT2017-1-10).
References
Abdullah MA, Lajis NH, Ali AM, Marziah M, Sinskey AJ, Rha C (2005)
Issues in plant cell culture engineering for enhancement of produc-
tivity. Asia Pac J Chem Eng 13:573–587. https://doi.org/10.1002/
apj.5500130507
Andersen CL, Jensen JL, Ørntoft TF (2004) Normalization of real-time
quantitative reverse transcription-PCR data: a model-based variance
estimation approach to identify genes suited for normalization, ap-
plied to bladder and colon cancer data sets. Cancer Res 64:5245–
5250. https://doi.org/10.1158/0008-5472.CAN-04-0496
Bochi VC, Barcia MT, Rodrigues D, Godoy HT (2015) Biochemical
characterization of Dovyalis hebecarpa fruits: a source of anthocy-
anins with high antioxidant capacity. J Food Sci 80:2127–2133.
https://doi.org/10.1111/1750-3841.12978
Bogs J, Ebadi A, McDavid D, Robinson SP (2006) Identification of the
flavonoid hydroxylases from grapevine and their regulation during
fruit development. Plant Physiol 140:279–291. https://doi.org/10.
1104/pp.105.073262
Borges A, Tsai SM, Caldas DGGC (2012) Validation of reference genes
for RT-qPCR normalization in common bean during biotic and abi-
otic stresses. Plant Cell Rep 31:827–838. https://doi.org/10.1007/
s00299-011-1204-x
Borges AF, Fonseca C, Ferreira RB, Lourenço AM, Monteiro S (2014)
Reference gene validation for quantitative RT-PCR during biotic and
abiotic stresses in Vitis vinifera. PLoS One 9:e111399. https://doi.
org/10.1371/journal.pone.0111399
Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible W-R (2005)
Genome-wide identification and testing of superior reference genes
for transcript normalization in Arabidopsis. Plant Physiol 139:5–17.
https://doi.org/10.1104/pp.105.063743
 IN VITRO PRESERVATION OF OREOCHARIS MILEENSE
Davis G, Ananga A, Krastanova S, Sutton S, Ochieng JW, Leong S,
Tsolova V (2012) Elevated gene expression in chalcone synthase
enzyme suggests an increased production of flavonoids in skin and
synchronized red cell cultures of North American native grape
berries. DNA Cell Biol 31:939–945. https://doi.org/10.1089/dna.
2011.1589
Decendit A, Mérillon JM (1996) Condensed tannin and anthocyanin pro-
duction in Vitis vinifera cell suspension cultures. Plant Cell Rep 15:
762–765. https://doi.org/10.1007/BF00232224
Dörnenburg H, Knorr D (1995) Strategies for the improvement of second-
ary metabolite production in plant cell cultures. Enzym Microb
Technol 17:674–684. https://doi.org/10.1016/0141-0229(94)00108-4
Espinoza C, Medina C, Somerville S, Arce-Johnson P (2007)
Senescence-associated genes induced during compatible viral inter-
actions with grapevine and Arabidopsis. J Exp Bot 58:3197–3212.
https://doi.org/10.1093/jxb/erm165
Freitas NC, Barreto HG, Fernandes-Brum CN, Moreira RO, Chalfun-
Junior A, Paiva LV (2017) Validation of reference genes for qPCR
analysis of Coffea arabica L. somatic embryogenesis-related tis-
sues. Plant Cell Tissue Organ Cult 128:663–678. https://doi.org/
10.1007/s11240-016-1147-6
Gamm M, Héloir M-C, Kelloniemi J, Poinssot B, Wendehenne D, Adrian
M (2011) Identification of reference genes suitable for qRT-PCR in
grapevine and application for the study of the expression of genes
involved in pterostilbene synthesis. Mol Gen Genomics 285:273–
285. https://doi.org/10.1007/s00438-011-0607-2
Ginzinger DG (2002) Gene quantification using real-time quantitative
PCR: an emerging technology hits the mainstream. Exp Hematol
30:503–512. https://doi.org/10.1016/S0301-472X(02)00806-8
González-Agüero M, García-Rojas M, Genova AD, Correa J, Maass A,
Orellana A, Hinrichsen P (2013) Identification of two putative ref-
erence genes from grapevine suitable for gene expression analysis in
berry and related tissues derived from RNA-Seq data. BMC
Genomics 14:878. https://doi.org/10.1186/1471-2164-14-878
Guerrero C J, Ciampi P L, Castilla C A, Medel S F, Schalchli S H,
Hormazabal U E, Bensch T E, Alberdi L M (2010) Antioxidant
capacity, anthocyanins, and total phenols of wild and cultivated
berries in Chile. Chil J Agr Res 70537–544 https://doi.org/10.
4067/S0718-58392010000400002, 70, 537
Gutha LR, Casassa LF, James F Harbertson JF, Naidu RA (2010)
Modulation of flavonoid biosynthetic pathway genes and anthocy-
anins due to virus infection in grapevine (Vitis vinifera L.) leaves.
BMC Plant Biol 10:187. https://doi.org/10.1186/1471-2229-10-187
Gutierrez L, Mauriat M, Guénin S, Pelloux J, Lefebvre J-F, Louvet R,
Rusterucci C, Moritz T, Guerineau F, Bellini C, Van Wuytswinkel O
(2008) The lack of a systematic validation of reference genes: a
serious pitfall undervalued in reverse transcription-polymerase chain
reaction (RT-PCR) analysis in plants. Plant Biotechnol J 6:609–618.
https://doi.org/10.1111/j.1467-7652.2008.00346.x
He F, Mu L, Yan GL, Liang NN, Pan QH, Wang J, Reeves MJ, Duan CQ
(2010) Biosynthesis of anthocyanins and their regulation in colored
grapes. Molecules 15:9057–9091. https://doi.org/10.3390/
molecules15129057
Hidalgo G-I, Almajano MP (2017) Red fruits: extraction of antioxidants,
phenolic content, and radical scavenging determination: a review.
Antioxid 6:7. https://doi.org/10.3390/antiox6010007
Holton TA, Cornish EC (1995) Genetics and biochemistry of anthocyanin
biosynthesis. Plant Cell 7:1071–1083. https://doi.org/10.1105/tpc.7.
7.1071
Hu RB, Fan CM, Li HY, Zhang QZ, Fu YF (2009) Evaluation of putative
reference genes for gene expression normalization in soybean by
quantitative real-time RT-PCR. BMC Mol Biol 10:93. https://doi.
org/10.1186/1471-2199-10-93
Huggett J, Dheda K, Bustin S, Zumla A (2005) Real-time RT-PCR nor-
malisation; strategies and considerations. Genes Immun 6:279–284.
https://doi.org/10.1038/sj.gene.6364190
Isah T, Umar S, Mujib A, Sharma MP, Rajasekharan PE, Zafar N, Frukh
A (2018) Secondary metabolism of pharmaceuticals in the plant in
vitro cultures: strategies, approaches, and limitations to achieving
higher yield. Plant Cell Tissue Organ Cult 132:239–265. https://
doi.org/10.1007/s11240-017-1332-2
Jian B, Liu B, Bi YR, Hou WS, Wu CX, Han TF (2008) Validation of
internal control for gene expression study in soybean by quantitative
real-time PCR. BMC Mol Biol 9:59. https://doi.org/10.1186/1471-
2199-9-59
Karaaslan M, Ozden M, Vardin H, Yilmaz FM (2013) Optimisation of
phenolic compound biosynthesis in grape (Bogazkere Cv.) callus
culture. Afr J Biotechnol 12:3922–3933. https://doi.org/10.5897/
AJB2013.12344
Katayama-Ikegami A, Katayama T, Takai M, Sakamoto T (2016)
Reference gene validation for gene expression studies using quanti-
tative RT-PCR during berry development of ‘Aki Queen’ grapes.
Vitis 55:157–160. https://doi.org/10.5073/vitis.2016.55.157-160
Lai CC, Fan LH, Huang XG, Xie HG (2014) Callus induction in brier
grape (Vitis davidii Foëx) from immature embryos and screening of
cell lines with high-production of oligomeric proanthocyanidins.
Plant Physiol J 50:1683–1691. https://doi.org/10.13592/j.cnki.ppj.
2014.0326
Landi M, Tattini M, Gould KS (2015) Multiple functional roles of antho-
cyanins in plant-environment interactions. Environ Exp Bot 119:4–
17. https://doi.org/10.1016/j.envexpbot.2015.05.012
Libault M, Thibivilliers S, Bilgin DD, Radwan O, Benitez M, Clough SJ,
Stacey G (2008) Identification of four soybean reference genes for
gene expression normalization. Plant Genome 1:44–54. https://doi.
org/10.3835/plantgenome2008.02.0091
Maroufi A, Van Bockstaele E, De Loose M (2010) Validation of reference
genes for gene expression analysis in chicory (Cichorium intybus)
using quantitative real-time PCR. BMC Mol Biol 11:15. https://doi.
org/10.1186/1471-2199-11-15
Meng JF, Fang YL, Qin MY, Zhuang XF, Zhang ZW (2012) Varietal
differences among the phenolic profiles and antioxidant properties
of four cultivars of spine grape (Vitis davidii Foex.) in Chongyi
County (China). Food Chem 134:2049–2056. https://doi.org/10.
1016/j.foodchem.2012.04.005
Monteiro F, Sebastiana M, Pais MS, Figueiredo A (2013) Reference gene
selection and validation for the early responses to downy mildew
infection in susceptible and resistant Vitis vinifera cultivars. PLoS
One 8:e72998. https://doi.org/10.1371/journal.pone.0072998
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio
assays with tobacco tissue cultures. Physiol Plant 15:473–497
Mushtaq MA, Pan Q, Chen D, Zhang Q, Ge X, Li Z (2016) Comparative
leaves transcriptome analysis emphasizing on accumulation of an-
thocyanins in Brassica: molecular regulation and potential interac-
tion with photosynthesis. Front Plant Sci 7(311). https://doi.org/10.
3389/fpls.2016.00311
Nicot N, Hausman J-F, Hoffmann L, Evers D (2005) Housekeeping gene
selection for real-time RT-PCR normalization in potato during biotic
and abiotic stress. J Exp Bot 56:2907–2914. https://doi.org/10.1093/
jxb/eri285
Nolan T, Hands RE, Bustin SA (2006) Quantification of mRNA using
real-time RT-PCR. Nat Protoc 1:1559–1582. https://doi.org/10.
1038/nprot.2006.236
Oksman-Caldentey K-M, Inzé D (2004) Plant cell factories in the post-
genomic era: new ways to produce designer secondary metabolites.
Trends Plant Sci 9:433–440. https://doi.org/10.1016/j.tplants.2004.
07.006
Petit P, Granier T, d’Estaintot BL, Manigand C, Bathany K, Schmitter J-
M, Lauvergeat V, Hamdi S, Gallois B (2007) Crystal structure of
grape dihydroflavonol 4-reductase, a key enzyme in flavonoid bio-
synthesis. J Mol Biol 368:1345–1357. https://doi.org/10.1016/j.jmb.
2007.02.088
 LAI ET AL.
Petrella DP, Metzger JD, Blakeslee JJ, Nangle EJ, Gardner DS (2016)
Anthocyanin production using rough bluegrass treated with high-
intensity light. HortScience 51:1111–1120. https://doi.org/10.
21273/HORTSCI10878-16
Pfaffl MW, Hageleit M (2001) Validities of mRNA quantification using
recombinant RNA and recombinant DNA external calibration
curves in real-time RT-PCR. Biotechnol Lett 23:275–282
Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination
of stable housekeeping genes, differentially regulated target genes
and sample integrity: BestKeeper—Excel-based tool using pair-
wise correlations. Biotechnol Lett 26:509–515. https://doi.org/10.
1023/B:BILE.0000019559.84305.47
Reid KE, Niclas Olsson N, Schlosser J, Peng F, Lund ST (2006) An
optimized grapevine RNA isolation procedure and statistical deter-
mination of reference genes for real-time RT-PCR during berry de-
velopment. BMC Plant Biol 6:1–11. https://doi.org/10.1186/1471-
2229-6-27
Sato K, Nakayama M, Shigeta J (1996) Culturing conditions affecting the
production of anthocyanin in suspended cell cultures of strawberry.
Plant Sci 11:391–398. https://doi.org/10.1016/0168-9452(95)
05694-7
Schaefer HM, Schaefer V, Levey DJ (2004) How plant-animal interac-
tions signal new insights in communication. Trends Ecol Evol 19:
577–584. https://doi.org/10.1016/j.tree.2004.08.003
Selim M, Legay S, Berkelmann-Löhnertz B, Langen G, Kogel K-H,
Evers D (2012) Identification of suitable reference genes for real-
time RT-PCR normalization in the grapevine-downy mildew
pathosystem. Plant Cell Rep 31:205–216. https://doi.org/10.1007/
s00299-011-1156-1
Simões C, Albarello N, de Castro T C, Mansur E (2012) Production of
anthocyanins by plant cell and tissue culture strategies, in: I.E.
Orhan (Ed.), Biotechnological production of plant secondary metab-
olites. Bentham eBooks pp. 67–86 https://doi.org/10.2174/
978160805114411201010067
Solfanelli C, Poggi A, Loreti E, Alpi A, Perata P (2006) Sucrose-specific
induction of the anthocyanin biosynthetic pathway in Arabidopsis.
Plant Physiol 140:637–646. https://doi.org/10.1104/pp.105.072579
Stintzing FC, Carle R (2004) Functional properties of anthocyanins and
betalains in plants, food, and in human nutrition. Trends Food Sci
Technol 15:19–38. https://doi.org/10.1016/j.tifs.2003.07.004
Tashiro RM, Philips JG, Winefield CS (2016) Identification of suitable
grapevine reference genes for qRT-PCR derived from heterologous
species. Mol Gen Genomics 291:483–492. https://doi.org/10.1007/
s00438-015-1081-z
Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G,
Grisar T, Igout A, Heinen E (1999) Housekeeping genes as internal
standards: use and limits. J Biotechnol 75:291–295. https://doi.org/
10.1016/S0168-1656(99)00163-7
Trabelsi N, d’Estaintot BL, Sigaud G, Gallois B, Chaudière J (2011) Kinetic
and binding equilibrium studies of dihydroflavonol 4-reductase from
Vitis vinifera and its unusually strong substrate inhibition. J Biophys
Chem 2:332–344. https://doi.org/10.4236/jbpc.2011.23038
Upadhyay A, Jogaiah S, Maske SR, Kadoo NY, Gupta VS (2015)
Expression of stable reference genes and SPINDLY gene in re-
sponse to gibberellic acid application at different stages of grapevine
development. Biol Plant 59:436–444. https://doi.org/10.1007/
s10535-015-0521-2
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe
A, Speleman F (2002) Accurate normalization of real-time quanti-
tative RT-PCR data by geometric averaging of multiple internal
control genes. Genome Biol 3(7):research 0034. https://doi.org/10.
1186/gb-2002-3-7-research0034
Wallace TC (2011) Anthocyanins in cardiovascular disease. Adv Nutr 2:
1–7. https://doi.org/10.3945/an.110.000042
Winkel-Shirley B (2001) Flavonoid biosynthesis: a colorful model for
genetics, biochemistry, cell biology, and biotechnology. Plant
Physiol 126:485–493. https://doi.org/10.1104/pp.126.2.485
Wong ML, Medrano JF (2005) Real-time PCR for mRNA quantitation.
BioTechniques 39:1–11 https://www.biotechniques.com/
multimedia/archive/00011/BTN_A_05391RV01_O_11901a.pdf
Wrolstad RE (2004) Anthocyanin pigments—bioactivity and coloring
properties. J Food Sci 69:C419–C425. https://doi.org/10.1111/j.
1365-2621.2004.tb10709.x
Wu J, Zhang H, Liu L, Li W, Wei Y, Shi S (2016) Validation of reference
genes for RT-qPCR studies of gene expression in preharvest and
postharvest longan fruits under different experimental conditions.
Front Plant Sci 7(780). https://doi.org/10.3389/fpls.2016.00780
Zhang W, Furusaki S (1999) Production of anthocyanins by plant cell
cultures. Biotechnol Bioproc E 4:231–252 https://link.springer.com/
content/pdf/10.1007%2FBF02933747.pdf