Beruflich Dokumente
Kultur Dokumente
DOI 10.1007/s00535-012-0579-y
Received: 21 December 2011 / Accepted: 28 February 2012 / Published online: 30 March 2012
Ó Springer 2012
123
J Gastroenterol (2012) 47:1228–1237 1229
123
1230 J Gastroenterol (2012) 47:1228–1237
Table 1 Characteristics of the patients enrolled in this study direct sequencing (BigDye Terminator; Applied Biosys-
Characteristic No. of patients or median Range
tems). A 2-ll sample of the genomic DNA extracted from a
whole blood sample was amplified over 40 cycles of PCR.
Gender (male/female) 14/16 The PCR thermal profile comprised an initial denaturation at
Age (years) 56 31–71 95 °C for 10 min and 40 cycles of amplification (denatur-
BMI (kg/m2) 24.5 19.4–32.0 ation at 95 °C for 60 s, annealing at 55 °C for 60 s, and
rs8099917 (TT/TG or GG) 25/5 extension at 72 °C for 60 s). The forward primer for
rs1127354 (AA/AC or CC) 7/23 rs8099917 was TTTGTCACTGTTCCTCCTTTTG and the
rs11697186 (TT/TA or AA) 7/23 reverse primer was TGCTGGGCCCTAACTGATAC. The
WBC (/mm3) 4500 3100–7700 forward primer for rs1127354 was ATGAGAAAGG
Hemoglobin (g/dl) 13.6 10.5–16.6 CGGATGACAG and the reverse primer was CGGCACT
Hematocrit (%) 40.8 32.0–48.6 TATCAGGGAAACA.
Platelets (9104/mm3) 14.0 8.9–37.4
AST (IU/l) 55 17–228 Measurement of serum EPO and thrombopoietin (TPO)
ALT (IU/l) 81 14–397 levels
c-GT (IU/l) 43 11–219
LDH (IU/l) 339 135–594 Serum levels of EPO were measured using an ELISA (EPO
Albumin (g/dl) 4.1 2.6–5.0 ELISA; Roche, Mannheim, Germany) in stored blood
T-bilirubin (mg/dl) 0.8 0.5–1.4 samples taken from patients at weeks 0, 1, 2, 3, and 4.
Creatinine (mg/dl) 0.7 0.4–1.1 Serum TPO levels were measured using an ELISA
HCV-RNA (log10 IU/ml) 6.0 3.7–6.6 (QuantikineTM Human TPO; R&D Systems, Minneapolis,
Fibrosis (0/1/2/3/4) 3/6/11/9/1 MN, USA) in patient blood samples taken at 0, 2, and
Activity (0/1/2/3) 1/9/20/0 4 weeks. Both assays were performed according to the
manufacturers’ instructions.
The data shown are medians and ranges unless otherwise specified
BMI body mass index, WBC white blood cell, AST aspartate amino- Pathological findings
transferase, ALT alanine aminotransferase, c-GT gamma-glutamyl
transpeptidase, HCV hepatitis C virus, LDH lactate dehydrogenase
Baseline liver biopsies were performed on all patients prior
to the treatment, to determine METAVIR activity and
fibrosis score. The METAVIR scoring system grades
one patient received just 53 %. No patients required a fibrosis on a 5-point scale (F0, no fibrosis; F1, portal
blood transfusion or administration of recombinant human fibrosis without septa; F2, few septa; F3, numerous bridging
erythropoietin (rhEPO). septa without cirrhosis; F4, cirrhosis) and grades activity on
a 4-point scale (A0, no activity; A1, mild activity; A2,
SNP genotyping moderate activity; A3, severe activity).
To determine the IL28B, ITPA, and DDRGK1 genotypes at Measurement of serum ribavirin concentration
select SNPs, genomic DNA was extracted from 200 ll of
whole blood, using the QIAamp DNA Blood Mini Kit Serum concentrations of RBV after 4 weeks of mono-
(QIAGEN Sciences, Germantown, MD, USA). SNP geno- therapy were measured using high-performance liquid
types were determined using the real-time PCR method chromatography (HPLC) as described previously [13].
(TaqManTM SNP Genotyping Assay; Applied Biosystems,
Foster City, CA, USA) according to the manufacturer’s Statistical analyses
instructions. Genotypes at three SNPs—rs8099917, IL28B
(Assay ID: C_11710096_10); rs1127354, ITPA (Assay ID: All results are presented as medians and ranges. Statistical
C_27465000_10); and rs11697186, DDRGK1 (Assay ID: tests were performed based on Friedman’s test to assess the
C_11815649_20)—were determined. The genotype of change in a parameter over time, the Mann–Whitney test
DDRGK1 could be determined by this method in all patients, and Chi-square test to assess differences between groups,
but the genotypes of ITPA and IL28B could not be deter- and the Spearman test to assess the correlation between
mined by this method in some patients. Therefore, when the hematological changes and hematopoietic hormones. The
genotype of a patient could not be determined by this degree of platelet increase was measured using the platelet
method, the genotype was determined using standard PCR change ratio, specifically the platelet count at week
(ExTaq Hot Start version; Takara Bio, Otsu, Japan) and 4/platelet count at week 0.
123
J Gastroenterol (2012) 47:1228–1237 1231
P values of \0.05 were considered significant. All sta- Association between ITPA SNP and hematological
tistical analyses were performed using PASW statistics 18 changes and hematopoietic hormones during RBV
software (IBM, Armonk, NY, USA). monotherapy
Table 2 Hematological changes and changes of ALT and HCV-RNA levels over a 4-week course of RBV monotherapy
Week 0 Week 2 Week 4 P value
3
WBC (/mm ) 4500 (3100–7700) 4800 (3800–8700) 4400 (2900–7500) NS
3
Neutrophils (/mm ) 2162 (1473–4068) 2355 (1867–4219) 2501 (1334–4219) NS
Lymphocytes (/mm3) 1659 (707–3796) 1678 (1092–2642) 1548 (616–2688) NS
Hemoglobin (g/dl) 13.6 (10.5–16.6) 12.3 (9.8–15.9) 11.7 (9.4–14.9) \0.001
MCV (fl) 98.3 (88.3–104.1) 97.2 (90.2–106.1) 99.6 (89.9–105.3) 0.009
Reticulocytes (%) 9.2 (6.1–40.4) 23.3 (7.0–54.1) 29.5 (9.0–80.2) 0.002
Platelets (9104/mm3) 14.0 (8.9–37.4) 15.3 (9.2–32.8) 15.8 (10.2–40.6) 0.003
ALT (IU/l) 81 (14–397) 58 (17–254) 50 (12–312) 0.007
HCV-RNA (log10 IU/ml) 6.0 (3.7–6.6) 5.9 (4.0–6.7) 5.6 (3.3–6.5) 0.045
EPO (pg/ml) 2.9 (0–35.8) 11.9 (0–114.8) 16.8 (0–184.2) \0.001
TPO (fmol/ml) 1.84 (0.94–2.50) 1.95 (0.66–2.57) 1.93 (0.82–2.51) NS
Serum RBV concentration (ng/ml) – 1868 (1087–4656) 2266 (1157–4366) 0.004
The significance of the changes in each parameter was analyzed using Friedman’s test
WBC white blood cell, MCV mean corpuscular volume, ALT alanine aminotransferase, EPO erythropoietin, TPO thrombopoietin, NS not
significant, RBV ribavirin
123
1232 J Gastroenterol (2012) 47:1228–1237
Table 3 Characteristics of the patients grouped according to inosine triphosphatase (ITPA) SNP genotype
ITPA (rs1127354)
CC allele (n = 23) AA or AC allele (n = 7) P value
123
J Gastroenterol (2012) 47:1228–1237 1233
123
1234 J Gastroenterol (2012) 47:1228–1237
123
J Gastroenterol (2012) 47:1228–1237 1235
and telaprevir with or without RBV, response rates were marrow, indicating that RBV influences bone marrow
lower when the treatment regimen did not include RBV. function. Bone marrow aspiration was not performed in the
This finding indicates that RBV is a key drug in treatments present study, but our findings confirmed that RBV
that achieve SVR for patients with CHC [15]. monotherapy can lead to anemia and increases in platelet
It is well known that RBV induces anemia, but few counts. Decreases in hemoglobin and increases in serum
reports have shown that RBV monotherapy induced ane- EPO were evident just 1 week after the start of RBV
mia. In 1984, Canonico et al. [16] reported that RBV monotherapy. Increases in platelet counts were evident
administration to rhesus monkeys led to anemia, increased 2 weeks after the start of RBV monotherapy. However,
platelet counts, and increased megakaryocytes in the bone RBV did not affect serum TPO levels. The patients who did
123
1236 J Gastroenterol (2012) 47:1228–1237
123
J Gastroenterol (2012) 47:1228–1237 1237
counts. The lack of a significant association may reflect an therapy for chronic hepatitis C virus infection. J Viral Hepat.
indirect, rather than a direct, relationship between ITPA 2004;11:243–50.
9. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K,
genotype and platelet physiology. Sakamoto N, et al. Genome-wide association of IL28B with
Tanaka et al. [12] showed that a DDRGK1 SNP near the response to pegylated interferon-alpha and ribavirin therapy for
ITPA gene, like the ITPA SNP, was associated with treat- chronic hepatitis C. Nat Genet. 2009;41:1105–9.
ment-induced anemia; moreover, the DDRGK1 SNP was 10. Fellay J, Thompson AJ, Ge D, Gumbs C, Urban TJ, Shianna K,
et al. ITPA gene variants protect against anaemia in patients
associated with treatment-induced thrombocytopenia dur- treated for chronic hepatitis C. Nature. 2010;464:405–8.
ing PEG-IFN/RBV combination therapy. Because a pro- 11. Ochi H, Maekawa T, Abe H, Hayashida Y, Nakano R, Kubo M,
tective DDRGK1 allele showed linkage with a protective et al. ITPA polymorphism affects ribavirin-induced anemia and
ITPA allele in all the patients enrolled in the present study, outcomes of therapy—a genome-wide study of Japanese HCV
virus patients. Gastroenterology. 2010;139:1190–7.
the association between DDRGK1 SNP and changes in 12. Tanaka Y, Kurosaki M, Nishida N, Sugiyama M, Matsuura K,
platelet counts could not be further examined. Sakamoto N, et al. Genome-wide association study identified
In conclusion, an association was found between ITPA ITPA/DDRGK1 variants reflecting thrombocytopenia in pegylat-
SNP genotype and treatment-induced anemia during a ed interferon and ribavirin therapy for chronic hepatitis C. Hum
Mol Genet. 2011;20:3507–16.
4-week course of RBV monotherapy. This RBV-induced 13. Homma M, Jayewardene AL, Gambertoglio J, Aweeka F. High-
anemia may have led to increases in endogenous serum performance liquid chromatographic determination of ribavirin in
EPO that, in turn, resulted in the stimulation of platelet whole blood to assess disposition in erythrocytes. Antimicrob
production. However, the sample size in this study was Agents Chemother. 1999;43:2716–9.
14. Pawlotsky JM, Dahari H, Neumann AU, Hézode C, Germanidis
small; therefore, further investigations are needed to elu- G, Lonjon I, et al. Antiviral action of ribavirin in chronic hepatitis
cidate the effects of RBV on hematopoietic parameters. C. Gastroenterology. 2004;126:703–14.
15. Hézode C, Forestier N, Dusheiko G, Ferenci P, Pol S, Goeser T,
Acknowledgments We appreciate the technical advice given by et al. Telaprevir and peginterferon with or without ribavirin for
ProfessorYasuhito Tanaka. chronic HCV infection. N Engl J Med. 2009;360:1839–50.
16. Canonico PG, Kastello MD, Cosgriff TM, Donovan JC, Ross PE,
Conflict of interest Shuhei Hige has received a research grant from Spears CT, et al. Hematological and bone marrow effects of
MSD. The other authors have declared that no conflict of interest ribavirin in rhesus monkeys. Toxicol Appl Pharmacol. 1984;
exists. 74:163–72.
17. Streja E, Kovesdy CP, Greenland S, Kopple JD, McAllister CJ,
Nissenson AR, et al. Erythropoietin, iron depletion, and relative
thrombocytosis: a possible explanation for hemoglobin-survival
paradox in hemodialysis. Am J Kidney Dis. 2008;52:727–36.
References 18. Homoncik M, Jilma-Stohlawetz P, Schmid M, Ferlitsch A, Peck-
Radosavljevic M. Erythropoietin increases platelet reactivity and
1. Lavanchy D. Evolving epidemiology of hepatitis C virus. Clin platelet counts in patients with alcoholic liver cirrhosis: a ran-
Microbiol Infect. 2011;17:107–15. domized, double-blind, placebo-controlled study. Aliment Phar-
2. Thomas DL, Astemborski J, Rai RM, Anania FA, Schaeffer M, macol Ther. 2004;20:437–43.
Galai N, et al. The natural history of hepatitis C virus infection: 19. Dessypris EN, Gleaton JH, Armstrong OL. Effect of human
host, viral, and environmental factors. JAMA. 2000;284:450–6. recombinant erythropoietin on human marrow megakaryocyte
3. di Iulio J, Ciuffi A, Fitzmaurice K, Kelleher D, Rotger M, Fellay colony formation in vitro. Br J Haematol. 1987;65:265–9.
J, et al. Estimating the net contribution of interleukin-28B vari- 20. Vaziri ND. Thrombocytosis in EPO-treated dialysis patients may
ation to spontaneous hepatitis C virus clearance. Hepatology. be mediated by EPO rather than iron deficiency. Am J Kidney
2011;53:1446–54. Dis. 2009;53:733–6.
4. Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, 21. Bilic E. Amino acid sequence homology of thrombopoietin and
Goncales FL, et al. Peginterferon alfa-2a plus ribavirin for erythropoietin may explain thrombocytosis in children with iron
chronic hepatitis C virus infection. N Engl J Med. 2002;347: deficiency anemia. J Pediatr Hematol Oncol. 2003;25:675–6.
975–82. 22. Tekin D, Yavuzer S, Tekin M, Akar N, Cin S. Possible effects of
5. Hadziyannis SJ, Sette H, Morgan TR, Balan V, Diago M, antioxidant status on increased platelet aggregation in childhood
Marcellin P, et al. Peginterferon-alpha2a and ribavirin combina- iron-deficiency anemia. Pediatr Int. 2001;43:74–7.
tion therapy in chronic hepatitis C: a randomized study of treat- 23. Youdim MB, Woods HF, Mitchell B, Grahame-Smith DG, Cal-
ment duration and ribavirin dose. Ann Intern Med. 2004;140: lender S. Human platelet monoamine oxidase activity in iron-
346–55. deficiency anaemia. Clin Sci Mol Med. 1975;48:289–95.
6. Sidwell RW, Huffman JH, Khare GP, Allen LB, Witkowski JT, 24. Schmid M, Kreil A, Jessner W, Homoncik M, Datz C, Gangl A,
Robins RK. Broad-spectrum antiviral activity of Virazole: 1-beta- et al. Suppression of haematopoiesis during therapy of chronic
D-ribofuranosyl-1,2,4-triazole-3-carboxamide. Science. 1972; hepatitis C with different interferon alpha mono and combination
177:705–6. therapy regimens. Gut. 2005;54:1014–20.
7. Reddy KR, Shiffman ML, Morgan TR, Zeuzem S, Hadziyannis S, 25. De Franceschi L, Fattovich G, Turrini F, Ayi K, Brugnara C,
Hamzeh FM, et al. Impact of ribavirin dose reductions in hepatitis Manzato F, et al. Hemolytic anemia induced by ribavirin therapy
C virus genotype 1 patients completing peginterferon alfa-2a/ in patients with chronic hepatitis C virus infection: role of
ribavirin treatment. Clin Gastroenterol Hepatol. 2007;5:124–9. membrane oxidative damage. Hepatology. 2000;31:997–1004.
8. Sulkowski MS, Wasserman R, Brooks L, Ball L, Gish R. Changes in 26. Vanderheiden BS. Genetic studies of human erythrocyte inosine
haemoglobin during interferon alpha-2b plus ribavirin combination triphosphatase. Biochem Genet. 1969;3:289–97.
123