Sie sind auf Seite 1von 10

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

ARTICLE
Pathogenesis-related genes as tools for discovering the
response of onion defence system against Iris yellow spot
virus infection
Adel ElMorsi, Ahmed Abdelkhalek, Omar AlShehaby, and Elsayed E. Hafez
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

Abstract: The Iris yellow spot virus (IYSV) is a viral pathogen of onions and causes severe damage and economic loss
in affected onion crops. Pathogenesis-related (PR) genes are part of the innate immune response that onions
harbour against viral diseases, which to date remains unclear. Using a sensitive and reliable real-time quantitative
PCR method, the dynamic expression of five different genes in infected onions were investigated after biological
inoculation with virulent isolate of Thrips tabaci (Lindeman). The transcription levels of PR1, PR2, PR3, PR4, and PR5
genes were highly expressed 1 day post inoculation (dpi). Furthermore, statistical analysis revealed a significant
change in peak expression levels of PR1 after 8 dpi and PR3 after 9 dpi. In contrast, the expression level change for
the other genes was only moderate. Further, we determined and ranked the expression stability of three reference
genes (EF1-␣, 18S rRNA, and ␤-actin) using geNorm and NormFinder. The overall analysis demonstrated that ␤-actin
is the most informative gene, which can be utilised as an internal control for quantitative gene expression. Our
study findings not only provide guidelines for selection of appropriate reference genes in virally infected onions,
but also valuable information concerning immune response related genes associated with the initial plant de-
For personal use only.

fences against viral infection. Moreover, the PR1 gene appears to be a disease-specific gene related to the IYSV
infection in onion tissues.
Key words: onion, IYSV, defence system, RT-PCR, PR genes.
Résumé : Le virus des taches jaunes de l’iris (IYSV, « Iris yellow spot virus ») est un pathogène viral des oignons qui
provoque des dommages importants et des pertes économiques qui affectent les récoltes d’oignons. Les gènes
reliés à la pathogenèse (PR) font partie de la réponse immunitaire innée que les oignons ont développée pour lutter
contre les maladies virales, laquelle demeure floue jusqu’à présent. Grâce à une méthode par PCR semi-quantitative
en temps réel sensible et fiable, l’expression dynamique de cinq gènes différents par des oignons infectés a été
suivie après l’inoculation biologique d’un isolat virulent de Thrips tabaci (Lindeman). Les gènes PR1, PR2, PR3, PR4
et PR5 étaient hautement exprimés au jour 1 post-inoculation. De plus, l’analyse statistique révélait que PR1
atteignait son pic d’expression au jour 8 post-inoculation alors que PR3 atteignait son pic au jour 9. Par contre, les
niveaux d’expression des autres gènes ne changeaient que de modérément. De plus, les auteurs ont déterminé et
ordonné la stabilité d’expression de trois gènes de référence (EF1-␣, ARNr 18S et la ␤-actine) à l’aide des outils
geNorm et NormFinder. L’analyse globale démontrait que le gène de la ␤-actine est le plus informatif et qu’il peut
être utilisé comme contrôle interne afin de quantifier l’expression génique. Les données de cette étude fournissent
non seulement des recommandations pour la sélection de gènes de référence appropriés chez les oignons infectés
par le virus mais aussi de l’information sur les gènes liés à la réponse immunitaire associés aux défenses initiales
de la plante contre l’infection virale. De plus, le gène PR1 semble être un gène spécifique à la maladie relié à
l’infection au IYSV dans les tissus de l’oignon. [Traduit par la Rédaction]
Mots-clés : oignon, IYSV, système de défense, RT-PCR, gènes PR.

Introduction Hafez et al. 2014). This disease is most damaging to onion


The Iris yellow spot virus (IYSV, of the genus Tospovirus) is seed crops where losses may reach up to 100% (Mandal
an economically relevant viral threat to onion and bulb et al. 2012). Viruses in the genus Tospovirus, the only plant-
crops in many parts of the world (Mandal et al. 2012; infecting members of the virus family Bunyaviridae, are

Received 30 January 2015. Accepted 6 June 2015.


A. ElMorsi and O. AlShehaby. Mansoura University, Faculty of Science, Botany Department, Mansoura, Egypt.
A. Abdelkhalek* and E.E. Hafez. City of Scientific Research and Technological Applications, ALCRI, Plant Protection and
Bimolecular Diagnosis Department, Alexandria, Egypt.
Corresponding author: Ahmed Abdelkhalek (e-mail: abdelkhalek2@yahoo.com).
*Present address: SRTA City, New Borg El-Arab, Alexandria, Egypt.

Botany 93: 1–10 (2015) dx.doi.org/10.1139/cjb-2015-0017 Published at www.nrcresearchpress.com/cjb on xx xxx xxxx.


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
2 Botany Vol. 93, 2015

transmitted exclusively by insects in the order Thys- if an inappropriate reference gene is selected (Kong et al.
anoptera; specifically, IYSV is transmitted by Thrips tabaci 2014; Remans et al. 2014).
(Lindeman) (Kritzman et al. 2001; Fauquet et al. 2005). In this study, we examined the expression stability of
The worldwide emergence of insecticide-resistant thrips three potential reference genes (EF1-␣, 18S rRNA, and
makes this viral infection difficult to control (Abe et al. ␤-actin) in an IYSV-infected onion, ranking their reliabil-
2012). Thus, new methods concerning the induction of ity as internal controls and evaluating and investigating
defence mechanisms related to the plant–viral response the expression pattern of selected PR genes (PR1, PR2,
need to be developed to control damage inflicted by PR3, PR4, and PR5) to elucidate the onion defence system
thrips. against IYSV. This article reveals the initial results relat-
Plants have evolved complex mechanisms to recognise ing to the identification and characterisation of the on-
attacks by pathogens and to activate an effective innate ion genes involved in plant defence pathways following
immune response (Karimi et al. 2013). These mechanisms infection by IYSV.
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

are based on the expression of resistance (R) genes in


Materials and methods
plants, whose products enable the identification of re-
lated virulence (Avr) proteins from the pathogen (Karimi Virus isolate
et al. 2013). Increased levels of the products encoded by The source of the viral inoculums used in this study
these genes are required to induce host defence response; was previously characterised and identified (Hafez et al.
however, this does not allow for a complete understanding 2014). The IYSV Egyptian isolate was maintained contin-
uously on Datura stramonium plants by mechanical inoc-
of the regulation of pathogen-induced defence responses in
ulations under greenhouse condition (Hafez et al. 2013).
onions.
The virus infection causes characteristic changes in gene Viral biological transmission and sample collection
expression that resemble stress and defence responses A virus-free culture of adult Thrips tabaci was estab-
(Whitham et al. 2006). The defence-like responses are char- lished and individuals were confined to bean pods to lay
acterised by the induction of pathogenesis-related (PR) eggs. Newly hatched larvae were collected and reared on
For personal use only.

genes, as well as other genes previously associated with bean pods according to previous studies (Murai and
plant disease defence (Whitham et al. 2006; Tabassum et al. Loomans 2001; Hafez et al. 2013). After 10–12 days, small
2013). The defence-like response includes the induction of nu- chlorotic lesions and systemic necrosis were observed in
merous PR genes such as PR1, PR2, PR3, PR4, and PR5 which the upper leaves of the IYSV-inoculated D. stramonium.
are associated with genes related to the regulation of the re- Groups of newly hatched larvae from virus free thrips
dox status, including superoxide dismutase, glutathione were collected after up to 12 h, used for virus acquisition
S-transferases, resistance gene homologs, and other genes of and placed on IYSV-infected D. stramonium plants for 2 h,
unknown function that are co-induced with the PR genes (van and then transferred to healthy onion seedlings in an-
Loon et al. 2006). other cage for 24 h. Subsequently, thrips were killed af-
Most work in the field of plant–pathogen interactions ter being sprayed with 0.01% Malathion. At each time
has focused on plant–bacterial and plant–fungal interac- interval, three biological replicates of thrips transmis-
tions; however, plant responses to viruses are less well sion were collected daily from 0–10 dpi, as well as 15 dpi
understood. Currently, the molecular mechanisms of and then subjected to RNA extraction. The samples col-
IYSV–onion interactions remain unclear. It is essential to lected at time 0 were used as control.
complete gene expression analysis of IYSV response in Total RNA extraction and cDNA synthesis
onion to clarify the interaction between IYSV and its Total RNA from healthy and infected onion tissue was
host. extracted using the RNeasy Mini Kit according to the
Real-time quantitative polymerase chain reaction manufacturer’s instructions (QIAGEN, Germany). The
(RT-PCR) is a very sensitive, accurate, and reproducible concentration and quality of each RNA sample was de-
technique that can be used to detect low levels of RNA termined spectrophotometrically with an Eppendorf
molecules, and it has been shown to be an efficient indi- Biophotometer plus (Eppendorf, Germany). The integrity
cator of virus gene expression in various instances, in- of RNA samples was assessed by agarose gel electropho-
cluding the Tomato spotted wilt virus (Boonham et al. 2002), resis. The first strand of cDNA synthesis was performed
the Rice stripe virus (Li et al. 2012), and the IYSV (Hafez et al. in a total reaction volume of 25 ␮L. The reaction mixture
2013). However, the accuracy of the results depend on contained 2.5 ␮L of 5× MgCl2 buffer, 2.5 ␮L of 2.5 mmol·L−1
transcript normalisation using a stably expressed refer- dNTPs, 4 ␮L of oligo (dT) primer (20 pmol·␮L−1), 2 ␮g RNA,
ence gene that is constantly expressed at the same level and 200 U reverse transcriptase enzyme (M-MLV, Fermentas,
in all tissues, under all conditions (Gutierrez et al. 2008; USA). The reverse transcriptase reaction was performed
Kozera and Rapacz 2013). Thus, good candidates for uni- in a thermal cycler (Eppendorf, Germany) run at 42 °C for
versal internal controls are housekeeping genes (Bustin 1 h and 72 °C for 10 min. cDNA was then stored at −20 °C
2002). Thus, the reliability and accuracy of RT-PCR is lost until further used.

Published by NRC Research Press


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
ElMorsi et al. 3

Table 1. Primer sequences used for amplification during on the Applied Biosystems Integrated (ABI) System.
real-time quantitative polymerase chain reaction. The CT value of each target gene was normalised to
Primer Direction Sequence 5=–3= CTreference to obtain ⌬CTtarget where:
PR1 Forward TTCTTCCCTCGAAAGCTCAA
⌬CTtarget ⫽ (CTtarget ⫺ CTreference), ⌬CTcontrol ⫽ (CTcontrol ⫺ CTreference)
Reverse CGCTACCCCAGGCTAAGTTT
PR2 Forward TCCGGGGTATGTTATGGAAGA
Reverse GGCCATCCACTCTCAGACACA The relative expression quantity of the target gene was
PR3 Forward CGGTGGTACTCCTCCTGGACCC determined as follows:
Reverse CGGCGGCACGGTCGGCGTCTGA
PR4 Forward GACAACAATGCGGTCGTCAAGG
⌬⌬CT ⫽ (⌬CTtarget ⫺ ⌬CTcontrol), according to 2⫺⌬⌬CT algorithm
Reverse AGCATGTTTCTGGAATCAGGCTG
PR5 Forward ATGGGCTACTTGACATCTTCTT
Reverse TTATGGGCAAAAAACAACCCT Resulting expression values higher than 1 demon-
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

18S rRNA Forward CATCAGCTCGCGTTGACTAC strate an increase (upregulated in expression) while val-
Reverse GATCCTTCCGCAGGTTCAC ues lower than 1 express a decrease (downregulation in
EF1-␣ Forward ATTGGAAACGGATATGCTCCA expression) for a parameter.
Reverse TCCTTACCTGAACGCCTGTCA
␤-actin Forward CTCGCCTTTGCCGATCC Results
Reverse GATCTTCATGAGGTAGTCAGTC
Expression levels and reference gene stability analysis
The CT values were determined for all genes in onions
subjected to IYSV infections to provide an overview of
Normalisation and selection of housekeeping genes and
expression of PR genes
the relative abundance of the three onion reference
Three housekeeping genes: elongation factor 1-␣ (EF1-␣), genes examined. The median mRNA CT values ranged
the 18S rRNA and ␤-actin were tested to identify the most from 7.82 (EF1-␣) to 19.20 (␤-actin) (Fig. 1A), which repre-
stably expressed reference gene(s) in virally infected on- sented the highest and lowest accumulated levels in virus-
For personal use only.

ion. Additionally, the time-course expression of onion infected onion tissue, respectively. Both the EF1-␣ and
PR-protein genes (PR1, PR2, PR3, PR4, and PR5) (Table 1) the 18S rRNA had highly fluctuating CT values, where the
was also established during a time-course of leaf sam- smallest values were 68% and 55% of the largest values
pling collected post infection. for the 18S rRNA and EF1-␣, respectively. Even though
some fluctuation in ␤-actin expression was observed, the
Quantitative RT-PCR assay smallest value was no more than 6% different from the
RT-PCR was performed using the SYBR Green PCR Mas- largest value identified and represented the lowest stan-
ter Mix (Fermentas, USA). Each reaction consisted of a dard error in the samples. This indicated that ␤-actin
25 ␮L mixture, which contained 1 ␮L of 10 pmol·␮L−1 of could be used as an internal control in downstream gene
each primer, 1 ␮L of template cDNA (50 ng), 12.5 ␮L of expression analyses of the IYSV–onion infection.
2×SYBR Green PCR Master Mix, and 9.5 ␮L of nuclease- A simple comparison of the raw CT values, however,
free water. Each sample was run in triplicate. The ampli- was not sufficient to evaluate expression stability of the
fication program included an initial denaturation step at reference genes. Consequently, a sophisticated statistical
95 °C for 10 min, followed by 40 cycles of denaturation
analysis was employed to provide a more accurate assess-
at 95 °C for 15 s, annealing at 60 °C for 30 s and extension
ment of the stability of the reference genes. Thus, the
at 72 °C for 30 s. Data acquisition was performed during
reference genes were examined by applying two com-
the extension step. The reaction was performed using a
monly used algorithms to individually calculate expres-
Rotor-Gene 6000 (QIAGEN, ABI System, USA). After the
sion stabilities, namely geNorm (Vandesompele et al.
40 cycles, the melting curves were obtained to eliminate
2002) and NormFinder (Andersen et al. 2004).
the inclusion of non-specific products.
First, by applying the geNorm analysis, the raw CT val-
RT-PCR data analysis ues were transformed into quantities that could be used
The relative expression ratio was accurately quantified for relative comparisons. The average gene expression
and calculated according to Livak and Schmittgen (2001). stability (M value) of the three reference genes was calcu-
Accordingly, for each biological sample, the difference lated with the geNorm applet, with all genes subse-
(⌬) in quantification cycle value (CT) between the target quently ranked based on the values (Fig. 1B). A lower
(CTtarget averaged from three technical replicates) and the M value indicated more stable expression. Both the
reference (CTreference, a fixed CT value used for all samples) housekeeping genes ␤-actin and EF1-␣ were highly and
was transformed into relative quantities (RQ) using the stably expressed harbouring the same M values of 2.044.
exponential function with the efficiency (E) of the PCR Second, NormFinder is a Microsoft Excel-based Visual
reaction. Basic application that assigns stability values to single
The CT (threshold of cycle) value for each gene was candidate reference genes. The stability of expression is
determined through an automated threshold analysis reflected by the standard deviation (SD) of biological rep-

Published by NRC Research Press


4
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

Fig. 1. (A) Expression levels of reference genes in healthy and virus-infected leaf tissue samples of onion. Values are given as the cycle threshold (CT, mean of
triplicate samples) and are inversely proportional to the amount of template used. Global expression levels of the different genes tested are shown as the horizontal

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)


lines, median (dashed horizontal line), and whiskers of the box plot. (B) Expression stability of reference genes analysed by geNorm. Average expression stability
values (M value) across all treatment groups. A lower M value (as is apparent with ␤-actin) indicates more stable gene expression. (C) Stability demonstrated by
standard deviation (SD) values of the candidate reference genes analysed by NormFinder. A lower SD value (as is harboured by ␤-actin) indicates more stable gene
expression.
For personal use only.
Published by NRC Research Press

Botany Vol. 93, 2015


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
ElMorsi et al. 5

licates. After analysis of the data using NormFinder was the gene with the highest expression levels at 1 dpi,
(Fig. 1C), the differences between the geNorm and Norm- with PR4, the second most highly expressed gene. Addi-
Finder results revealed that the ␤-actin gene was more sta- tionally, PR1 was also the highest expressed gene at 2 dpi,
ble in virus-infected onion tissues than the other two genes followed by PR3. At 3 dpi, PR1, PR3, and PR4 were com-
with SD values of 0.18. pletely suppressed, while PR2 and PR5 demonstrated low
levels of expression. At 4 dpi, PR1 was the most highly
Time-course expression of PR genes
expressed gene with all other PR gene expression also
The RT-PCR comparative method was used in the
quantification analysis, which mathematically trans- induced except in the case of PR2, which was suppressed.
forms the CT value into the relative expression levels of Furthermore, at 5 dpi, all PR genes were expressed greater
the genes. The results of this study revealed that PR1 is than the controls except for PR1. At 24 h intervals between 6
rapidly induced or upregulated once the onion plant has and 10, as well as at 15 dpi, PR1 and PR3 revealed high levels of
been infected by IYSV (Fig. 2). The expression level was expression, except in the case of 10 dpi, where PR3 was com-
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

significantly greater (127.10×) than in the control at 1 dpi. pletely suppressed.


Furthermore, the expression levels were even further Discussion
clearly differentiated at 8 dpi with PR1 expressed 164.30×
RT-PCR is a very sensitive, accurate, and reliably quan-
more than in the control. Moreover at 3 and 5 dpi, PR1
titative method for gene expression analysis, detection
was downregulated with expression levels 0.40 and 0.70×
of plant viruses, and elucidation of viral propagation pro-
that of the control, respectively. The time-course expres-
files inside infected tissues (Peters et al. 2004; Varga and
sion study suggested that PR1 was specifically associated
James 2005; Hafez et al. 2013).
with the IYSV–onion viral infection.
Choosing the correct internal controls (reference genes) is
In our analysis, the expression of the PR2 gene exhibited
important in experiments where the expression levels of
a slower response to the viral infection (Fig. 2) than PR1. The
target genes are normalised by the most and least stable
gene was slightly induced during the first 3 dpi with expres-
reference genes (Liu et al. 2012). The incorrect use of
sion levels higher than those found in the control plants.
For personal use only.

reference genes that lack validation can introduce bias to


The expression level then decreased to 1.50× the control at
the analysis and lead to the misinterpretation of data
7 dpi, and 1.48× at 5 dpi. The expression of PR2 dramatically
(Mafra et al. 2012). However, the accuracy of target gene
decreased at 4, 8, 9, and 15 dpi with 0.91×, 0.67×, 0.65×, and
expression analysis depends on precise transcript nor-
0.77× compared with the control, respectively. From these
results, it appeared that the viral infection induced the ex- malisation using stably expressed reference genes at dif-
pression of PR2 in the first 2 days, while the virus subse- ferent biological and physiological states (Gutierrez et al.
quently succeeded in completely silencing the gene. 2008; Maltseva et al. 2013). The reliability and accuracy of
IYSV infection causes a rapid induction of the PR3 gene RT-PCR is lost if an inappropriate reference gene is se-
to 4.54× the control at 1 dpi. Interestingly, the gene was lected (Ferguson et al. 2010). Thus, it is essential that
still induced (20.19×) at 2 dpi (Fig. 2). The expression level prior to the experiment, all reference genes are validated
of PR3 continued to increase to 25.90× the control at to confirm the stability of their expression under certain
7 dpi and peaked at 9 dpi (46.99×). The expression level experimental conditions, and to prevent inaccurate data
was downregulated at 10 dpi. interpretation and subsequent incorrect conclusions
The data shown in (Fig. 2) reveal that the expression (Bustin 2002; Gutierrez et al. 2008). For these reasons, the
level of the PR4 gene were high at 1 dpi (15.46×), after expression of three well-known reference genes was ana-
which point the expression was decreased to 12.73× at lysed using two different software programs, geNorm
2 dpi. The expression level continued to decrease dra- and NormFinder. The analysis using geNorm was con-
matically at 3 dpi (0.05×) in comparison with the control. ducted to determine the optimal number of stable
The expression of PR4 increased to 2.02× at 4 dpi and housekeeping genes needed for accurate normalisation
completely shut down at 6, 7, 8, 10, and 15 dpi. (Vandesompele et al. 2002), whereas NormFinder was
The PR5 family is composed of thaumatin-like pro- utilised to assess the quality of the results obtained by
teins. In the present study, PR5 exhibited a moderate geNorm (Andersen et al. 2004; Pfaffl et al. 2004). The two
response to the virus (Fig. 2). The gene was induced with best reference housekeeping genes defined by geNorm
expression rate of 5.38× at 1 dpi, compared with control (␤-actin and EF1-␣) yielded high expression stability cri-
plants. The expression level then decreased to 1.13× at teria with the same M value (2.044). The NormFinder
2 dpi and then slightly increased to 1.16× at 3 dpi reach- analysis ranked ␤-actin as the most stable gene, with SD
ing a maximum of 4.72× at 5 dpi. However, the PR5 gene values of 0.18, while EF1-␣ and the 18S rRNA yielded SD
expression increased again rapidly after 9 dpi with a values of 0.40 and 0.54, respectively.
2.56× increase in expression at 10 dpi and 3.58× at 15 dpi. The ␤-actin gene has long been used as a universal
The study conducted here allowed us to summarise the internal control for gene expression studies (Nicot et al.
ratio of the relative expression levels of the PR genes. All 2005), and has more recently been used in a study of
five PR genes were expressed at both 1 dpi and 2 dpi. PR1 induced and differential gene expression during Wheat

Published by NRC Research Press


6
Fig. 2. Relative quantities expression of pathogenesis-related (PR) genes at various intervals days post-inoculation (dpi). The values shown represent the mean
reading of three treated plants and the error bars indicate the standard errors of the means.
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)


For personal use only.
Published by NRC Research Press

Botany Vol. 93, 2015


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
ElMorsi et al. 7

yellow mosaic virus (WYMV) infection of wheat tissues levels after 8 dpi suggested that upregulation of this pro-
(Jarošová and Kundu 2010). In addition, the ␤-actin gene tein is among the first defence responses against IYSV
has been employed as an internal control for the quanti- infection in onion cells. We suggest that the expression
fication of the Tomato spotted wilt virus (TSWV) using indi- of the PR1 gene is a response to viral infection and not
vidual thrip vectors (Rotenberg et al. 2009). due to the thrips feeding, supporting our results and a
The two housekeeping genes (18S rRNA and EF1-␣) are suggestion by Abe and colleagues (2012), who studied the
commonly used reference genes in RT-PCR experiments. response of Arabidopsis thaliana plant defense induced by
Previously, EF1-␣ was reported to be stably expressed in both non-viruliferous thrips and viruliferous thrips with
potatoes during biotic and abiotic stress (Wood et al. TSWV infection. They found that thrips feeding did not
2000), while the 18S rRNA has proven to be suitable for affect the level of TSWV accumulation and did not change the
normalisation in Barley yellow dwarf virus-infected cereals expression of the PR1 and PR2 genes induced by TSWV infec-
(Jarošová and Kundu 2010). In this study, however, the tion (Abe et al. 2012). Reymond and colleagues (2000) also
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

performance of EF1-␣ and 18S rRNA was unsatisfactory, showed that the insect (Pieris rapae) feeding on Arabidopsis did
even though EF1-␣ was successively ranked by the geNorm not change the expression of many genes including PR genes
analysis. Our results were consistent with earlier studies in (Reymond et al. 2000).
virus-infected tomatoes, which demonstrated highly vari- The PR2 family of proteins includes ␤-1,3-glucanases
able expression levels for both18S rRNA and EF1-␣ (Mascia (glucan endo-␤-1,3-glucosidases), which are monomeric
et al. 2010; Castro et al. 2012), suggesting that these widely- enzymes with a molecular weights ranging from approx-
used reference genes may not be the optimal choices for imately 20 to 23 kDa. They are highly regulated enzymes
testing gene expression in onions during viral infection. In that catalyse the hydrolytic cleavage of ␤-1,3-glucanase
summary, our results indicate that the most stable refer- abundantly prevalent in plant cell walls (Doxey et al.
ence gene for accurate normalization of a target gene in 2007; Sinha et al. 2014). Studies have reported that ␤-1,3
virus-infected onion is ␤-actin. glucanase plays a defensive role against pathogens in
It has often been suggested that the collective set of PR several herbaceous plants (Zemanek et al. 2002; Eboigbe
For personal use only.

genes may be responsible for systemic acquired resis- et al. 2014). An increase in ␤-1,3 glucanase has been re-
tance, as well as effective in inhibiting pathogen growth, ported following inoculation of soybeans with the bacte-
multiplication and (or) spread (van Loon and van Strien rial pathogen Pseudomonas syringae pv. glycinea (Cheong
2002). The time-course expression study presented here et al. 2000). Several studies (Takeuchi et al. 1990; Ham
suggested that the PR1 gene was specifically associated et al. 1997; Balasubramanian et al. 2012) have demon-
with the IYSV–onion viral infection. Transcripts of PR1 strated that glucan endo-␤-1,3-glucosidase induced in soy-
exhibited a rapid upregulated as early as 1 dpi and bean seedlings by infection or chemical stress, releases
reached maximum levels of expression after 8 dpi. The elicitor-active fragments from cell wall preparations of
biological function of PR1 family proteins remains un- the fungus Phytophthora megasperma f. sp. glycinea, help-
clear (Riviere et al. 2008; Urano et al. 2013), although ing to stimulate defence responses in adjacent cells, as
some results indicated that tobacco and tomato PR1 well as induce acquired resistance to future infection. In
proteins have antifungal activity (Niderman et al. 1995). the present study, our results agree with those obtained
Consequently, enhanced plant resistance against phyto- by Ahn and colleagues (Ahn et al. 2014) that revealed
pathogenic bacteria and oomycetes was observed in both downregulation of the expression of ␤-1,3-glucanase fol-
Arabidopsis thaliana and Nicotiana tabacum plants that lowing bacterial and fungal infection. We suggest that
overexpressed PR1 from Capsicum annuum (Hong and the viral infection induces expression of this gene after
Hwang 2005; Sarowar et al. 2005). The results of this the first 2 days, but then subsequently completely shuts
study demonstrated that PR1 is rapidly induced or up- down gene expression.
regulated at the early stage of onion plant infection by The PR3 family of proteins include chitinases that
the IYSV, and is constitutively expressed in onion tissues. catalyse the hydrolysis of chitin, a linear homopoly-
The results here agree with those found by Cutt and mer of ␤-1,4-linked N-acetylglucosamine (van Loon 1999;
colleagues who reported that PR1 proteins of tobacco are Romão-Dumaresq et al. 2014). In animals and plants,
involved in viral resistance (Cutt et al. 1989). This indi- chitinases mainly play a role in the organism’s defence
cates that the PR1 protein of tobacco is not sufficient for against pathogen attack (Singh and Subudhi 2014). In the
Tobacco mosaic virus (TMV) resistance, and implies that the present study, IYSV infection caused a rapid induction of
PR1 proteins may not function as unique antiviral fac- the PR3 gene with expression levels reaching to 4.54× at
tors. In addition, in 2014, Li and colleagues reported that 1 dpi, later increasing to 30.19× at 2 dpi. We assumed that
nitric oxide causes an increase in PR1 expression during the PR3 expression level was high at the 7 dpi time point,
tobacco virus infection (Li et al. 2014). Plants produce an but then decreased at the 10 dpi due to either the viral
array of PR1 proteins that exhibit differential toxicities to clearance or cell death. The results were similar to other
various plant pathogens (Niderman et al. 1995). The ex- studies that have reported the induction of chitinases in
pression of PR1 after 1 dpi and subsequent increase peak response to viral infections (Lawton et al. 1992; Busam

Published by NRC Research Press


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
8 Botany Vol. 93, 2015

et al. 1997; Sinha et al. 2014). In addition, the hydrolytic interactions among vector insect, thrips and a tospovirus.
chitinase enzymes of are generally expressed constitu- Plant Cell Physiol. 53: 204–212. doi:10.1093/pcp/pcr173. PMID:
22180600.
tively, with an increase in synthesis observed upon viral
Ahn, S.Y., Kim, S.A., and Yun, H.K. 2014. Differential expression
infection (Khan 2002; Zhang 2006). of ␤-1,3-glucanase transcripts induced by pathogens in the
The PR4 family is similar to that of the plant chitinase leaves of Vitis flexuosa. Plant Breed. Biotechnol. 2: 176–183.
family; both contain structural subclasses characterised doi:10.9787/PBB.2014.2.2.176.
by the presence (class I) or absence (class II) of a con- Andersen, C.L., Jensen, J.L., and Ørntoft, T.F. 2004. Normaliza-
tion of real-time quantitative reverse transcription-PCR data:
served N-terminal cysteine-rich domain corresponding a model-based variance estimation approach to identify
to a mature hevein (Van Parijs et al. 1991). This hevein genes suited for normalization, applied to bladder and colon
domain partially shares identity with several chitin- cancer data sets. Cancer Res. 64: 5245–5250. doi:10.1158/0008-
binding domains in other proteins (Broekaert et al. 1990). 5472.CAN-04-0496. PMID:15289330.
Balasubramanian, V., Vashisht, D., Cletus, J., and Sakthivel, N.
The PR4 results revealed high expression levels at 1 dpi
2012. Plant ␤-1,3-glucanases: their biological functions and trans-
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

with 15.46× expression levels identified in comparison genic expression against phytopathogenic fungi. Biotechnol. Lett.
with the control, after which the expression level de- 34: 1983–1990. doi:10.1007/s10529-012-1012-6. PMID:22850791.
creased at 2 dpi and continued to drop dramatically at Boonham, N., Smith, P., Walsh, K., Tame, J., Morris, J.,
3 dpi. At 4 dpi, the expression of PR4 increased again to Spence, N., Bennison, J., and Barker, I. 2002. The detection of
Tomato spotted wilt virus (TSWV) in individual thrips using
2.02×, however, it completely shut down again at 6, 7, 8, real-time fluorescent RT-PCR (TaqMan). J. Virol. Methods,
10 and 15 dpi. In another study on six defence-related 101: 37–48. PMID:11849682.
genes, PR1, PR2, PR4, PR9, PR10, and phenylalanine Broekaert, I., Lee, H., Kush, A., Chua, N., and Raikhel, N. 1990.
ammonia-lyase (PAL), in wheat plants infected with Wound-induced accumulation of mRNA containing a hevein
sequence in laticifers of rubber tree (Hevea brasiliensis). Proc.
Barley stripe mosaic virus (BSMV), Tufan and colleagues
Natl. Acad. Sci. U.S.A. 87: 7633–7637. doi:10.1073/pnas.87.19.
concluded that the analysis revealed that all of the 7633. PMID:2217194.
defence-related genes, except PR2, were significantly in- Busam, G., Kassemeyer, H., and Matern, U. 1997. Differential
duced in BSMV–wheat infected plants (Tufan et al. 2011). expression of chitinases in Vitis vinifera L. responding to sys-
For personal use only.

The PR5 family comprises thaumatin-like proteins. In temic acquired resistance activators or fungal challenge.
Plant Physiol. 115: 1029–1038. PMID:9390436.
the present study, PR5 exhibited a moderate response to Bustin, S. 2002. Quantification of mRNA using real-time reverse
the viral infection. The results were similar to those re- transcription PCR (RT-PCR): trends and problems. J. Mol. Endocri-
ported previously by Wang et al. (1996), where the infec- nol. 29: 23–39. doi:10.1677/jme.0.0290023. PMID:12200227.
tion with the Turnip crinkle virus increased expression of Castro, P., Román, B., Rubio, J., and Die, J.V. 2012. Selection of
reference genes for expression studies in Cicer arietinum L.:
PR5. Additionally, Satoh et al. (2011) found that the Rice
analysis of cyp81E3 gene expression against Ascochyta rabiei.
dwarf virus also leads to the activation of the PR5 gene, Mol Breed. 29: 261–274. doi:10.1007/s11032-010-9544-8.
suggesting that the PR5 domain might bind a polypep- Cheong, Y.H., Kim, C.Y., Chun, H.J., Moon, B.C., Park, H.C.,
tide ligand, and raising the possibility that mature PR5 Kim, J.K., Lee, S., Han, C., Lee, S.Y., and Cho, M.J. 2000. Molec-
proteins may also interact with polypeptides. ular cloning of a soybean class III ␤-1,3- glucanase gene that is
regulated both developmentally and in response to pathogen
Conclusions infection. Plant Sci. 154: 71–81. doi:10.1016/S0168-9452(00)00187-4.
PMID:10725560.
To the best of our knowledge, this article describes the Cutt, J.R., Harpster, M.H., Dixon, D.C., Carr, J.P., Dunsmuir, P.,
first attempt to validate a set of commonly used candi- and Klessig, D.F. 1989. Disease response to tobacco mosaic
date reference genes, in onions, that can be used for the virus in transgenic tobacco plants that constitutively express
normalisation of gene expression using RT-PCR. Evalua- the pathogenesis-related PR1b gene. Virology, 173: 89–97.
doi:10.1016/0042-6822(89)90224-9. PMID:2815592.
tions of the results using geNorm and NormFinder iden- Doxey, A.C., Yaish, M.W.F., Moffatt, B.A., Griffith, M., and
tified the most suitable reference gene in onions to be McConkey, B.J. 2007. Functional divergence in the Arabidop-
␤-actin. The analysis presented here identified novel pat- sis ␤-1,3-glucanase gene family inferred by phylogenetic
terns of genes for pathogenesis-related proteins (which reconstruction of expression states. Mol. Biol. Evol. 24: 1045–
were either induced or suppressed) as result of biostress 1055. doi:10.1093/molbev/msm024. PMID:17272678.
Eboigbe, L., Tzima, A.K., Paplomatas, E.J., and Typas, M.A. 2014.
on the onion. These results are among the first to char- The role of the ␤-1,6-endoglucanase gene vegB in physiology
acterise, at the molecular level, the onion defence reac- and virulence of Verticillium dahliae. Phytopathol. Mediterra-
tions to the host–parasite interaction involving IYSV, an nea, 53(1): 94–107. doi:10.14601/Phytopathol_Mediterr-13235.
economically important plant pathogenic virus. Nevertheless, Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., and
Ball, L.A. 2005. Virus taxonomy. Eighth Report of the Inter-
further characterisation and functional analysis of the genes
national Committee on Taxonomy of Viruses. Elsevier Aca-
identified in this study, will lead to a more comprehensive demic Press, San Diego, Calif.
understanding of onion–pathogen interactions. Ferguson, B.S., Nam, H., Hopkins, R.G., and Morrison, R.F. 2010.
Impact of reference gene selection for target gene normaliza-
References tion on experimental outcome using real-time qRT-PCR in
Abe, H., Tomitaka, Y., Shimoda, T., Seo, S., Sakurai, T., adipocytes. PLoS ONE, 5: e15208. doi:10.1371/journal.pone.
Kugimiya, S., Tsuda, S., and Kobayashi, M. 2012. Antagonistic 0015208. PMID:21179435.
plant defense system regulated by phytohormones assists Gutierrez, L., Mauriat, M., Guénin, S., Pelloux, J., Lefebvre, J.F.,

Published by NRC Research Press


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
ElMorsi et al. 9

Louvet, R., Rusterucci, C., Moritz, T., Guerineau, F., Bellini, C., Mafra, V., Kubo, K.S., Alves-Ferreira, M., Ribeiro-Alves, M.,
and Van Wuytswinkel, O. 2008. The lack of a systematic val- Stuart, R.M., Boava, L.P., Rodrigues, C.M., and Machado, M.A.
idation of reference genes: a serious pitfall undervalued in 2012. Reference genes for accurate transcript normalization
reverse transcription-polymerase chain reaction (RT-PCR) in citrus genotypes under different experimental conditions.
analysis in plants. Plant Biotechnol. J. 6: 609–618. doi:10.1111/ PLoS ONE, 7: e31263. doi:10.1371/journal.pone.0031263. PMID:
j.1467-7652.2008.00346.x. PMID:18433420. 22347455.
Hafez, E.E., Abdelkhalek, A.A., Abeer, S.A., and Galal, F.H. 2013. Maltseva, D.V., Khaustova, N.A., Fedotov, N.N., Matveeva, E.O.,
Altered gene expression: induction/suppression in leek elic- Lebedev, A.E., Shkurnikov, M.U., Galatenko, V.V.,
ited by iris yellow spot virus infection (IYSV) Egyptian isolate. Schumacher, U., and Tonevitsky, A.G. 2013. High-throughput
Agricult. Environ. Biotechnol. 27(5): 4061–4068. doi:10.5504/ identification of reference genes for research and clinical
BBEQ.2013.0068. RT-qPCR analysis of breast cancer samples. J. Clin. Bioinform.
Hafez, E.E., El-Morsi, A.A., El-Shahaby, O.A., and Abdelkhalek, A.A. 3: 13. doi:10.1186/2043-9113-3-13.
2014. Occurrence of iris yellow spot virus from onion crops in Mandal, B., Jain, R.K., Krishnareddy, M., Krishna, Kumar, N.K.,
Egypt. VirusDisease, 25: 455–459. doi:10.1007/s13337-014-0235-7. Ravi, K.S., and Pappu, H.R. 2012. Emerging problems of To-
PMID:25674622. spoviruses (Bunyaviridae) and their management in the In-
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

Ham, K.S., Wu, S.C., Darvill, A.G., and Albersheim, P. 1997. Fun- dian Subcontinent. Plant Dis. 96: 468–479. doi:10.1094/PDIS-
gal pathogens secrete an inhibitor protein that distinguishes iso- 06-11-0520.
forms of plant pathogenesis-related endo-␤-1, 3-glucanases. Plant J. Mascia, T., Santovito, E., Gallitelli, D., and Cillo, F. 2010. Evalua-
11: 169–179. doi:10.1046/j.1365-313X.1997.11020169.x. tion of reference genes for quantitative reverse-transcription poly-
Hong, J.K., and Hwang, B.K. 2005. Induction of enhanced dis- merase chain reaction normalization in infected tomato plants.
ease resistance and oxidative stress tolerance by over expres- Mol. Plant Pathol. 11: 805–816. doi:10.1111/j.1364-3703.2010.00646.x.
sion of pepper basic PR-1 gene in Arabidopsis. Physiol. Plant, PMID:21029324.
124: 267–277. doi:10.1111/j.1399-3054.2005.00515.x. Murai, T., and Loomans, A.J.M. 2001. Evaluation of an improved
Jarošová, J., and Kundu, J. 2010. Validation of reference genes as method for mass-rearing of thrips and a thrips parasitoid.
internal control for studying viral infections in cereals by Entomol. Exp. Appl. 101(3): 281–289. doi:10.1046/j.1570-7458.
quantitative real-time RT-PCR. BMC Plant Biol. 10: 146. doi: 2001.00913.x.
10.1186/1471-2229-10-146. PMID:20630112. Nicot, N., Hausman, J.F., Hoffmann, L., and Evers, D. 2005.
Karimi, L.F., Mardi, M., and Ebrahimi, A.M. 2013. Quantitative Housekeeping gene selection for real-time RT-PCR normal-
expression analysis of candidate genes for Septoria tritici ization in potato during biotic and abiotic stress. J. Exp. Bot.
For personal use only.

blotch resistance in wheat (Triticum aestivum L.). Progr. Biol. 56: 2907–2914. doi:10.1093/jxb/eri285. PMID:16188960.
Sci. 72–78. Niderman, T., Genetet, I., Bruyère, T., Gees, R., Stintzi, A.,
Khan, A.A. 2002. Characterization of chitinase activities, and Legrand, M., Fritig, B., and Mösinger, E. 1995. Pathogenesis-
cloning, analysis, and expression of genes encoding patho- related PR1-proteins are antifungal. Isolation and characterization
genesis related proteins in strawberry. Ph.D. thesis, Depart- of three 14 kilodalton proteins of tomato and of a basic PR-1 of
ment of Biological Sciences Louisiana State University and tobacco with inhibitory activity against Phytophthora infestans. Plant
Agricultural and Mechanical College, La. Physiol. 108: 17–27. PMID:7784503.
Kong, Q., Yuan, J., Niu, P., Xie, J., Jiang, W., Huang, Y., and Bie, Z. Peters, I.R., Helps, C.R., Hall, E.J., and Day, M.J. 2004. Real-time
2014. Screening suitable reference genes for normalization RT-PCR: considerations for efficient and sensitive assay de-
in reverse transcription quantitative real-time PCR analysis sign. J. Immunol. Methods, 286: 203–217. doi:10.1016/j.jim.
in melon. PLoS ONE, 9(1): e87197. doi:10.1371/journal.pone. 2004.01.003.
0087197. PMID:24475250. Pfaffl, M.W., Tichopad, A., Prgomet, C., and Neuvians, T.P. 2004.
Kozera, B., and Rapacz, M. 2013. Reference genes in real-time Determination of stable housekeeping genes, differentially
PCR. J. Appl. Genet. 54(4): 391–406. doi:10.1007/s13353-013- regulated target genes and sample integrity: BestKeeper -
0173-x. PMID:24078518. Excel-based tool using pair-wise correlations. Biotechnol.
Kritzman, A., Lampel, M., Raccah, B., and Gera, A. 2001. Distri- Lett. 26: 509–515. doi:10.1023/B:BILE.0000019559.84305.47.
bution and transmission of Iris yellow spot virus. Plant Dis. PMID:15127793.
85: 838–842. doi:10.1094/PDIS.2001.85.8.838. Remans, T., Keunen, E., Bex, G.J., Smeets, K., Vangronsveld, J.,
Lawton, K., Ward, E., Payne, G., Moyer, M., and Ryals, J. 1992. and Cuypers, A. 2014. Reliable gene expression analysis by
Acidic and basic class III chitinase mRNA accumulation in reverse transcription quantitative PCR: reporting and mini-
response to TMV infection of tobacco. Plant Mol. Biol. 19: mizing the uncertainty in data accuracy. Plant Cell, 26(10):
735–743. doi:10.1007/BF00027070. PMID:1643280. 3829–3837. doi:10.1105/tpc.114.130641. PMID:25361954.
Li, S., Li, X., Sun, L., and Zhou, Y.J. 2012. Analysis of rice stripe Reymond, P., Weber, H., Damond, M., and Farmer, E.E. 2000.
virus whole-gene expression in rice and in the small brown Differential gene expression in response to mechanical
planthopper by real-time quantitative PCR. Acta Virol. 56: wounding and insect feeding in Arabidopsis. Plant Cell, 12:
75–79. doi:10.4149/av_2012_01_75. PMID:22404613. 707–719. doi:10.1105/tpc.12.5.707. PMID:10810145.
Li, Z., Liang, W.S., and Carr, J.P. 2014. Effects of modifying alter- Riviere, M.P., Marais, A., Ponchet, M, Willats, W., and Galiana, E.
native respiration on nitric oxide-induced virus resistance 2008. Silencing of acidic pathogenesis-related PR-1 genes in-
and PR1 protein accumulation. J Gen Virol. 95(Pt 9): 2075– creases extracellular ␤-(1,3)-glucanase activity at the onset of
2081. doi:10.1099/vir.0.066662-0. tobacco defence reactions. J. Exp. Bot. 59: 1225–1239. doi:10.
Liu, D., Shi, L., Han, C., Yu, J., Li, D., and Zhang, Y. 2012. Valida- 1093/jxb/ern044. PMID:18390849.
tion of reference genes for gene expression studies in virus- Romão-Dumaresq, A., Fróes, A., Cuadrat, R., Silva, F., and
infected Nicotiana benthamiana using quantitative real-time Dávila, A. 2014. Towards a comprehensive search of putative
PCR. PLoS ONE, 7: e46451. doi:10.1371/journal.pone.0046451. chitinases sequences in environmental metagenomic data-
PMID:23029521. bases. Nat. Sci. 6: 323–337. doi:10.4236/ns.2014.65034.
Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene Rotenberg, D., Krishna, Kumar, N.K., Ullman, D.E.,
expression data using real-time quantitative PCR and the Montero-Astúa, M., Willis, D.K., German, T.L., and
2−⌬⌬CT method. Methods (San Diego, Calif.), 25: 402–8. doi: Whitfield, A.E. 2009. Variation in Tomato spotted wilt virus titer in
10.1006/meth.2001.1262. Frankliniella occidentalis and its association with frequency of trans-

Published by NRC Research Press


Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
10 Botany Vol. 93, 2015

mission. Phytopathology, 99: 404–410. doi:10.1094/PHYTO-99-4- pathogenesis-related proteins, their activities, and compara-
0404. PMID:19271982. tive analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol.
Sarowar, S., Kim, Y.J., Kim, E.N., Kim, K.D., Hwang, B.K., 55: 85–97. doi:10.1006/pmpp.1999.0213.
Islam, R., and Shin, J.S. 2005. Overexpression of a pepper van Loon, L.C., Rep, M., and Pieterse, C.M.J. 2006. Significance of
basic pathogenesis-related protein 1 gene in tobacco plants inducible defense-related proteins in infected plants. Annu
enhances resistance to heavy metal and pathogen stresses. Rev Phytopathol. 44: 135–162. doi:10.1146/annurev.phyto.44.
Plant Cell Rep. 24: 216–224. doi:10.1007/s00299-005-0928-x. 070505.143425. PMID:16602946.
PMID:15719238. van Parijs, J., Broekaert, W., Goldstein, I., and Peumans, W. 1991.
Satoh, K., Shimizu, T., Kondoh, H., Hiraguri, A., Sasaya, T., Hevein: an antifungal protein from rubber-tree (Hevea brasiliensis)
Choi, I.R., Omura, T., and Kikuchi, S. 2011. Relationship be- latex. Planta, 183: 258–264. doi:10.1007/BF00197797. PMID:
tween symptoms and gene expression induced by the infec- 24193629.
tion of three strains of Rice dwarf virus. PLoS ONE, 6(3): Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B.,
e18094. doi:10.1371/journal.pone.0018094. PMID:21445363. Van Roy, N., De Paepe, A., and Speleman, F. 2002. Accurate
Singh, A., and Subudhi, E. 2014. Isolation and expression of a normalization of real-time quantitative RT-PCR data by geo-
chitinase family protein AT4G01700 from Arabidopsis thaliana. metric averaging of multiple internal control genes. Genome
Botany Downloaded from www.nrcresearchpress.com by Dr Ahmed Abdelkhalek on 10/08/15

Austin Biotechnol. Bioeng. 1(4): 7. Biol. 18(3): 1–12. PMID:12184808.


Sinha, M., Singh, R.P., Kushwaha, G.S., Iqbal, N., Singh, A., Varga, A., and James, D. 2005. Detection and differentiation of
Kaushik, S., Kaur, P., Sharma, S., and Singh, T.P. 2014. Cur- Plum pox virus using real-time multiplex PCR with SYBR
rent overview of allergens of plant pathogenesis related pro- Green and melting curve analysis: a rapid method for strain
tein families. Sci. World J. 2014: Article ID 543195. doi:10.1155/ typing. J. Virol. Methods, 123: 213–220. PMID:15620404.
2014/543195. Wang, X., Zafian, P., Choudhary, M., and Lawton, M. 1996. The
Tabassum, B., Sher, Z., Tariq, M., Khan, A., Shahid, N., Bilal, M., PR5K receptor protein kinase from Arabidopsis thaliana is
Ramzan, M., Shehzad, I.M., Nasir, I.A., and Husnain, T. 2013. structurally related to a family of plant defense proteins.
Overview of acquired virus resistance in transgenic plants. Proc. Natl. Acad. Sci. U.S.A. 93: 2598–2602. doi:10.1073/pnas.
Exp. Agricult. Horticult. 2(2): 12–28. 93.6.2598. PMID:8637920.
Takeuchi, Y., Yoshikawa, M., Takeba, G., Tanaka, K., Shibata, D., Whitham, S.A., Yang, C., and Goodin, M.M. 2006. Global impact:
and Horino, O. 1990. Molecular cloning and ethylene induc- elucidating plant responses to viral infection. Mol. Plant Microbe
tion of mRNA encoding a phytoalexin elicitor-releasing Interact. 19: 1207–1215. doi:10.1094/MPMI-19-1207. PMID:17073303.
factor, ␤-1,3-endoglucanase, in soybean. Plant Physiol. 93: Wood, A.J., Duff, R.J., and Oliver, M.J. 2000. The translational
For personal use only.

673–682. doi:10.1104/pp.93.2.673. PMID:16667522. apparatus of Tortula ruralis: polysomal retention of tran-


Tufan, H.A., Stefanato, F.L., McGrann, G.R., MacCormack, R., scripts encoding the ribosomal proteins RPS14, RPS16 and
and Boyd, L.A. 2011. The barley stripe mosaic virus system RPL23 in desiccated and rehydrated gametophytes. J. Exp.
used for virus-induced gene silencing in cereals differentially Bot. 51: 1655–1662. doi:10.1093/jexbot/51.351.1655. PMID:
affects susceptibility to fungal pathogens in wheat. J. Plant 11053454.
Physiol. 168: 990–994. doi:10.1016/j.jplph.2010.11.019. PMID: Zemanek, A.B., Ko, T.S., Thimmapuram, J., Hammerschlag, F.A.,
21315476. and Korban, S.S. 2002. Changes in ␤-1,3-glucanase mRNA lev-
Urano, D., Chen, J.G., Botella, J.R., and Jones, A.M. 2013. Hetero- els in peach in response to treatment with pathogen culture
trimeric G protein signalling in the plant kingdom. Open filtrates, wounding, and other elicitors. J. Plant Physiol. 159:
Biol. 3: 120186. doi:10.1098/rsob.120186. PMID:23536550. 877–889. doi:10.1078/0176-1617-00779.
van Loon, L.C. 1999. Occurrence and properties of plant Zhang, Y. 2006. Studies of pathogenesis-related proteins in the
pathogenesis-related proteins. In Pathogenesis-related pro- strawberry plant: partial purification of a chitinase-
teins in plants. Edited by S.K. Datta and S. Mathukrishnan. containing protein complex and analysis of an osmotin-like
CRC Press, Boca Raton, Fla. pp. 1–19. protein gene. Thesis, Louisiana State University and Agricul-
van Loon, L.C., and van Strien, E.A. 2002. The families of tural and Mechanical College, La.

Published by NRC Research Press