Available online at www.sciencedirect.

com

Research in Veterinary Science 85 (2008) 8–16

www.elsevier.com/locate/rvsc

The development of a real-time PCR to detect pathogenic

Leptospira species in kidney tissue
C. Fearnley a,*, P.R. Wakeley a,*, J. Gallego-Beltran b, C. Dalley c,
S. Williamson d, C. Gaudie e, M.J. Woodward b
a
Technology Transfer Unit, Veterinary Laboratories Agency (VLA), Woodham Lane, Addlestone, Surrey KT15 3NB, UK
b
Food and Environmental Safety Department, Veterinary Laboratories Agency (VLA), Woodham Lane, Addlestone, Surrey KT15 3NB, UK
c
Laboratory Testing Department, Veterinary Laboratories Agency (VLA), Woodham Lane, Addlestone, Surrey KT15 3NB, UK
d
VLA, Rougham Hill, Bury St. Edmunds, Suffolk IP33 2RX, UK
e
VLA, West House, Station Road, Thirsk YO7 1PX, UK

Accepted 4 September 2007

Abstract

A LightCycler real-time PCR hybridization probe-based assay that detects a conserved region of the16S rRNA gene of pathogenic
but not saprophytic Leptospira species was developed for the rapid detection of pathogenic leptospires directly from processed tissue
samples. In addition, a differential PCR specific for saprophytic leptospires and a control PCR targeting the porcine b-actin gene were
developed. To assess the suitability of these PCR methods for diagnosis, a trial was performed on kidneys taken from adult pigs with
evidence of leptospiral infection, primarily a history of reproductive disease and serological evidence of exposure to pathogenic lepto-
spires (n = 180) and aborted pig foetuses (n = 24). Leptospire DNA was detected by the ‘pathogenic’ specific PCR in 25 tissues (14%)
and the control b-actin PCR was positive in all 204 samples confirming DNA was extracted from all samples. No leptospires were iso-
lated from these samples by culture and no positives were detected with the ‘saprophytic’ PCR. In a subsidiary experiment, the ‘path-
ogenic’ PCR was used to analyse kidney samples from rodents (n = 7) collected as part of vermin control in a zoo, with show animals
with high microagglutination titres to Leptospira species, and five were positive. Fifteen PCR amplicons from 1 mouse, 2 rat and 14 pig
kidney samples, were selected at random from positive PCRs (n = 30) and sequenced. Sequence data indicated L. interrogans DNA in the
pig and rat samples and L. inadai DNA, which is considered of intermediate pathogenicity, in the mouse sample. The only successful
culture was from this mouse kidney and the isolate was confirmed to be L. inadai by classical serology. These data suggest this suite
of PCRs is suitable for testing for the presence of pathogenic leptospires in pig herds where abortions and infertility occur and potentially
in other animals such as rodents.
Crown Copyright  2007 Published by Elsevier Ltd. All rights reserved.

Keywords: Leptospira; Detection; Tissue; Real-time PCR

1. Introduction
Leptospirosis is a significant zoonosis worldwide (Plank
and Dean, 2000). In humans it causes a spectrum of symp-
toms; the classical syndrome of Weil’s disease, caused by
Leptospira interrogans represents the most severe presenta-
*
Corresponding authors. Tel.: +44 (0) 1932 357635; fax: +44 (0) 1932
357890 (C. Fearnley).
E-mail address: c.fearnley@vla.defra.gsi.gov.uk (C. Fearnley).
tion where the liver, kidneys, heart, lungs and eyes may be
affected. Milder cases can result in fever, headaches,
abdominal pain, conjunctival suffusion or skin rashes (Lev-
ett, 2001). In animals, infection with leptospires is a signif-
icant problem causing abortion and infertility in cattle and
pigs (Ellis et al., 1982; Nielsen et al., 1989; Dhaliwal et al.,
1996) and may be carried chronically by many animal spe-
cies. The organism may be excreted from affected animals
in urine in large numbers (Levett, 2001) and this is a source
of transmission to in-contact animals and the environment

0034-5288/$ - see front matter Crown Copyright  2007 Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.rvsc.2007.09.005
 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
with man at risk particularly from direct contact and urine
contaminated water sources (Woodward, 2001).
Serological approaches such as macroscopic (Galton
et al., 1958) and microscopic agglutination tests (Ryu,
1970; Cole et al., 1973) or direct antigen detection in tissues
by a fluorescent antibody test (FAT) (Appassakij et al.,
1995) are used commonly for diagnosis in animals. In the
agglutination tests, antibodies in serum dilutions are reacted
with live or killed leptospires and agglutination is observed.
Antibody titres are determined by this approach but it is a
complex test to control, perform and interpret (Turner,
1968). The FAT may be used for direct microscopic analysis
of tissues such as kidney or aborted foetus. Culture methods
are well established for leptospires but are technically
demanding and time consuming, often taking weeks to
achieve observable growth depending on the sample type,
freedom from overgrowth by other bacterial and fungal
contaminants and the specific serovar causing infection.
There is a need for more rapid and accurate diagnostic
tests for leptospiral infections in animals particularly to
support appropriate control measures that may include
antibiotic treatment or vaccination. Polymerase chain reac-
tion is a well-established tool and many PCR tests have
been developed for DNA detection of leptospires (Wood-
ward, 2001). However, in recent years, real-time PCR has
emerged as a valuable tool for the rapid testing of various
biological specimens and tissues for the presence of
micro-organisms (Kaltenboeck and Wang, 2005). The
LightCycler system (Roche Molecular Biochemicals,
Mannheim, Germany) offers two different fluorescence
detection formats employing either SYBR Green I, that
binds non-specifically to double-stranded DNA or hybrid-
isation probes that allow sequence-specific detection by
using fluorescence energy transfer (FRET) between two
fluorophores. For the later method, two specific oligonu-
cleotide probes hybridise to the amplicon, one probe is
labelled with LightCycler-Red 640 (LC red 640) and the
other with fluorescein. On hybridisation the emitted fluo-
rescence from the LC red 640 fluorophore is measured by
the LightCycler instrument resulting in monitoring of
the PCR in real time, increasing the speed of detection of
amplicon generation and the elimination of gel electropho-
resis for the analysis of PCR products.
In this study, we developed a real-time PCR assay on the
LightCycler system with specific primers and hybridisa-
tion probes targeting the 16S rRNA gene for the direct
detection of pathogenic Leptospira species in tissues. Preli-
minary tests show the PCR to be suitable for use with sam-
ples from various animals.
2. Materials and methods
2.1. Bacterial species used in this study
Bacterial strains used in this study were from the Veter-
inary Laboratories Agency (VLA) strain collection, and
included the 22 strains used in routine MAT serology test-
9
ing for the diagnosis of leptospirosis and 16 obtained from
the Health Protection Agency Leptospira Reference labora-
tory in Hereford, UK (Table 1). Culture of all Leptospira
strains was carried out in EMJH media (Johnson and Har-
ris, 1967) with 2 lg/ml 5-fluorouracil and 20 ml/l deacti-
vated rabbit serum at 30 C for 7 days.
A total of 25 different bacterial species and four non-lep-
tospiral spirochaetes were used to assess the specificity of
the LightCycler PCR (Arcanobacterium pyogenes, Bor-
relia burgdorferi, Enterobacter cloacae, Enterococcus faecal-
is, Escherichia coli, Escherichia fergusonii, Citrobacter
freundi, Hafnia alvei, Klebsiella pneumoniae, Leptonema
illini, Oligella urethracis, Pasteurella multocida, Proteus
mirabilis, Proteus morganii, Pseudomonas aeruginosa, Sal-
monella enterica enterica serovars Typhimurium and Chit-
tagong, Serpulina innocens, Shigella flexneri,
Staphylococcus aureus, Staphylococcus epidermidis, Trepo-
nema denticola, Yersinia enterocolitica, Yersinia frederickse-
nii and Yersinia rhodei). Broth cultures of these bacteria
were grown on appropriate liquid medium at the appropri-
ate temperatures and samples were boiled for 5 min to pro-
duce culture lysates ready for direct addition (2 ll) to PCR
master mixes without DNA extraction.
2.2. DNA extraction
Leptospiral DNA for development of the PCR was
extracted from leptospires grown in broth cultures that
had been centrifuged to pellet the cells (3250g 15 min at
4 C) and resuspended in lysis buffer. The bacteria were
lysed overnight at 65 C in lysis buffer (100 mM Tris–
HCl, 100 mM EDTA, 50 mM NaCl, adjusted to pH 7.4)
containing 1% SDS (vol/vol) and 400 lg/ml proteinase K,
followed by extraction in phenol/chloroform/iso-amylalco-
hol (vol/vol 25:24:1) and ethanol precipitation. The DNA
was resuspended in double distilled sterile water and
DNA concentrations measured using a spectrophotometer.
DNA concentrations were adjusted to 1 mg per ml and
diluted to produce a 10-fold dilution series for testing in
the real-time PCR. Sequencing was conducted to verify
the species of the strains (data not shown). In the case
of the four spirochaetes (B. burgdorferi, L. illini, S. innocens
and T. denticola) DNA was purified from cultures prepared
as described above.
DNA was extracted from kidney tissue using an
automated robotic MagNA Pure LC instrument (Roche
Applied Science, Switzerland) with the commercially
available DNA isolation kit II for use with tissues (Roche,
Cat. No. 3186229) and following the manufacturers’
instructions.
2.3. Design of pathogenic Leptospira specific PCR
The 16S rDNA sequences of 38 Leptospira species,
including the closely related spirochaetes Borrelia burgdor-
feri, Leptonema illini, Serpulina innocens and Treponema
denticola found in the NCBI database (Table 2) were
10 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16

Table 1
Panel of Leptospira reference strains used for the development of the LightCycler assay and their corresponding results including melting temperature
(Tm) in C
Species Serogroup Serovar Strain PCR Result Tm
L. interrogans Autumnalis Australis Ballico Positive 63
L. interrogans Autumnalis Autumnalis Akiyami A Positive 63
L. interrogans Pyrogenes Zanoni Zanoni Positive 63
L. interrogans Bataviae Bataviae Swart Positive 63
L. interrogans Australis Bratislava Jez Bratislava Positive 63
L. interrogans Canicola Canicola Utrechi Positive 63
L. interrogans Icterohaemorr-hagiae Copenhagenii Wijinberg Positive 63
L. interrogans Grippotyphosa Grippotyphosa Moskva V Positive 63
L. interrogans Hebdomadis Hebdomadis Hebdomadis Positive 63
L. interrogans Icterohaemorr-hagiae Icterohaemorr-hagiae RGA#1 Positive 63
L. interrogans Pomona Pomona Pomona Positive 63
L. borgpetersenii Javanica Javanica Veldrat bataviae 46 Positive 63
L. borgpetersenii Mini Mini sari Sari Positive 63
L. borgpetersenii Ballum Ballum Mus 127 Positive 63
L. borgpetersenii Sejroe Hardjobovis Hardjobovis Weybridge Positive 63
L. borgpetersenii Sejroe Sejroe M84 Positive 63
L. borgpetersenii Tarassovi Tarassovi Pereplicin Positive 63
L. kirschneri Pomona Mozdok Pomona 5621 Positive 63
L. borgpeterseni Sejroe Hardjobovis Hardjobovis Bill Ellis Positive 63
L. biflexa Semaranga Patoc Patoc I Negative
L. meyeri Semaranga Semaranga Veldrat S.173 Negative
L. inadai Lyme Lyme Positive 59
L. santarosai Javanica Fluminense AA3 (HR) Positive 63
L. kirschneri Bataviae Djatzi HS26 (HR) Positive 63
L. interrogans Sejroe Hardjo Hardjoprajitno (HR) Positive 63
L. interrogans Sejroe Saxkoebing Mus24 (HR) Positive 63
L. meyeri Sari Sari SARI (HR) Positive 63
L. interrogans Grippotyphosa Grippotyphosa Duyster (HR) Positive 63
L. interrogans Canicola Broomi Patane (HR) Positive 63
L. interrogans Australis Australis Ballico (HR) Positive 63
L. santarosai Cynopteri Tingomaria M13 (HR) Positive 63
L. santarosai Sarmin Rio RR5 (HR) Positive 63
L. interrogans Pomona Pomona Pomona (HR) Positive 63
L. noguchii Louisiana Louisiana LSU1945 (HR) Positive 63
L. interrogans Autumnalis Autumnalis Akiyami A (HR) Positive 63
L. borgpetersenii Ballum Castellonis Castellon3 (HR) Positive 63
L. interrogans Hebdomadis Hebdomadis Hebdomadis (HR) Positive 63
L. interrogans Icterohaemorr-hagiae Icterohaemorr-hagiae Ictero1 (HR) Positive 63

aligned (data not shown). The leptospiral sequences could
be separated into two specific clusters that represented
the pathogenic and saprophytic species of Leptospira.
The pathogenic cluster contained nine different genomo-
species, which included the intermediate species L. inadai
and L. fainei. The saprophytic cluster included L biflexa,
L. wolbachii and Leptonema illini. Variable nucleotide
bases were highlighted by using the MegAlign program
(Lasergene6, DNASTAR, Inc. Madison, WI, USA). Bor-
relia burgdorferi, Serpulina innocens and Treponema denti-
cola were significantly distantly related. Specific primers
were designed to conserved regions of the 16S rRNA gene
that allowed clear differentiation between pathogenic
(primers PFA/PRA) and saprophytic (primers SFA/SRA)
leptospires (Table 3). One set of hybridisation probes
(Lepto 1 and 2) was designed to the region between the pri-
mer sets and these detect amplicons produced in both the
pathogenic and saprophytic specific PCRs. The LC red
640 dye was used as the reporter for this probe set which
allowed detection of the fluorescence from this probe in
channel 2 of the LightCycler instrument (Table 4).
Specific primers and hybridisation probes were also
designed to a conserved region of the b-actin gene in pigs
and cattle using those sequences deposited in the NCBI
database for Sus scrofa b-actin mRNA partial cds (Acc.
No. U07786) and Bos taurus b-actin mRNA complete cds
(Acc. No. AY141970). The LC red 705 dye was used as
the reporter for this probe which allowed detection in chan-
nel 3 of the LightCycler (Table 3).
2.4. Real-time PCR using the Roche LightCycler
The PCR mixture was prepared using a ready-made mas-
termix, LightCycler FastStart DNA Master Hybridisation
Probes (Roche Applied Science cat. no. 2239272) with the
following added, to give a final concentration of 2 mM
MgCl2, 500 nM of each primer, 200 nM of each probe
and ‘Hotstart’ Faststart polymerase enzyme according to
 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16 11

Table 2 Table 3
NCBI sequences used for the alignments for design of the primers and Primer and probe sequences for detection of pathogenic and saprophytic
probes to pathogenic leptospires leptospires and porcine and bovine b-actin genes
Bacterial species GeneBank Primer Primer sequence 5 0 –3 0
accession number
Lepto 1 Probe ggtgttcggccacaatgg -FL
Pathogenic Lepto 2 Probe LC Red640 ctgagacacggtccatactctacg-PH
L. borgpetersenii serovar Balcanica strain 1627 U12669 PFA Primer tgagtaacacgtgggtaatcttcc
Burgas PRA Primer caggtaccatcatcacatygctgc
L. borgpetersenii serovar Hardjo, strain Hardjo U12670 SFA Primer carcaatgcgcttttagatgggt
bovis/Sponselee SRA Primer aggtaccgtcaytttyttcktccct
L. borgpetersenii serovars Javanica strain Veldrat Z21630 Lepto forward nested gggtaatcttcctnygagtctg
batavia 46 (HD) Lepto reverse nested ccctgcttahtgaactttacaatc
L. fainei strain Hurstbridge U60594 PorBov For Primer ccaggctgtgctgtccctgta
L. fainei strain SSI 5402-98 Y19243 PorBov Rev Primer cagcaccgtgttggcgtagag
L. inadai strain Lyme (HD) Z21634 B-Actin FL Probe ggggtcacccacacgg-FL
L interrogans serovar Canicola strain Moulton X17547 b-Actin LC red Probe LC Red705-cccatctaygaggggtacgc-PH
L interrogans serovar Icterohaemorrhagiae strain Z12817 Key: Y = C + T, K = G + T, R = A + G, H = A+C+T, PH = phos-
RGA HD phorylation modification of probe, FL = fluorescein; LC Red640 and LC
L interrogans strain Kennewicki M71241 Red 705 = LightCycler red fluorophores detected by different channels of
L. kirschneri serovar Cynopteri, strain Cynopteri Z21628 the PCR machine.
3522 HD
L. meyeri serovar Ranarum strain ranarum ICF Z21648
HD Table 4
L. noguchii strain panama CZ 214 HD Z21635 Sequences of spirocheate, Leptospira-related bacteria and E. coli sequences
L. noguchii serogroup Autumnalis, subserogroup U12671 examined for regions of similarity to the Lepto primers 1 and 2
Fort Bragg, serovar Fortbragg, strain Fort
Bacterial species NCBI accession number Gene size (bp)
Bragg
L. santarosai strain shermani 1342 k HD Z21649 Borrelia burgdorferi M88239 1537
L. santarosai serogroup Tarassovi, subserogroup U12672 Escherichia coli M24828 1541
Atlantae, serovar Atlantae, strain LT81 Leptospira parva Z21636 1379
L. weilii serogroup Celledoni, serovar Celledoni, U12676 Staphylococcus aureus X68417 1555
strain Celledoni ATCC 43285 Serpulina hyodysenteriae M57741 1454
L. weilii serogroup Hebdomadis, subserogroup U12677 Serpulina innocens M57745 1453
Borincana serovar Worsfoldi, strain Worsfold Treponema denticola M71236 1509
L. weilii Celledoni strain Celledoni Z21637 Treponema maltophilum X87140 1479
L. weilii serogroup Icterohaemorrhagiae U12673 Treponema palladium M88726 1573
subserogroup Sarmin, serovar Sarmin, strain Treponema phagedensis M57739 1581
Sarmin Treponema vincentii AF033310 1473
L. weilii strain Ecochallenge AY034037
Non-pathogenic
L. biflexa strain tororo Z26969 85 C step that was set to 0.1 C/s. The fluorescence data
L. biflexa serovar Patoc strain patoc 1 Z12821 was collected during the 55 C annealing step and continu-
L. biflexa canela Z21631 ously during the melting curve program. The total volume
L. wolbachii strain CDC biflexa cdc Z21638 of the LightCycler reaction was 20 ll, of which 2 ll was
Leptospira spp. (turtle strain A-183) M88721
template.
L. biflexa serovar Ancona strain ancona ancona Z21629
porto
L. biflexa serovar Canela strain canela canela Z21631 2.5. Preparation of a Leptospira molecular mimic to act as a
Leptonema illini M88719 PCR positive control
Leptonema illini strain 3055 Z21632
Other Spriochaetes A DNA mimic was prepared by cloning a 370 bp frag-
Borrelia burgdorferi M88239 ment of the 16S rRNA gene of L. inadai into the
Serpulina innocens M57745 pGEM-T Easy Vector (Promega). Briefly this involved
Treponema denticola M71236
amplifying a L. inadai specific fragment from a boiled
lysate of a bacterial culture grown in EMJH media, using
manufacturers’ instructions. A second mastermix was pre- the primers PFA/PRA. Pfx DNA polymerase (Invitrogen)
pared using the primers and probes designed against b-actin was used in the PCR containing 300 lM dNTP’s, 1 mM
with the same concentrations of MgCl2, primers and probes MgSO4and 300 nM of each primer. The fragment was
as for the leptospire PCR. The cycling conditions for both ligated into the pGEM-T Easy Vector according to man-
PCRs were 95 C for 10 min, followed by 45 cycles of 10 s ufacturer’s instructions and E. coli (JM109 cells) were
at 95 C, 15 s at 55 C, and 20 s at 72 C. The PCR program transformed with this construct. The plasmid was extracted
was then followed with the melting curve analysis program from E. coli grown in liquid culture and purified using a
of 95 C for 0 s, 45 C for 15 s, 85 C for 0 s. The ramping plassmid mini preparation kit (QIAGEN). A 10-fold dilu-
speed was set to 20 C/s for all the stages, except the tion series of the plasmid DNA was prepared to 1011 to
12 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
test the sensitivity of the PCR. The plasmid insert was
sequenced and it was shown to share 100% identity with
the 16S rRNA gene of L. inadai and 99% with L. fainei.
2.6. Sequencing of positive amplicons from PCR of DNA
extracts of macerated kidney tissue
The amplicons from PCR positive field samples (see
below) were used as the template for a second round of
PCR in the LightCycler. Nested forward and reverse prim-
ers (Table 3) directed to pathogenic amplicons were used
with the same cycling reaction conditions as described above.
The hybridisation probes were added to detect the produc-
tion of amplicon in real-time. The amplicons were run on a
2% agarose gel, and extracted using QIAquick spin columns
according to manufacturer’s instructions (QIAGEN). Cycle
sequencing was conducted using a Beckman Coulter DTCS
Quick Start Kit according to the manufacturers’ instructions
and the products run on a Beckman Coulter CEQ8800
sequencer. The sequences were analysed using the SeqMan
program (Lasergene 6), and BLASTN search performed to
assess homologies with sequences in the NCBI database.
2.7. Field samples: sources and preparation
Porcine kidneys (n = 204) were collected from (a) cull
sows from pig herds with a history of reproductive disease
and positive MAT titres to pathogenic leptospires
(n = 180) and (b) porcine foetuses from diagnostic submis-
sions to VLA Regional Laboratories for investigation of
the cause of abortion (n = 24). Bovine kidneys (n = 2) were
taken at slaughter from animals in herds with high MAT
titres (n = 2). Rodent kidneys (rat, mouse, squirrel) were
from animals captured during rodent control operations
in a zoological garden with show animals with high MAT
titres (n = 7) and kidneys were also collected from a dog
dying with clinical signs suspicious of leptospirosis.
Kidney tissues were collected within a few hours of death
where possible. Entire kidney from aborted foetus or a
1 cm3 portion, spanning the corticomedullary junction,
was dissected aseptically from sow kidneys and macerated
in 2 ml of media (EMJH) using a Griffiths tube tissue grin-
der. Half of the macerate was serially diluted in fresh EMJH
(10 ml volumes) for bacterial culture. The other half was
boiled for 5 min and used for DNA extraction.
Cultures were observed for the presence of leptospires
periodically up to 26 weeks of incubation by taking a
50 ll sample and using dark-field light microscopy at a
magnification of 40· and 100·. The cultures were filtered
through a 0.2 lM filter if contamination was overt.
3. Results
3.1. Development of the PCR
DNA extracted from a panel of bacteria comprising 38
leptospire strains and 29 other bacterial species belonging
to different genera was used to test the specificity of the
‘pathogenic’ PFA/PRA primers. As expected, all patho-
genic strains were positive (including the positive control
L. inadai mimic plasmid). L. meyeri serovar Semaranga
and L. biflexa serovar Patoc that belong to the saprophytic
group and all unrelated bacterial species were negative by
the PCR. Confirmation that the negative results of L. mey-
eri serovar Semaranga and L. biflexa serovar Patoc were
not a consequence of PCR inhibition was shown by ampli-
fication using the same preparations as targets with primers
SFA/SRA designed to be specific for the saprophytic
strains. None of the pathogenic strains or unrelated bacte-
rial species gave amplicons with these primers.
To test the limit of detection of the PCR, boiled lysates
of the 38 pathogenic leptospires prepared by serial dilu-
tions of cultures standardised by dark field counts were
tested by PCR with primers PFA/PRA. In each case a posi-
tive PCR was achieved with approximately 1 c.f.u. The
cycle threshold (Ct) values obtained for the bacterial
lysates at a dilution giving 1 c.f.u. was 24–31 with fluores-
cence levels of approximately 0.8 on the F2 channel. The
limit of detection for purified L. inadai mimic DNA was
10 molecules.
From the melting curve data, which is used as an indica-
tor of the specificity of the probe for the amplicon, the Tm
of the probes and specific amplicons for all the pathogenic
leptospire strains tested with primers PFA/PRA was within
the range 63–64 C, except with L. inadai which had a Tm
of 59 C (Table 1 and Fig. 1). This is a so-called ‘interme-
diate’ species of Leptospira (Perolat et al., 1998). The L.
inadai molecular mimic also had a Tm of 59 C. As the
Tm of L. inadai was 3 C lower than pathogenic species it
allowed discrimination of positive test samples from con-
tamination with the mimic.
3.2. b-Actin internal control
The addition of dilutions of kidney macerates directly to
the PCR mastermix with primers PFA/PRA and leptospire
DNA inhibited the PCR. However, DNA extracted from
the kidney macerate in the MagNA Pure robotic automatic
extraction system (Roche) overcame inhibition in 98% of
samples tested. Thus, to confirm that all components of
the PCR performed correctly with such samples, an addi-
tional PCR acting as an internal control was developed.
A host DNA gene PCR was developed and the target cho-
sen was the porcine b-actin gene that is abundant in tissue
samples. The Ct values obtained from the amplification of
b-actin DNA in the tissue samples were low with fluores-
cence values approaching 0.8–1.0. The Ct values ranged
from 24 to 31 and the Tm values were 63–64 C with por-
cine kidney DNA as template.
3.3. PCR testing of field samples
A total of 204 kidney samples from pigs were tested by
the PCR assay and culture. All samples were positive with
 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
Fig. 1. Typical LightCycler result showing melting curves of positive pathogenic leptospires, and flat lines for negative samples and no template control
reactions. (Tm melting temperature of 63–65 C represents pathogenic leptospires whilst a Tm of 59 C represents the intermediate species L. inadai).
the b-actin control PCR confirming the quality of DNA
samples was suitable for PCR. Of the 204 samples tested,
25 that comprised of 4 pig foetal and 21 adult pig kidney
samples were positive by PCR with primers PFA/PRA.
All these positive samples produced amplicons with a Tm
of 62 C. No samples were positive with the PCR using
primers SFA/SRA and no culture from pig samples were
successful.
In a separate trial, kidney samples from a number of
other animals were tested by the PCR assay and culture.
Four animals were positive by the PCR with primers
PFA/PRA and comprised of three rat kidney samples
and both kidney samples of the same mouse. The positive
samples from rats produced amplicons with a Tm of
62 C whereas the mouse derived amplicon had a lower
Tm of 59 C. Leptospires were isolated by culture from only
one mouse kidney positive by PCR. Because the b-actin
control PCR was specific for porcine and bovine sequences,
this control assay could not be used as a positive control
from samples of non-porcine origin. It is possible that some
of the rodent DNA samples were of insufficient quality for
PCR amplification.
3.4. Confirmation of amplicon identity by DNA sequence
analysis
A total of 12 porcine and 2 rat derived amplicons from
kidney samples positive by PCR with primers PFA/PRA
were selected at random and the DNA sequence deter-
mined. The outputs were compared with NCBI database
entries using BLASTN. Not all products gave complete
amplicon length reads (mean 298 bp, range 233–357 bp)
but the evidence was clear that they aligned with 98–
100% identity with pathogenic Leptospira species (L. inter-
rogans; NCBI accession number AM050586).
13
To confirm that the positive PCR with primers PFA/
PRA direct from the mouse kidney was real, PCR was con-
ducted using boiled lysates taken from the corresponding
successful culture. Sequencing showed that both amplicons
(full-length 357 bp) were identical to corresponding region
of the L. inadai 16S rDNA gene (NCBI Acc. No. Z21634).
This confirmed why the observed Tm of 59 C was
obtained. In addition, the designation of the culture as
belonging to L. inadai was confirmed by species-specific
monoclonal antibody testing conducted by the KIT Lepto-
spirosis Reference Laboratory (Amsterdam, The
Netherlands).
4. Discussion
The aim of this study was to develop a diagnostic PCR
based test for use on kidney tissues from cases of suspected
infection with pathogenic leptospires, including aborted
foetuses. A real-time PCR was developed using primers
previously designed to a conserved region of 16S rRNA
sequences of pathogenic species of Leptospira (Gallego-Bel-
tran, 2002) for use on the Roche LightCycler. An auto-
mated DNA extraction method was developed on the
MagNa Pure LC extraction robot (Roche) that was shown
to be suitable for preparation of DNA template. The inclu-
sion of an internal control PCR (b-actin) in the Light-
Cycler assay gave assurance that a negative PCR result
represents a leptospire negative sample and failure to detect
leptospires in such samples was not due to PCR inhibition,
or failure of DNA extraction.
Detection of leptospires by culture requires considerable
skill and often extended periods of incubation, and detec-
tion by FAT also requires expertise, avid antibody reagents
and abundant leptospires in the sample. By comparison,
direct detection by PCR required 6 h including sample
14 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
preparation, extraction and PCR etc. Our attempts at cul-
ture were unsuccessful, except for one sample, even though
standard protocols were followed. The high failure rate
may be associated with delays in the kidney samples arriv-
ing at the laboratory, even though we endeavoured to keep
delay prior to culture to less than 24 h as it is known that
leptospires are very fastidious. Although this study is not
a validation study, it did indicate the suitability of the
PCR to detect leptospires in samples.
PCR has been developed for the detection of leptospires
for a wide variety of clinical samples such as serum (Heine-
mann et al., 1999; Smythe et al., 2002), aqueous humour
(Faber et al., 2000), aborted foetuses (Richtzenhain et al.,
2002), cerebrospinal fluid (Romero et al., 1998; Merien
et al., 1992) urine (Van Eys et al., 1989; Wagenaar et al.,
1994; Bal et al., 1994; Harkin et al., 2003; Merien et al.,
1992) and environmental samples (Smythe et al., 2002).
Most are directed towards detection of 16S rRNA genes,
are not real-time assays and the amplicons require analysis
by gel electrophoresis. There are a few published methods
that use real-time PCR. Smythe et al. (2002) developed a
TaqMan assay that can discriminate between pathogenic
and saprophytic strains. However, it cannot detect L. ina-
dai which is an intermediate species (Faine et al., 1999).
In this context, the detection of a presumptive L. inadai
from one mouse tissue raises interesting questions over
the pathogenic potential of this serotype. It should be
noted that L. inadai has been isolated from rats previously
(Gangadhar et al., 2000).
Levett (2001) and Merien et al. (1992) developed real-
time assays on the LightCycler platform to detect lepto-
spires but used SYBR green to monitor the reactions.
SYBR-green has advantages in that it is cheaper than
FRET probes although it is not specific for the amplicon
as it will give a false positive signal for non-specific ampli-
cons. As in our study, Slack et al. (2007) has recently
refined an existing PCR into the TaqMan LightCycler
format specifically for use with serum samples from clinical
cases suggesting this approach could replace culture. How-
ever, our study is the first paper to describe a LightCycler
PCR for the detection of pathogenic leptospires that uses a
specific probe set that can discriminate between pathogenic
and saprophytic leptospires and that includes a b-actin
amplification run in parallel to control for PCR inhibition.
Although only designed for porcines, the principle of this
control PCR can be extended to other tissue sample types.
The PCR developed here was able to detect all patho-
genic leptospires tested in the development stage of the
study, including L. inadai. The two saprophytic strains L.
biflexa serovar Patoc and L. meyeri serovar Semaranga
were not detected, neither were other unrelated spirochae-
tes detected. There is some controversy concerning the clas-
sification of pathogenicity of some members within the
species L. meyeri. Postic et al. (2000) studied the 16S rRNA
sequences of over 50 different Leptospira species available
in databanks by phylogenetic analysis, including four dif-
ferent L. meyeri serovars. They found that leptospires fell
into three clades. The pathogenic species (L. interrogans,
L. weilii, L. borgpetersenii, L. noguchi, L. kirschneri, L.
santarosai) formed one cluster; a second contained L. ina-
dai and L. fainei while the third contained the saprophytic
species (L. biflexa, L. wolbachii). Some L. meyeri serovars
fell into the pathogenic clade (L. meyeri serovar Ranarum
strain ICF and L. meyeri serovar Sofia) while others did
not (L. meyeri serovar Semaranga) and fell into the clade
including the L. biflexa serovars and L. wolbachii. Several
authors (Hookey et al., 1993; Perolat et al., 1998; Kosiat-
anont et al., 2007) found that L. meyeri type strain ICF
clustered with the pathogenic species. This suggests that
some serovars of L. meyeri are pathogenic and others
not, e.g. L. meyeri serovar Semaranga. In our study we
tested two L. meyeri serovars, L. meyeri serovar Sari was
positive in the pathogenic PCR whereas L. meyeri serovar
Semaranga was negative. This is the first report of L. mey-
eri serovar Sari being tested in a 16S rRNA pathogenic
PCR. There is no data on pathogenicity of this serovar in
animals. An alternative approach to differentiation on
pathogenic and non-pathogenic leptospires is by duplex
PCR as described by Tansuphasari et al. (2006) in which
one primer pair amplified the 16S rRNA gene common
to all leptospires and another primer pair amplified the
Lip32 gene found in pathogenic leptospires only.
There is also limited information on the pathogenicity of
L. inadai. It is free-living in the surface water of streams or
rivers, and therefore, it may be an environmental strain
that is found incidentally in animals living near to contam-
inated water. There are no documented cases of L. inadai
causing human infections even though it was isolated orig-
inally from the skin of a Lyme disease patient (Schmid
et al., 1986). In our study we found L. inadai serovar Lyme
to be positive in the pathogenic leptospire PCR. In contrast
Merien et al. (2005) and Levett et al. (2005) who directed a
pathogenic leptospire PCR to conserved regions of a gene
encoding a hypothetical protein and a lipoprotein respec-
tively found the ‘Lyme’ serovar to be negative. The 16S
rRNA PCR developed by Smythe et al. (2002) also found
L. inadai serovar Lyme to be negative, however, our anal-
ysis of their probe sequences showed that they were homol-
ogous to the target gene sequence and should have allowed
amplification. The gel-based 16S rRNA PCR designed by
Wagenaar et al. (1994) did obtain a positive result with
L. inadai serovar Lyme. In our study the melting tempera-
ture of the amplicon was 3 C lower than the other patho-
genic species tested. This is due to one nucleotide change in
the target for the Lepto probe 1. Based on these genetic
data we may conclude L. inadai could be classified as an
intermediate type. L. fainei also has the same nucleotide
change in this region but Kosiatanont et al. (2007) sug-
gested L. fainei was non-pathogenic based on 23S rRNA
sequence analysis. The Tm difference is useful as it allows
the two intermediate strains to be differentiated from the
acknowledged pathogenic strains.
In summary, these results show that the LightCycler
assay developed in this study is suitable for the detection
 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
of pathogenic leptospires from kidney tissue. The inclusion
of the b-actin internal control allows the PCR to be used
with more confidence as a diagnostic test. The test is
currently being further assessed as a diagnostic for the
detection of leptospires in animals by the VLA. A disad-
vantage of this PCR is that the species of the leptospire
cannot be determined directly from the PCR result because
the PCR is directed to a conserved region of the 16S rRNA
gene where very few nucleotide differences exist between
different species. Serology may help indicate the infecting
Leptospira species. However, that single nucleotide poly-
morphisms in this region do exist indicates the potential
for enhancing the test to achieve speciation and this is an
area of active further research. However, other genes such
gyrB that show sequence diversity have been used as tar-
gets for differentiation by PCR as described recently Slack
et al. (2006).
Acknowledgements
We would like to thank Yvonne Hesketh and Kate
Smith for all their hard work in the leptospire section at
VLA Weybridge.
References
Appassakij, H., Silpapojakul, K., Wansit, R., Woodtayakorn, J., 1995.
Evaluation of the immunofluorescent antibody test for the diagnosis of
human leptospirosis. American Journal of Tropical Medicine and
Hygiene 52, 340–343.
Bal, A.E., Gravekamp, C., Hartskeerl, R.A., De Meza-Brewster, J.,
Korver, H., Terpstra, W.J., 1994. Detection of leptospires in urine by
PCR for early diagnosis of leptospirosis. Journal of Clinical Micro-
biology 32, 1894–1898.
Cole, J.R., Sulzer, C.R., Pursell, A.R., 1973. Improved microtechnique for
the leptospial microscopic agglutination test. Applied Microbiology
25, 976–980.
Dhaliwal, G.S., Murray, R.D., Ellis, W.A., 1996. Reproductive performance
of dairy herds infected with Leptospira interrogans serovar hardjo relative
to the year of diagnosis. Veterinary Record 138, 272–276.
Ellis, W.A., O’Brien, J.J., Neill, S.D., Ferguson, H.W., Hanna, J., 1982.
Bovine leptospirosis: microbiological and serological findings in
aborted foetuses. Veterinary Record 110, 147–150.
Faber, N.A., Crawford, M., LeFebvre, R.B., Buyukmihci, N.C., Madigan,
J.E., Willits, N.H., 2000. Detection of Leptospira spp. in the aqueous
humor of horses with naturally acquired recurrent uveitis. Journal of
Clinical Microbiology 38, 2731–2733.
Faine, S., Adler, B., Bolin, C., Perolat, P., 1999. Leptospira and
leptospirosis. Second ed., Melbourne, Australia, MedSci.
Gallego-Beltran, J., 2002. Leptospirosis in Colombian dairy cattle:
microbiological, serological and molecular aspects of the disease.
Thesis (PhD). Royal Veterinary College, University of London.
Galton, M.M., Powers, D.K., Hall, A.D., Cornell, R.G., 1958. A rapid
macroscopic slide screening test for the serodiagnosis of leptospirosis.
American Journal of Veterinary Research 19, 505–512.
Gangadhar, N.L., Rajasekhar, M., Smythe, L.D., Norris, M.A., Symonds,
M.L., Dohnt, M.F., 2000. Reservoir hosts of Leptospira inadai in
India. Revue Scientifique et Technique 19, 793–799.
Harkin, K.R., Roshto, Y.M., Sullivan, J.T., Purvis, T.J., Chengappa,
M.M., 2003. Comparison of polymerase chain reaction assay, bacte-
riologic culture, and serologic testing in assessment of prevalence of
urinary shedding of leptospires in dogs. Journal of the American
Veterinary Medical Association 222, 1230–1233.
15
Heinemann, M.B., Garcia, J.F., Nunes, C.M., Morais, Z.M., Gregori, F.,
Cortez, A., Vasconcellos, S.A., Visintin, J.A., Richtzenhain, L.J., 1999.
Detection of leptospires in bovine semen by polymerase chain reaction.
Australian Veterinary Journal 77, 32–34.
Hookey, J.V., Bryden, J., Gatehouse, L., 1993. The use of 16S rDNA
sequence analysis to investigate the phylogeny of Leptospiraceae and
related spirochaetes. Journal of General Microbiology 139, 2585–2590.
Johnson, R.C., Harris, V.G., 1967. Differentiation of pathogenic and
saprophytic leptospires. 1. Growth at low temperatures. Journal of
Bacteriology 94, 27–31.
Kaltenboeck, B., Wang, C., 2005. Advances in real-time PCR: application
to clinical laboratory diagnostics. Advances in Clinical Chemistry 40,
219–259.
Kosiatanont, U., Rugsasuk, S., Phulsuksombati, D., Tantianawat, S.,
Naigowit, P., 2007. Detection and differentiation between pathogenic
and saprophytic Leptospira spp. by multiplex polymerase chain
reaction. Diagnostic Microbiology and Infectious Disease 57, 117–122.
Levett, P.N., 2001. Leptospirosis. Clinical Microbiology Reviews 14, 296–
326.
Levett, P.N., Moery, R.E., Galloway, R.E., Turner, D.E., Steigerwalt,
A.G., Mayer, L.W., 2005. Detection of pathogenic leptospires by
real-time quantitative PCR. Journal of Medical Microbiology 54,
45–49.
Merien, F.M., Portnoi, D., Bourhy, P., Charavay, F., Berlioz-Arthaud,
A., Baranton, G., 2005. A rapid and quantitative method for the
detection of Leptospira species in human leptospirosis. FEMS Micro-
biology Letters 249, 139–147.
Merien, F., Amouriaux, P., Perolat, P., Baranton, G., Saint Girons, I.,
1992. Polymerase chain reaction for detection of Leptospira spp. in
clinical samples. Journal of Clinical Microbiology 30, 2219–2224.
Nielsen, J.N., Armstrong, C.H., Turek, J.J., Nielsen, N.C., 1989. Etiologic
studies on late-term swine abortions. Journal of Veterinary Diagnostic
Investigation 1, 160–164.
Perolat, P., Chappel, R.J., Adler, B., Baranton, G., Bulach, D.M.,
Billinghurst, M.L., Letocart, M., Merien, F., Serrano, M.S., 1998.
Leptospira fainei sp. nov., isolated from pigs in Australia. Interna-
tional Journal of Systematic Bacteriology 48, 851–858.
Plank, R., Dean, D., 2000. Overview of the epidemiology, microbiology,
and pathogenesis of Leptospira spp. in humans. Microbes and
Infection 2, 1265–1276.
Postic, D., Riquelme-Sertour, N., Merien, F., Perolat, P., Baranton, G.,
2000. Interest of partial 16S rDNA gene sequences to resolve
heterogeneities between Leptospira collections: application to L.
meyeri. Research in Microbiology 151, 333–341.
Schmid, G.P., Steere, A.C., kornblatt, A.N., Kaufmann, A.F., Moss,
C.W., Johnson, R.C., Hovind-Hougen, K., Brenner, D.J., 1986. Newly
recognized Leptospira species (‘‘Leptospira inadai’’ serovar Lyme)
isolated from human skin. Journal of Cloninal Microbiology 24, 484–
486.
Richtzenhain, L.J., Cortez, A., Heinemann, M.B., Soares, R.M., Sakam-
oto, S.M., Vasconcellos, S.A., Higa, Z.M., Scarcelli, E., Genovez,
M.E., 2002. A multiplex PCR for the detection of Brucella spp. and
Leptospira spp. DNA from aborted bovine fetuses. Veterinary Micro-
biology 87, 139–147.
Romero, E.C., Billerbeck, A.E., Lando, V.S., Camargo, E.D., Souza,
C.C., Yasuda, P.H., 1998. Detection of Leptospira DNA in patients
with aseptic meningitis by PCR. Journal of Clinical Microbiology 36,
1453–1455.
Ryu, E., 1970. Rapid microscopic agglutination test for Leptospira
without non-specific reaction. Bulletin Office Internationale Epizooite
73, 49–58.
Slack, A.T., Symonds, M.L., Dohnt, M.F., Smythe, L.D., 2006. Identi-
fication of pathogenic Leptospira species by conventional or real-time
PCR and sequencing of the DNA gyrase subunit B encoding gene.
BMC Microbiology 6, 95.
Slack, A., Symonds, M., Dohnt, M., Harris, C., Brookes, D., Smythe, L.,
2007. Evaluation of a modified Taqman assay detecting pathogenic
Leptospira spp. against culture and Leptospira-specific IgM enzyme-
16 C. Fearnley et al. / Research in Veterinary Science 85 (2008) 8–16
linked immunosorbent assay in a clinical environment. Diagnostic
Microbiology and Infectious Disease 57, 361–366.
Smythe, L.D., Smith, I.L., Smith, G.A., Dohnt, M.F., Symonds, M.L.,
Barnett, L.J., McKay, D.B., 2002. A quantitative PCR (TaqMan)
assay for pathogenic Leptospira spp.. BMC Infectious Diseases 2, 13.
Tansuphasari, U., Chathadee, R., Phulsuksombati, D., Sangjun, N., 2006.
Development of a duplex-polymerase chain reaction for rapid detec-
tion of pathogenic Leptospira. Southeast Asian Journal of Tropical
Medicine and Public Health 37, 297–308.
Turner, L.H., 1968. Leptospirosis II. Serology. Transactions of the Royal
Society of Tropical Medicine and Hygiene 62, 880–889.
Van Eys, G.J., Gravekamp, C., Gerritsen, M.J., Quint, W., Cornelissen,
M.T., Schegget, J.T., Terpstra, W.J., 1989. Detection of leptospires in
urine by polymerase chain reaction. Journal of Clinical Microbiology
27, 2258–2262.
Wagenaar, J.A., Segers, R.P., Van der Zeijst, B.A., 1994. Rapid
and specific detection of pathogenic Leptospira species by
amplification of ribosomal sequences. Molecular Biotechnology
2, 1–14.
Woodward, M.J., 2001. Leptospira. In: Sussman, M. (Ed.), Molecular
Medical Microbiology. Harcourt-International Academic Press, Lon-
don, pp. 2137–2159.