JECAS Ap 2013-FEM-Published PDF

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/328304840
JEC&AS Ap 2013 - FEM - Published
Article · April 2013
CITATIONS READS
0 133
1 author:
s.Bala Murugan
Coimbatore Institute of Technology
4 PUBLICATIONS 0 CITATIONS
SEE PROFILE
All content following this page was uploaded by s.Bala Murugan on 16 October 2018.
The user has requested enhancement of the downloaded file.

ISSN : 2319-5606
Journal
of Engineering, Computers &
Applied Sciences
Journal of Applied
Engineering & Computer
Sciences Volume 2, No 4, April 2013
Blue Ocean Research Journals

www.borjournals.com
ww
SR.No Title/Author Page No.
1 Integrated Solar Wall System With Combined Electricity And Windows 1-4
Radhakrishnan.P, Mahesh Priya.L, Sowmya.S
2 Optical Studies on Sol-Gel Derived Lead Chloride Crystals 5-9

I.Rejeena, B.Lillibai, B.Nithyaja, V.P.N.Nampoori, P.Radhakrishnan
Simulation of Plasma Transferred ARC (PTA) Hardfaced on Structural Steel

3 with Titanium Carbide
10-14
S.Balamurugan, N.Murugan
4 Elimination of Charge Sharing Problem in Dynamic Circuit 15-19

Saurabh Sharma, Sanjeev Maheshwari, Sanjeev Kumar, Vrince Vimal
5 Effect Of Climate Change On Global Surface Temperature 20-24

Dr. S.C. Dubey, Mr. G.P. Dubey, Dr. L.K. Borkar
6 Solar Powered Generator Free Electricity 25-29

Amrit Pal Singh
7 Data Leakage Detection 30-34

Sachin A. Bansode, Uday M. Jadhav, Prof. N. K. Patil
Biotransformation of a Textile AZO Dye Acid Yellow 25 by Marinobacter

8 35-45
Gudaonensis AY-13
Shertate R.S., Thorat P.R.
Techno-Economic Analysis of a Mixed Grainage for the Production of

9 Multivoltine and Bivoltine Commercial Seed Production in Karnataka 46-49
(India)
B.S.Angadi
10 Comparative Study of EMC Greenplum and Oracle Exadata 50-54

Ektaa Rajput, Harshita Yadav, Ayushi Singh
11 Comparative Study of 1G, 2G, 3G and 4G 55-63

Sapna Shukla, Varsha Khare, Shubhanshi Garg, Paramanand Sharma
12 A Novel Application for Android Based Handheld Devices 64-67

Rashmi Sharma, Somya, Deepa Raghava
13 Dual Watermarking For High Protective Copyright System 68-71

Sagar R Dhole, Rahul S.Shahane, KrishnaV.Varat, Ganesh N.Falake
To Identify Disease Treatment Relationship in Short Text Using Machine

14 Learning & Natural Language Processing
72-75
Khan Razik , Dhande Mayur , Patil Aniket,Gaikwad Namrata
15 A Review on Need of BI in an Organization 81-84

Saloni Bansal , Soumya Awasthi, Charu Gupta
www.borjournals.com Blue Ocean Research Publications

Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606

Volume 2,, No.4, April 2
2013
________________________________________________________________________________________

Inteegrated Solar Wall

W Sy ystem W
With Com
mbined
d Electrricity
Andd Wind
dows
Radhakrrishnan.P, Asssistant Professsor, Departm
ment of EEE, Karpagam
K Uniiversity, Coim
mbatore
Mahesh Priya.L, Assiistant Professoor, Departmennt of Social Work,
W Karpagaam University, Coimbatore
Sowmyaa.S, Final Yearr Student, Deppartment of Civil Engineeriing, Karpagam
m University, Coimbatore
ABSTR
RACT
This papper presents a study on thee utilization of
o solar energgy, and buildiing solar walll system. A significant
s
amount ofo research and developmeent work has to be carriedd out in develloped nationss. Windows w with power
generatioon system iss not develooped. A rangge of theoreetical model have investtigated for aand their
appropriiateness validaated by simullation data. Im
mprovement ofo the solar wall's
w perform
mances can bee obtained
using douuble glazing. The
T results deemonstrated thhat solar wall provides enerrgy savings.
Keyword ds: Solar wallls, Dynamic Simulation,
S Inddoor thermal comfort,
c Enerrgy analysis.
1. Introoduction During operatio

D on of PV sysstems neither noise nor
The appllication of Window
W Photoovoltaic systemms poollution is prooduced.
incorporaating hybrid PV Thermal collectors iss a A
Advanced conccept of BIPV V systems is solar
s skin
viable mmethod of costt saving due to t the combin ned w
which unifies both
b opaque and
a semitranspparent PV
provisionn of electricaal power, heaated air and hot h ellements togetther with dou uble-skin faccades and
water forr use within thhe building. W
Window wall systems
s into architecturally
a attractive
Using thiis technology,, air is actively passed behiind ennergy generatiing building envelope.
e
the PV modules, theere by coolinng the cells to
maintain efficiency, whichw can thhen be used to
temper vventilation airr or re-circullated throughh a
heater baattery for hot water
w provisioon.
The issuee of PV cost is currently one o of the maain
factors limiting
l its wide-scale application.
a A
As
Window Photovoltaicc systems inccur even highher
capital coosts due to thhe plant requiired for therm mal
collectionn and distribbution, this technology may m
seem eveen less econom mically viablee to an architeect
or develooper.
Howeverr, if considerred at an eaarly stage in a
building’’s design usiing a holistiic approach to
incorporaate passive an nd active solaar systems , thhis
technologgy can provid de significantt life cycle coost
savings ccompared to standard
s PV, and thereforee a
reductionn in the pay--back period of the originnal Fig.1 Glazzing with inteegrated semi--
capital ouutlay. tran
nsparent PV module
m
To ensure that the appllication of Wiindow
Photovolltaic systems is appropriatte for a speciific 2.. Descriptioon
building and its looad requirem ments, detailled Phhotovoltaic caan be integrated into the facade
f of
simulatioon at the design
d stage can assist in thhe building as cladding or glazing.
g The orrientation
optimizinng the perform mance of the innstalled systemm. off the facade may be verrtical, as in walls, w or
Building Integrated Phhotovoltaic (B BIPV) is rapiddly sloped, as in rooofs, domes, or vaults. Thhe curtain
developinng concept of o integration of PV devicces w
wall, consistingg of a frame fitted
f with inffill panes,
into buildding envelopees. is especially suitable
s to PVV integrationn. It is a
BIPV sysstems can be designed in form f of facadees, coommon buillding envelo ope technoloogy that
roofs orr PV glazing g with accennt put on full fu reesembles conv ventional phottovoltaic technnology.
functionaal, structural and aesthetiical integration
and coopperation with thet building.
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 1
5606

2013
________________________________________________________________________________________

opptimization of
o its structuural, geometrrical and
teechnological parameters,
p a complex siimulation
m
model must be established. It basically coonsists of
inndividual models
m whhich are solved
simmultaneously.
Fig .3.1 Coomplex modeel scheme
3..1 Meteorolog gical and airfflow model

Thhe overall simmulation modeel takes meteoorological
Figg .2.1 Basic ex
xperimental PV
P façade daata and airrspeed as input variaables for
coomputation of o thermal and a electricaal energy
A numbeer of different PV facade appproaches werre ouutput. Calculaations of metteorological inputs
i are
investigaated as followss: baased on MET TEONORM data. Furtherrmore the
1. Warm versus cold façade vaalues of ambient temperatuure and wind speed are
2. Insulating glaass versus weaather claddingg neeeded.
3. Frame designn Frrom the natu ure of airfloww in the mecchanically
4. Cladding verssus stick-wall w
window air gapp follows that the velocity of
o moving
5. Encapsulationn aiir can be deetermined inddependently of o the air
6. Transparencyy of PV teemperature. Airspeed
A in the window w gap is
Mechaniccally ventilateed PV system m is designed in obbtained by annalytical solu ution of Naviier-Stokes
two partts along a ceentral glassedd-in strip of the t eqquation and co ontinuity equation for 1D stationary
existing facade. PV panels
p will bee mounted onn a tuurbulent flow,, where the air
a is consideered to be
steel/alum
minum supporrting structuree covering walll. N
Newtonian uncompressible fluid.
f
3..2 Electrical model

m
Calculation of electrical eneergy output is based on
Phhotovoltaic Array
A ormance Model. The
Perfo
ammount of ouutput power depends, beeside the
inncident solar radiation, on n solar cells operating
teemperature – with
w increasing cells temperrature, the
effficiency of ennergy conversion is decreassing.
Byy a maximuum power pooint tracking (MPPT)
coontroller are the main energy sourcees of the
syystem That is why it is dessirable to keepp the cells
teemperature low w, which can be done by mechanical
m
w
window of the air
a gap
Foor determinattion of a ben nefit of the mechanical
m
w
window an ap ppropriate theermal model must be
buuilt.
Fig. 2.2 Ven
ntilated PV faacade
ulation
3. Simu
For prediction of PV system behavior annd
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 2
5606

2013
________________________________________________________________________________________

heeat equation with

w mixed boundary condditions for
coonduction witthin the PV panels and for
f forced
coonvection in thhe air gap.
Thhe network of heat exchhange with key
k nodal
teemperatures giiven below.
3.3 Therrmal Model

Incident solar radiatiion on the PV P modules is
F 3.4 Netwo
Fig. ork of heat exxchange with key
either refflected or abssorbed by a glass
g cover annd
the rest iss transmitted to
t the solar ceells. noodal temperattures
A portionn of energy absorbed
a by thhe solar cells is
mportant is thhat thermal ennergy from thhe air
Im
directly converted into electriccity and th he
gaap can be colleected and utilized for heatinng or
remaininng energy is tu urned into heatt.
coooling of a buiilding.
Thermal energy geneerated at thee solar cells is
Foor instance during heaating season the
conducteed simultaneously towards front and baack
prreheated air can
c be directeed into ventilaation
surface oof the PV mod dules.
unnit and duringg summer tim me this hot airr can
drrive desiccant cooling systeem.
4.. Results
Models discusssed Section IIII; a simulationn has
M
beeen developedd using MATL LAB/Simulinnk. In
orrder to verify
y the system performance load
deemand data.
Thhe power diffference betweeen the generaation
soources and the load demannd and micro grid
baalance power quality by FA
ACTS devices..
5.. Conclusioon
Inn this paper, a Window Phhotovoltaic syystem
is proposed. Studied utillization of solar
ennergy, and buuilding solar wall
w system which
w
Figg .3.3 Networkk of solar eneergy caapable to mainntain load demmand in peak load
conveersion .B
By using solaar wall ambieent temperaturre of
inndoor is minimmum in summ mer and electtrical
This eneergy is radiatted and convverted from the
t poower outage is maintained. Model cann be
modules’’ surfaces to surroundinngs or to the t ussed in hot /coool conditionns. The simulaation
window aair gap, respecctively. m
model of thee hybrid sy ystem has been
deeveloped using MA ATLAB/Simuulink.
The therm
mal model is then based onn solution of 1D
1 Siimulation studies have beeen carried ouut to
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 3
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606

Volume 2, No.4, April 2013
_________________________________________________________________________________

verify the system performance under different Sandia National Laboratories, Albuquerque,
scenarios using the practical load. 2004
[4] Incropera, F. P., DeWitt, D. P.: Introduction to
6. Reference Heat Transfer, 3rd ed., John Wiley & Sons,
[1] The German Solar Energy Society: Planning New York, 1996
and Installing Photovoltaic Systems – A [5] Mei, L., Infield, D., Eicker, U., Fux, V.:
Guide for Installers, Architects and Engineers, Thermal Modelling of a Building with an
James & James, London, 2005 Integrated Ventilated PV Façade, Energy and
[2] Heinemann, D.: Energy Meteorology – Buildings 35 (2003)pp. 605-617
Lecture notes, Carl von Ossietzky Universität, [6] C. Hua, J. Lin, and C. Shen, “Implementation
Oldenburg, 2002 of a DSP-controlled photovoltaic system with
peak power tracking,” IEEE Trans. Ind.
[3] King, D. L., Boyson, W. E., Kratochvil, J. A.: Electron., vol. 45, no. 1, pp. 99–107, Feb. 1998
Photovoltaic Array Performance Model,

www.borjournals.com Blue Ocean Research Journals 4

_________________________________________________________________________________

Optical Studies on Sol-Gel Derived Lead Chloride

Crystals
I.Rejeena, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala,
India and M.S.M.College, Kayamkulam, Kerala, India
B.Lillibai, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala,
India,
B.Nithyaja, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala,
India
V.P.N.Nampoori, International School of Photonics, Cochin University of Science and Technology, Cochin
Kerala, India
P.Radhakrishnan, International School of Photonics, Cochin University of Science and Technology, Cochin
Kerala, India
ABSTRACT
Optical characterization of lead chloride crystals prepared by sol-gel method is reported. The relevant sol-gel
technique is used for the preparation of PbCl2 samples with five different types. In this paper, we report the
absorption and fluorescence behaviour of pure, UV& IR irradiated and electric & magnetic field applied lead
chloride crystal samples in solution phase at two different concentrations. Optical bandgap and emission
studies of these crystals are also done.
KEYWORDS: Lead chloride, absorption,fluorescence,gel method,spectroscopy
Introduction
Flourescence spectroscopy is of overwhelming with layers perpendicular to the [010] direction.
importance in the field of photo physics. Lead The lead chloride crystal is characterized by an
chloride is a well known photosensitive material excitonic fundamental edge, which are formed by
possessing ionic crystalline nature belonging to electronic states of lead ion.Our experiments on the
orthorhombic system [1]. PbCl2 is the model growth of lead chloride confirm the utility of this
material from heavy element halogenide group method for growing large needles and single
since it satisfies high birefringence, low attenuation crystals. In the visible region the length of the
coefficient and wide transparency range [2]. Many needle is small compared to the growth of lead
of the researchers reported the luminescence chloride crystals under the influence of ultraviolet
property of PbCl2 [3]. Under excitation in the and infrared radiations.
fundamental absorption region, PbCl2 crystals
exhibit two types of intrinsic luminescence [4]. Experimental Technique
W.C.DE Gruijter had done emission studies on In our spectroscopic studies the PbCl2 crystal
PbCl2 [5]. The top of the valence band is composed samples used were prepared by using a stock
of Pb2+-6s with considerable admixing of chlorine- solution of sodium meta silicate (SMS). A quantity
np, while the bottom of the conduction band is of 25 ml. of SMS solution of specific gravity 1.03,
made up of Pb2+-6p [6]. PbCl2 is classified as a whose pH was adjusted to be 6.5, 7.0, 7.5 , 8.0 and
normal class I crystal and its transmission range is 8.5 by titration with 1M tartaric acid, and was
wide [7-8]. PbCl2 finds importance in experimental allowed to gel in five various boiling test tubes
field due to their large band gap and exhibiting without any disturbances. Growth experiments
interesting features from the stand point of were conducted for different densities of the gel
electron-lattice interaction [9-18]. Lead halide ranging from 1.02 to 1.06. It was found that for the
based materials can be used as laser hosts with low same concentration of HCl, tartaric acid and lead
phonon energies. The Pb2+ in the PbCl2 crystal is nitrate solution, the rate of growth of the needles is
known to be emissive in aqueous solution [19-22]. conspicuously larger and the needles are larger for
In the present study, we report for the first time the lesser densities of the gel. This is due to the
absorption and fluorescence emission properties of increased rate of diffusion of HCl in the gel and
PbCl2 crystal samples prepared by sol-gel increased mobility of the molecules of the crystals
technique through five different methods. PbCl2 is at lower densities of the gel. PbCl2 crystals were
marked as an insulator with a moderate bandgap. obtained by the reactions of lead nitrate, tartaric
They belong to the space symmetry group D2h16 acid and HCl (99.9% Sigma-Aldrich). Two
5606

2013
________________________________________________________________________________________

different PbCl2 crystaal samples weere obtained by deescribed as eloongated alongg the c axis w
with (100),
irradiatinng pure PbCl2 crystals witth ultra violet ( (0010) as main forms
f and (1110), (120) andd (210) as
UV lampp (insect Killler)) and Inffrared radiatioons smmaller faces, while at the t top (0111) is the
(HL43111 (PHILIPS)) 230V~50H Hz~150w). The T doominant form m. From the exxternal observvations of
other twoo samples werre prepared by subjecting the t foour sets of lead chloride dihydrate
d crysstals, it is
crystal too an electric field of 20 V using paralllel cllear that there is no chhange in thee external
plate arraangement and d subjecting the
t crystal to oa m
morphology by
y naked eye.
magneticc field using two bar maagnets kept on 1.. Absorpption Studies
either sside of thee experimenntal test tu ube O
Optical absorpttion spectra of
o PbCl2 samples at two
perpendiccular to the length
l of the test-tube. Thhus diifferent concentrations c1 and
a c2 are shoown in the
five PbCCl2 samples were
w obtained for our studies figgure 1.
viz pure, UV and IR irradiated, sam mples subjectted (aa)
to electric and magnettic fields. Thee sol-gel deriv
ved
PbCl2 sam mples were suubjected to X-ray
X diffractiion
studies ( XPERT-PRO O using K-Alppha 1.54060 A0
(XRDML L)). The cryystal structurre of PbCl2 is
confirmeed to be orth horhombic diipyramidal with w
each Pbb having a coordination under 9.
Observattions under peetrological miicroscope reveeal
that PbC Cl2 crystals grown undeer all the fiive
conditionns show inclinned extinctionn. The preparred
crystal saamples were powdered ussing mortar and a
weighed about 0.15g and disssolved in 15 ml
pestle, w
of single distilled water
w (SDWW) to obtain a
concentraation c1=0.01 gm/m ml. Anothher
concentraation c2=0.02 2 gm/ml waas obtained by
dissolvinng 0.32gm inn 20 ml of SDW. For the t
dissolutioon ,a magnettic stirrer waas used and the t (bb)
solvent evaporation was preventeed by using a
sealed gglass containeer. Linear absorption of the t
crystal ssamples in soolution phasee was record ded
using Jassco V-570 UV V/VIS/IR Speectrophotometter.
Optical bband gap of these
t sampless were obtain ned
from liinear absorp ption measuurements. The T
emissionn and excitatioon studies werre carried out by
taking thhe room temp perature flourrescence specctra
of thesee PbCl2 samp ples using a Cary Eclip pse
fluoresceence spectrophhotometer (Vaarian).
Result And Discussion

Observattions under peetrological miicroscope reveeal
that PbC Cl2 crystals grown under all the fo our
conditionns show inclin ned extinctionn. The dendrittes
grown unnder the fourr conditions shows variatioons Fiigure 1. Room m temperaturee absorption spectra
s of
from onne another. Those
T grown under infrarred pbbCl2 at concenntrations (a) c1 and (b) c2
radiationn are radiatingg type while those in visibble Thhe absorptio on peak of PbCl2 at the two
light are fibrolitic. Larrge massive dendritic
d growwth cooncentrations c1 and c2 are located in i the uv
was obsserved under ultra violet radiation. The T reegion at 266 nm n correspondds to 4.6 eV. The peak
tendencyy for radiatingg along the axxis of the crysstal att this particulaar wavelength is due to the electronic
was founnd when grow wn in all thee conditions. A traansition from the valence band
b to the PbC Cl+ cation
study off external morphology
m s
shows that the
t [223-24]. There is no valuablle change in absorption
a
crystals grown in the presence of o radiation are a peeak for varyiing concentraation.The aboove linear
needle sshaped good quality acicular aggregattes abbsorption specctra can be used for optical band gap
with shiinning edgess. Each inddividual in the t stuudies on PbCll2 in solution phase
p in singlle distilled
aggregatee is highly brittle,
b tubulaar needles. The
T w
water.. The linear absorptionn coefficient α can be
habit of llead chloride crystals that is least affectted deetermined froom absorptioon spectra, which is
morpholoogically by external faactors can be reelated to the band gap Eg as (αhν)2=k (hν- Eg),
w
where hν is the incident lightt energy, k is a constant
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 6
5606

2013
________________________________________________________________________________________

and Eg iss the optical band

b gap of lead
l chloride. A chhloride ions arre surroundedd by five lead ions [25].
graph of Eg= hν versess (αhν)2 givess the direct baand It was suggesteed that the 4.6 eV absorption to be an
gap of PbCl2 for fivve different samples at tw wo exxciton absorpttion , but on thet other handd it might
concentraations c1 andd c2. The optical band gap of allso be ascribed to a characteristic
c 6s2-6s6p
PbCl2 forr concentratioon c1 is varyinng from 4.54 eV e traansition insidee the lead ion..
(pure) to 4.67 eV (mag gnetic). For uv
u irradiated and
a
electric field
f applied PbCl
P 2 sampless, Eg is 4.54 eV e
and 4.555 eV respectivvely. When cooncentration iss at
c2, Eg vaaries between 4.6 and 4.46 eV. The valuues
of directt band gap att c1 and c2 are a listed in thet
table1. Several types of o chloride ioon vacancies can
c
exist in tthe lead chlorride lattice whhich are electrron
traps in the energy ranger 4.2-4.44 eV above the t
valence bband [24].
Figure 2.
2 Optical baand gap plot of Pure PbC Cl2
sample att concentratio
ons (a) c1 and (b) c2
Figure 2 shows the direct
d band gaap behaviour of
PbCl2 saamples at twoo different cooncentrations c1
and c2. T
The chloride ioons at the larggest distance are
a
surroundded by four leead ions wherre as the closest
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 7
5606

2013
________________________________________________________________________________________

Fiigure 3. Flourrescence emisssion spectra ofo PbCl2 at

a wavelength 270 nm for (a) pure (b) UV (c) IR (d)
ellectricfield andd (e) magneticcfield applied samples.
Taable 1. Measuured values of optical bandd gap and

emmission peakss for PbCl2 att concentrationns c1 and
c22(gm/ml)
PbbCl2 Optical direcct Emisssion peak

saample band gap at at
concentration ns
C1 C22 C1 C2
(eV) (eVV) (nm) (nm)
puure 4.54 4.661 348 357
431 422
498 490
540 525
U
UV 4.53 4.554 - -
422 423
491 487
534 532
IR
R 4.62 4.440 339 342
423 423
492 492
533 533
Ellectric 4.57 4.555 342 342
421 421
493 492
533 533
M
Magnetic 4.67 4.446 338 342
424 423
490 493
531 533
Thhe excitonic trransitions in lead

l chloride are partly
exxplained by th he 6s-6p transiition in lead ioons which
giives the emisssion bands at three of the t above
traansitions. Floourescence in PbCl2 is com mposed of
brroad guassian band with larrge stokes shifft and it is
inndicative of strong excciton-acoustic phonon
innteraction [26]]. The electricc dipole transiition from
thhe 6p to 6s sttates also prooduces lumineescence in
2.Flouresscence Studiess PbbCl2. The exccitons can rellax into pairs of a self
Flouresceence spectra of PbCl2 aree taken at tw wo traapped electro on (STEL) an nd a self trappped hole
different concentrattions c1 and c2 for f (SSTH) when both b electronss and holes strongly
photolumminescence stuudies. Figure 3 represents the
t innteract with acoustic phhonons. A repulsive
fluoresceence emission spectra of coorrelation is ascribable
a to the origin off electron-
five PbC Cl2 samples in SDW. PbCl2 samp ple hoole separationn. The repulsiive correlationn through
solutionss at concentrattions c1 and c2
c are excitedd at accoustic phonoons with thee formation of o cooper
a wavellength of 2770 nm gives three stroong paairs mediated by these acou ustic phonons cause the
emissionns at around 421
4 nm, 491 nm n and 533 nm n sppontaneous breeaking of exccitons [27].
respectivvely. A concentratiion is increased, phonon vibration
As
w induce mo
will ore non radiative de excitattions. Our
PbbCl2 solutionss show many peaks p due to the
t stokes
shhift by the cryystal field inteeractions resullting from
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 8

_________________________________________________________________________________

the strong interaction between phonon and Pb2+ [4] M.Kituara, H.Nakagawa, J. Electron Spectrosc.
ions. From the fluorescence spectra given in the Relat. Phenom. 79 (1996) 171
figure, it is evident that the emission peaks at 491 [5] W.C.DE.Gruijter, J. Solid State Chem. 6
and 533 nm are assigned to the excitonic emissions. (1973) 151
For pure PbCl2 sample, the emission peak at 431 [6] M. Fujita et al, J. Phys. Soc.Japan 60 (1991)
nm at concentration c2 is red shifted. The IR 4393
irradiated and electric field applied samples have [7] F.E.A.Melo, K.W.Garret, J. Mendes Filho,
almost same emission peak at 423, 492 and 533 nm J.E.Moreira, Solid State Commn., 29-33 (1979) 31
for the two concentrations c1 and c2. The shifting [8] O.Keefe.M, Comm. Sol.State Phys. 7 (1977)
of emission peaks at pure PbCl2 sample is due to 163
the band edge emission which are attributed to the [9] Plekhanov.V Phys.StatusSolidi B 57 (1973)
quasi free recombination at the absorption band K55
edge. Thus the spontaneous exciton dissociation [10] Nistor.S.V, Goovaerts.E and Schoemaker.D
has been revealed by the fluorescence emission in 1993 Phys.Rev.B 48 9575
sol- gel derived PbCl2 samples in solution phase. [11] Kitaura M, Nakagawa.H 1996 J.Electron
Spectrosc.Relat.Phenom. 79 171
Conclutions [12] Kitaura.M and Nakagawa.H 1997 J.Lumin.
High quality lead chloride crystals were prepared 72-74 883
by sol-gel technique. The obtained PbCl2 crystal [13] Itoh.M, Nakagawa.H, Kitaura. M, Fujita.M
samples of five different types in solution phase and Alov.D.L 1999 J.Phys.:Condens.Matter 11
were subjected to spectrophotometric studies. The 3003
linear absorption spectra give the optical band gap [14] Kink.R, Avarmaa.T, Kisand.V. Lohmus.A,
details of these crystals. Photo luminescence Kink.I and Martinson.I 1998
studies on these lead chloride samples were done J.Phys.:Condens.Matter 10 693
by fluorescence spectroscopy. The fluorescence [15] Kanbe.J, Takezoe.H,and Onaka.R 1976
emission of these crystals shows that PbCl2 crystals J.Phys.Soc.Jpn. 41 942
have the band gap in connection with the 6s to 6p [16] Eijkelenkamp A.J.H.and V A.J os.K J.. 1976
gap in lead ions and tend to become highly Phys.Status Solidi B 76 769
luminescent coming from the odd transition. Thus [17] Beaumont.J.H,.Bourdillon .A.J and Bordas.J
the high luminescence nature of lead chloride 1977 J.Phys.C 10 761
makes them suitable for applications in [18] Fujita.M, Nakagawa.H, Fukui.K,
photography, acoustical-optical devices and Matsumoto.H, Miyanaga.T and Watanabe.M 1991
radiation detectors. J.Phys.Soc.Jpn. 60 4393
[19] Hans Niikol, Alexander Becht, Arnd Vogler,
Acknowledgements Inorg. Chem. 3277-3279 (1992) 31
The authors acknowledge KSCSTE and Moulana [20] P. Pringshem, H,Vogels, Physica 225 (1940)
Azad National Fellowship schemes for financial 7
support. [21] C.W.Sill, H.E. Peterson, Anal. Chem. 1266
(1949) 21
[22] R. Narayanaswamy, P.J. Mayne, G.F.
References Kirkbright, J. Inorg. Nucl. Chem.129 (1978) 40
[1] H.Nakagawa, Y.Doi, T.Nakamura , [23] K.I Best, Z. Physik, 163 (1961) 309
“Absorption [24] K.J.Devries, Doctoral Dissertation, University
and luminescence in PbCl2 : Tl+ crystals”.J. of Utrecht (1965)
Lumin. 87-89 (2000) 1130-1132 [25] K.J.Devries, J.H.Vansanten, Physica 2051-
[2] P.Nishasanthakumari, S.Kalainathan, Cryst. 2058 (1964) 30
Res.Technol. 43 (2008) 4 [26] G.Liidja, V.I.Plekhanov, J. Lumin. 6 (1973)
[3] M.Kituara, H.Nakagawa, J. Lumin. 72-74 71
(1997) 883 [27] Masanobu Iwanga, Tetsusuke Hayashi, J.
Lumin. 102-103 (2003) 663-668

_________________________________________________________________________________

Simulation of Plasma Transferred ARC (PTA) Hardfaced

on Structural Steel with Titanium Carbide
S.Balamurugan, Assistant Professor, Department of Mechanical Engineering, Coimbatore Institute of
Technology – Coimbatore, INDIA
N.Murugan, Professor, Department of Mechanical Engineering, Coimbatore Institute of Technology –
Coimbatore, INDIA
ABSTRACT
Plasma Transferred Arc (PTA) hardfacing performed to improve the surface properties of metallic machine
parts locally. Hardfacing process was applied when the surface to be damaged by wear due to hard minerals.
The analyses of PTA hardfacing on structural steel with titanium carbide (TiC) are employed using by finite
element technique. The aim of this work is to compare the simulated measured weld bead geometry values with
experimental results at various heat input conditions and showing good agreement.
Key Words: PTA hardfacing, FEM, validation
1. Introduction carried out on butt and fillet welds, but not on

It was reported that wear resistance could be hardfacing deposits [9, 10]. Hence, finite element
improved when hard particles were embedded in a analysis using ANSYS birth and death technique is
tough, metallic matrix [1, 2]. Hardfacing is a used in the present work to identify the correct
technique used to improve the surface properties of welding parameters like welding current, welding
metallic mechanical parts, such as the resistance voltage, welding speed, base metal preheat and inter
against wear and correction. Surface properties and pass temperature requirements, to facilitate crack-free
quality depend upon the selected alloys and hardfacing and limiting the welding residual stress.
deposition processes [3, 4]. Depending on the applied The finite element analysis of hardfacing of titanium
technique, common problems encountered in carbide on structural steel plate is performed using
hardfacing are combination of a poor bonding of the ANSYS software by applying different heat input
applied surface layer to the base material, the conditions.
occurrence of porosity of the thermal distortion of the The thermal diffusivity of the base material plays a
workspiece, the mixing of the layer with the base large role - if the diffusivity is high, the material
material and the inability of a very local treatment cooling rate is high and the HAZ is relatively small.
[5]. According to the literature, coatings obtained by Alternatively, a low diffusivity leads to slower
PTA present a very good alternative to other cooling and a larger HAZ. The amount of heat
hardfacing processes, such as conventional inputted by the hardfacing process plays an important
techniques or more recent ones like laser cladding [6, role. To calculate the heat input for arc welding
7]. A significant advantage of PTA surfacing over procedures, the following formula is used:
traditional surface welding processes arises from the
fact that the consumable material used is in the ∗ ∗ 60
∗
powder form. This fact enables a wide range of ∗ 1000
composition for the coating materials and even Where Q = heat input (kJ/mm), V = voltage (V), I =
mixtures of different material powders. current (A), and S = welding speed (mm/min). The
Finite Element (FE) simulation of welding consists of efficiency depends on the welding process used. For
transient thermal analysis to predict the hardfaced PTA hardfacing efficiency is taken as 0.6 [11]
structures. The results of simulation of welding can The objective of this work is to compare the
be used to explain the physical essence of the experimentally measured weld bead geometry with
complex phenomena explicitly and can be used for simulated results at various heat input conditions.
optimizing the process parameters. Therefore, FE
simulation of the welding process using ANSYS 2. Matrial Properties
software has great significance from both theoretical The chemical composition and mechanical properties
and practical aspects [8]. It is observed that finite are shown in Table 1. The temperature dependent
element coupled field thermal and structural thermal properties of base substrate and TiC are
shown in Table 2.
analytical studies for evaluating residual stresses
using ANSYS birth and death analysis have been

_________________________________________________________________________________

3. Finite Element Simulation

A substrate structural steel plates with dimensions 4. Experimental Procedure
150 mm x 100 mm x 20 mm thickness and 100 mm X Using PTA hardfacing system, Titanium Carbide
12 mm X 2 mm hardfaced material placed on the (TiC) was deposited onto the structural steel plate
substrate. Hardfaced process is simulated a single of size 150 mm X 100 mm X 25 mm. This was
pass. The eight-node brick elements are used in done by changing the welding parameters to
meshing the model. To simulate the moving heat achieve different heat input conditions: Low,
source element birth and death technique of ANSYS medium and high. Single hardfacing bead was laid
was used. The element type SOLID70, which has a on each plate. Samples were prepared from each
single degree of freedom, was used for the thermal hardfaced plate by cutting them at their centre
analysis. For the structural analysis the element type perpendicular to hardfacing direction. Standard
SOLID45, with three translational degrees of freedom metallurgical procedures were employed to prepare
at each node, was used. Constraints (all degrees of the samples from PTA hardfacing deposited at
freedom) are placed at both ends of the plate, as different heat input conditions as shown in Table.
during hardfacing these ends are tack welded to 3. Hardfaced plate and typical cross section are
prevent any distortion. Fig.1 shows the meshed shown in Fig.2 and Fig.3 respectively.
model.
Table .1: Chemical Composition and Mechanical Properties of Structural Steel and TiC
Elements, Weight %
Sl.No Material Used
C Si Mn S P Mg Ti Fe
1 IS:2062 (Base Metal) 0.18 0.18 0.98 0.016 0.016 - - bal
Titanium Carbide (TiC)
2 0.04 0.03 0.03 - - 0.09 99.0 0.12
(PTA Powder)
Hardness
Tensile Strength Yield Strength
Base Metal Hardfaced Metal
18 HRC 56HRC 485 MPa 275 MPa
Table.2 The temperature dependent material properties of substrate and TiC.

IS 2062 MILD STEEL TiC
Temp(0C) K ( W/m0C) C (J/kg 0C) K(W/m0C) C(Jkg0C)
0 60
100 50
200 45
400 38
600 30 620 42 566
800 25
1000 26 (average of
1200 28 200C to 15150)
1400 37
1550 37
5606

2013
________________________________________________________________________________________

Fig.1
1Meshed moddel of the PTA
A hardfaced pllate
Fig 1. Photoograph of Fiig 2. Typical cross

c
hardfaced plate sectionn of hardfaceed plate
Table. 3 PTA Hardfacing Experrimental Cond ditions

Paraameters Heeat Input,
Sl.No
I S F H T kJ/mm
1 1660 140 1
16 10 2990 15..14 Low Heat
H Input(LH HI)
2 2005 130 1
14 9 2660 18..85 Mediuum Heat Inputt(MHI)
3 1990 120 1
16 10 2990 20..98 High Heat
H Input(HH HI)
I =Welding Current (ampss); S = Weldinng Speed (mm
m/min); F = Po
owder feed ratte (gm/min); H =
Oscillation Width
W (mm);
T = Pre heatt temperature (0C).
5. Resu
ult And Disscussion strrongly affecteed by appliedd heat input during
d the
The resuults of simulaation obtainedd for three heeat TiiC hardfacing of plates. The measuured bead
input coondition as shown in the Table. 4. geeometry param meters of thee plates are compared
Transverrse section is taken from Q-Slice optiion w
with simulatioon results whhich are presented in
availablee in ANSYS, used to find the penetratiion Taable 4 and Fiigure 4. Thus to obtain a good
g weld
and longitudinal temperature plots are used to fiind beead profile, selection
s of process paraameters is
bead widdth of the weld profile. From the Figuress 2 im
mportant. It iss evident that, Finite Elemeent results
and 3, itt is understoo od the heat input increases, arre less deviateed when com mpared to expperimental
mulated results, it
penetratioon increases. From the sim reesults and th hese deviatioons are duee to the
is concluuded that beaad width and penetration area asssumptions madem nite element analysis.
in fin
www.bo
orjournals.co an Research Journals 12
om Blue Ocea
5606

2013
________________________________________________________________________________________

Figg.2 Typical Teemperature Coontour plot of hardfaced plaate.
Fig.3 Typicaal Temperaturre Counter ploot cut

the traansverse direcction of hardfaaced plate
Table 4 Comparison of measured

d and predicteed bead geom
metry of hardfaced plate.
Heat Inpput, Penetrattion(mm) Beadd width (mm)

No
Sl.N
(kJ/mmm)
Exxp FE
EM % Errror Exp FEM % Error
1 LHI 0
0.99 0.90 9.09 11.20 11.00 1.79
2 MHI 1.60 1.49 6.87 10.58 10.16 3.96
3 HHI 0
0.85 0.80 5.88 11.77 11.43 2.88
www.bo
om Blue Ocea
5606

2013
________________________________________________________________________________________

Fig.4 Comparison
C off effect of heaat input on beaad width and penetration
p
6. Con
nclusion tw
wo similar pllates, Scientiffic Technicall Review,
Three dim mensional theermal models is employed to V LIX, No.1, 2009, pp. 577-59
Vol.
predict tthe bead geoometry param meters such as [99] Xiang gyang Lu, Tasnim
T Hassaan, Finite
penetratioon and beadd width andd the predictted reesidual stressees in butt andd socket weldded joints,
results arre compared with
w experimenntal results. Trransactions, SMiRT
S 16, Papper No. 1983,, 2001
[110] ASM reaady reference: Thermal prooperties of
7. Refferences m
metals, ASM
[1] U.Drraugelats, B. Bouaifi and T. T Plegge. Weeld [11] FU Yuue-chun, SHI Nan-lin,
N Zhanng De-zhi,
Res. Abrroad, 42,(11), pp.
p 39 -41, 19996. Y
YANG Rui. Prreparation of SiC/Ti compposites by
[2] A. K. Jha, B.. K. Prasad, R.R Dasgupta, et poowder cloth teechnique[J]. The
T Chinese Journal
J of
al.; J.Maater.Eng.Perfoorm, 8, (2), pp.
p 190 – 19 96, N
Nonferrous Metals,
M 2004, 14(3): 465− −470. (in
1999. Chhinese)
[3] J.R.Davis annd Associatees, Hardfacin ng,
weld claadding and dissimilar
d meetal joining in;
ASM Handbook
H – Welding, Brazing and a
Solderingg, Vol.6, 10th Ed, ASM metals
m Park, OH,
O
1993, pp – 699 – 823.
[4] E.Lugscheideer,U.Morkram mor, A. Ait- A
Makidechhe, Advancces in PT TA surfacin ng,
Proceedinng of the Fou urth National Thermal Sprray
Conferennce, Pittsburghh, PA, USA, 1991.
1
[5] Wolfgang Whal,
W Stuttgart, Trends forf
Hardfacinng, www.eengineers.org.il/
uploads/11683/drwhal0206.pdf
[6] D’ Oliveira, A.S.C.M., Yaedu,
Y A.E and
a
Silva P..S.C.P, “ Influence oof dilution on
microstruucture and meechanical propperties of cobaalt-
based allloy depositedd by Plasma Transferred
T A
Arc
Welding””, Internationnal Conferencce on Advancced
materialss, their processes andd application ns,
materialss week, Mucheen , 2002.
[7] Agustin Guallo Hernan G. Svoboda Esteela
S.Surian and Luis A. de vedia, Efffect of weldiing
procedurre on wear behavior of o a modifiied
martenstiic tool steel hardfacing
h deeposit, Materials
& Designn, Elsevier, 20011.
[8] Ivaana Vasovic, Dragi Stam menkovic, Finnite
element analysis of reesidual stress in butt weldiing
www.bo
om Blue Ocea

_________________________________________________________________________________

Elimination of Charge Sharing Problem in Dynamic

Circuit
Saurabh Sharma, Sr.Lecturer ,Department of Electronics and Communication, MIET Group, Meerut
Sanjeev Maheshwari, Director, MIET Group, Meerut
Sanjeev Kumar, HOD, Department of Electrical Engineering, IET Group, Meerut
Vrince Vimal, Asst. Proffessor, Department of Electronics and Communication, MIET Group, Meerut
ABSTRACT
A technology is proposed in this literature to simultaneously reduce the charge sharing problem in the
dynamiccircuits due to the generation of the parasitic capacitor at each node. Here we used a weak PMOS pull-
up device(with a small W/L ratio) to the dynamic CMOS stage output to reduce the effect of the parasitic
capacitor
Keywordss—NMOS, PMOS. CMOS, domino logic, weaker PMOS Tool Used---- Tanner.

Introduction tanner. We will show that dynamic logic gates are

The digital integrated circuit charge sharing not necessarily less charge sharing problem tolerant
problem has become one of the foremost issues in if proper charge sharing problem tolerant design
the design of very deep submicron VLSI chips. techniques are employed. In fact, using the
Charge sharing in digital circuits refers to any proposed method in this paper, charge sharing
phenomenon that causes the voltage at a node to tolerance of dynamic logic circuits can be
deviate from its nominal value. While these charge improved beyond the level of static CMOS logic
sharing always existed, in the past they had little gates while still retain their advantage in
impact on the performance of integrated circuits performance. The proposed charge sharing tolerant
and were often neglected. It is the unstopped design method can be realized using a number of
aggressive technology scaling in an effort to different circuits and therefore having broader
continuously improve chip performance and impact.
integration level that makes charge sharing plays an
increasingly important role in comparison with Dynamic Circuit
conventional design metrics like area, speed and In the dynamic CMOS circuit technique, clock
power consumption. pulse is given between a PMOS and a NMOS and
Together with technology scaling, aggressive the NMOS logic is connected between them. The
design practices like employing dynamic logic circuit operation is based on first precharging the
styles have also seen wider use in recent years to output node capacitance and subsequently
achieve higher performance of integrated circuits. evaluating the output level according to the applied
Circuits design using dynamic logic style can be inputs. Both of these operations are scheduled by a
considerably faster and more compact then their single clock signal which drives one NMOS and
static CMOS counterparts. This is especially the one PMOS transistors in each dynamic stage.
case with wide fan-in dynamic logic gates where a When the clock signal is high then precharge
single gate can realize the logic function that transistor p1 turns off and n1 turns on. If the input
otherwise would require multiple levels of static signal creates a conducting path between the output
CMOS logic gates. Therefore, wide fan-in dynamic node and ground then output capacitance will
gates are routinely employed in performance- discharge towards 0V.When the clock signal is low
critical blocks of high performance chips, such as the PMOS transistor p1 is conducting and the
in microprocessor, digital signal processor, and so complementary NMOS transistor n1 is off .The
on. output capacitance of the circuit is charged up
In this paper, we propose a novel design method to through the conducting PMOS transistor to a logic
enhance the charge sharing problem tolerance of high level of VDD.
dynamic circuits by analyzes their results on
5606

2013
________________________________________________________________________________________

Fig.1: CM
MOS Dynamiic inverter
Above wwe have impleemented the dynamic

d inverrter caapacitance is already chargge to VDD but
b due to
using tannner and gen nerated its waveform.
w Fig
g,2 thhe charge disstribution at each node oof NMOS
shows thhat there is a problem
p in dynnamic circuit, in loogic, it will be corrupted.
the evalluation phasee if the inpput is low the t
T-Spice1
v( cloc k)
1 .2
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
T-Spice1
1 .2 v( out )
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
T-Spice1
1 .2 v( In)
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
Figg.2: Waveform
m for CMOS dynamic
d inverrter
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 16
5606

2013
________________________________________________________________________________________

Dominoo logic CM MOS stage is either disscharged to low l level

In the doomino logic, wew connectedd a static CMO OS thhrough the NM MOS circuitry (1 to 0 transittion), or it
inverter aat the output of
o the dynamicc circuit. Duriing reemains high. Consequentlyy, the invertter output
the prechharge phase (when clock is i 0), the outpput vooltage can alsoo make at most one transitiion during
node of tthe dynamic CMOS
C i precharged to
stage is thhe evaluation phase,
p from 0 to1.Regardlless of the
high loggic level, and d the output of the CMO OS innput voltage applied
a to the dynamic CM MOS stage,
inverter bbecomes low.. When the cllock signal risses it is not possiblle for the CMO OS inverter too make a 1
at the beeginning of thhe evaluation phase, there are
a too 0 transition during
d the evaaluation phase.
two posssibilities: The output node of the dynam mic
Fig
g.3: Domino loogic
Above w we have impplemented thee domino loggic immplemented and

a second chharge sharingg between
using tannner and gen nerated its waveform.
w Fig
g.4 thhe dynamic staage output nodde and the inttermediate
shows that there are soome limitationns in the domiino noodes of the NMOS loggic block duuring the
logic. Fiirst, only nonn-inverting sttructure can be evvaluation phasse may cause erroneous
e outtputs.
Cell0
v( out )
1 .0
0 .5
Voltage (V)
0 .0
- 0. 5
- 1. 0
0 10 20 30 40 50 60 70 80
Time (ns)
Cell0
1 .2 v( In)
1 .1
1 .0
0 .9
0 .8
Voltage (V)
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
Cell0
1 .2 v( Ckl )
1 .1
1 .0
0 .9
0 .8
Voltage (V)
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
Fig.4: Wavefform for dominno logic
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 17
5606

2013
________________________________________________________________________________________

Removval Of Charrge Sharingg Problem hiigh output levvel unless therre is a strong ppull-down
paath between thhe output andd the ground. It can be
Using W
Weak PMOS S Logic obbserved that the weak PM MOS transistoor will be
One simmple solution to remove charge shariing tuurned on only when the preecharge node voltage is
problem is just to add
a a weak PMOS pull--up keept high. Otheerwise it will be turned offf as output
with a small W/L ratio) to
device(w t the dynam mic vooltage becomees high.
CMOS sstage output, which essenntially forcess a
Fig.5: Weaker PMO

OS logic
Above w
we have implem mented an invverter with weeak annd falling edgges and theree is no chargge sharing
PMOS using
u tanner and
a generatedd its waveforrm. prroblem.
As we caan see the wav
veform is sharrp at both risiing
efg
v( clk)
1 .2
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
efg
1 .10 v( out )
1 .05
1 .00
0 .95
V o lt a g e (V )
0 .90
0 .85
0 .80
0 .75
0 .70
0 .65
0 10 20 30 40 50 60 70 80
Time (ns)
efg
1 .2 v( ni )
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
F
Fig.6: Wavefo
orm for weakeer PMOS logic
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 18

_________________________________________________________________________________

Results and Conclusions [3] P. Larsson and C. Svensson, “Noise in digital

By analyzing the above circuits on the tanner we dynamic CMOS circuits,” IEEE J. Solid-State
conclude that the charge sharing problem in the Circuits, vol. 29, pp. 655-662, June 1994.
dynamic circuit can be improve by adding a weak [4] G. P. S’Souzw, “Dynamic logic circuit with
PMOS pull-up device to the dynamic CMOS stage reduced charge leakage,” U.S. Patent 5 483 181,
output. Jan. 1996.
[5] J. J. Coyino, “Dynamic CMOS circuits with
noise immunity,” U.S. Patent 5 650 733, July 1997.
[6] K. Roy, S. Mukhopadhyay, H.M. Meimand,
References
“Leakage current mechanisms and leakage
[1] V. G. Oklobdziia and R. K. Montoye, “Design- reduction techniques in deep-submicrometer
performance trade-offs in CMOS domino logic,” in CMOS circuits”. In proc., IEEE, vol. 91, no. 2,
Proc. IEEE Custom Integrated Circuits Conf., May 2003, pp. 305-327.
1985, pp. 334-337. [7] V. Kursun and E. G. Friedman, “Domino Logic
[2] J. A. Pretorius, A. S. Shubat, and C. A. T. with variable threshold voltage keeper, U.S. patent
Salama, “Charge redistribution and noise margins pending”.
in domino CMOS Logic,” IEEE Trans. Circuits
Syst., vol. CAS-33,pp. 786-793, Aug. 1986.

_________________________________________________________________________________

Effect Of Climate Change On Global Surface Temperature

Dr. S.C. Dubey, Department of Physics, SGS Govt. PG College Sidhi (M.P), India
Mr. G.P. Dubey, Department of Physics, SGS Govt. PG College Sidhi (M.P.), India
Dr. L.K. Borkar, Department of Physics, SGS Govt. PG College Sidhi (M.P.), India
ABSTRACT
Present work deals the long-term climate change and their effect on continuous increasing in global surface
temperature. The climate change is a long-term change in the weather patterns over periods of time that may
range from decades to thousands of years. There are two well-known causes that effect the climate change. One
of them is variation of solar activities and other is human made activities. The external change may involve a
variation in the Sun’s output. Mechanisms proposed to explain the climate response on solar variations can be
associated with variations in total solar irradiance (TSI). Internal variations in the climatic system may be
caused by changes in the concentrations of atmospheric gases, mountain building, volcanic activity, and
changes in surface or atmospheric albedo. In the present work, we have analysed long-term variations of
various solar activities and human made activities and their impact on climate changes. Adverse impacts of
climate change and challenges in near future have also been discussed.
Keywords: Total solar irradiance (TSI), climate change and global surface temperature.
1. Introduction years. Second cyclical variation results from the

Terrestrial magnetosphere and upper atmosphere fact that, as the Earth rotates on its polar axis, it
can be greatly perturbed by variations in the solar wobbles like a spinning top changing the orbital
variations caused by disturbances on the Sun. The timing of the equinoxes and solstices. Finally, the
state of near-Earth space environment is governed third cyclical variation is related to the changes in
by the Sun and is very dynamic on all spatial and the tilt (obliquity) of the Earth’s axis of rotation
temporal scales. Sunspots are huge magnetic over a 41,000 year period.
storms that are seen as dark (cooler) areas on the Solar ultraviolet (UV) radiation directly influence
Sun’s surface. The number of sunspots peaks every stratospheric temperatures and the dynamical
11 years. During periods of maximum sunspot response to this heating extends the solar influence
activity, the Sun’s magnetic field is strong. When both poleward and downwards to the lower
sunspot activity is low, the Sun’s magnetic field stratosphere and tropopause region. Ozone is the
weakens. The magnetic field of the Sun also main gas involved in radiative heating of the
reverses every 22 years, and the complete duration stratosphere. Solar-induced variations in ozone can
is known as 22-year sunspot cycle. There are therefore directly affect the radiative balance of the
longer cycles than the 11-year sunspot cycle known stratosphere with indirect effects on circulation.
as Gleissberg cycle (88-year) with variable Evidence that this influence can also penetrate into
amplitudes. The cosmogenic radio nuclides the underlying troposphere is accruing from a
confirm the existence of other longer periodicities number of different sources. One consequence of
(e.g. 208-year DeVries or Suess cycle, 2300-year these solar perturbations is to complicate the
Hallstatt cycle and others) and also the present detection of human-induced depletion of the
relatively high level of solar activity, although protective ozone layer; another may be to perturb
there is some controversy [1-3]. The Milankovitch the temperature at the Earth’s surface, through
theory suggests that normal cyclical variations in connections that link the upper and lower parts of
three of the Earth’s orbital characteristics are the atmosphere. The galactic cosmic rays increases
probably responsible for some past climatic the amount of C-14 in the atmospheric Co2. During
change. The basic idea behind this theory assumes the increased solar activity close to solar cycle
that over time these three cyclic events vary the maximum years, Earth is better shielded from the
amount of solar radiation that is received on the cosmic rays than during the minimum years, and
Earth’s surface. The first cyclical variation, known the amount of C-14 decreases. Thus the C-14
as eccentricity, controls the shape of the Earth’s content of, for example, annual rings of old trees
orbit around the Sun. The orbit gradually changes may reveal something about the Sun’s performance
from being elliptical to being nearly circular and during the last few millennia. Some studies have
then back to elliptical in a period of about 100,000 indicated that there is a connection between long
term climate change and Sun’s activity [4,5].

_________________________________________________________________________________

2. Long-term total solar irradiance absolute value is described by Kopp and Lean [7]
(TSI) variations based on new calibration and diagnostic
The total solar irradiance (TSI) is integrated solar measurements by using TIM V.12 data on 19th
energy flux over the entire spectrum which arrives January 2012, and is updated annually. TSI are
at the top of the atmosphere at the mean Sun-Earth known to be linked to Earth climate and
distance. The TSI observations show variations temperature. The historical reconstruction of TSI
ranging from a few days up to the 11-year sunspot and their association with 11-year sunspot cycle
cycle and longer timescales [6]. TSI has been from 1700 onwards are shown in Fig 1. From the
monitored from 1978 by several satellites, e.g. plot, it is find that TSI variation trend follows with
Nimbus 7, Solar Maximum Mission (SMM), the sunspot number within a limit but centurial
NASA, Earth Radiation Budget Satellite (ERBS), variation trends of TSI have not shown clear
NOAA9, NOAA 10, Eureca and the UARS (Upper association. Linear variation of TSI for last 311
Atmospheric Research Satellite) etc. The historical years shows continuously increasing trend.
reconstruction of more recently accepted TSI
SSN TSI [W/m^2] Linear (TSI [W/m^2])

300 1362
Total Solar Irradiance (TSI)

Sunspot Number (SSN)
200 1361
100 1360
0 1359
1700
1710
1720
1730
1740
1750
1760
1770
1780
1790
1800
1810
1820
1830
1840
1850
1860
1870
1880
1890
1900
1910
1920
1930
1940
1950
1960
1970
1980
1990
2000
2010
Years
Fig. 1 Shows the long-term variation of TSI and yearly mean SSN, during 1700 onwards. [The data of TSI
were taken from SOURCE website (http://lasp.colorado.edu/sorce/index.htm)]
3. Greenhouse gases and atmospheric During the pre-industrial Holocene, concentrations

carbon dioxide (Co2) variations of existing gases were roughly constant. In the
Many chemical compounds found in the Earth’s industrial era, human activities have added
atmosphere act as “greenhouse gases.” These gases greenhouse gases to the atmosphere, mainly
allow sunlight to enter the atmosphere freely. through the burning of fossil fuels and clearing of
When sunlight strikes the Earth’s surface, some of forests. However, since the beginning of the
it is reflected back towards space as infrared industrial revolution (1750’s), the burning of fossil
radiation (heat). Greenhouse gases absorb this fuels has contributed to the increase in Co2 in the
infrared radiation and trap the heat in the atmosphere from 280 ppm to 394.29 ppm. Increase
atmosphere. Over time, the amount of energy sent of main greenhouse gases from pre-industrial level
from the Sun to the Earth’s surface should be about to current level along with radiative forcing are
the same as the amount of energy radiated back shown in table 1. Human activity since the
into space, leaving the temperature of the Earth’s industrial revolution has increased the amount of
surface roughly constant. The primary greenhouse greenhouse gases in the atmosphere, leading to
gases in the Earth’s atmosphere are water vapour, increased radiative forcing from Co2, methane,
carbon dioxide (Co2), methane, nitrous oxide, tropospheric ozone, CFCs and nitrous oxide. The
ozone and helocarbons. Aside from purely human- concentrations of Co2 and methane have increased
produced synthetic halocarbons, most greenhouse by 36% and 148% respectively since 1750.
gases have both natural and human-caused sources.

_________________________________________________________________________________

Table 1: Represent increase of main greenhouse gases from pre-industrial level to current level.
S.No. Main Greenhouse Gases Pre-industrial Current level Increase since Radiative
level 1750 forcing
01 Co2 280 ppm 394.29 ppm 114.29 ppm 1.46
02 Methane 700 ppb 1745 ppb 1045 ppb 0.48
03 Nitrous oxide 270 ppb 314 ppb 44 ppb 0.15
04 Clorofluoro-carbons (CFC- 0 ppt 533 ppt 533 ppt 0.17
12)
Atmospheric Co2 is an important kind of surface. Without the greenhouse effect, the average
greenhouse gas which influences global surface global temperature of the Earth would be a cold -
temperature. Its concentration variation could 18° Celsius rather than the present 15° Celsius. The
indicate the distribution of human and natural world’s most current data available for the
activities in various regions. The amount of Co2 atmospheric Co2 is from measurements at the
that can be held in oceans is a function of Mauna Loa Observatory in Hawaii. Monthly mean
temperature. Co2 is released from the oceans when Co2 concentrations are determined from daily
global temperatures become warmer and diffuses averages for the number of Co2 molecules in every
into the ocean when temperatures are cooler. Initial one million molecules of dried air and without
changes in global temperature were triggered by considering the water vapor in air. Annual mean
changes in received solar radiation by the Earth Co2 concentrations are the arithmetic mean of the
through the Milankovitch cycles. The increase in monthly averages for the year. The estimated
Co2 then amplified the global warming by uncertainty in the Mauna Loa annual mean growth
enhancing the greenhouse effect. The long-term rate is 0.11 ppm/yr. The variation of Atmospheric
climate change represents a connection between the Co2 (in ppm) during 1958 onwards are plotted in
concentrations of Co2 in the atmosphere and means Fig 2. From the plot, it is find that that the rate of
global temperature. Certain atmospheric gases, like concentration of atmospheric Co2 are increasing
Co2, water vapor and methane, are able to alter the continuously during above mentioned periods.
energy balance of the Earth by being able to absorb These increases can reach more than 550 ppmv
long wave radiation emitted from the Earth’s before the end of the 21st century.
Atmospheric Co2
400
375
Parts per millian (ppm)
350
325
300
1958
1960
1962
1964
1966
1968
1970
1972
1974
1976
1978
1980
1982
1984
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
2008
2010
2012
Years
Fig. 2 Shows the variation of Co2 concentration during 1958 onwards.

_________________________________________________________________________________

4. Long-term variation of global surface emerged lately. The increase in global surface
temperature temperature is extending the distribution of
Global warming is the rise in the average mosquitoes due to the increase in humidity levels
temperature of Earth’s atmosphere and oceans and their frequent growth in warmer atmosphere.
since the late 19th century and its projected Various diseases due to ebola, hanta and machupo
continuation. Since the early 20th century, Earth’s virus are expected due to warmer climates. The
mean surface temperature has increased by about effect of increase in global surface temperature will
0.8 °C (1.4 °F). The ranges of these estimates arise definitely be seen on some species in the water. A
from the use of models with differing sensitivity to survey was made in which the marine life reacted
greenhouse gas concentrations. The variation of significantly to the changes in water temperatures.
atmospheric Co2 and global surface temperature It is expected that many species will die off or
(GSTemp) during 1958 onwards are shown in Fig become extinct due to the increase in the
3. From the plot, it is observed that the Co2 and temperatures of the water, whereas various other
global surface temperature both are increasing species, which prefer warmer waters, will increase
continuously during above mentioned periods. A tremendously. The increase in global surface
rise in Earth’s temperatures may boost the temperature is expected to cause irreversible
occurrence and concentration of severe climate changes in the ecosystem and the behavior of
events, such as floods, famines, heat waves, animals. Based on the study on past climate shifts
tornados, and twisters. Other consequences may and computer simulations, many climate scientists
comprise of higher or lower agricultural outputs, say that lacking of big curbs in greenhouse gas
glacier melting, lesser summer stream flows, genus discharges, the 21st century might see temperatures
extinctions and rise in the ranges of disease vectors. rise of about 3 to 8º C, climate patterns piercingly
As an effect of increase in global surface shift, ice sheets contract and seas rise several feet.
temperature species like golden toad, harlequin The IPCC [8] suggests that if sea level rise could
frog of Costa Rica has already become extinct. convert as much as 33% of the world’s coastal
There are number of species that have a threat of wetlands to open water by 2080.
disappearing soon and various new diseases have
Co2 GSTemp Linear (Co2) Linear (GSTemp)

500 75
Giobal Surface Temperature

450 50
Atmospheric Co2
400 25
350 0
300 -25
1958
1960
1962
1964
1966
1968
1970
1972
1974
1976
1978
1980
1982
1984
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
2008
2010
2012
Years
Fig. 3 Shows the variation of Atmospheric Co2 (in ppm) and global surface temperature (GSTemp) during
1958 onwards.
References [3] Steinhilber, F., Abreu, J. A., & Beer, J., Solar
[1] Muscheler, R., F. Joos, J. Beer, S.A. Muller, modulation during the Holocene, Astrophys.
M. Vonmoos and I. Snowball, Solar activity Space Sci. Trans., 4 (2008) 1–6.
during the last 1000 yr inferred from [4] Friis-Christensen, E. and K. Lassen, Science,
radionuclide records, Quat. Sci. Rev., 26 254 (1991) 698-700.
(2007) 82-97. [5] Lassen, K. and Friis-Christensen, E., J. Atmos.
[2] Usoskin, I.G., S.K. Solanki and M. Korte, Terr. Phys., 57 (1995) 835-845.
Astron. Astrophys., 413 (2004) 745-751.

_________________________________________________________________________________

[6] Lockwood, M. and C. Fröhlich, Recent [8] IPCC: 2007, Climate Change 2007, The
oppositely-directed trends in solar climate Physical Science Basis. Contribution of
forcing and the global mean surface air Working Group I to the Fourth Assessment
temperature: II. Different reconstructions of Report of the Intergovernmental Panel on
the Total Solar Irradiance variation and Climate Change eds: Solomon, S., D. Qin, M.
dependence on response timescale, Proc. Roy. Manning, Z. Chen, M. Marquis, K.B. Averyt,
Soc., Lond. (2008). M. Tignor and H.L. Miller, Cambridge
[7] Kopp, G. and Lean, J.L., A New, Lower Value University Press, Cambridge, United Kingdom
of Total Solar Irradiance: Evidence and and New York, NY, USA, (2007) 663-745.
Climate Significance, Geophys. Res. Letters,
Vol. 38 (2011) L01706.
5606

2013
________________________________________________________________________________________

Solar Pow
wered Generatoor Free Electricity
Amrit Paal Singh, Chaairperson. Jyotti Welfare Fouundation, Patiiala, Punjab, In
ndia
ABSTR
RACT
The givenn paper deals with design of Parabolic dish
d heat collector which inccreases the eff fficiency of sollar
heating ssystem.The optical efficiency
cy of parabolicc dishes is connsiderably higgher than that of through, LFR
L or
power tow wer systems because
b the miirror is alwayys pointed direectly at the sunn, whereas thee through, LFFR and
power tow wer have a reeduction in proojected area due
d to a frequeent low angle of incidence of o the solar raadiation.
Keywordds: Parabolic dish
d heat colleector (PDHC)), solar, Heat losses, Efficieency.
Introducction
In todayy's climate off growing eneergy needs and a Methodology
M
increasinng environmen ntal concern, alternatives to A solar ray fromfr sun whiich is time ddependent
the use oof non-renewaable and polluuting fossil fuels vaaries from 45degree to 90 degree. This solar ray
have to be investigatted. One such alternative is strrikes the refleector which inn turn reflectss it to the
solar eneergy. Enoughh amount off solar heart is RFPC (as show wn in fig). All
A the rays fromfr 0900
availablee, we can use this
t energy to heat water orr to hoours to1800 hours
h will strike the Parabbolic dish.
generate Electricity. Here
H what wee do we colleect Thhis ray will transfer
t throuugh glass into the CO2
solar heaat by parabolicc dish at a singgle point and we
w laazer. This willl increase heatt and send it to
t sterling
amplify hheat by CO2 lazer then we w have enouugh enngine head or o give start to the sterlinng engine
heat to ruun an Sterling
g Engine then we convert heeat w
which is couppled with dyynamo. Dynam mo starts
energy innto mechaniccal energy w with the help of geenerate Electriicity.
coupling with dynamo o we can gennerate electriccity W
Which can be directly
d use orr can store in battries.
b
from solaar energy.
Block Diiagram
Paraboliic Dish reesults are usefful in the calcuulation: (or the

The dimeensions of a symmetrical paraboloidal diish
eqquivalent: and w
where
are relateed by the equaation: where is
and are defined as above.
a The diameter of
the focaal length, is the depthh of the diish
thhe dish, measuured along thee surface, is thhen given
(measureed along the axis of symm metry from the t
vertex too the plane of the rim), andd is the radiius byy: wheere meaans
of the rimm. Of course, they must alll be in the sam me thhe natural logaarithm of , i..e. its logarithhm to base
units. If two of thesee three quantiities are know wn, "ee".
this equaation can be ussed to calculatte the third. Thhe volume off the dish, th he amount off liquid it
A more complex calcculation is neeeded to find the t coould hold if th
he rim were hoorizontal and the t vertex
diameter of the dish measured aloong its surfacce. att the botto om (e.g. the t capacityy of a
This is soometimes callled the "linearr diameter", and
a
paaraboloidal wook), is given by
b w
where the
equals thhe diameter of a flat, ciircular sheet of
syymbols are defined as above. This can be
material, usually metall, which is thee right size to be
coompared withh the formulaae for the voolumes of
cut and bbent to makee the dish. Tw wo intermediaate
www.bo
orjournals.co
om Blue Oceean Research
h Journals 25
5606

2013
________________________________________________________________________________________

arrea enclosed by
b the rim, which
w is propoortional to
a cylindeer a hemisphere
thhe amount ofo sunlight thhe reflector dish can
where and a conee Of inntercept.
course, is the apperture area of
o the dish, the
t
The parrabolic sufffer from

reflector an aberration
a
functionss due to the geometric prroperties of the t called coma. This is prim marily of innterest in
paraboloiidal shape: any incom ming ray that is teelescopes becaause most oth her applicationns do not
parallel to
t the axis of the
t dish will beb reflected tooa reequire sharp reesolution off the
t axis of the parabola.
central point, or "focuus". (For a geoometrical proof,
click heree.) Because many
m types off energy can be CO2 Lazer
reflected in this way,, parabolic reeflectors can be A the active medium,
As m thesse lasers use a suitable
used to ccollect and concentrate energy entering thet m
mixture Of CO O2, N2, and He. Oscillattion takes
reflector at a particu ular angle. Siimilarly, enerrgy pllace between n two vibraational levelss of the
radiating from the focus to thee dish can be CO2 molecule, while N2 and He greatlyy improve
transmittted outward inn a beam that is parallel to the
t thhe efficiency of laser action. The CO O2 laser is
axis of thhe dish. acctually one of the most powerful
p laserrs (output
In contraast with spherrical reflectorrs, which sufffer poowers of morem than 100
1 kW haave been
from a sppherical aberrration that beecomes strongger deemonstrated from
f a CO2 gas-dynamic
g l
laser) and
as the rratio of the beam
b diameter to the foccal onne of the mostt efficient (15-20% slope effficiency).
distance bbecomes largeer, parabolic reflectors
r can be N
Nitrogen helps producing a large populattion in the
made too accommod date beams of any wid dth. uppper laser leevel while heelium helps removing
Howeverr, if the incom ming beam maakes a non-zeero poopulation from
m the lower laaser level.
angle witth the axis (or if the emittiing point sourrce
is not placed
p in the focus), paraabolic reflectoors
www.bo
orjournals.co
h Journals 26
5606

2013
________________________________________________________________________________________

Fig:1
Figure (1) shows thee relevant vibbrational enerrgy laaser is limited
d by the disasssociation of thhe carbon
levels foor the electrronic groundd states of the t diioxide into oxyygen and carbbon monoxidee.
CO2 and N2 molecules. The N2 molecule,
m beiing 2.. The second type Of CO O2 laser is the axialflow
diatomic, has only onee vibrational mode;
m its lowest laaser. This is the
t most widdely used typee of CO2
two energgy levels (v= 0, v = 1) are indicated in thet laaser, in whichh the gas flowws along the axisa of the
figure. Energy levvels for CO C 2 are moore opptical cavity (Fig.2) Axxial flow alllows the
complicaated, since CO2 is a liinear triatom mic deepleted gas to be replaced byb new gas. Laaser beam
moleculee. In this case, there are thrree poowers of up to t 4 kW of continuous waave output
nondegennerate modess of vibration: Symmettric caan be achieveed. Laser beam ms with pure Gaussian
stretchingg, bending, annd asymmetricc stretching. inntensity profilees can be gennerated for pow wer levels
The rem maining energ gy between thhe intermediaate upp to about one o kW, whiile beams wiith power
states annd the groundd state is lost through kineetic abbove one kW generally havve a mixed moode output
energy trransfer, whicch generates heat instead of coontaining two or mom diffe ferent intensityy profiles.
light. Forr CO2 molecuules, the rate of
o energy releaase Siince the used gas is either exhausted im mmediately
through heat is muchh lower than energy releaase orr is reused aftfter removing any contaminnants, this
through light, so the t energy efficiency for f syystem requiress a constant supply of gas and a gas
producinng a laser beeam is high compared with w haandling system m. Axial floww lasers can be b further
other lasiing materials. In comparisoon, helium has a cllassified by th he speed of gas flow, nam mely low-
very higgh thermal diffusivity; theerefore, with its sppeed flow and d high-speed flow
f lasers. Low-speed
L
addition to the lasin ng gas mixtuure, the rate of floow lasers attaain power outtputs of aboutt 50 W to
energy reelease througgh heating is extremely hig gh. 700 W for each meter
m of cavitty length. To produce a
This com mbination of lasing
l interacttions makes the
t coompact packaage, the opticcal cavity is folded so
carbon dioxide laseer suitable for industrrial thhat longer disccharge lengthhs can be obtaained in a
applicatioons in terms ofo both the ennergy efficienncy smmaller assemb bly. The low flow speed causesc the
(up to 110%) and thee high outpuut beam poweers laaser to heat upp considerablyy, and the relattively low
achievable. coonductivity off the gas mixtture limits the bore size
The threee main typpes of gas flow f are sealled off the lasing tuube. Heating of the resonaator cavity
dischargee tube, axxialflow, andd traverse or caauses distortioons in the reesonator opticcs due to
crossfloww. The flow method
m determ
mines how fastf thhermal expannsion; these distortions affect a the
the post--stimulation carbon dioxiide gas can be beeam intensitty profile and beam stability.
removed from the optiical cavity so that
t new grouund H
However, withh external coooling for the resonator
state carrbon dioxide gas can be introduced for f annd optics, beaam outputs withw good adjjustability
excitationn and stimulattion. annd stability can
c be generated. Mgh-sppeed flow
1. The sealed
s dischaarge laser coontains a fix xed m
models typicallly have a gaas velocity off 60 nVs.
lasing gas
g mixture sealed in thhe laser caviity; Thhus, the carbon dioxide molecule
m only has time
thereforee, it does not require a gas supply or gas g foor one excitattion/stimulatioon cycle before exiting
handling system. How wever, becausee there is no gas
g thhe optical cavvity. Typical outputs
o are 6000 W per
flow, ouutput powers are limited to t about 50 W m
meter of caviity length, with
w total lasser beam
(since uused CO2 cannot c be discharged
d and
a ouutputs availaable up to 6 kW. Duee to the
replenishhed with new CO2), and thee lifetime of the t coonvective coo oling of the high-speed flow, the
www.bo
orjournals.co
h Journals 27
5606

2013
________________________________________________________________________________________

thermal distortions in the resonaator optics are a prroduce intennsity profiless which arre nearly
minimizeed and larger bore
b diameterrs can be used
d to G
Gaussian in shaape.
Fig:2
Sterling Engine arrrangement iss shown in Figure 1. As the t figure

The Alphha Stirling en
ngine consistss of two pow
wer deepicts, the hott and cold worrkspaces are physically
p
pistons, each with a separate cylinder and a seeparated fromm each other. This featuree provides
connectinng rod. One power pistoon and cylindder exxcellent therm
mal isolation for
fo the two woorkspaces.
representts hot worrkspace, thee other coold Thhe conduit that joins the t two woorkspaces,
workspacce. The connnecting rods join
j a comm
mon hoowever, adds to the dead space associiated with
journal on a singlee flywheel/crrankshaft. Thhis thhis design
.
The Alphha then, in itss simplest forrm, utilizes fo

our coonfiguration reequires a closse tolerance fiit between
reciprocaating parts and
a one rottary part. Thhis eaach power pisston and its reespective cylinnder. This
www.bo
orjournals.co
h Journals 28
5606

2013
________________________________________________________________________________________

is not ann issue for those

t components operatiing faailure due to these operating conditions.
within thhe cold work kspace. The hot workspaace Teechniques thaat alleviate piston
p seal faiilure may
piston annd cylinder dod represent a problem withw allso increase engine dead space. The Alpha is
regard to t maintaininng a reliablle seal in an knnown for its high
h power-to--volume ratio..
environmment with higgh heat couplled with slidiing
friction. Seals on this piston
p can be subject to earrly
System Design
D
REFER
RENCES [44] Patel, C. K. N. (19644). "Continuoous-Wave
[1] John n Danniel Laser Action on Vibrational-R Rotational
Kraus American physicist
p knowwn for his h Transitionss of CO2". Physical
contrributions to electrom
magnetics, raddio Review 1366 (5A): A1187–
astroonomy, and anntenna theory.. A1193. Bibbcode:1964PhhRv..136.11877P. doi:10
[2] Robeert Stirling , T. Finkelsteeinl; A.J. Orggan .1103/PhyssRev.136.A11187
(20001) [55] CO2-laser micromachhining and back-end
[3] Finkkelstein, T. Generalized
G T
Thermodynam mic processing for rapid production
p off PMMA-
Anallysis of Stirrling Enginess. Paper 1188B, based miccrofluidic systems". Retrrieved 21
Sociiety of Automotive Engineeers, 1960. October 20009.
www.bo
orjournals.co
h Journals 29

_________________________________________________________________________________

Data Leakage Detection

Sachin A. Bansode, Computer Department, Sinhgad Institute of Technology, Lonavala, India
Uday M. Jadhav, Computer Department, Sinhgad Institute of Technology, Lonavala, India
Prof. N. K. Patil, Computer Department, Sinhgad Institute of Technology, Lonavala, India
ABSTRACT
We study the following problem: A data distributor has given sensitive data to a set of supposedly trusted agents
(third parties). Some of the data are leaked and found in an unauthorized place (e.g., on the web or somebody’s
laptop). The distributor must assess the likelihood that the leaked data came from one or more agents, as
opposed to having been dependently gathered by other means. We propose data allocation strategies (across the
agents) that improve the probability of identifying leakages. These methods do not rely on alterations of the
released data (e.g., watermarks). In some cases, we can also inject “realistic but fake” data records to further
improve our chances of detecting leakage and identifying the guilty party.
Keywords:Allocation strategies, data leakage, data privacy, fake records, leakage model.
1. Introduction set of objects or records. Specifically, we study the

In the course of doing business, sometimes following scenario: After giving a set of objects to
sensitive data must be handed over to supposedly agents, the distributor discovers some of those
trusted third parties. For example, a hospital may same objects in an unauthorized place. (For
give patient records to researchers who will devise example, the data may be found on a website, or
new treatments. Similarly, a company may have may be obtained through a legal discovery
partnerships with other companies that require process.) At this point, the distributor can assess
sharing customer data. Another enterprise may the likelihood that the leaked data came from one
outsource its data processing, so data must be given or more agents, as opposed to having been
to various other companies. We call the owner of independently gathered by other means. Using an
the data the distributor and the supposedly trusted analogy with cookies stolen from a cookie jar, if
third parties the agents. Our goal is to detect when we catch Freddie with a single cookie, he can argue
the distributor’s sensitive data have been leaked by that a friend gave him the cookie. But if we catch
agents, and if possible to identify the agent that Freddie with five cookies, it will be much harder
leaked the data. We consider applications where the for him to argue that his hands were not in the
original sensitive data cannot be perturbed. cookie jar. If the distributor sees “enough
Perturbation is a very useful technique where the evidence” that an agent leaked data, he may stop
data are modified and made “less sensitive” before doing business with him, or may initiate legal
being handed to agents. For example, one can add proceedings. In this paper, we develop a model for
random noise to certain attributes, or one can assessing the “guilt” of agents.We also present
replace exact values by ranges. However, in some algorithms for distributing objects to agents, in a
cases, it is important not to alter the original way that improves our chances of identifying a
distributor’s data. For example, if an outsourcer is leaker. Finally, we also consider the option of
doing our payroll, he must have the exact salary adding “fake” objects to the distributed set. Such
and customer bank account numbers. If medical objects do not correspond to real entities but appear
researchers will be treating patients (as opposed to realistic to the agents. In a sense, the fake objects
simply computing statistics), they may need act as a type of watermark for the entire set,
accurate data for the patients. without modifying any individual members. If it
Traditionally, leakage detection is handled by turns out that an agent was given one or more fake
Watermarking, e.g., a unique code is embedded in objects that were leaked, then the distributor can be
each distributed copy. If that copy is later more confident that agent was guilty. We start by
discovered in the hands of an unauthorized party, introducing our problem setup and the notation we
the leaker can be identified. Watermarks can be use. We present a model for calculating “guilt”
very useful in some cases, but again, involve some probabilities in cases of data leakage. Then, we
modification of the original data. Furthermore, present strategies for data allocation to agents.
watermarks can sometimes be destroyed if the data Finally, we evaluate the strategies in different data
recipient is malicious. In this paper, we study leakage scenarios, and check whether they indeed
unobtrusive techniques for detecting leakage of a help us to identify a leaker.

_________________________________________________________________________________

2. Existing System 3. Proposed System

Traditionally, leakage detection is handled by This paper we are going to implement by using
watermarking, e.g., a unique code is embedded in fake object addition technique and our goal is to
each distributed copy. If that copy is later detect when the distributor’s sensitive data has
discovered in the hands of an unauthorized party, been leaked by agents, and if possible to identify
the leaker can be identified. Watermarks can be the agent that leaked the data. Perturbation is a very
very useful in some cases, but again, involve some useful technique where the data is modified and
modification of the original data. Furthermore, made less sensitive before being handed to agents.
watermarks can sometimes be destroyed if the data In this section we develop a model for assessing the
recipient is malicious. E.g. A hospital may give guilt of agents. We also present algorithms for
patient records to researchers who will devise new distributing objects to agents, in a way that
treatments. Similarly, a company may have improves our chances of identifying a leaker.
partnerships with other companies that require Finally, we also consider the option of adding fake
sharing customer data. Another enterprise may objects to the distributed set. Such objects do not
outsource its data processing, so data must be correspond to real entities but appear realistic to the
given to various other companies. We call the agents. In a sense, the fake objects acts as a type of
owner of the data the distributor and the watermark for the entire set, without modifying any
supposedly trusted third parties the agents. individual members. If it turns out an agent was
given one or more fake objects that were leaked,
2.1. Digital Watermark then the distributor can be more confident that
Digital watermarking is a technology for agent was guilty.
embedding various types of information in digital
content. In general, information for protecting 3.1 Allocation Strategies
copyrights and proving the validity of data is In this section, we describe allocation strategies
embedded as a watermark. A digital watermark is a that solve exactly or approximately the scalar
digital signal or pattern inserted into digital versions for the different instances presented in
content. The digital content could be a still image, different forms. We resort to approximate solutions
an audio clip, a video clip, a text document, or in cases where it is inefficient to solve accurately
some form of digital data that the creator or owner the optimization problem. In the first place, the
would like to protect. The main purpose of the goal of these experiments was to see whether fake
watermark is to identify who the owner of the objects in the distributed data sets yield significant
digital data is, but it can also identify the intended improvement in our chances of detecting a guilty
recipient. Why do we need to embed such agent. In the second place, we wanted to evaluate
information in digital content using digital our e-optimal algorithm relative to a random
watermark technology? The Internet boom is one allocation.
of the reasons. It has become easy to connect to the
Internet from home computers and obtain or Algorithm 1: Allocation for Explicit Data
provide various information using the World Wide Requests (EF)
Web (WWW). Step 1: Calculate total fake records as sum of fake
All the information handled on the Internet is records allowed.
provided as digital content. Such digital content Step 2: While total fake objects > 0
can be easily copied in a way that makes the new Step 3: Select agent that will yield the greatest
file indistinguishable from the original. Then the improvement in the sum objective i.e.
content can be reproduced in large quantities. For i =argmax (1⁄)………………………..
example, if paper bank notes or stock certificates Step 4: Create fake record
could be easily copied and used, trust in their Step 5: Add this fake record to the agent and also to
authenticity would greatly be reduced, resulting in fake record set.
a big loss. To prevent this, currencies and stock Step 6: Decrement fake record from total fake
certificates contain watermarks. These watermarks record set. Algorithm makes a greedy choice by
are one of the methods for preventing counterfeit selecting the agent that will yield the greatest
and illegal use. Digital watermarks apply a similar improvement in the sum-objective.
method to digital content. Watermarked content With sample data requests agents are not interested
can prove its origin, thereby protecting copyright. in particular objects. Hence, object sharing is not
A watermark also discourages piracy by silently explicitly defined by their requests. The distributor
and psychologically deterring criminals from is “forced” to allocate certain objects to multiple
making illegal copies. agents only if the number of requested objects
exceeds the number of objects in set T. The more
5606

2013
________________________________________________________________________________________

data objeects the agents request in total, the moore It can be shown n that algorithhm s-max is opptimal for
recipients on average an object hass; and the moore thhe sum-objecctive and the t max-objeective in
objects arre shared amo ong different agents,
a the moore prroblems
difficult iit is to detect a guilty agentt. w
where M ≤ |T| and n < |T|. Itt is also optim
mal for the
m
maxobjective
Algorith hm 2. Alloccation for Sample Da ata iff |T| ≤ M ≤ 2 |T| or all ageents request data
d of the
Requestss (SF) saame size.
Step 1: IInitialize Min__overlap ← 11, the minimuum W
With sample data
d requestss, each agentt Ui may
out of tthe maximum m relative ovverlaps that the
t reeceive any T from a subsett out of differrent ones.
allocationns of differentt objects to H
Hence, a different allocations. In every
there are
Step 2: foor k {k | } do alllocation, the distributor canc permute T objects
Initialize max_rel_ov ← 0, the maxiimum annd keep thee same channces of guillty agent
relative ooverlap between and any set that the deetection. The reason is thaat the guilt probability
p
allocationn of to deepends only on o which ageents have recceived the
Step 3: foor all j = 1,..., n : j = i and do leeaked objects and not on the identity of the t leaked
Calculatee absolute oveerlap as obbjects. Therrefore, from m the disstributor’s
abs_ov ← | ∩ | + 1 peerspective th here are diffferent allocattions. An
Calculatee relative overrlap as obbject allocatioon that satisfiees requests annd ignores
rel_ov ← abs_ov / minn ( , ) thhe distributor’s objective iss to give each agent a
Step 4: FFind maximum m relative as unnique subset ofo T of size m.m The s-max algorithm
max_rel__ov ← MAX (max_rel_ov,
( rel_ov) alllocates to an agent the data record that yields the
If max_reel_ov ≤ min_o overlap then m
minimum incrrease of th he maximum m relative
min_overrlap ← max_rrel_ov ovverlap amongg any pair of o agents. Thhe s-max
ret_k ← k allgorithm is as follows.
Return reet_k
3. Ageent Guilt Model

M Means probabbility of leakking object t1
M t is get
Before we present the generaal formula for f diivided in U1 and
a U2.
computinng the probab bility Pr{Gi|S} that an ageent
Ui is guillty, we providde a simple example with seet. Here we have following
H f casees :
T ={t1,t22,t3} // distributor set T 1.. The target guuessed t1 withh probability p,
p
R1={t1,t22} // agent set
s R1 2.. Agent U1 leaaked t1 to S with
w probabilityy (1-p)/2,
R2={t1,t3} // agent set
s R2 3.. Agent U2 leaaked t1 to S with
w probabilityy (1-p)/2,
S={t1,t2,,t3} // Target leaked set S 4.. similaraly, agent U1 leaked l t2 too S with
prrobability
Here all tthree objects t1,t2
t and t3 leaked by S. (11-p),
Distributtor gives objeccts t1 to both U1
U nd U2. 5.. and agent U22 leaked t3 too S with probaability (1-
p)).
www.bo
orjournals.co
om Blue Ocean
n Research Jo
ournals 32

_________________________________________________________________________________

With sample data requests, agents are not interested

Given this values, the probability that agent U1 is in particular objects. Hence, object sharing is not
not guilty, namely that U1 and U2 did not leak explicitly defined by their requests. The distributor
either object is: is “forced” to allocate certain objects to multiple
Pr{~G1|S} = (1-(1-p)/2) * (1-(1-p)) //for agents only if the number of requested objects mi
agent U1 exceeds the number of objects in set T. The more
Pr{~G2|S} = (1-(1-p)/2) * (1-(1-p)) //for data objects the agents request in total, the more
agent U2 recipients, on average, an object has; and the more
And , the probability that agent U1 and U2 is guilty objects are shared among different agents, the more
is : difficult it is to detect a guilty agent.
Pr{G1|S} = 1-Pr{~G1} //for agent U1
Pr{G2|S} = 1-Pr{~G2} //for agent U2 5. Conclusion
In a perfect world, there would be no need to hand
In general case, first we compute probability that over sensitive data to agents that may unknowingly
he leaks a single object t to S. or maliciously leak it. And even if we had to hand
To compute this, we define set of agents Vt = {Ui|t over sensitive data, in a perfect world, we could
in Ri} that have t in their data sets so that we have watermark each object so that we could trace its
following : origins with absolute certainty. However, in many
1. Probability that some agents leaked object t to S cases, we must indeed work with agents that may
is : not be 100 percent trusted, and we may not be
Pr{Ui leaked t to S} = 1-p certain if a leaked object came from an agent or
from some other source, since certain data cannot
2.Probability that all agents leaked objects t to S is : admit watermarks. In spite of these difficulties, we
Pr{Ui leaked t to S} = (1-p)/|Vt|, if Ui is in Vt have shown that it is possible to assess the
likelihood that an agent is responsible for a leak,
4. Experimental Results based on the overlap of his data with the leaked
We implemented the presented allocation data and the data of other agents, and based on the
algorithms in Python and we conducted probability that objects can be “guessed” by other
experiments with simulated data leakage problems means. Our model is relatively simple, but we
to evaluate their performance. believe that it captures the essential trade-offs. The
algorithms we have presented implement a variety
4.1 Explicit Requests of data distribution strategies that can improve the
We focus on scenarios with a few objects that are distributor’s chances of identifying a leaker. We
shared among multiple agents. These are the most have shown that distributing objects judiciously
interesting scenarios, since object sharing makes it can make a significant difference in identifying
difficult to distinguish a guilty from no guilty guilty agents, especially in cases where there is
agents. Scenarios with more objects to distribute or large overlap in the data that agents must receive.
scenarios with objects shared among fewer agents Our future work includes the investigation of agent
are obviously easier to handle. As far as scenarios guilt models that capture leakage scenarios that are
with many objects to distribute and many not studied in this paper. For example, what is the
overlapping agent requests are concerned, they are appropriate model for cases where agents can
similar to the scenarios we study, since we can map collude and identify fake tuples? Another open
them to the distribution of many small subsets. problem is the extension of our allocation strategies
Incidentally, the two jumps in the e-optimal curve so that they can handle agent requests in an online
are due to the symmetry of our scenario. Algorithm fashion (the presented strategies assume that there
e-optimal allocates almost one fake object per is a fixed set of agents with requests known in
agent before allocating a second fake object to one advance).
of them. The presented experiments confirmed that 6. References
fake objects can have a significant impact on our [1] R. Agrawal and J. Kiernan, “Watermarking
chances of detecting a guilty agent. Note also that Relational Databases,” Proc. 28th Int’l Conf. Very
the algorithm evaluation was on the original Large Data Bases (VLDB ’02), VLDB
objective. Hence, the superior performance of e- Endowment, pp. 155-166, 2002.
optimal (which is optimal for the approximate [2] P. Bonatti, S.D.C. di Vimercati, and P.
objective) indicates that our approximation is Samarati, “An Algebra for Composing Access
effective. Control Policies,” ACM Trans. Information and
System Security, vol. 5, no. 1, pp. 1-35, 2002.
4.1 Sample Requests

_________________________________________________________________________________

[3] P. Buneman, S. Khanna, and W.C. Tan, “Why SIGMOD, pp. 98-109, 2003. [18] L. Sweeney,
and Where: A Characterization of Data “Achieving K-Anonymity Privacy Protection
Provenance,” Proc. Eighth Int’l Conf. Database Using Generalization and Suppression,”
Theory (ICDT ’01), J.V. den Bussche and V. http://en.scientificcommons. org/43196131, 2002
Vianu, eds., pp. 316-330, Jan. 2001.
[4] P. Buneman and W.-C. Tan, “Provenance in
Databases,” Proc. ACM SIGMOD, pp. 1171-1173,
2007.
[5] Y. Cui and J. Widom, “Lineage Tracing for
General Data Warehouse Transformations,” The
VLDB J., vol. 12, pp. 41-58, 2003.
[6] S. Czerwinski, R. Fromm, and T. Hodes,
“Digital Music Distribution and Audio
Watermarking,” http://www.scientificcommons.
org/43025658, 2007.
[7] F. Guo, J. Wang, Z. Zhang, X. Ye, and D. Li,
“An Improved Algorithm to Watermark Numeric
Relational Data,” Information Security
Applications, pp. 138-149, Springer, 2006.
[8] F. Hartung and B. Girod, “Watermarking of
Uncompressed and Compressed Video,” Signal
Processing, vol. 66, no. 3, pp. 283-301, 1998.
[9] S. Jajodia, P. Samarati, M.L. Sapino, and V.S.
Subrahmanian, “Flexible Support for Multiple
Access Control Policies,” ACM Trans. Database
Systems, vol. 26, no. 2, pp. 214-260, 2001.
[10] Y. Li, V. Swarup, and S. Jajodia,
“Fingerprinting Relational Databases: Schemes and
Specialties,” IEEE Trans. Dependable and Secure
Computing, vol. 2, no. 1, pp. 34-45, Jan.-Mar.
2005.
[11] B. Mungamuru and H. Garcia-Molina,
“Privacy, Preservation and Performance: The 3 P’s
of Distributed Data Management,” technical report,
Stanford Univ., 2008.
[12] V.N. Murty, “Counting the Integer Solutions
of a Linear Equation with Unit Coefficients,” Math.
Magazine, vol. 54, no. 2, pp. 79-81, 1981.
[13] S.U. Nabar, B. Marthi, K. Kenthapadi, N.
Mishra, and R. Motwani, “Towards Robustness in
Query Auditing,” Proc. 32nd Int’l Conf. Very
Large Data Bases (VLDB ’06), VLDB
Endowment, pp. 151-162, 2006.
[14] P. Papadimitriou and H. Garcia-Molina, “Data

Leakage Detection,” technical report, Stanford
Univ., 2008.
[15] P.M. Pardalos and S.A. Vavasis, “Quadratic
Programming with One Negative Eigenvalue Is
NP-Hard,” J. Global Optimization, vol. 1, no. 1, pp.
15-22, 1991.
[16] J.J.K.O. Ruanaidh, W.J. Dowling, and F.M.
Boland, “Watermarking Digital Images for
Copyright Protection,” IEE Proc. Vision, Signal
and Image Processing, vol. 143, no. 4, pp. 250-256,
1996.
[17] R. Sion, M. Atallah, and S. Prabhakar, “Rights
Protection for Relational Data,” Proc. ACM

_________________________________________________________________________________

Biotransformation of a Textile AZO Dye Acid Yellow 25

by Marinobacter Gudaonensis AY-13
Shertate R.S., Research Scholar, P.G. Department of Microbiology and Research Center, Shri Shivaji
Mahavidyalaya, Barshi – 413411, Dist. - Solapur, MS, India.
Thorat P.R., Associate Professor, P.G. Department of Microbiology and Research Center, Shri Shivaji
Mahavidyalaya, Barshi – 413411, Dist. - Solapur, MS, India.
ABSTRACT
Biotransformation of Acid Yellow 25 was carried out using Marinobacter gudaonensis AY-13(Accession No.
HE970768) isolated from natural marine environment. The decolorization of the azo dye Acid Yellow 25 in
nutrient broth and half strength nutrient broth having 8.0% salt concentration was up to 92.00% and 90.03%
respectively in 24 hours. The decolorization of the dye by cell-free extract was found to be upto 80.13 % in 24
hours. The decolorization of the dye was also studied in presence of different co-substrates viz. 1% glucose, 1%
yeast extract and 1% starch and found that percent decolorization was up to 92.77%, 94.00% and 92.05%
respectively. From these results it can be concluded that, the isolate could decolorize the dye very effectively.
The percent COD reduction of the dye by the isolate was 70.00%. The degradation products formed were
analyzed by GC-MS technique and it was found that culture degraded Acid Yellow 25 to the products having
molecular weights 98, 70, 112, 125, 140, 168, 186, 128, 141, 83, 111, 154, 72 and 155. The microbial toxicity
study revealed that degradation products of Acid Yellow 25 were non-toxic to ecologically important
microorganisms like Pseudomonas sp., Rhizobium sp. and Azotobacter sp.
Keywords – Acid Yellow 25, Biodegradation, COD Reduction, GC-MS analysis, Marine Bacteria
I. Introduction leading to removal of color and toxicity of the dye.

The Ocean, which is called the ‘Mother of origin of The dye wastewaters can be treated by
life’, is also the source of structurally unique physicochemical methods, biological and
natural products that are mainly accumulated in microbiological methods. The major disadvantage
living organisms. Water is a huge resource on of physicochemical methods has been largely due
earth. Of all the water resources on earth, only 3% to the high cost, low efficiency, limited versatility,
of it is not salty and two- third of fresh water exists interference by other wastewater constituents (Van
in the form of glaciers and ice caps. Color present der Zee and Villaverde, 2005; Kaushik and Malik,
in the industrial effluent gives a direct indication 2009). Traditional wastewater treatment
that the water is polluted. Hence color is the first technologies have proven to be markedly
contaminant recognised in the textile effluent and it ineffective for handling wastewater of synthetic
has to be removed before discharging into large textile dyes because of the chemical stability of
bodies (Khadijah et al., 2009). Textile industries these pollutants (Forgacs et al., 2004). Also these
are usually located in places near to the sea, mainly techniques generate a huge volume of sludge and
for easy overseas transportation. However, the cause secondary pollution due to the formation of
toxic effluents released by the industries causes a sludge and hazardous by-products (Mohandass et
great challenge to the marine life. In a year, about al., 2007). The use of microorganisms for the
280,000 tonnes of textile dyes are let out into the removal of synthetic dyes from industrial effluents
environment worldwide most of which end up into offers considerable advantages; the process is
the marine environment. The textile dyes relatively inexpensive, the running costs are low,
profoundly disturbs the marine ecosystem, as they and the end products of complete mineralization
undergo chemical and biological changes. Their are not (Forgacs et al., 2004)
breakdown products might also be toxic to some Thus, biodegradation is a promising approach for
aquatic organisms. Biodegradation causes the remediation of synthetic dyes wastewater
mineralization of dyes to simpler inorganic because of its cost effectiveness, efficiency, and
compounds which are not lethal to life forms environmentally friendly nature (Jirasripongpun et
(Tripathi and Shrivastava, 2011). al., 2007; Shedbalkar et al., 2008; Gopinath et al.,
The basic step in the decolorization and 2009). As a best alternative, much interest is now
degradation of azo dyes is breakdown of azo bonds, focused on biodegradation of dyes (Mcmullan et
al., 2001; An et al., 2002). This study deals with
biological decolorization and biodegradation of a

_________________________________________________________________________________

textile azo dye Acid Yellow 25 by Marinobacter marine water and compost were collected as the
gudaonensis AY-13. source of microorganisms; these soil samples were
kept in a container and refrigerated till use.
II. Materials and Methods – Textile Dye – Acid Yellow-25 (λmax-392nm).
Materials Analytical Grade dye purchased from Sigma-
Soil samples from salterns (Saltpan), areas nearby Aldrich (USA).
waste disposal sites of the textile industry, sewage,
sludge from effluent treatment plants (ETP),
Table 1: Properties of the dye
Dye Name - Acid Yellow 25. (CI No. 18835) λmax 392nm
Structure
O
NH S OH
O N N
N
H3C N
SO3Na
Properties
Molecular Formula = C22H24N5NaO6S2
Formula Weight = 541.575629
Composition = C(48.79%) H(4.47%) N(12.93%) Na(4.24%) O(17.73%) S(11.84%)
a. Acclimatization and isolation of i. Percent Decolorization in Nutrient

microorganisms Broth, Half (½) Strength Nutrient Broth
For the isolation of microorganisms capable of Isolate AY-13 was used to inoculate
decolorizing the dye soil was used as a source of in 20 ml nutrient broth (peptone – 1.0g, NaCl –
microorganisms. The soil samples were subjected 0.5g, Beef Extract – 0.3g, Distilled Water –
to enrichment using nutrient broth amended with 100.0ml) containing 8.0% NaCl and 1500µg/ml
increasing concentrations of NaCl (0.5%-20.0%) concentration of dye. These tubes were then
and of dye (10µg ml-1 to 1500µg ml-1) with incubated at ambient temperature for 24 hrs and
incubation time of 24 h at 37°C. Repeated transfers observed for decolorization of the dye. In addition,
were carried out to isolate stable dye decolorizing half strength nutrient broth (peptone – 0.5g, NaCl –
strain and the isolated strain was stored at 5°C for 0.25g, Beef Extract – 0.15g, Distilled Water –
further use. The high decolorizing bacteria were 100.0ml) was also used to test for the ability of
screened by performing a decolorization assay with isolate AY-13 to decolorize the dye Acid Yellow
the dye using UV- VIS spectrophotometer 25 with same NaCl and dye concentration.
(Systronics-106 model) at its respective λ max ii. Percent Decolorization in presence of
392nm and designated isolate AY-13 and used for different Co-substrates
further studies. The isolate was supplemented with different carbon
b. Determination of biodegradation source and nitrogen sources viz. 1% Glucose,
activity 1%Yeast Extract and 1%Starch. The effects of
The isolate AY-13 was inoculated in nutrient these sources on the decolorization were then
medium containing dye Acid Yellow 25 (Table 1) observed.
at a concentration 1500µg ml-1 and incubated at iii. Percent Decolorization in Cell Free
37oC. An aliquot of 5 ml was removed after Extract
different time intervals and centrifuged at 10,000 The biomass of isolate AY-13, grown in nutrient
rpm for 20 min to remove the cell mass. The broth containing 8.0% NaCl were separated by
supernatant was then used to investigate the centrifugation using cooling centrifuge (BIO-
decolorization of the dye by observing the change LABS 165-R) at 8000 rpm for 20 min at 40C. The
in the absorbance at maximum absorption pellet was then suspended in 50mM phosphate
wavelength (λmax) 392 nm on spectrophotometer. buffer pH – 7.2. The cell suspension in the buffer
was properly cooled and lysed by using

_________________________________________________________________________________

Ultrasonicator (Sonic-Vibra Cell System – 130) the supernatant containing the crude enzyme was then
output was kept 50amp with 6 strokes of 25 s each, added with 1500µg/ml concentration of dye
time interval kept was 2min at 40C. This solution and observed for dye decolorization. The
homogenate was centrifuged at 10,000 rpm for 10 percent decolorization studies were monitored by
min so as to separate the cell debris from the using spectrophotometer.
intracellular enzymes. The supernatant was used as The percent decolorization of the dye by the isolate
a crude intracellular enzyme source. The was determined by following formula,
A0 - At
Decolorization (%) = -------------------------- X 100
A0
Where,
A0 = Absorbance of the blank (dye solution).
At = Absorbance of the treated dyes solution.
c. Percent COD reduction Studies PCR amplification of 16S rDNA from all the
Percent COD reduction value of the dye strains was performed using 16S rDNA specific
decolorized in nutrient broth by isolate AY-13 was universal oligonucleotide primers 16F27N (5’-
calculated by COD analysis using K2Cr2O7 as a AGA GTT TGA TCM TGG CTC AG-3’) and
strong oxidizing agent under reflux conditions. 16R1488 (5’-CGG TTA CCT TGT TAC GAC
d. GCMS Analysis TTC ACC-3’) hybridizing respectively at positions
Degradation of the dye Acid Yellow 25 by the 8–27 and 1488–1511 relative to E. coli 16S rDNA
isolate AY-13 was confirmed by GC-MS analysis. numbering (Grifoni et al., 1995). The PCR
The samples for GCMS were prepared by reactions were carried out in PE 9700 thermal
extracting the degraded products in Di-Chloro cycler (Perkin Elmer, USA). The amplification
Methane (DCM). The decolorized broth was conditions were: an initial denaturation at 94°C for
centrifuged at 10,000 rpm for 20 min. The two minutes, followed by 35 cycles of denaturation
supernatant was taken in a separating funnel and at 94°C for one minute, annealing at 55°C for one
equal amount of DCM was added to and allowed to minute and extension at 72°C for one minute and
separate solvent and aqueous phase. The funnel final extension at 72°C for 10 minutes13. PCR was
was shaken vigorously for 20 min to extract the carried out in 25 µl reaction mixture consisted of
products in DCM. The products that are extracted 10 x Taq polymerase buffer Bangalore Genei,
in the solvent phase were concentrated in the vial Bangalore, India), 2mM dNTPs, 10pM primers, 1
by evaporation of the solvent at room temperature. unit Taq polymerase (Bangalore Genei, Bangalore,
This was then analyzed by Gas chromatography India), and 10ng DNA. The PCR amplification
and Mass spectroscopy (GC-MS). The GC-MS products were checked on 1% (wt/vol) agarose
analysis of metabolites was carried out using a gels. The PCR product was purified by PEG-NaCl
Shimadzu 2010 MS Engine, equipped with precipitation14. Briefly, the PCR product was mixed
integrated gas chromatograph with HP1 column with 0.6 volumes of PEG-NaCl solution (20% PEG
(60 m long, 0.25 mm id, non-polar). Helium was 6000, 2.5 M NaCl) and incubated for 10 min at
used as carrier gas at a flow rate of 1 ml min−1. The 370C. The precipitate was collected by
injector temperature was maintained at 2800C with centrifugation at 12,000 rpm for 10 min. The pellet
oven conditions as: 800C kept constant for 2 min was washed twice with 70% ethanol and dried
and increased up to 2000C with 100C min-1 raised under vacuum, which was then resuspended in
up to 2800C with 200C min−1 rate. glass distilled water at a concentration of >0.1
e. Identification of the isolate PCR pmol/ ml. Purified products were sequenced on
Amplification and sequencing of 16S rRNA gene both strands on an AB 3730 DNA analyzer using
– the Big Dye terminator kit (Applied Biosystems,
The 16S rRNA was determined in National Center Inc. Foster City, CA). Internal primers used were
for Cell Sciences, University of Pune Campus, 16S-704F- 5’GTAGCGGTGAAATGCGTAGA3’;
Pune. Genomic DNA isolation of isolate was 16S-907R-5’ CCGTCAATTCMTTTGAGTTT3’;
carried using Qiagen DNA isolation kit as per 16S-355F-5’ GGCGGACGGGTGAGTAAT3. The
manufacturer’s instruction. Its presence was sequence was deposited to European
checked by running in agarose gel (0.8%) stained Bioinformatics Institute (EBI).
with ethidium bromide. Sequence was analyzed at the Ribosomal Database
Project (RDP-II) (http://rdp.cme.msu.edu/) for

_________________________________________________________________________________

closed homology. The sequences downloaded from lengths in the same units as those of the
the RDP II database were aligned by using evolutionary distances used to infer the
CLUSTAL X2 multiple sequence alignment tools. phylogenetic tree. The evolutionary distances were
The Phylogenetic tree was constructed by the computed using the Maximum Composite
neighbor joining method using Kimura-2- Likelihood method (Tamura et al., 2004) and were
parameter distances in MEGA 4.0 (Tamura et al., in the units of the number of base substitutions per
2007). site. Phylogenetic analyses were conducted in
f. Phylogenetic analysis and sequence MEGA4 (Tamura et al., 2004).
alignment
Initially the 16S rRNA gene sequence was III. Results
analyzed at NCBI server a. Screening and Identification of the
(http://www.ncbi.nlm.nih.gov) using BLAST isolate –
(blastn) tool and corresponding sequences of One isolate was selected and designated as AY-13
homologous species were downloaded and used for showing the zone of decolorization on nutrient agar
phylogenetic analysis. The evolutionary history containing 8.0% NaCl and 1500µg/ml dye. The
was inferred using neighbor joining method (Saitou isolate was gram negative, highly motile rod.
and Nei, 1987). The percentage of replicate trees in Colonies on nutrient agar containing 8.0% NaCl
which the associated taxa clustered together in the and dye were transparent and circular in shape. On
bootstrap test (1,000 replicates) was shown next to the basis of biochemical tests and 16S rRNA
the branches (Felsenstein, 1985).The phylogenetic analysis, the isolate was identified as Marinobacter
tree was linearized assuming equal evolutionary gudaonensis AY-13. The sequence was deposited in
rates in all lineages. The clock calibration to EBI with accession no. HE970768. Phylogenetic
convert distance to time was 0.01 (time/node tree was constructed using MEGA 4.0. (Figure I).
height). The tree was drawn to scale, with branch
99 EU496088 Marinobacter santorin

50 DQ325514 Marinobacter koreensi
56
EU047505 Marinobacter lacisals
59
DQ458821 Marinobacter pelagius
67 EF157832 Marinobacter segnicre
AY-13
12
97 DQ414419 Marinobacter gudaonen
AY517632 Marinobacter flavimar
44 EF486354 Marinobacter salicamp

51 AJ609271 Marinobacter bryozoor
93 AJ609270 Marinobacter sediminu

EF028328 Marinobacter salsugin
47 EU293413 Marinobacter zhejiang
97 EU293412 Marinobacter mobilis
EF660754 Marinobacter goseonge
AM503093 Marinobacter guineae
43
AY147906 Marinobacter lipolyti
37
52 DQ235263 Marinobacter vinifirm
84 AF479689 Marinobacter litorali
0.005
Figure 1 Phylogenic tree of Marinobacter joining analyses of 1,000 replicates. The scale bar
gudaonensis AY-13. Phylogenetic analysis of 16s (0.005) indicates the genetic distance.
rRNA gene sequence of Marinobacter gudaonensis b. Decolorization studies –
AY-13. The percent numbers at the nodes indicate
the levels of bootstrap support based on neighbor-

_________________________________________________________________________________

The decolorization capacity of a microorganism the dye in half (½) strength nutrient broth was
can be tested by examining its potential to degrade slightly less.
various dyes20. ii. Percent Decolorization in Cell Free
i. Decolorization studies in Nutrient Extract
Broth, Half (½) Strength Nutrient Broth Microbes can acclimatize themselves to toxic
The decolorization was conducted with the Acid wastes and new resistant strains develop naturally,
Yellow 25, supplemented with nutrient broth which can transform various toxic chemicals to less
having 8.0% NaCl and dye at 37oC. So as depicted harmful forms. The action of cell free extract of the
in Table 2, Marinobacter gudaonensis AY-13 Marinobacter gudaonensis AY-13 to decolorize the
showed the decolorization of the dye Acid Yellow dye Acid Yellow 25 was observed in nutrient
25 to a greater extent. Also the decolorization of medium containing 8.0% NaCl (Table 2).
Table 2 – Percent Decolorization in Nutrient Broth, Half (½) Strength Nutrient Broth, Cell Free Extract
by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max.
Culture COD
Code % Decolorization in Reduction
% Decolorization in
% Decolorization in Half Strength
cell-free extract
Nutrient Broth Nutrient Broth
70
92.00 90.03 80.13
AY-13
Percent Decolorization in presence of different 24 hours and observed for decolorization of the
Co-substrates- dye. Additionally, nutrient medium containing 1%
The isolate was inoculated in 20ml nutrient broth Starch and 1% Yeast extract with the same dye and
(Peptone – 1.0g, NaCl – 0.5g, Beef Extract – 0.3g, NaCl concentration were also used to test the
Distilled Water – 100ml,) containing 8.0% NaCl ability of the isolate AY-13 to decolorize the dye
concentration, 1500μg/ml concentration of dye and Acid Yellow-25.
1% Glucose. Tube was then incubated at 37oC for
Table 3 – Percent Decolorization in presence of Co-substrates viz. 1%Glucose, 1%Yeast Extract and 1%
Starch by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max.
Culture Code % Decolorization in
1% Glucose 1% Yeast Extract 1% strach
AY-13 92.77 94.00 92.05
Percent COD reduction The GCMS analysis report showed that the dye
To evaluate the level of biodegradation of Acid Acid Yellow 25 was degraded by Marinobacter
Yellow 25 by Marinobacter gudaonensis AY-13, gudaonensis AY-13 and not decolorized (Figure
we have determined the percentage of II). The molecular weights of the degraded
mineralization (represented by COD removal) by products are 98, 70, 112, 125, 140, 168, 186, 128,
measuring the initial and final organic content. 141, 83, 111, 154, 72 and 155 respectively. The
70% of COD was removed which is significant probable degradation pathway is depicted in
removal of COD was observed after a period of 24 Figure III which helps for the confirmation of the
hours. degradation of the dye Acid Yellow 25.
Confirmation of Biodegradation of dye
Figure II : GC-MS analysis report of the dye Acid Yellow 25 by Marinobacter gudaonensis AY-13
5606

2013
________________________________________________________________________________________

www.bo
orjournals.co
h Journals 40
5606

2013
________________________________________________________________________________________

Figure IIII Degradation

n Pathway off Acid Yellow
w 25 by the Prromising Isollate AY-13
www.bo
orjournals.co
h Journals 41

_________________________________________________________________________________

O
OH
NH S N N
O N
H 3C N
SO 3 Na
Acid Yellow 25
Molecular Formula = C22H24N5NaO6S2
Formula Weight = 541.575629
OH
O H 2N
NH S NH 2 N
H 3C N
O SO 3 Na
4-am ino-N-phenylcyclohexanesulfonam ide
sodium
Mol. wt.- 254
4-(4-am ino-5-hydroxy-3-m ethyl-1H-pyrazol-
1-yl)benzenesulfonate
Mol. wt.- 291
O
+
NH 2 S NH 2 OH
H 2N
O
aniline Mol. wt.- 162 NH
Mol. wt.- 93 H 3C SO 3 Na
N
4-am ino-3-m ethyl-1 sodium benzenesulfonate
H-pyrazol-5-ol Mol. wt.- 167
Mol. wt.- 113
NH 2
benzene cyclohexanam ine

Mol. wt.- 78 Mol. wt.- 99 H 2N SO 3 Na
Mol. wt.- 103
NH
H 3C N
3-m ethyl-1H-pyrazol-4 benzene
CH 2 -am ine Mol. wt.- 78 SO 3
CH 3 Mol. wt.- 97 Mol. wt.- 80
cyclohexane
(3Z)-penta-1,3-diene
Mol. wt.- 84
Mol. wt.- 68
H 2N CH 2
CH 3 H 3C NH
CH 2 3-im inobut-1-en-2-am ine
CH 3
Mol. wt.- 84
CH 2 pentane
Mol. wt.- 72
buta-1,3-diene
Mol. wt.- 54 H 2N CH 2
CH 3 H 3C
but-1-en-2-am ine
Mol. wt.- 71
CH 3
butane
Mol. wt.- 58 H 2N CH 2
H 3C
prop-1-en-2-am ine
Mol. wt.- 57

_________________________________________________________________________________

Discussion cleavage pathway to degrade mixtures of 3-

The Halomonas elongate decolorized and degraded chlorobenzoate and phenols (Babu et al., 1995).
all the 3 azo dyes (Reactive blue 81, Reactive Red Pseudomonas sp. CPE1 can completely mineralize
111 and Reactive yellow 44) efficiently (Pandu 4-Chlorobiphenyl via 4-chlorobenzoate. Some
and Compala, 2013). Guo et al., (2008) isolated compounds such as chlorobenzenes, chloroanilines
Halomonas strains from coastal sediments and polyaromatic hydrocarbons prevent microbial
contaminated by chemical wastewater. They degradation of dyes, as they get adsorbed to clay
showed that under high salt concentration the and organic matter (Puvaneswari et al., 2006).
isolated Halomonas sp. decolorized five azo dyes Similarly, Marinobacter gudaonensis AY-13 uses
in 24 hours with a decolorization above 90%. This ring cleavage pathway to degrade the dye Acid
results were very much similar with our results in Yellow 25.
which Marinobacter gudaonensis AY-13
decolorized the textile azo dye Acid Yellow 25 Conclusion
upto 92% in nutrient medium in 24 hours. Previous The present work focuses on the use of marine
studies have shown that the strains of Halomonas microorganism to remediate the environment
sp. isolated from textile industries effluents were contaminated by azo dyes, which are extensively
able to decolorize seven azo dyes- Remazol Black used in the textile industries. The presence of high
B, Remazol Black N, Sulfonyl Scarlet BNLE, salt content in the textile dye effluents hinders the
Sulfonyl Blue TLE, Maxilon Blue and Entrazol development of efficient bio-treatment system to
Blue IBC. The strains were identified as bioremediate the textile azo dyes. This imposes a
Halomonas aquamarina, Halomonas meridian, great need in developing bacterial strains that could
Halomonas salina (Asad et al., 2007). Halotolerant thrive under high salt conditions. Salterns or Solar
bacteria has been reported to decolorize textile azo salt crystallizer ponds contain hyper-saline waters
dyes (Khalid et al., 2008). The azo dyes are and the soil present there serves as a rich source of
degraded by bacteria using their extracellular marine microorganisms. The bacteria isolated from
hydrolytic and oxidative enzymes (Axelsson et al., such saline soil will definitely yield a good
2006; Wang et al., 2009). collection of halophilic and halotolerant bacterial
Due to acclimatization, this isolate was resistant to strains. Bioremediation has proved to be very
10,000ppm of dye concentration. Such similar effective method in countering the textile dye
findings were reported by Khehra et al., (2005). pollution in an eco-friendly way. This approach
Since the dyes are deficient in carbon source, it creates a promising hope to remediate the
seems necessary to supplement additional carbon environments polluted by textile azo dyes.
or nitrogen source to assist biodegradation of dyes The results presented here indicated that,
by the bacterial consortium (Senan and Abraham, the dye Acid Yellow 25 was biodegraded in 24
2004). Marinobacter gudaonensis AY-13 showed hours by the isolate AY-13 which was identified as
slight increase in decolorization when it was Marinobacter gudaonensis AY-13. The degradation
supplemented with different carbon and nitrogen of the dye was enhanced when 1% co-substrates
sources (co-substrates). Jadhav et al., (2010) were used as carbon and nitrogen source. Also the
pointed out that the presence of various carbon and intracellular enzymes showed the considerable
nitrogen sources in medium might have stimulatory amount of degradation of the dye. The isolate
or inhibitory effect on enzyme systems involved in reduced the COD of the dye to a much greater
the decolorization. The role of oxidoreductive extent proving it a good agent for bioremediation.
enzymes in the decolorization of sulfonated reactive So the isolate might play a possible role in
azo dyes have been characterized in Rhizobium bioremediation of the dye contaminated soil.
radiobacter MTCC 8161 (on Reactive Red 141),
and Pseudomonas sp. SUK1 on Reactive Red 2
(Kalyani et al., 2009; Telke et al., 2008). 70% of Acknowledgment
COD was removed by Marinobacter gudaonensis We would like to offer our sincere thanks to Staff
AY-13 which is significant removal of COD was of Indian Institute of Technology Powai, Mumbai
observed after a period of 24 hours. Moreover, the for GCMS analysis and National Center for Cell
COD removal efficiency is better than that reported Sciences, University of Pune Campus for the 16s
earlier (Kalyani et al., 2009), as a COD reduction rRNA sequencing of the isolate. Our sincere thanks
of 55.55 and 52% was observed for Reactive Blue to Principal, Shri Shivaji Mahavidyalaya, Barshi
172 by Exiguobacterium sp. RD3 and Reactive Red for providing the Laboratory facilities.
2 by Pseudomonas sp. SUK1, respectively. Mixed
cultures of Pseudomonas aeruginosa 3MT and References
Pseudomonas sp. CP4 uses ortho and meta ring [1] O. Khadijah, L.K.K. Mohd Faiz, and F.
Abdullah, “Isolation, screening and

_________________________________________________________________________________

development of local bacterial consortia with [13] I.M. Banat, P. Nigam, D. Singh, R. Marchant,
azo dyes decolourising capability,” Malaysian “Microbial decolorization of textile dye-
Journal of Microbiology, Vol. 5, pp. 25-32, containing effluents: a review,” Bioresour
2009. Technol., Vol. 58, pp. 217-227, 1996.
[2] A. Tripathi, S.K. Shrivastava, “Ecofriendly [14] J. Sambrook, E.F. Fritsch, T. Maniatis,
treatment of azo dyes – Biodecolorization “Molecular cloning: a laboratory manual, 2nd
using bacterial strains,” International Journal edn. Cold Spring Harbor Laboratory,” Cold
of Bioscience, Biochemistry and Spring Harbor, NY. 1989.
Bioinformatics., Vol.1, no.1, pp. 37 – 40, 2011. [15] K. Tamura, J. Dudley, M. Nei, S. Kumar,
[3] F. P. Van der Zee, S. Villaverde, “Combined “MEGA4: Molecular evolutionary genetics
anaerobic-aerobic treatment of azo dyes—A analysis (MEGA) software version 4.0,” Mol
short review of bioreactor studies,” Water Biol Evol, Vol. 24, pp. 1596–1599, 2007.
Research, Vol. 39, pp. 1425–1440, 2005. [16] N. Saitou, M. Nei, “The neighbor-joining
[4] P. Kaushik, A. Malik, “Fungal dye method: a new method for reconstructing
decolourization: Recent advances and future phylogenetic trees,” Mol Biol Evol, Vol. 4, pp.
potential,” Environment International, Vol. 35, 406–425, 1987.
pp. 127–141, 2009. [17] J. Felsenstein, “Confidence limits on
[5] E. Forgacs, T. Cserhati, G. Oros, “Removal phylogenies: an approach using the bootstrap,”
Of Synthetic Dyes From Wastewaters: A Evolution, Vol. 39, pp. 783–791, 1985.
Review,” Environ Int, Vol. 30, pp. 953-71, [18] K. Tamura, M. Nei, S. Kumar, “Prospects for
2004. inferring very large phylogenies by using the
[6] Mohandass Ramya, Bhaskar Anusha, S. neighbor-joining method,” Proc Natl Acad Sci
Kalavathy, S. Devilaksmi, “Biodecolorization USA, Vol. 101, pp. 11030–11035, 2004.
and biodegradation of Reactive Blue by [19] K. Tamura, J. Dudley, M. Nei, S. Kumar,
Aspergillus sp.,” African Journal of “MEGA4: Molecular evolutionary genetics
Biotechnology, Vol. 6, pp. 1441-1445, 2007. analysis (MEGA) software version 4.0,” Mol
[7] E. Forgacs, T. Cserhati, G. Oros, “Removal Of Biol Evol, Vol. 24, pp.1596–1599, 2007.
Synthetic Dyes From Wastewaters: A [20] R.C. Senan, T.E. Abraham, “Bioremediation of
Review,” Environ Int, Vol. 30, pp. 953-71, textile azo dyes by aerobic bacterial
2004. consortium,” Biodegradation, Vol. 15, pp.
[8] K. Jirasripongpun, R. Nasanit, J. Niruntasook, 275–280, 2004.
B. Chotikasatian, “Decolourization and [21] Pandu krishna and Compala Prabhakar.,
degradation of C. I. Reactive Red 195 by “Bioremediation of textile dyes and
Enterobacter sp. Thammasat,” International improvement of plant growth by marine
Journal of Science and Technology, Vol.12, bacteria,” Thesis submitted to University of
pp. 6–11, 2007. Boras. 2013
[9] U. Shedbalkar, R. Dhanve, J. Jadhav, [22] J. Guo, J. Zhou, D. Wang, J. Yang, “The new
“Biodegradation of Triphenylmethane Dye incorporation bio-treatment technology of
Cotton Blue By Penicillium Ochrochloron bromoamine acid and azo dyes wastewaters
MTCC 517,”Journal Of Hazardous Materials, under high-salt conditions,” Biodegradation,
Vol. 157, pp. 472–479, 2008. Vol. 19 no.1, pp. 93–98, 2008.
[10] K.P. Gopinath, H. A. M. Sahib, K. [23] S. Asad, M.A. Amoozegar, A.A. Pourbabaee,
Muthukumar, M. Velan, “Improved M.N. Sarbolouki, S.M.M. Dastgheib,
biodegradation of Congo red by Bacillus sp.,” “Decolorization of textile azo dyes by newly
Bioresource Technology, Vol. 100, pp. 670– isolated halophilic and halotolerant bacteria,”
675, 2009. Bioresource Technology, Vol. 98, pp. 2082-
[11] G. Mcmullan, C. Meehan, A. Conneely, N. 2088, 2007.
Kirby, T. Robinson, P. Nigam, I.M. Banat, R. [24] A. Khalid, M. Arshad, D.E. Crowley,
Marchant, W.F. Smyth, 2001 “Microbial “Accelerated decolorization of structurally
Decolourization And Degradation Of Textile different azo dyes by newly isolated bacterial
Dyes,” Appl Microbiol Biotechnol, Vol. 56, strains,” Applied Microbiology and
pp. 81–87, 2001. Biotechnology, Vol. 78, pp. 361-369, 2008.
[12] S. Y. An, S. K. Min, I. H. Cha, Y. L. Choi, Y. [25] J. Axelsson, U. Nilsson, E. Terrazas, T.
S. Cho, C. H. Kim, “Decolourization of Alvarez Aliaga, U. Welander, “Decolorization
triphenylmethane and azo dyes by Citrobacter of the textile dyes Reactive Red 2 and Reactive
sp.,” Biotechnology Letters, Vol. 24, pp. 1037– Blue 4 using Bjerkandera sp. Strain BOL 13 in
1040, 2002. a continuous rotating biological contactor

_________________________________________________________________________________

reactor,” Enzyme and Microbial Technology,

Vol. 39, pp. 32-37, 2006.
[26] H. Wang, J.Q. Su, X.W. Zheng, Y. Tian, X.J.
Xiong, T.L. Zheng, “Bacterial decolorization
and degradation of the reactive dye Reactive
Red 180 by Citrobacter sp. CK3,”
International Biodeterioration and
Biodegradation, Vol. 63, pp. 395-399, 2009.
[27] M. Khehra, H. Saini, D. Sharma, B. Chadha, S.
Chimni, “Decolorization of various azo dyes
by bacterial consortium,” Dyes Pigments., Vol.
67 no. 1, pp. 55–61, 2005.
[28] J.P. Jadhav, D.C. Kalyani, A.A. Telke, S.S.
Phugare, S.P. Govindwar, “Evaluation of the
efficiency of a bacterial consortium for the
removal of color, reduction of heavy metals,
and toxicity from textile dye effluent,”
Bioresour. Technol, Vol. 101, pp. 165–173,
2010.
[29] D.C. Kalyani, A.A. Telke, R. Dhanve, J.P.
Jadhav, “Ecofriendly biodegradation and
detoxification of Reactive Red 2 textile dye by
newly isolated Pseudomonas sp. SUK1,”J.
Hazard. Mater, Vol. 163, pp. 735–742, 2009.
[30] A. Telke, D. Kalyani, J. Jadhav, S. Govindwar,
“Kinetics and mechanism of Reactive Red 141
degradation by a bacterial isolate Rhizobium
radiobacter MTCC 8161,” Acta Chim Slov,
Vol. 55, pp. 320–329, 2008.
[31] K.S. Babu, P.V. Ajith-Kumar, A.A. Kunhi,
“Simultaneous degradation of 3-
chlorobenzoate and phenolic compounds by a
defined mixed culture of Pseudomonas spp.,”
World Journal of Microbiology and
Biotechnology, Vol. 11, pp. 148-152, 1995.
[32] N. Puvaneswari, J. Muthukrishnan, P.
Gunasekaran, “Toxicity assessment and
microbial degradation of azo dyes,” Indian J
Exp Biol, Vol. 44, pp. 618-626, 2006
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319-5606
_________________________________________________________________________________
Techno-Economic Analysis of a Mixed Grainage for the

Production of Multivoltine and Bivoltine Commercial
Seed Production in Karnataka (India)
B.S.Angadi, Central Silk Board, Bangalore, India
ABSTRACT
Consequent to the disappearance of Japan, USSR and Korea from the silk production scenario, the onus of
international grade raw silk production in massive scale and absorption of global demand lies on China and
India, which have emerged as leaders in the recent past. Indian sericulture is mostly is multivoltine oriented and
concentrated in the southern part, with conspicuous contribution from Karnataka state. Karnataka that enjoys
salubrious climatic conditions, is all set for accepting the challenge, but requires the active intervention of all
the stake holders for gearing up the production of international grade bivoltine raw silk in appreciable
quantities. This should begin from encouraging the existing grainages and enable them to produce the
proportionate quantities of both multivoltine and bivoltine disease free layings required y the industry. This
paper discusses the techno-economic feasibility of such facility for Karnatka state.
(Key words: Mixed Grainage, Techno-Economics, Multivoltine, Bivoltine, Commercial Seed)
hybrids and produced by using two or more

Introduction specific authorized pure races of silkworm and are
Significant changes have taken place in the global reared by the farmers for producing the reeling
silk industry. Considering the fact that the mighty cocoons. A mixed grainage is considered primarily
silk producers like Japan, USSR and Korea have to serve the demands of certain pockets where
virtually disappeared from the silk production rearing of both the combinations are practiced,
scenario, the onus of producing a large quantity of alternatively in the favourable and unfavourable
silk of international grade and meeting the demand seasons of the year. The ruling hybrids of
lies on India and China which have emerged as Karnataka are, Pure Mysore x CSR2, Pure Mysore
leading silk producing countries of the world in the x FC2 (Cross breeds: Reared throughout the year)
recent past. Any change that is intended to be made and CSR2 x CSR4, FC1 x FC2 (Bivoltine hybrids:
in the Indian silk industry needs initiation from Reared from July to February)
Karnataka state since its transformations will have
greater impact on the progress, owing to the fact Present Status
that it is currently contributing over 47% to the Grainages existing in Karnataka State can be
country’s production. In this direction efforts are classified as:
required at every level to set up facilities that a. Grainages established by Department of
improve efficiency, quality and productivity. Sericulture, Govt. of Karnataka.
Sericulture is an agro-industrial activity practiced b. Grainages established by Central Silk Board,
in over 10,795 villages of Karnataka and is spread functioning under National Silkworm Seed
over 62,697 hectares. Apart from the traditional Organisation.
sericulture districts of Karnataka like Kolar, c. Grainages established by Registered Seed
Bangalore, Ramanagaram, Mysore, Mandya, Producers (RSP’s) in the private sector.
Chamarajanagar and Tumkur, it is being actively The number of such grainages in operation and
encouraged in other districts through interventions their overall production for 2010-11 is presented
of various projects and programs envisaged by the in Table 1A.
governmental and non-governmental agencies from
time to time.
A grainage is such one facility where disease free Very meagre quantity of 9.52% dfls of bvioltine
and quality silkworm seeds are produced based on hybrid disease free layings were produced by all
scientific methods, to cater to the timely the above agencies together, while LSP’s have not
requirements of the farmers. Normally, grainages contributed naything. Contribution of the LSP’s
production for the overall production of the state is
to the extent of 64.55%, followed by the DOS
are established for production of either Cross Breed grainages (17.77%) and NSSO (17.67%).
or Bivoltine industrial seeds. Industrial seeds are

_________________________________________________________________________________
Technical Feasibility production is estimated at Rs 113.75 lakhs and after

It is evident from the estimates of past consumption considering the depreciation of the equipment’s
and the increased mulberry productivity per unit and the building, option ‘i’ leaves an operating
area coupled with the anticipated increase in the profit of Rs 4.15 lakhs on a sale of Rs 44.84 lakhs.
acreage under mulberry, the requirement of Under option ii, wherein it is proposed to hire a
silkworm seed will shoot up considerably. building for grainage operation and equip it newly
Especially the demand for bivoltine hybrids shall the non-recurring and recurring expenditures shall
be more to commensurate with the projected be Rs 41.19 lakhs and leaves an operating profit
production plan by the end of 12th plan. To fulfill of Rs 3.65 lakhs on a sale of Rs. 44.84 lakhs. Under
the projected target of 5000 M.T of gradable option iii, wherein it is proposed to take on lease a
bivoltine raw silk, we need to produce 595.00 lakh government building along with the equipment’s
bivoltine hybrids. The share of this shall be 190 the non-recurring and recurring expenditures shall
lakhs by CSB, 273 lakhs by DOS and 133 lakhs by be Rs 37.55 lakh and leaves an operating profit of
LSP grainages. Thus there exists a quite good Rs 4.49 lakhs on a sale of Rs. 44.84 lakhs.
demand for bivoltine commercial seeds in addition In view of the high initial investments under option
to the cross breeds. i, cost of project in an alternate scenario of rented
There is an abundant scope for establishment of a building and equipping it with the required
commercial grainage to produce 6.00 lakh cross equipments or taking grainage building on lease
breed and 4.00 lakh bivoltine hybrids per year. The basis along with the required equipments is
production of bivoltine hybrids can be restricted for economically feasible.
favorable months for ensuring the quality of dfls
produced. Breakeven production
At 80% capacity utilization, breakeven point is
Project cost achieved indicating a very low risk. A production
The total cost of the project based on the above of 4.80 lakh cross breed and 3.20 lakh bivoltine
considerations, is worked in three options; hybrids will ensure no- profit, no-loss situation.
i. Purchase of land, construction of grainage
building and equipping it newly costs around Rs References
113.75 lakhs and a recurring expenditure of Rs
36.00 lakhs per year. [1] Angadi.B.S and Dandin.S.B (2007).
Establishment of a mixed grainage for the
ii. Establishing grainage in a rented building by production of multivoltine and bivoltine
equipping it newly costs around Rs 18.25 lakhs commercial seed production in Karnataka. A
and a recurring expenditure of Rs 42.00 lakhs Project Profile submitted to Central Silk
per year Board, Bangalore.
Taking on lease a government building along with [2] Angadi. B.S. (2002). Commercial bivoltine
the equipments on a nominal lease amount of Rs seed production. Workshop on promotion of
10,000 per month will incur a recurring bivoltine sericulture technology under PPBST
expenditure of Rs 37.19 lakhs per year project 7-8 March 2002 Japan International
Cooperation Agency Central Sericultural
Working Capital Research & Training Institute. Mysore.
Considering the holding period of dfls and the cost [3] Dandin, S.B., Basavaraja, H.K., and
of seed cocoons an amount of Rs 3.00 lakh Sureshkumar, N. (2003). Factors for success of
working capital is required to run the mixed Indian sericulture Indian Silk, 41(9); 5-8.
grainage and this amount taken from any bank in [4] Jacob Thomas, M.N.S,Iyengar, B.S.Suligavi,
the form of loan attracts an interest rate of 12% per Y.S.Ramesha, G.Srinivasa, H.Jayaram,
annum which is also considered while calculating V,.S.Kulakarni and R.M.Mattigatti (1992).
the profitability. Role of credit in sericulture development.
Proceedings of the National Workshop on
Profitability and economic feasibility Credit to Sericulture, held on 22,23 May 1992
The profitability has been estimated at 100% at Central Silk Board, Bangalore.
capacity utilization from the very first year [5] Table 1A. Sector-wise grainages in Karnataka
onwards. The total cost of the project and and their productions

_________________________________________________________________________________
Category Number of Bivoltine F1 Cross breed F1 Total

Grainages production (lakh nos) production (lakh nos) production
(lakh nos)
Govt. of Karnataka 58 13.38 128.49 141.87
N.S.S.O (C.S.B) 6 62.63 78.46 141.09
Private 231 - 515.26 515.26
Table 2 : PROFITABILITY OF THE PROJECT (Option i)

Item Unit Rate Amount (lakh Rs)
A.Expenditure
1. Depreciation on building 50.00 lakh 5% 2.5

2. Depreciation on equipments 18.25 lakh 10% 1.83
3. Interest on working capital 3 12% 0.36
4. Recurring expenditure 36.00 lakh 100% 36
Total 40.69
B.Returns
1. Cost of CB dfls 6.00 lakh 350/100 dfls 21.00
2. Cost of Biv dfls 4.00 lakh 450/100 dfls 18.00
3. Cost MSC P.C 480 kgs 527/kg 2.53
4. Cost of BSC P.C 800 kgs 414/kg 3.31
Total 44.84
C. Profit/loss 4.15

_________________________________________________________________________________
Table 3 :PROFITABILITY OF THE PROJECT (Option ii)

A.Expenditure
1. Building rent 5000 sq.ft 25000/month 3.00

2. Depreciation on equipments 18.25 10% 1.83
4. Recurring expenditure 36 100% 36
Total 41.19
B.Returns

Total 44.84
C. Profit/loss 3.65
Table 4 : PROFITABILITY OF THE PROJECT (Option iii)

A.Expenditure
1. Lease amount - 10000/month 1.20
- - -
4. Recurring expenditure 35.99 100% 35.99
Total 37.55
B.Returns
Total 44.84
C. Profit/loss 4.49

5606

2013
________________________________________________________________________________________

C
Comparrative Sttudy off EMC Greenp
G plum an
nd Oracle
E
Exadata
a
Ektaa Rajput, Studennt ,Computer SScience , RKG
GITW, Ghaziabbad
Harshitaa Yadav, Stud
dent ,Computeer Science , RK
KGITW, Ghazziabad
Ayushi S
Singh, Student ,Computer Science
S , RKG
GITW, Ghaziabbad
ABSTR
RACT
Our papeer deals with the
t comparatiive study of tw wo databases namely
n EMC Greenplum
G annd Oracle Dattabase
.Greenpllum is a massiively parallel processing
p daatabase serverr that is designned to supportt the next geneeration of
data warrehousing andd large-scale analytics
a proceessing. Oraclee is the first database
d desiggned for enterpprise grid
computinng, the most flexible and cosst effective waay to manage information and a applications.Our paper focuses
on the eff
fficiency, compplexity and cappacity of bothh the databasees. It is believeed that this pap
aper is giving the
insight off pros and conns in both dataabases .
Keywordds: EMC; MPP P; database
1.Introduction capacity can be easily addded or realloccated from thee

As we knnow humans can c process daata, store it in their resource pooll as needed.[1]
minds annd use it whennever they neeed it, but whenn the 2.1 Oracle Exxadata Databaase Machine Architecture
A
data incrreases it becoomes difficult for a perso on to
memorize everything and be accuurate about it.. So, In the figuree below is a simplified scchematic of a
databasess were developed to mainntain big reco ords. typical Databbase Machine Half Rackk deployment.
The dataabases makess organizing and maintaiining Two Oracle Databases,
D one Real Appliccation Clusterss
long term
m data easier. (RAC) databbase deployeed across thhree databasee
With thee help of dataabase we can find the requ uired servers and one
o single- in nstance databbase deployedd
data andd use it acccordingly We W use diffe ferent on the remaiining databasee server in thhe Half Rack,
databasess for differentt types of dataa according too our are shown. (O Of course all four
f database servers could
d
prioritiess. The first daatabase was developed byy Dr. be used for a single fourr node RAC cluster.) Thee
Edgar Frrank Codd inn the year 1996. Few off the RAC databasse might be a production database and d
largest ddatabases in the world are a of Libraryy of the single-innstance databaase might bee for test and d
Congresss, CIA, Amazoon, Youtube, Google. development. Both databaases are shariing the seven.
Exadata cellss in the Half Rack but theyy would havee
There aare various types of databases
d nammely separate Orracle homess to maintaain softwaree
Relationaal Databases, Distributed Database,
D Parrallel independencee. All the componentts for thiss
Databasee, Active Dataabase, Mobilee Database, Back-
B configurationn – databasee servers, Exadata
E cells,
End Dataabase, Docum ment-Oriented Database. Inn this InfiniBand sw witches and other
o support hardware aree
paper we will take up comparision between two housed in thee Database Maachine rack[2]].
major daatabases undeer Relational Database thatt are
Oracle Exxadata and EM
MC Greenplum m.
2.Oraclle Exadata
An oraclle database is a collection of data treateed as
units. It is the first daatabase designned for enterpprise
grid commputing, the most
m flexible and cost effective
way to manage innformation and a applicattions.
Enterprisse grid compputing creates large poolls of
industry--standard, moddular storage and servers. With
W
this archhitecture, eachh new system m can be rap pidly
provisionned from the pool
p of compoonents. There is no Fig. 1. Oraclee Exadata dataabase Architeccture
need for ppeak workloaads because
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls
50
Journaal of Engineerring, Computeers & Applied
d Sciences (JEC
C&AS) ISSN No: 23
319‐5606

Volum
me 2, No.4, Ap pril 2013
_________________ ________________________ ___________________________________ _____________

2.1 Oraacle exadatta databasee features 3.1. MPP (M

Massively Paraallel Processin
ng)
Exadata smart scan
Improve query perforrmance by off ffloading intennsive
query proocessing and data mining scoring
s to scallable
intelligennt stogare serv
vers
Exadata smart flash cache
c
Transparrent cache ‘hoot’ read and write data to o fast
solid-statte storage,impproves query response
r timee and
throughpput.
InfiniBand network
Connect multiple Exaadata Database Machines usingu
the InfiniBand fabric to form a larrger single syystem
image coonfiguration. Each InfiniBand link provvides
40 Gigabbits of bandw width–many times
t higher than
traditionaal storage or server
s networkks
Petabytee scalability
Fig. 2. Massively Parrallel Proceessing
Easily sccale data warehhouse to suppport enterprise data
growth The figure abbove summarizes the core shared
s nothing
g
Exadata hybrid colum
mnar compreession MPP architeecture enablees massive data storage,
loading, andd processing g with unliimited linearr
Reduce the
t size of daata warehousiing tables by 10x, scalability. The core principle off the EMC C
and archhive tables by
y 50x, to impprove perform
mance Greenplum Database
D is to move thhe processing g
and loweer storage coosts for primaary, standby, and dramatically closer to thee data and itts users. Thiss
backup ddatabases. effectively enables
e the computational resources to o
process everyy query in a fuully parallel manner,
m use alll
3. EMC
C Greenplu
um storage conn nections simuultaneously, anda flow dataa
The Greeenplum Databbase builds onn the foundatioon of efficiently between
b resouurces as thee query plan n
open souurse databasee foundationss of open so ourse dictates.[4]
databaseP PostgreSQL It
I primarily fuunctions as a data
warehousse and utilizees a shared-nnothing, massiively
parallel processing (MPP) architecture. In this 3.2 EMC Greenplum
G m Architectu
ure.
architectuure, data is partitioned across mulltiple
segment servers, annd each seggment owns and Core Massivvely Parallel Processing
P Arrchitecture
manages a distinct porrtion of the ovverall data; theere is The Greenpplum Databaase architectuure providess
no disk--level sharingg nor data contention
c am
mong automatic parallelization of
o data andQuueries.All dataa
segmentss[3]. is automaticaally partitioneed across all nodes of thee
system, and queries are planned and exxecuted using g
all nodes woorking togetheer in a highlyy coordinatedd
fashion.
Petabyte-Scaale Loading
High-performmance loadingg uses MPP Scatter/Gather
S r
Streaming teechnology. Loading speedds scale with h
each additionnal node to grreater than 100 terabytes perr
hour, per rack
k.
Polymorphicc Data Storagge and Execu ution

Using Greeenplum’s Poolymorphic Data D storagee
technology, the DBA can selecctthe storagee
,execution, annd compressioon settings thaat suit the wayy
that table will be accessed..
Anywhere Data
D Access
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 51

_________________________________________________________________________________

Anywhere data access enables queries to be executed deduplication process to Greenplum Database
from the database against external data sources, servers, and enables them to send only unique data to
returning data in parallel regardless of location, the Data Domain system. This dramatically increases
format, or storage medium. aggregate throughput, reduces the amount of data
transferred over the network, and eliminates the need
In-Database Compression
for NFS mount management[5].
In-database compression uses industry-leading
compression technology to increase performance and Interoperatibility
dramatically reduce the space required to store data.
Indexes – B-Tree, Bitmap, and More
Multi-level Partitioning Greenplum Database supports a range of index types,
Flexible partitioning of tables is based on date, range, including B-Tree and Bitmap.
or value. Partitioning is specified using DDL and Client Access and Third-Party Tools
enables an arbitrary number of levels. The query Greenplum supports standard database
optimizer will automatically prune unneeded interfaces(PostgreSQL,SQL,ODBC,JDBC,OLEDB,
partitions from the query plan. etc.) and is fully supported and certified by a wide
Dynamic Partioning Elimination and Query range of business intelligence (BI) and
Memory Optimization extract/transform/load (ETL) tools
Greenplum Database supports dynamic partition Comprehensive SQL
elimination and query memory optimization. Greenplum Database offers comprehensive SQL-92
Dynamic Partition Elimination desregards irrelevant and SQL-99 support with SQL 2003 OLAP
partions in a table and allows for significant extensions and full support, including window
reduction in the amount of data scanned and results in functions, rollup, cube, and a wide range of other
faster query execution times. The query memory expressive functionality. All queries are parallelized
optimization feature intelligently frees and reallocates and executed across the entire system.
memory to different operators during query XML Support
processing, allowing for better memory utilzation, Greenplum Database provides support for XML, it
higher throughput, and higher concurrency. enables high-performance, support for XML data
type, parallel load of XMLdocuments into the
3.2 EMC Greenplum Features database and the XML Path language (xpath)
High Availability,Backup and Disaster
Recovery
Self-Healing Fault tolerance:
Traditional MPP fault tolerance techniques were
suitable for environment havin less than 100 servers.
Greenplum’s fault-tolerance capabilities provide
intelligent fault detection and fast online differential
recovery, it lowers TCO and enabling cloud-scale
systems with the highest levels of availability.
Post-Recovery Online Segment Rebalancing
After segment recovery, the EMC Greenplum
Database segments can be rebalanced while the
system is online. There is no downtime and all client
sessions remain connected . The database remain
functional while the system is recovered back into an
optimal state.

Simpler, Scalable Backup with Data Domain
Boost
Greenplum Databse includes integration with EMC
Data Domain deduplication storage systems via
EMCDataDomain Boost for faster, more efficient
backup. This integration distributes parts of the

_________________________________________________________________________________

4. Comparison
Table 1. Comparison Table
Characterstics EMC Greenplum Oracle Exadata
Pipelines Smaller Bigger
Data Loading Fastest data loading, virtual private cloud Comparatively slower
infrastructer for datawarehouse & analytics.
Total Servers 18 22
Downtime No downtime Takes days for new exadata database

machine to be installed.
Data Sharing Parallel Storage, if one storage fails then only Shared Storage, if one storage fails
the defected part suffers. entire system suffers.
Total Cores 192 264
Cost Low Cost High Cost
Performance High Performance Low Performance
Capacity (TB) 36 TB 45TB
External Database No ability to connect to external database. It can connect to external database.
Normalization No Replication Replication
Total Scan rate 24 GB/Sec 100 GB/Sec
Modularity Dependency on physical infrastructure when No dependency

performing backup.
Load (TB/hr) -10 TB/hr -12 TB/hr
Largest Multi-Rack 24 racks 8 racks

Configuration
5. Conclusion areas. This paper is not to draw any conclusion

The paper has widely covered various characteristics regarding which one is superior.
of both the databases. EMC’s Greenplum can load 6.References
data faster as compared to oracle but oracle has better
scan rate. Where capacity of EMC Greenplum is [1]http://docs.oracle.com/cd/B19306_01/server.102/b
36TB that of Oracle exadata is 45TB. Oracle was the 14220/intro.htm
first database whereas Greenplum has been designed [2]http://www.oracle.com/technetwork/database/exad
for nextgen data. Both the databases are efficient. ata/exadata-technical-whitepaper-134575.pdf
Oracle is old and has been developed whereas
Greenplum being new still needs to explore a lot of

_________________________________________________________________________________

[3]http://www.greenplum.com/sites/default/files/201 m/sites/default/files/2012_0614_GPDB_DS.pdf&ei=
2_0614_GPDB_DS.pdf ocxbUam0AsnTrQegk4H4BQ&usg=AFQjCNElmp-
uyHtlz6VKAIpyNQBfD_90Iw&bvm=bv.44697112,d
[4]www.google.co.in/url?sa=t&rct=j&q=greenplum+
.bmk
database+architecture&source=web&cd=4&cad=rja
[5]http://www.greenplum.com/sites/default/files/201
&ved=0CEEQFjAD&url=http://www.greenplum.co
2_0614_GPDB_DS.pdf

_________________________________________________________________________________

Comparative Study of 1G, 2G, 3G and 4G

Sapna Shukla, Student, Electronics and Communication, RKGITW, Ghaziabad

Varsha Khare, Student, Electronics and Communication, RKGITW, Ghaziabad
Shubhanshi Garg, Student, Electronics and Communication, RKGITW, Ghaziabad
Paramanand Sharma, Assistant Professor, Electronics and Communication, RKGITW, Ghaziabad
ABSTRACT
Mobile communication is continuously one of the hottest areas that are developing at a booming speed, with
advanced techniques emerging in all the fields of mobile and wireless communications. This paper deals with
the comparative study of wireless cellular technologies namely First Generation, Second Generation, Third
Generation, and Fourth Generation. A cellular network or mobile network is a radio network distributed over
land areas called cells, each served by at least one fixed-location transceiver, known as a cell site or base
station. In a cellular network, each cell uses a different set of frequencies from neighbouring cells, to avoid
interference and provide guaranteed bandwidth within each cell. The First Generation were referred to as
cellular, which was later shortened to "cell", Cell phone signals were based on analog system transmissions,
and First Generation devices were comparatively less heavy and expensive. Second Generation phones deploy
GSM technology. Global System for Mobile communications or GSM uses digital modulation to improve voice
quality but the network offers limited data service. The Third Generation revolution allowed mobile telephone
customers to use audio, graphics and video applications. Fourth Generation is short for fourth-generation cell
phones or/and hand held devices.
Keywords— Cellular network, First Generation, Second Generation, Third Generation, and Fourth Generation

1. INTRODUCTION  Possibility, according to the historical indication of

The past few years have witnessed a phenomenal a generation revolution once a decade, and now we
growth in the wireless industry, both in terms of are near the end of 3G standardization phase and
mobile technology and subscribers. The first- the beginning of 3G deployment.
generation mobile systems were the analogue (or  Necessity: according to 3G goals, 3G is necessary
semi-analogue) systems, which came in the early but not sufficient to the mobile communication
1980s - they were also called NMT (Nordic Mobile strategy, in which many problems are only partly
Telephone). They offered mainly speech and solved and there are still many problems left to be
related services and were highly incompatible with solved in the next generation, i.e. 4G [1-3].
each other. 1G refers to analog cellular This paper is organized as follows. Section II
technologies; it became available in the 1980s. 2G provides a brief review of the development history
denotes initial digital systems, introducing services and status of mobile communications. From first
such as short messaging and lower speed data. generation of cellular networks how mobile
CDMA2000 1xRTT and GSM are the primary 2G industry has grown till fourth generation.
technologies, although CDMA2000 1xRTT is Description of First, Second, Third and Fourth
sometimes called a 3G technology because it meets generation. Section III portrays a comparison
the 144 kbps mobile throughput requirement. between all the four generation. Section IV gives
EDGE, however, also meets this requirement. 2G the conclusion of the paper and also about the
technologies became available in the 1990s. 3G future prospects of the paper.
requirements were specified by the ITU as part of
the International Mobile Telephone 2000 (IMT- 2. EVOLUTION OF MOBILE CELLULAR
2000) project, for which digital networks had to NETWORKS
provide 144 kbps of throughput at mobile speeds, A cellular network or mobile network is a radio
384 kbps at pedestrian speeds, and 2 Mbps in network distributed over land areas called cells,
indoor environments [5]. UMTS-HSPA and each served by at least one fixed-location
CDMA2000 EV-DO are the primary 3G transceiver, known as a cell site or base station. In
technologies, although recently WiMAX was also a cellular network, each cell uses a different set of
designated as an official 3G technology [5]. The frequencies from neighbouring cells, to avoid
present time is just right to start the research of 4G interference and provide guaranteed bandwidth
mobile communications because of: within each cell. When joined together these cells
5606

2013
________________________________________________________________________________________

provide radio coverage over a wide w geographhic fixxed transceivers and teleph hones anywhere in the
area. This
T enables a large number of neetwork, via base
b stations, even if som
me of the
portablettransceivers (ee.g., mobile phones, pageers, traansceivers aree moving thro
ough more thaan one cell
etc.) to communicatee with each other and with w duuring transmisssion.
FIGU
URE I: EVOL
LUTION OF MOBLIE
M CEL
LLULAR N
NETWORKS[
[7]
2.1 FIRST GEN NERATION thhese calls suscceptible to unw

wanted eaves dropping
The firrst generatiion of wiireless mobbile byy third parties.
communiications was based on annalog signallin ng. With the inntroduction off 1G phones, thhe mobile
Analog ssystems, impllemented in North N Americca, m
market showedd annual grow wth rate of 30 to 50 per
were known as Anaalog Mobile Phone System ms ceent, rising to nearly 20 million
m subsccribers by
(AMPS),, while systeems implemennted in Euro ope 19990.
and the rrest of the worrld was typicaally identified as
a variattion of Tottal Access Communicatiion
Systems (TACS). Analog systems were primarrily
based onn circuit-switchhed technologgy and design ned
for voicee, not data. Rooaming was notn possible anda
the efficient use of frequency
f speectrum was not n
possible. 1G referss to the first-generatiion
of wireleess telephone technology,
t m
mobile telecommm
unicationns. These a
are
the analoog telecommunnications stanndards that weere
introduceed in the 1980s and continnued until beiing
replaced by 2G digital telecommuniications.
The main
m differennce between two succeediing
mobile teelephone systtems, 1G andd 2G, is that the t FIGURE II: NOKIA 650 1G MOBILE
E PHONE
radio siggnals that 1G G networks useu are analo og,
while 2G G networks are digital. 1G- 1 technoloogy 2..2 Second Generation
G n
replaced 0G technoloogy, which featured
f mobbile Thhe second geeneration, 2G system, fieldded in the
radio teleephones and such technoloogies as Mobbile laate 1980s and d finished in n the late 19990s, was
Telephonne System (MTS), Advvanced Mobbile pllanned mainlyy for voice tra ansmission wiith digital
Telephonne System (AMTS),( Im
mproved Mobbile siggnal and the speeds up too 64kbps. 2G G wireless
Telephonne Service (IMTS),
( and Push to Taalk ceellular mobilee services waas a step aheead of 1G
(PTT). . Through 1G,, a voice call gets modulatted seervices by prooviding the faacility of shortt message
to a higheer frequency ofo about 150MMHz and up ass it seervice(SMS) unlike
u 1G thatt had its primee focus on
is transm
mitted betweenn radio towerrs. This is do one veerbal communnication. The bandwidth
b off 2G is 30-
using a technique called Freqquency-Divisiion 2000 KHz. Durinng the secondd generation, the t mobile
Multiple Access (FDM MA). But itsi fail in som me teelecommunications inddustry exp
xperienced
field suchh as in terms of overall connnection qualiity, exxponential grrowth in term ms of both suubscribers
1G comppares unfavourrably to its annd value-addeed services. InI the early 1990s,
1 2G
phhones deplooying GSM M technologgy were
successorrs. It has low capacity, unrreliable handooff, inntroduced. Global Syystem for Mobile
poor voicce links, and no security att all since voiice coommunicationns or GSM usees digital moddulation to
calls werre played baack in radio towers, makiing immprove voice quality
q but thee network offeers limited
www.bo
om Blue Ocea
5606

2013
________________________________________________________________________________________

data serrvice. As dem mand drove uptake of cell c As the requireement for sen
A nding data onn the air-
phones, 2G carrierrs continuedd to improove innterface increaased, new eleements such as SGSN
transmisssion quality an nd coverage. The 2G carrieers (SServing GPRS S) and GGSN (Gateway GP PRS) were
also beggan to offer additional
a seervices, such as addded to the exxisting GSM system.
s Thesee elements
paging, ffaxes, text messages
m and voicemail. TheT m
made it possibble to send packet
p data onn the air-
limited data
d servicess under 2G included WA AP, innterface. This part of the network hanndling the
HSCSD and a MLS.An intermediary
i p
phase, 2.5G was
w a called thee 'packet core network'.
paacket data is also
introduceed in the latte 1990s. It uses the GPR RS Inn addition too the SGSN and GGSN N, it also
standardd, which dellivers packett-switched daata coontains the IPP routers, fireewall servers and DNS
capabilitties to existin ng GSM netw works. It allows (ddomain namee servers). This T enables wireless
users to send graphiccs-rich data as a packets. The
T acccess to the Internet
I and thhe bit rate reeaching to
importannce for packett-switching inccreased with the t 1550 kbps in opttimum conditiions.
rise of the Internet andd the Internet Protocol,
P or IP.
I
In the miid-1980s the European
E com
mmission startted  G
GSM and ED DGE (Enhaanced Data rates for
a seriees of actiivities to liberalise the t gllobal evolution):
communiications seector, incluuding mobbile W
With both voice and data traffic movinng on the
communiications. Thiss resulted in the creation of syystem, the neeed was felt too increase the data rate.
ETSI, which
w inheritted all the standardisatiion Thhis was done by using morre sophisticateed coding
activitiess in Europe. This
T saw the birth
b of the fiirst m
methods over the
t Internet anda thus increeasing the
specificaations, and thhe network bbased on digiital daata rate up to 384 kbpps. EDGE/EGPRS is
technologgy; it was caalled the Gloobal System for f immplemented as a bolt-on
b enhhancement
Mobile C Communicatioon or GSM. Since the fiirst foor 2.5G GSM//GPRS netwoorks, making it easier
networkss appeared at the beginningg of 1991, GS SM foor existing GS
SM carriers to upgrade to it.. EDGE is
has graduually evolved d to meet the requirements of a superset to GPRS and can functionn on any
data trafffic and manny more serrvices than the t neetwork with GPRS
G deployyed on it, proovided the
original nnetworks. caarrier implemments the neceessary upgradde. EDGE
 GSM (Global System for Mobbile caan carry a banndwidth up to o 236 kbit/s (with
( end-
Commun nication): too-end latency of
o less than 1550 ms) for 4 timeslot in
The maiin elements of o this system m are the BSS paacket mode. This
T means it can handle ffour times
(Base Sttation Subsysttem), in whicch there are the t ass much traffic as standard GPRS.
G
BTS (Baase Tran receiiver Station) and BSC (Baase
Station Controllers); and the NSS N (Netwo ork
Switchinng Subsystem)), in which thhere is the MS SC
(Mobile Switching Ceentre); VLR (V Visitor Locatiion
Register)); HLR (Hom me Location Register); AC A
(Authenttication Centtre), and EIIR (Equipmeent
Identity Register) Thhis network is capable of
providingg all the basicc services such as speech and a
data servvices up to 9.6 kbps, fax, etc. This GS SM
network also has an a extension to the fix xed
telephonyy networks.
 GSM an nd VAS (Valu ue Added Servvices):
The nextt advancementt in the GSM system was the t
addition of two plaatforms, calleed Voice Mail M
System (VMS) and the Short Message M Serviice F
FIGURE III: 2G
2 TECHNOL
LOGY
Centre (SMSC). Th he SMSC proved to be
incredibly commerciaally successfuul, so much so GSM technolog
G gy is a combbination of Frequency
F
that in soome networks the SMS trafffic constitutes a D
Division Multtiple Access (FDMA) and a Time
major paart of the total traffic. Alongg with the VA AS, D
Division Multip
iple Access (T
TDMA). The first
f GSM
IN (Intellligent servicees) also made its mark in the t syystems used a 25MHz freqquency spectruum in the
GSM syystem, with its i advantagee of giving the t 9000MHz band d. FDMA is used to divide d the
operatorss the chance too create a whoole range of neew avvailable 25M
MHz of bandw width into 1224 carrier
services. Fraud manag gement and 'prre-paid' servicces frrequencies off 200 kHz each. Each freqquency is
are the reesult of the IN
N service. thhen divided using
u a TDM MA scheme into
i eight
 GSM aand GPRS (General Packet Raddio timmeslots. Thee use of seeparate timeeslots for
Services)): trransmission and recep ption simplififies the
ellectronics in the mobile units. Todaay, GSM
www.bo
om Blue Ocea
5606

2013
________________________________________________________________________________________

systems ooperate in thee 900MHz andd 1.8 GHz bannds exxisting GSM and TDMA networks. Woorking on
throughoout the worldd with the exxception of the
t thhe basis of em
mails, it sendss text and grapphics-rich
Americass where they operate
o in the 1.9 GHz band
d daata as pack kets at very fast speedd. EDGE
teechnology is a standard thaat has been sppecified to
2.3 Gen
neration orr 2G+ Wireeless ennhance the throughput
t p
per timeslot for both
Networrk H
HSCSD and GPRS. Althhough GPR RS is an
The virtuual explosion of Internet usage
u has hadd a exxtension to thhe radio access network, iit requires
tremendoous Impact on the demannd for advancced w
whole new paccket based IP data links, serrvers, and
wireless data communnication servicces. The mobbile gaateways in thhe core netwoork. Thus GP PRS adds
technologgy using geeneral packett radio serviice seeveral new components
c besides channging the
(GPRS) standard has been termedd as 2.5G. 2.5 5G exxisting GSM oro TDMA netw work
systems enhance the data capacityy of GSM and a
mitigate some of its limitations
l thhe effective daata
rate of 2G circuit-sw witched wirelless systems is
relativelyy slow -- too slow
s for todayy's Internet. As a
result, GSM, PDC andd other TDMA-based mobbile
system pproviders and carriers have developed 2G G+
technologgy that is paccket-based annd increases the t
data commmunication speeds to as high h as 384kbp ps.
These 2G G+ systems are based onn the followiing
technologgies: High Sp peed Circuit--Switched Da ata
(HSCSD D), General Packet Radio R Serviice
(GPRS) and Enhancced Data Raates for Glob bal
Evolutioon (EDGE) technologies.
HSCSD is one step toowards 3G wideband

w mobbile
data netw works. This circuit-switchhed technoloogy
improvess the data rates up too 57.6kbps by
introduciing 14.4 kbbps data cooding and by
aggregatiing 4 radio channels tim meslots of 14 4.4 FIIGURE IV: SIIEMENS S577 2.5G PRS PHONE
kbps.GPR RS adds paccket-switched capabilities to
FIGURE V: GPRS
G NETW
WORK [9]
Mobile Station:
S The MS
M includes radio
r equipmeent seeparate module called SIM M (Subscribeer Identity
and the Man Machiine Interface (MMI) thatt a M
Module)).
subscribee needs in order
o to acceess the servicces Base Transceiiver System (BTS): Thee physical
providedd by the GSM.. The MS is a combination of annd radio transm
mission interfface between ssubscriber
terminal equipmentt (called ME (Mobbile station and the BSC are prov vided by the BTS. The
Equipmeent)) and sub bscriber dataa (stored in a raadio equipmennt’s that are reequired to serrvice each
www.bo
om Blue Ocea

_________________________________________________________________________________

cell in the network are components of the BTS. wireless networks and sell mobile services to end-
Cells are the logical divisions in the Radio users, usually on a monthly subscription basis.
transmission coverage. BTS controls each cell in a Mobile service providers use licensed spectrum to
network, and in turn, one BSC controls a group of provide wireless telephone coverage over some
BTSs. It takes care of Air interface signalling, Air relatively large contiguous geographic serving area.
interface ciphering and speech processing. Historically, this might have included a
Base Station Controller (BSC): The management metropolitan area. Today it may include the entire
of several Base Transceiver Stations (BTS) is done country. From a user’s perspective, the key feature
by the BSC. It also provides all the control of mobile service is that it offers (near) ubiquitous
functions and physical links among the different and continuous coverage that is, a consumer can
BTS and between the switching center (SC) and the carry on a telephone conversation while driving
BTS’s. Being a high-capacity switch, it provides along a highway at 100Km/hour. To support this
functions such as cell configuration data, and service, mobile operators maintain a network of
control of radio frequency power levels in BTS. interconnected and overlapping mobile base
One SC serves a number of BSCs stations that hand-off customers as those customers
Base Station Subsystem (BSS): BSS is the point move among adjacent cells. Each mobile base
where all radio transmission related functions are station may support users up to several kilometres
performed. The BSS is composed of the BSC and away. The cell towers are connected to each other
the BTS. by a backhaul network that also provides
Home Location Register (HLR): All the interconnection to the wire line Public Switched
administrative information related to each Telecommunications Network (PSTN) and other
subscriber registered in the respective services. The mobile system operator owns the
communication network, including the current end-to-end network from the base stations to the
location of the subscriber, is contained in the HLR backhaul network to the point of interconnection to
Visitor Location Register (VLR): The VLR is a the PSTN (and, perhaps, parts thereof). These can
database containing all the temporary information support data rates of from 384Kbps up to 2Mbps,
about the subscribers. This information is needed although most commercial deployments are
by the MSC to service the visiting subscribers. expected to offer data rates closer to 100Kbps in
Equipment Identity Register (EIR): The EIR is a practice. While this is substantially below the rates
database containing a list of all the valid mobile supported by the current generation of wire line
subscriber stations on the network. broadband access services such as DSL or cable
modems, it is expected that future upgrades to
2.3 Third Generation the3G or the transition to 4G mobile services will
The third generation mobile technology based on offer substantially higher bandwidths. Although
wide band wireless network fulfilling the wire line systems are likely to always exceed the
International Mobile Telecommunications-2000 capacity of wireless ones, it remains unclear
(IMT-2000) specifications by the International precisely how much bandwidth will be demanded
Telecommunication Union. As per the IMT-2000 by the typical consumer and whether 3G services
standards, a system is required to provide peak data will offer enough to meet the needs of most
rates of at least 200 Kbit/s. 3G functions in the consumers. Auctions for 3G spectrum licenses
range of 2100 Hz and bandwidth 15-20 MHz The occurred in a number of countries in 2000 and the
communication provides enhanced clarity and first commercial offerings of 3G services began in
perfection like the real conversation. Recent 3G Japan in October 2001. More recently, Verizon
releases provide mobile broadband access of Wireless has announced "3G" service in portions of
several M bit/s to smart phones and mobile its serving territory (though this is not true-3G
modems in laptop computers. The first release of service). 3G offers much narrower bandwidth but
(Third Generation Partnership Project) 3GPP Long over a wider calling area and with more support for
Term Evolution (LTE) standard completely fulfil rapid movement between base stations.
the (International Telecommunications Union) ITU The IMT-2000 framework sets the following goals
4G requirements called the IMT-Advanced. 4G or for the so called 3G wireless systems:
3.9G technology is the first release LTE. Its  Global standards to allow for low cost and
evolution LTE Advanced is a 4G technology. worldwide roaming.
3G offers a vertically- integrated, top-down,  High Quality of Service (QoS) especially for
service-provider approach to delivering wireless voice.
Internet access. 3G is a technology for mobile  Support for advanced services: Multimedia,
service providers. Mobile services are provided by Bandwidth on Demand, High speed data.
service providers that own and operate their own
5606

2013
________________________________________________________________________________________

 Flexibiility for evoluution allowinng for backwaard  Sigtran (SCTTP, M3UA): protocols suitte used to
compaatibility and too cope with anny future markket transfer SCN
N signaling prootocols over IP
P network
disconttinuity.
 Multi-eenvironment capabilities.
c
 Compaatibility of serrvices with fixxed networks.
 In building/Private Systems
S Integration.
FIGURE E VII: 3G TEC

CHNOLOGY
The folllowing is a brief description of eaach FIIGURE VIII: 3G NETWOR
RKS [8]
protocool layer in a 3G wirreless netwo ork
infrastrructure:
2.4 F
Fourth Generation:
 Globall Mobility Managem ment (GMM M): 4GG (or 4-G) is short for fourth-generaation cell
protocool that includdes attach, detach,
d securiity, phhones or/and hand held deevices. It is a wireless
and rouuting area upddate functionaality. acccess technoloogy. It will be the successsor of 3G.
 Node B Application Part (NB BAP): providdes Cuurrently we are a undergoin ng a transitionn between
proceddures for pagging distribuution, broadcast 2GG and 3G which w is also
o known as 2.5G. 2 4G
systemm informatioon and managementm of m
mobile commu unications will
w have trannsmission
dedicatted and logicaal resources raates up to
 Radio Link Controol (RLC): proovides a logiccal 200 Mbps higher than of 3G G. When It is still to
link coontrol over thee radio interfacce. esstimate as to how many number n of peoople have
 Mediu um Access Control
C (MAC C): controls the
t m
moved on from
m 2G to 3G , teechnology hass come up
access signaling (reequest and grrant) procedurres w the latest of its type namely
with n 4G.A successor
for the radio channel. off 2G and 3G, 4G promisess a downloadding speed
off 100Mbps. Then with the case oof Fourth
 Radio resource Coontrol (RRC C): manages the t
G
Generation thaat is 4G in addition
a to thhat of the
allocattion and maintenancee of raddio
seervices of 3G G some additional featuress such as
commuunication path hs.
M
Multi-Media N
Newspapers, also to waatch T.V
 Radio Access Netw work Appliccation Protoccol
prrograms with the clarity ass to that of ann ordinary
(RANA AP): encapsuulates higher layer signalin ng.
T.V. In additio on, we can send
s Data muuch faster
Managges the signaaling and GT TP connectioons
thhan that of the previous generations.
betweeen RNC and 3G-SGSN,
3 annd signaling and
a
Currently 2.5G
2 provides WAP and allso access
circuit--switched connnections betw ween RNC and a
too the internet from a mobiile phone, butt the data
3G MS SC.
raate is a big ressistance to thee developmentt of better
 Radioo Network Service Application Paart feeatures. We will
w definitely see s very high data rates
(RNSA AP): providess the communnication betweeen inn 4G phones. 802.15, commonly c k
known as
RNCs. Bluetooth is veery popular thhese days. Currrently the
 GPRS Tunnel Prootocol (GTP)): protocol thhat coonnectivity beetween wired and wireless devices is
tunnelss the protoco ol data units through the IP biit painful as thhe vendors aree reluctant in providing
backboone by addin ng routing infformation. GT TP a bridge betweeen both the teechnologies. B But I think
operatees on top of TCP/UDP overr IP. inn 4G we wou uld definitelyy see a changge in this
 Mobilee Applicatio on Part (M MAP): suppoorts atttitude as it wiill be very eassy to transfer huge files
signaling between SGSN N/GGSN and
a orr other data frrom a PC to wireless
w devicces. Email
HLR/A AuC/EIR. m
messages, coontacts, rem mainders, etc e will
 AAL2 Signaling (Q Q.2630.1, Q.21150.1, Q.21500.2, syynchronize in no time and thus t giving moore power
AAL2 SSSAR, and AAL2 CPS):: protocols suuite too the users. It is easy to t say, basedd on the
used too transfer voicce over ATM backbone usiing deeveloping trennds of mobile communicaation, that
ATM aadaptation layyer 2. 4GG will have broader
b width, higher data rate,
bandw
www.bo
om Blue Ocea
5606

2013
________________________________________________________________________________________

smootherr and quickerr handoff, widder mobile areea, innterfaces, incllude e.g. vission, hearingg, speech,
more varrious service, lower
l cost, etcc. toouch sense, haands and fingeers, body, etc.
Terminal Diversity an nd Adaptabillity: The
teerminals’ exterrnal diversitiees are the diffeerences of
teerminals in botth static and mobile
m attribuutes. Static
atttributes incluude e.g. functtionality, weiight, size,
baattery life, hu uman interfacce, antenna, processing
p
caapability, seccurity, style, and cost.. Mobile
atttributes incllude dynamic attributes of both
teemporal and sp patial featuress.
Network Diversity
D annd Adaptabillity: The
exxternal diversity of networrks is obviouss. Internet
is assorted by nature,
n while wireless
w netwworks keep
thhe same propeerty. For instaance air interrfaces can
inntegrate all kinds
k of staandards and work on
diifferent frequeencies. Moreo over, multiple operators
deeploy networrks with muultiple standdards and
prrotocols. The internal diverrsity of networrks means
thhat one netw work can intterconnect with w other
diifferent netwoorks and trannsfer various kinds of
looads, e.g. celluular systems with
w various cooverage.
FIGURE E IX: 4G FRAM MEWORK NETWORK[3]
N ]
User Divversity: The ex xternal diverssity of users, i.e.
i 3. C
Comparison
n Between 1G, 2G, 3G AND
people inn different situuations, includes e.g. cultuure,
educationnal backgrouund, econom mic capabiliity,
4G
G
Here Table I. summarises
H s thhe comparisonn between
physical property, peersonal preferrence, etc. The T
1G
G, 2G, 3G andd 4G.
internal ddiversity of ussers, i.e. peoplle with differeent
www.bo
om Blue Ocea
5606

2013
________________________________________________________________________________________

TABLE II: COMPARISON OF 1G, 2G, 3G AND

D 4G[3]
Conclu
usion
The last few years hav ve witnessed the phenomennal veersions of HT TML, Java, GIF,
G HTTP, and
a many
growth of wireless generations. There is evver more. New stan
m ndards will neeed to be deveeloped for
increasinng demands off the cellular networks whiich usse in 4G.
motivatedd the researchhers and indusstrialists to comme 5G technology has channged the meaans to use
up witth fourth generation (4G) mobbile ceell phones witthin very high bandwidth. User
U never
communiication and further more m with 5G 5 exxperienced ever
e before such a higgh value
technologgy.. As the t historyy of mobbile teechnology. No owadays mobbile users haave much
communiications show ws, many attem mpts have beeen awwareness of the
t cell phonee (mobile) technology.
made to reduce a nuumber of Tecchnologies too a Thhe 5G techno ologies includde all type of advanced
single gllobal standard d. The first generation
g (1G) feeatures whicch makes 5G 5 technology most
has fulfillled the basicc mobile voicce using anallog poowerful and in huge dem mand in near future.5G
techniquees, while the second geneeration (2G) has h A
Although updatted standards that define caapabilities
introduceed capacity and coveragee using digiital beeyond those defined
d in thee current 4G standards
techniquees. This is followed by the third generatiion arre under consiideration, those new capabbilities are
(3G), whhich has questt for data at higher
h speeds to still being grou
uped under thee current 4G standards.
s
open thee gates for truly “mobbile broadban nd” N mobile geenerations are typically assiigned new
New
experiencce, which will be further realized by the t frequency band ds and wider spectral banddwidth per
fourth generation (4G G). 4G will provide better- frequency chan nnel (1G up too 30 kHz, 2G up to 200
than-TV quality imaages and viideo-links. The T kH Hz, 3G up to 5 MHz, and 4G 4 up to 40 MHz),
M but
communiications modeel has new devveloped
www.bo
om Blue Ocea

_________________________________________________________________________________

the main issue that there is little room for new Department of Informatics Engineering of the
frequency bands or larger channel bandwidths. University of Coimbra, Portugal 2004.
[6] Kamarularifin Abd Jalil, Mohd Hanafi Abd.
References Latif, Mohamad Noorman Masrek, “Looking Into
[1] F. Williams, Ericsson, “Fourth generation The 4G Features”, MASAUM Journal of Basic and
mobile,” in ACTS Mobile Summit99, Sorrento, Applied Sciences Vol.1, No. 2 September 2009.
Italy, June 1999. [7] Amit Kumar, Dr. Yunfei Liu ,Dr. Jyotsna
[2] H. Huomo, Nokia, “Fourth generation mobile,” Sengupta, Divya, “Evolution of Mobile Wireless
in ACTS Mobile Summit99, Sorrento, Italy, June Communication Networks 1G to 4G”, International
1999. Journal of Electronics & Communication
[3] Jun-Zhao Sun, Jaakko Sauvola, and Douglas Technology, IJECT Vol. 1, Issue 1, Dece- mber
Howie, “Features in Future: 4G Visions From a 2010.
Technical Perspective,”in IEEE, 2001. [8] Mobile Technology: Evolution from 1G to 4G,
[4] Mishra, Ajay K. “Fundamentals of Cellular Electronics for You, June 2003.
Network Planning and Optimization, [9] Third Generation (3G) Wireless White Paper,
2G/2.5G/3G…Evolution of 4G”, John Wiley and Trillium Digital Systems, Inc. March 2000.
Sons, 2004. [10] Nabeel ur Rehman, Asad Asif,Junaid Iqbal,
[5] Pereira, Vasco & Sousa, Tiago. “Evolution of “3G Mobile Communication Networks”,in Explore
Mobile Communications: from 1G to 4G”, Summer 2006.

_________________________________________________________________________________

A Novel Application for Android Based Handheld Devices

Somya, Student, Information Technology, RKGITW, Ghaziabad, India
Reetika Joshi, Student, Information Technology, RKGITW, Ghaziabad, India
Shaffali Aggarwal, Student, Information Technology, RKGITW, Ghaziabad, India
ABSTRACT
In modern era when populations increasing exponentially, chances of colliding to uneven situations are also
increasing. In such situation we have to take some decision and human intelligence is the key of finding out the
solutions and creating a socio technical environment to find out the solutions in easy steps. The motive of the
solution methods should observe, analyze and prevent such hazardous and critical occurrences. The proposed
work provides an android mobile application which provides help to a victim to recover from such critical
situation by getting frequent help on time.
Keywords: Voice Recognition, Patterns, Artificial Intelligence, Criticpal, Machine Learning, NLP.
1.Introduction contracted to fast. The resultants are too small size

As we all know that crime rate is increasing day by of chips. Then the evolution done with the storages,
day. Every minute something wrong is happening storages become very small in size with high
in the world such as accidents, sudden attacks, capacity of storing data. In the next generation the
theft, rape etc. but these all crimes have one thing communication system become faster the data rate
in common that it takes so much time to get cured, become faster, we can connect anywhere and
as police comes 1 hour after when incident took anytime to anyone in the world through internet
place.Then after 30 to 40 minutes ambulance used with its speed. The previous evolutions have their
to come. While all these happening, victim or significant role to make things possible in this way.
injured person or people sometimes died. Processors become faster. The forthcoming
In any conventional way of providing the help on generation will be all about machine and its
time to people in their hard times, we provide that intelligence. To making a system such a powerful
help by utilizing resources available around us as that it can imitate the human being. Artificial
soon as possible, it is needed for them to have Intelligence is an answer.
helping hand around them in such critical Artificial Intelligence is a branch of Science which
situations. But in such cases the most important deals with helping machines find solutions to
issue arises is help reaches to a victim very late. It complex problems in a more human-like fashion
may be either useful or just all in vain. [2]. This generally involves borrowing
Suppose someone face snatching in a lone area of characteristics from human intelligence, and
the city. He wants help as soon as possible. Either applying them as algorithms in a computer friendly
he calls police to complain for the accident way. A more or less flexible or efficient approach
happened to him or he calls his kith n kins for help. can be taken depending on the requirements
But all of them need to know the exact location of established, which influences how artificial the
the victim to rescue him. A lot of problem still intelligent behavior appears. Unlike humans,
remains as prior situations. So dealing with such computers have trouble understanding specific
cases for a victim is a very crucial matter. situations, and adapting to new situations. Artificial
Human intelligence is the key of solutions, in a Intelligence aims to improve machine behavior in
way of finding the solution we act rationally with tackling such complex tasks. Humans have an
those situations we face. Then make decisions to interesting approach to problem-solving, based on
get maximum output. Our experiences become abstract thought, high-level deliberative reasoning
knowledge, knowledge gives intelligence. A good and pattern recognition. Artificial Intelligence can
solution shows how intelligent you are. Human help us understand this process by recreating it,
being have certain limitations like tiredness, will then potentially enabling us to enhance it beyond
power, laziness, low calculation powers, uneven our current capabilities.
commonsense and many more. So there is always There are many subfields of Artificial Intelligence
a need of robust systems. but we can focus here some of them closely related
to our work.
 Pattern recognition
2. Need Of Artificial Intelligence
 Natural Language Processing
Some time ago there was the evolution in
microchips and integrated circuits, the evolution  Machine learning
process really followed the moor’s law and  Knowledge and Representation etc.

_________________________________________________________________________________

As we know that AI is a very vast field to be dealt. digitized voice input. These similarities will be
It consists of various other verticals and further present for a wide range of speakers, and so the
those verticals are also not limited to a specific system need not be trained by each new user. The
area. Given basic elements of Artificial types of speech differences that the speaker-
Intelligence has used here to create a gross view of independent method can deal with, but which
the application development. As Voice Recognition pattern matching would fail to handle, include
system is the key factor, which we are using in our accents, and varying speed of delivery, pitch,
proposed work, is an application of Pattern volume, and inflection. Speaker-independent
Recognition. speech recognition has proven to be very difficult,
with some of the greatest hurdles being the variety
2.1 Voice Recognition of accents and inflections used by speakers of
Voice recognition is the process of taking the different nationalities. Recognition accuracy for
spoken word as an input to a computer program. speaker-independent systems is somewhat less than
This process is important to virtual reality because for speaker-dependent systems, usually between 90
it provides a fairly natural and intuitive way of and 95 percent.
controlling the simulation while allowing the user's Voice Recognition alternatively called Speech
hands to remain free. Voice recognition is "the recognition. It implies various algorithms for its
technology by which sounds, words or phrases various applications. It is the basic need of our
spoken by humans are converted into electrical proposed work.
signals, and these signals are transformed into
coding patterns to which meaning has been 3.Proposed Work
assigned". While the concept could more generally The project aims at providing the help or
be called "sound recognition", we focus here on the immediate service to the people who unfortunately
human voice because we most often and most falls into the critical situations such as fatal
naturally use our voices to communicate our ideas accidents, sudden attack or theft. This application
to others in our immediate surroundings. The helps the people through their mobile phones by
difficulty in using voice as an input to a computer remaining in the running state in their phones.
simulation lies in the fundamental differences Whenever this application hears the cry of the user,
between human speech and the more traditional it rushly sends text messages of user’s current GPS
forms of computer input. While computer programs location to the already registered numbers and not
are commonly designed to produce a precise and only message, it also make calls on those numbers
well-defined response upon receiving the proper one by one. So that the happening fatal situation
(and equally precise) input, the human voice and can be cured or we can stop the things becoming
spoken words are anything but precise [3]. Each worst.
human voice is different, and identical words can It is an application based on android and voice
have different meanings if spoken with different recognition system which treats you in your bad
inflections or in different contexts. Several times. This bad time could be anything such as
approaches have been tried, with varying degrees accident, any attack while going on the road, theft,
of success, to overcome these difficulties. robbery etc. One has to just register it his mobile
phone. And it starts working from the minute user
2.1.1 Approaches to Voice Recognition installs it.
The most common approaches to voice recognition Currently there is no such system which can
can be divided into two classes: "template provide immediate help like this. Or we can say
matching" and "feature analysis". Template that the manual way is the existing system. Manual
matching is the simplest technique and has the way means calling police and relatives of the
highest accuracy when used properly, but it also victim, hours after the incident happened.
suffers from the most limitations.
A more general form of voice recognition is
available through feature analysis and this
technique usually leads to "speaker-independent"
voice recognition. Instead of trying to find an exact
or near-exact match between the actual voice input
and a previously stored voice template, this method
first processes the voice input using "Fourier
transforms" or "linear predictive coding (LPC)",
then attempts to find characteristic similarities
between the expected inputs and the actual
5606

2013
________________________________________________________________________________________

Fig.1. Ovverview of Working

W
Fig. 2 Work Flow of

o The System
m
3.1 Advvantages off the system

m inn the world such as accidents, suddenn attacks,
This appllication providdes better scoope to reduce the
t thheft, rape etc. but these all crimes have one thing
crime ratte upto some extent.
e It incluudes: inn common thaat it takes so much
m time to get
g cured,
ass police comees 1 hour afteer when inciident took
[1] First-Aid: Thhis application serve user by pllace. Then aftter 30 to 40 min
m ambulancce used to
providingg immediate help
h wheneverr required. coome. While alll these happeening, victim or injured
[2] Quick n Easyy: Not so mucch to do for thhis peerson or peop ple sometimees died. Criticc-pal is a
help, onlly to PRESS A BUTTON N and your GP PS soolution to this problem up tot some extennts. Critic-
location will be sent to your friendds and relativves paal is an appllication whichh would be your real
mobile phhone. friend in your critical situattions. We jusst have to
[3] Reliable: onne can rely on this applicatiion prress a button and we get immediate
i hellp. Critic-
as no inteernet connectiion is requiredd. paal immediatelly send the usser’s current loocation to
[4] User Friend dly Interfacce: User can
c thhe registered phone
p numbeers and also make
m calls
update hiis informationn, which is reegistered on thhis onn those numbeers one after another.
a
applicatioon, whenever he wants.
5..References
As it iss an androidd application so it will be [11] Cheng O, O Abdulla W, and Salcic S Z.
applicablle in android phones
p only. “HHardware–Sofftware Codeesign of AutomaticA
User shouuld have his phone
p in hands, as he needss to Sppeech Recognnition System m for Embeddded Real-
press buttton to make use
u of this appplication. Tiime Applicaations”, IEE EE Transacttions on
Inndustrial Electtronics, Volumme: 58. (2002)
4.Futurre Works And
A Conclu
usion [22] Stuart R, Peter N, Arttificial Intelliigence: A
As we all know that crrime rate is inncreasing day by M
Modern Approa ach (2nd Editiion) (2011)
day. Eveery minute something wronng is happeniing [33] Liu X, Zh hao Y, Liangg L. and Neffian A.V.
"AAudio-visual continuous
c sppeech recognittion using
www.bo
orjournals.co
om Blue Ocean Research JJournals 66

_________________________________________________________________________________

a coupled hidden Markov model", in Proc. [8] Lewis, T. W. and D. M. W. Powers., “Audio-
INTERSPEECH. (2002) Visual Speech Recognition using Red Exclusion
[4] Marschark M, LePoutre, D, and Bement L.; and Neural Networks,” Journal of Research and
“Mouth movement and signed communication,” In Practice In Information Technology, Vol. 35(1).
Campbell R., Dodd B, and Burnham D. (Eds.), (2003)
Hearing by Eye II. Hove, United Kingdom: [9] The NIST Speaker Recognition Evaluation
Psychology Press Ltd. Publishers, pp. 245–266. Plan:
(1998) http://www.nist.gov/speech/tests/spk/2006/sre06_e
[5] Lynn W, Francine C, Kimber D, and valplan-v9.pdf (2006)
Balasubmnianzan V. “Segmentation of speech [10] Poli G, Levada A, Mari J. And Saito J. H.
using speaker identification”, ICASSP-94,1161- “Voice Command Recognition with Dynamic Time
1164. (2003) Warping (DTW) using Graphics Processing Units
[6] Zhou P, An exploration of Voice-over-IP using (GPU) with Compute Unified Device Architecture
Ruby. In Proceedings of the Workshop on Optimal (CUDA)”, 19th International Symposium on
Epistemologies. (1964) Computer Architecture and High Performance
[7] Cawsey A, The Essence of Artificial Computing, 19-25. (2007)
Intelligence Prentice Hall ISBN: 0135717795
(1998)

_________________________________________________________________________________

Dual Watermarking For High Protective Copyright

System
Sagar R Dhole, Student,Computer Department,Sinhgad Institute of Technology,Lonavala
Rahul S.Shahane, Student,Computer Department,Sinhgad Institute of Technology,Lonavala
KrishnaV.Varat, Student,Computer Department,Sinhgad Institute of Technology,Lonavala
Ganesh N.Falake, Student,Computer Department,Sinhgad Institute of Technology,Lonavala
ABSTRACT
Dual Watermarking is used forcopyright protection and authentication. In theproposed system, a Dual
Watermarking Schemebased on BPCS and Alpha Channel maskingalgorithm, will be developed to improve
therobustness and protection along with security.Our project implemented the BPCS (Bit Plane Complexity
Segmentation) technique to embed data into bitmap files. The ultimate goal is to embed as much data as
possible into a cover image without detection by human perception or statistical analysis. Our first attempt to
implement this hiding technique was on 8-bit grayscale images as our cover object. After accomplishing that
version, we manipulated it into a second version that was also capable of using 24-bit color images.First outline
the BPCS embedding and extraction technique for grayscale images and explain the subtle differences in the
color version. It will also compare and contrast the results of embedding data at different thresholds and
capacities for both grayscale and color images.
KeyWords: Dwt,watermarking,bpcs,alpha channel masking
security measure. Digital watermarking is not a

Introduction form of steganography, in which data is hidden in
the message without the end user's knowledge,
“A digital watermark is a digital signal or pattern although somewatermarking techniques have the
inserted into a digital document such as text, steganographic feature of not being perceivable by
graphics or multimedia, and carries information the human eye[1][6].
unique to the copyright owner, the creator of the The enormous popularity of the World Wide Web
document or the authorized consumer[1].” in the early 1990's demonstrated the commercial
potential of offering multimedia resources through
Digital Watermarking is used for copyright
the digital networks. Since commercial interests
protection and authentication. In the proposed
seek to use the digital networks to offer digital
system, a Dual Watermarking Scheme based on
media for profit, they have a strong interest in
BPCS Algorithm and Alpha Channel
protecting their ownership rights. Digital
/Transparency Channel Masking Algorithm will be watermarking has been proposed as one way to
developed to improve the robustness and protection accomplish this.
along with security[2]. Two watermarks will be
embedded in the host image. The secondary is Proposed system
embedded into primary watermark and the resultant A digital watermark is a digital signature or pattern
watermarked image can then be transmitted over a inserted into digital image. Since the signal or
non secure channel. This provides an efficient and pattern is present in each unaltered copy of original
secure way for image security and transmission. image, the digital watermark may also serve as a
The watermarked image is decrypted and a reliable digital signature for the copies. A given watermark
watermark extraction scheme can be developed for may be unique to each copy (e.g, to identify the
the extraction of the primary as well as secondary intended recipients), or be common to multiple
watermark from the image. copies. In either case, the watermarking of the
document involves the transformation of the
Existing System original into another form. This distinguishes
Digital watermarking is a technique which allows digital watermarking from digital fingerprinting
an individual to add hidden copyright notices or where the original file remains intact, but another
other verification messages to digital audio, video, file is created that "describes" the original file's
or image signals and documents. Such hidden content.
message is a group of bits describing information where the original file remains intact, but another
pertaining to the signal or to the author of the file is created that "describes" the original file's
signal (name, place, etc.). The technique takes its content.
name from watermarking of paper or money as a
Journal off Engineering,, Computers & 5606

2013
________________________________________________________________________________________

C. Primary Enccryption Usingg BPCS

D Alpha Channnel Masking
D.
E. Watermark Verification
V
A Image Bit Plane
A. P Decomp
position
1)) The carrier image
i is dividded into 8 diffferent Bit-
Pllanes. All thee bit-planes are
a divided into small
piieces of the same
s size, wh hich is called bit-plane
bllocks, such as 8 × 8[2].
2)) Calculate thhe complexityy of every bllock. The
coomplexity is defined as the t amount ofo all the
addjacent pixels that get diffe
ferent values ( onepixel
is 0, and the other
o is 1. The
T maximum m possible
vaalue of the com
mplexity is deenoted as maxx C .
3)) Setting the complexity
c thrreshold of thee bit-plane
bllock is max C, here α is a parameter. Thee bit-plane
bllock whose complexity
c is larger than maxm C is
ussed to embed secret inform mation. The sm maller the
vaalue of the more secrett informationn can be
em
mbedded[2].
4)) Secret info ormation is formed into bit-plane
bllocks. The bit-plane block can
c replace thhe original
onne straightly if
i its complexxity is greater than max
C. Yet, it need d to take conjjugate processsing with
thhe checkerbooard pattern block(as sshown in
Fiigure1) if the complexity is i less than orr equal to
m C, than tak
max ke the new bloock replace thhe original
onne.
Fig.1 Systeem Flow Diaggram 5)) Make a recorrd of the blockks that have taaken
coonjugate proceessing and this information also
neeed to be embedded into thee carrier. The
1) Primaary Waterma
ark emmbedding of thhis extra inforrmation cannoot
Primary watermark shall contain the author and a prroduce effect ono the embedd ded secrets, annd it must
copyrighht informatio on of the image. Thhis bee correctly piccked up.The process
p of secrret
mbedded on orriginal image so
informatiion will be em innformation exttraction is sim
mple. Firstly, pick
p up all
that an image shall always carryy its copyrigght thhe pieces of th
he carrier data whose compllexity is
informatiion with it. We
W shall achhieve this usiing grreater than maax C, and thenn pick up the extra
e
BPCS Steganography[[4]. emmbedded inforrmation mentiioned in step (5) ( to
coonfirm the bloocks that have taken conjugaate
prrocessing. Theese blocks neeed take XOR operation
o
ndary Waterm
2) Secon mark w tessellated
with d chock to get the recovery of secret.
We will use intermeediate image data (grayscaale

componeent of the inteermediate imaage) itself as the
t
data to be watermaarked on thhe intermediaate
image[1]. This data will
w help us deetermine if theere
is any modification orr damage donee to the originnal
image annd also reconnstruct the orriginal image to
some exttent. We shall do this usingg Alpha Channnel
/ Transpaarency Channeel masking.
Modulees
A. Imagee Bit Plane Deecomposition
B. TGA IImage Generaation (BMP, P
PNG to TGA)
www.bo
orjournals.co
om Blue Occean Researcch Journals 69
5606

2013
________________________________________________________________________________________

baackground-collor only pixeels, and the group of

fooreground-bacckground blen nded color piixels. The
bllending factorrs for the pixeels in the last group are
m
modified to em mbed each bit b of a wateermarking
paattern. Becausse the modifieed pixels beloong to the
arrea around ann image edge, change to thhe original
im
mage due to o watermarkk embeddingg is less
peerceptible.
E.VERIFICAT
TION
We can verify the watermarkk using this module.
W m In
thhis module we
w can veriffy the attackk of any
annonymous useer if he/she dam
mage the origginal data
We can see thee modification
W n also and wee claim on
thhe unauthorizeed user for dam
maging the daata.
Experimentaal Results An
nd Analysis
Thhe length off the black-aand-white borrder in a
Fiig.2 Image Bitt Plane Decom
mposition biinary image is a good measure foor image
coomplexity. Iff the border is long, the image is
coomplex, otherw wise it is sim
mple. The totall length of
B. TGA
A Image Generation (BM
MP, PNG TO
T
thhe black-andd-white border equals to the
TGA)
suummation of the number of o color-changes along
We are cconverting thee image into TGA
T format for
f thhe rows and co olumns in an image. For example, a
the betteer security because
b TGA A image cannnot sinngle black pixxel surrounded by white baackground
modify eeasily and thhe image is ofo 32 bit so it piixels has the boarder
b length
h of 4.
contains alpha channeel also so we are convert the
t W will define the image com
We mplexity αby the
image intto TGA formaat. foollowing.
C. Primaary Encryptioon Using Bpccs α=
= k
The max. possible B W chaanges in the imaage… (1)
The BPC CS steganograaphy providess a high hidiing
capacity because the more
m significaant bit planes are
a
used to hhide the messsage. It also provides
p a low
wer Where, k is the total length of
W o black-and-wwhite
perceptibbility of thee hidden message
m in the
t boorder in the im
mage. So, the value
v ranges over
o
stegoimaage, because only sufficiently compllex 0 ≤α≤1. … (2)
blocks aare replacedd by secret message, and a
generallyy, these bloocks have a lower visuual (11) is defined globally,
g i.e., αis
α calculated over the
sensibilitty for Human Visual System S (HVS). whole image arrea. It gives uss the global coomplexity
w
Howeverr, although thee BPCS stegannography show ws off a binary imaage.
excellentt properties, reegarding hidinng capacity and
a H
However, we caan also use αffor a local imaage
impercepptibility, it can
c be vulnnerable to the t
extractionn of the hiddeen message, dued to its spattial g., an 8 ×8 pix
coomplexity (e.g xel-size area).. We will
domain ddata hiding reaalization.
usse such αas ouur local
D. Alphaa Channel Masking
coomplexity meaasure in this paper[2].
p
A method for embedd ding a digital watermark onnto
a host im
mage’s alpha chhannel is desccribed. Blendiing
Overall, the results wentt fairly as expected.
O
factors wwhich form an a alpha channnel define the t
proportioon of foregroound and bacckground coloors Inncreasing the threshold att which bit planesare
deetermined to be
b complex deecreased the em mbedding
which inn turn are commbined to ressult in an actu ual
caapacity, butt also deccreased theddistortion.
color forr each pixel. Here, the blending
b facto
ors
corresponnding to areaas along edgges in the hoost Em mbedding att full capacity (based upon u the
t image inccludingevery bit plane
thhreshold) of the
image is of interest. The host imagee is first divid
ded
into bloccks of subim mages[7]. A dominant ed dge prroved to add distortion
d (althhough typicallly
found in any subimage is used to divide
d the pixels worse at lowerr thresholds)b
w because the hhigher bit
on that block into three groups:the group of pllanes are visuaally much lesss tolerant to chhange.
foregrounnd- color only
o pixels, the group of
www.bo
orjournals.co
om Blue Occean Researcch Journals 70

_________________________________________________________________________________

An interesting observation is that grayscale images References

had a slight advantage over the colorimages in the
sense that only grayscale values could be changed [1] Dual Watermarking Scheme with Encryption
as opposed to acombination of values for each Proceedings of the Int. Conf. on Information
color plane. When pushed to higher limits, the Science and Applications ICISA 2010 Chennai,
grayscaleimages could look altered compared to the India. 6 February 2010.
original, but still appear unaltered without [2] Wu J, Zhang R eta. Reliable Detection of BPCS
comparison to the original. In color images, when Steganography[J].Journal of Beijing University of
pushing the limits of threshold andcapacity, Posts and Telecommunications, 2009, 32(4): 113-
noticeable color distortions occurred that clearly 121
indicated some kind of changeto the original [3] Mussarat Abdullah,and Fazal Wahab “Key
image. Based Text Watermarking of E-Text Documents in
an object based Environment using Z-axis for
Conclusion
Watermark Embedding”,world academy of engg
This paper deals with dual watermarking scheme, and technology 46,2008
which includes encryption, to improve rightful
[4] Cl.Song, S.Sudirman and M.Merabti, “A
ownership, protection and robustness.
Spatial and Frequency Domain Analysis of the
First generation of copyright marking schemes is Effect of Removal Attacks on Digital Image
not strong enough. Existing schemes provide only Watermarks”, Proc 11th of PostGraduate Network
limited measures of marking.Can only meet few Symposium, 119-124, June, 2010.
requirements at a time.
[5] Mohamed Saehab,ElisaBertino,ArifGhafoor
For the extraction of watermark, a reliable “Watermarking Relational Databases Using
watermark decryption scheme and an extraction Optimization-Based Techniques” 2011
scheme is constructed for both primary and
[6] Copyright Protection of Online Application
secondary watermark. Robustness of this method is
using Watermarking,march 2011
carried out by variety of attacks.
[7] “Alpha Channel Digital Image Watermarking
Method.”NataponPantuwong and
NoppornChotikakamthornICSP2008 Proceedings.

_________________________________________________________________________________

To Identify Disease Treatment Relationship in Short Text

Using Machine Learning & Natural Language Processing
Khan Razik, Student, Computer Department, Sinhgad Institute of Technology, Lonavala
Dhande Mayur, Student, Computer Department, Sinhgad Institute of Technology, Lonavala
Patil Aniket, Student, Computer Department, Sinhgad Institute of Technology, Lonavala
Gaikwad Namrata, Student, Computer Department, Sinhgad Institute of Technology, Lonavala
ABSTRACT
Due to advancements in medical domain automatic learning has gained popularity in the fields of medical
decision support, extraction of medical knowledge and complete health management. Using Machine
Learning(hereafter, ML) and Natural language Processing(hereafter, NLP) we can make the healthcare field
more efficient and reliable. This paper describes how ML and NLP can be used for extracting knowledge from
published medical papers. It extracts the sentences that mention diseases and treatments and identifies the
relationship between them
Kewwords: Automatic Learning, Medical Decision Support, Machine Learning, Natural Language processing,
Healthcare.
identify and eliminate uninformative sentences and

Introduction then second is to classify the rest of the sentences
People are more concerned about their health than by the relation of interest. By this a substantial
ever before. In spite of their busy schedules they improvement is shown getting the information
want each and everything to go in a good flow.
People want Fast access to reliable information and 2 Related Work
in a manner that is suitable to their habits and Entity recognition for Diseases and Treatments--
workflow. Medical field has grown to such an The most relevant work is done by Rosario and
extent that the people practicing medicine should Hearst[2].It uses Hidden Markov Models and
not only have experience but also information maximum entropy models to perform both the task
about latest discoveries. Electronic Health of entity recognition and the relation
Record(hereafter, EHR) is becoming a standard in discrimination. Their representation techniques are
healthcare domain. Websites such as Google based on words in context, part of speech
Health[9] and Microsoft Health Vault[10] make information, phrases, and a medical lexical
people to care deeply about their health. Having an ontology—Mesh terms[13].The task of relation
extraction or relation identification is previously
EHR has the following benefits[11]: done by (Craven, [3])with a focus on biomedical
1. Rapid access to information that is focused on taks, gene disorder association(Ray and Craven,
certain topics such as immunizations, drugs [4]) and diseases and drugs(Shrinivasan and
etc. Rindflesch, [5]).
2. To have quality medical data for taking proper
medical decisions. For this purpose we need a Rule-based approaches
better, more efficient and reliable access to It has been widely used for solving relation
information. extraction tasks. The main sources of information
According to researches people are searching the used by this technique are either syntactic: part-of-
web in order to be informed regularly about their speech (POS) and syntactic structures; or semantic
health. In medical domain the most used source of information in the form of fixed patterns that
information is MEDLINE[12]. MEDLINE is contain words that trigger a certain relation. The
database where all the research discoveries come best rule-based systems are the ones that use rules
and enter at a high rate. Due to the busy schedules constructed manually or semi automatically—
the experts don't get time to read millions of extracted automatically and refined manually. A
articles therefore there is a need to build a tool that positive aspect of rule-based systems is the fact that
will suffice the purpose. they obtain good precision results, while the recall
Our objective is to work with ML and NLP is levels tend to be low. They tend to require more
that the task of identifying and disseminating human-expert effort than data-driven methods
reliable healthcare information becomes easy and (though human effort is needed in data-driven
beneficial for the people. A hierarchical approach is methods too, to label the data).
used for performing the two tasks: The first is to
5606

2013
________________________________________________________________________________________

Syntacttic rule-basedd relation exttraction system ms annd Side Efffect, becausee these are of most
are compplex systems based
b on addittional tools ussed immportance. Appplying task1 first followedd by task2
to assignn POS tags or o to extract syntactic parrse giives far bettter results thhan applying machine
trees. It iis known thatt in the biommedical literatuure leearning directtly to the conntent.This appproach is
such toolls are not yet at the state-off-the-art level as beetter becau use uninform mative data can be
they are for general English textss, and therefoore coonsidered as potential
p data if
i not filtered((task1).
their perrformance on sentences is not always the t
best(Bunnescu et al. [6]).
3 Prop
posed Apprroach
3.1 Tassk
The workk that we preesent in this paper
p is focussed
on two ttasks: automaatically identiifying sentencces
publishedd in medical abstracts (Medline) as
containinng or not infoformation aboout diseases and a
treatmentts, and autommatically identtifying semanntic Fig 1.Architecture Of th
he Proposed System
S
relations that existt between diseases and a
treatmentts, as expressed in these teexts. The secoond 3..2 Algorithms
A U
UsedAs classsification
task is foocused on thrree semantic R Relations: Cuure, allgorithms, wee use a set of six repreesentative
Prevent, and Side Effeect. m
models: decisiion-based mo odels (Decisioon trees),
The prroblems addressed in this paper form the t prrobabilistic models
m (Naı¨¨ve Bayes (NB) ( and
building blocks of a frramework thatt can be used by Complement Naı¨ve N Bayees (CNB), which w is
healthcarre providers (ee.g., private cllinics, hospitaals, addapted for text withh imbalanceed class
medical ddoctors, etc.), or laypeople who want to be diistribution), adaptive
a learnning (Ada- B Boost), a
in chargee of their heaalth by readinng the latest lifel linnear classifieer (support vector machinne (SVM)
science published
p articcles related too their interessts. w
with polynomial kernel), and a classsifier that
The finall product cann be envisioneed as a browsser allways predictss the majorityy class in thee training
plug-in or a desk ktop applicattion that will w daata (used as a baseline). We W decided to use these
automaticcally find annd extract thee latest mediccal cllassifiers becaause they are representativve for the
discoveriies related too disease-treaatment relatioons leearning algorithms in thee literature and a were
and preseent them to thet user. The product can be shhown to work k well on bothh short and loong texts.
developeed and sold by y companies thatt do researrch D
Decision trees are
a decision-b based models similar to
in Heallthcare Inforrmatics, Nattural Languaage thhe rule-based models that are a used in haandcrafted
Processinng, and Mach hine Learning,, and companies syystems, and are suitabble for shoort texts.
that develop tools liike Microsoftt Health Vauult. Prrobabilistic models,
m especially the ones based on
Consumeers are looking to buy or use u products thhat thhe Naı¨ve Bayyes theory, aree the state of the art in
satisfy ttheir needs and gain their t trust and
a teext classificatiion and in almmost any autom matic text
confidencce. Healthcarre products arre probably the t cllassification task.
t Adaptivve learning algorithms
a
most sennsitive to th he trust and confidence of arre the ones th hat focus on hard-to-learn
h concepts,
consumers. Compannies that want w to sell
s ussually undeerrepresented in the data, a
informatiion technolo ogy healthcaare frameworrks chharacteristic that
t appears in i our short texts and
need to bbuild tools thhat allow them m to extract and
a immbalanced daata sets. SV VM-based moodels are
mine auutomatically the wealth of publish hed accknowledged state-of-th
he-art classsification
research. The first task (task 1 or sentennce teechniques on text.
t All classsifiers are partt of a tool
selectionn) identifies sentences from Medliine caalled Weka[14 4].(Oana Frunnza et al. [1]).
publishedd abstracts thhat talk abouut diseases and a
treatmentts. The taskk is similar to a scan of 3..2.1 Bag-of-w words Repressentation
sentencess contained inn the abstract of an article in Thhe bag-of-w words (BOW W) representtation is
order to present to thee user-only seentences that are a coommonly usedd
identifiedd as contaiining relevannt informatiion foor text classifiication tasks. It
I is a represeentation in
(disease treatment infformation). The T second taask w
which features are chosen am mong the wordds that are
(task 2 or relation identification)
i ) has a deepper prresent in the training
t data. Because we deal with
semantic dimension an nd it is focuseed on identifyiing shhort texts wiith an averaage of 20 w words per
disease-trreatment relattions in the seentences alreaady seentence, the difference
d beetween a binary value
selected as
a being inforrmative (e.g., task
t 1 is appliied reepresentation and
a a frequency value repreesentation
first). We focus on thhree relations:: Cure, Preveent, is not large. Inn our case, we w chose a ffrequency
vaalue representtation. This haas the advantaage that if
www.bo
orjournals.co
om Blue Ocean Research JJournals 73

_________________________________________________________________________________

a feature appears more than once in a sentence, this macromeasure is not influenced by the majority
means that it is important and the frequency value class, as the micromeasure is. The macromeasure
representation will capture this—the feature’s value better focuses on the performance the classifier has
will be greater than that of other features. We keep on the minority classes. The formulas for the
only the words that appeared at least three times in evaluation measures are: Accuracy ¼ the total
the training collection, contain at least one number of correctly classified instances; Recall ¼
alphanumeric character, are not part of an English the ratio of correctly classified positive instances to
list of stop words[15] and are longer than three the total number of positives. This evaluation
characters. Words that have length of two or one measure is known to the medical research
character are not considered as features because of community as
two other reasons: possible incorrect tokenization sensitivity. Precision ¼ the ratio of correctly
and problems with very short acronyms in the classified positive instances to the total number of
medical domain that could be highly ambiguous classified as positive. F-measure ¼ the harmonic
(could be an acronym or an abbreviation of a mean between precision and recall(Oana Frunza et
common word). al. [1]).
3.2.2 NLP Representation 5 Conclusion

The second type of representation is based on This approach is very useful for everyone as it
syntactic information. In order to extract this type gives information only of the area of interest. The
of information we used the Stanford pos-tagger[8] task is divided into two tasks The first task that we
tool. The tagger analyzes English sentences and tackle in this paper is a task that has applications in
outputs the base forms, part-of-speech tags, chunk information retrieval, information extraction, and
tags, and named entity tags. text summarization. We identify potential
The following preprocessing steps are applied in improvements in results when more information is
order to identify the final set of features to be used brought in the representation technique for the task
for classification: removing features that contain of classifying short medical texts.
only punctuation, removing The second task that we address can be viewed as
stop words (using the same list of words as for our a task that could benefit from solving the first task
BOW representation), and considering valid first. In this study, we have focused on three
features only the lemma-based forms. We chose to semantic relations between diseases and treatments.
use lemmas because there are a lot of inflected Our work shows that the best results are obtained
forms (e.g., plural forms) for the same word and when the classifier is not overwhelmed by
the lemmatized form (the base form of a word) will sentences that are not related to the task.
give us the same base form for all of them. This study is related to a particular field but the
future scope of the paper lies in the fact that this
4 Evaluation Measures can be extended to the information on the web.
The most common used evaluation measures in the Identifying and classifying medical-related
ML settings are: accuracy, precision, recall, and F- information on the web is a challenge that can
measure. All these measures are computed form a bring valuable information to the research
confusion matrix (Kohavi and Provost [7]) that community and also to the end user. We also
contains information about the actual classes, the consider as potential future work ways in which the
true classes and the classes predicted framework’s capabilities can be used in a
by the classifier. The test set on which the models commercial recommender system and in
are evaluated contain the true classes and the integration in a new EHR system.
evaluation tries to identify how many of the true
classes were predicted by the model classifier. In 6 Acknowledgement
the ML settings, special attention needs to be We express our sincere gratitude towards co-
directed to the evaluation measures that are used. operative department who has provided us with
For data sets that are highly imbalanced (one class valuable assistance and requirements for the
is overrepresented in comparison with another), development. We hereby take this opportunity to
standard evaluation measures like accuracy are not record our sincere thanks and heartily gratitude to
suitable. Because our data sets are imbalanced, we our guide Prof. M. Galphade for her useful
chose to report in addition to accuracy, the guidance and making us available her intimate
macroaveraged F-measure. We decided to report knowledge and experience.
macro and not microaveraged F-measure because
the

_________________________________________________________________________________

7 References Machine Learning and the Knowledge

Discovery Process, vol. 30, pp. 271-274,
[1] Oana Frunza, Diana Inkpen, and Thomas 1998.
Tran " A Machine Learning Approach for [8] http://nlp.stanford.edu/software/tagger.sht
Identifying Disease-Treatment Relations ml.
in Short Texts" [9] Google health report,
vol. 23, 2011. https://www.google.com/health
[2] B. Rosario and M.A. Hearst, “Semantic [10] Microsoft Health Vault,
Relations in Bioscience Text,” Proc. 42nd http://healthvault.com
Ann. Meeting on Assoc. for [11] Health care tracker,
Computational Linguistics, vol. 430, http://healthcaretracker.wordpress.com/
2004. [12] Medline Database,
[3] M. Craven, “Learning to Extract http://www.proquest.com/en
Relations from Medline,” Proc. Assoc. for US/catalogs/databases/detail/medline_ft.s
the Advancement of Artificial html
Intelligence, 1999. [13] Medical Subject Headings,
[4] S. Ray and M. Craven, “Representing http://www.nlm.nih.gov/mesh/meshhome.
Sentence Structure in Hidden Markov html.
Models for Information Extraction,” Proc. [14] Weka tool,
Int’l Joint Conf. Artificial Intelligence http://www.cs.waikato.ac.nz/ml/weka/.
(IJCAI ’01), 2001.
[5] P. Srinivasan and T. Rindflesch, List of Stop words,
“Exploring Text Mining from Medline,” http://www.site.uottawa.ca/~diana/csi5180/StopWo
Proc. Am. Medical Informatics Assoc. rds.
(AMIA) Symp., 2002.
[6] R. Bunescu, R. Mooney, Y. Weiss, B.
Scho¨ lkopf, and J. Platt,“Subsequence
Kernels for Relation Extraction,”
Advances in Neural Information
Processing Systems, vol.18, pp. 171-178,
20
[7] R. Kohavi and F. Provost, “Glossary of
Terms,” Machine Learning, Editorial for
the Special Issue on Applications of
5606

2013
________________________________________________________________________________________

A Review
R o Need
on d of BI in
i an Organizaation
Saloni B
Bansal, Studen
nt, Informationn Technology, RKGITW, Ghaziabad
G
Soumya Awasthi, Stuudent, Informaation Technoloogy, RKGITW
W, Ghaziabad
Charu GGupta, Lectureer, Informatioon Technology
y, RKGITW, Ghaziabad
G
ABSTR
RACT
Business intelligence is a broad part of techhnologies whiich includes collecting, sttoring, accesssing, and
analyzingg data to helpp business useers in making g better decisions and analyyzing business performancce through
data-drivven insight. Thhe ability to extract
e and prresent informaation in a meaaningful mannner is vital forr business
success. BBusiness intellligence helpss an organisattion to transfo
form data into actionable in nsight regardlless of the
location. This technoloogy understannds the past annd predicts thhe future. This paper providdes an overvieew of need
of busineess intelligencee in an organiisation.
Keyword ds: business intelligence,
i d
decision makinng, data mininng, future insiight, businesss performancee, decision
support ssystem
Introdu
uction deemands that business
b conttinue to imprrove their
Why bussiness intelliggence? It is essential for an abbility to makke decisions and
a anticipatee changes
organisattion to knoow its bussiness, markket, .B
Business intellligence tools help
h the organnisation in
customerrs, and com mpetition. Exxecutives neeed deelivering righht information
n to the right people at
summarizzed data whiich gives an overall view of thhe right time in
i order to maake smart andd effective
the comppany and its functionalityy if they are to deecisions. Com mpanies are moost likely to reach
r their
measure performance and respondd proactively to buusiness outcom mes when maany different users can
changes happening in the maarketplace and a acccess compllete, consisteent and truustworthy
organisattion. Manageers, teams, and a individuals innformation. AsA can be seenn by vendor offerings,
need thhe ability to o search, shhare, and use u i to move an organisation down the
thhe aspiration is
informatiion from acrooss all aspectss of the busineess paath of analytical maturity, from past innformation
to perforrm various taasks efficienttly and monittor too future insigh
ht.(Fig1)
business operations.[1] Increasinng complex xity
Fig1. Anallytical maturity journey
Businesss Users an
nd BI efffect on an orgganisation was considerablee. Though
Former generations of BI soluutions normaally most of the employees
m e in the organisaation had
targeted specific
s high-level roles in an organisatio
on, grrown expert ini using the basic
b tools avvailable, it
so only a less number of people hadd opportunityy to w
was not sufficient in meeting their iincreasing
use them m. As an alternative, they analyzzed innformation maanagement neeeds. They needed
n the
informatiion using usuual office prooductivity toools abbility to quickkly analyze their
t data to turn their
such as spreadsheets and desktop databases. The T innsight into acttions for imprrovement. Wee are now
www.bo
orjournals.co
om Bllue Ocean Reesearch Jourrnals 76
6
5606

2013
________________________________________________________________________________________

in the deecade of smaart. The worlld is now moore orrganisation froom the execuutive group alll the way
instrumennted, organissed and inteellectual. Moore too the front linnes of the bussiness. More explicitly,
e
Data is available thann ever beforee- that to froom thhey need:
multiple sources. In this fast, interrelated
i and
a  Analyttics they cann use to answer key
complex world, it is non longer adeqquate to makee a buusiness question present at a single placee with the
decision and perform m on the bassis of restrictted m meaningfu
most ful informationn.
informatiion, fixed tiime horizons, and strateggic  Collecctive intelliggence gatherred from
planning cycles. Busin ness users neeed BI solutioons otther business users
u to agree, decide and act.
a
that are intended to offer agility-- the ability to  Actionnable insight that anyonee can use
assess, reeinvent and addjust.[2] reegardless of time and locaation to respoond at the
pooint of impactt.(Fig2)
For the bbest business output, comppanies must set
free the intelligence found in alll parts of th
heir
Fig2. A unified, inteeractive brow

wser-based workspace
w cann help users explore
e inform
mation regarrdless of
where the data is stored
s
www.bo
orjournals.co
om Bllue Ocean Reesearch Jourrnals 77
7

_________________________________________________________________________________

Executives For travelling managers, who require to access

“Insight and foresight are linked with leadership. information instantly, a mobile facility should
It’s insight that helps to capture opportunity.” make it easy for them to access what they need the
—Zhou Ming, Executive Vice President and moment they need it.
Secretary General, China Council for
International Investment Promotion BI workflow capability can benefit managers in:
 Initiating tasks at any time.
Executives require information that is brief and  Assigning ownership of an activity to
bears straight significance to their key initiatives. individuals.
They need to be able to see the big picture quickly  Managing initiatives and tracking projects
and clearly so they can take actions. To meet this and activities.
need executives require preassembled, interactive
collaboration tools and integrated workflow. Thus, Business Analysts
a BI solution for this user group must provide these Business analysts rely heavily on query and
features so that it fulfils the following reporting to provide them with the information they
requirements: require to connect the dots between revenues and
 Connect with other executives to share losses, products and profitability, financial
their views and collect more opinions. performance and market trends and so on.[4]
 Track activities and projects and gain The right BI solution would provide a complete
instant access to a complete task list. query and reporting capability that would:
 Trace the source of data or a report  Present them with the complete and steady
whenever they need it. view of business and operations.
 Help them access consistent statistical
The right BI solution gives executives the choice of evidence, trends, patters and predictions easily
working with the known interface, if that is what  Expand visibility and intelligence beyond
they are comfortable with because they don’t have the information at hand.
the time to learn new technology. Similar to other business users, analysts need
Executives’ decisions are ultimately responsible for collaboration and networking capabilities so they
taking the company in a new direction. Thus they can engage with business managers, executives and
require a BI solution that provides real-time other analysts to share the insights they have
analytics competence so they can be sure that they uncovered.
are making best decisions for their organisation
with all the information they need at their Non-Technical Users
fingertips.[3]
Non-technical users are those workers who are not
Business Managers managers or analysts or in IT. These users require:
With the aim of business success and profitability,  A starting point to understand information
business managers need both a high-level view of and uncover insight to check their performance.
business and the skill to explore operational details.  A browser based reporting feature to help
Quick access to relevant information can help them them work along with the data they need for
make better decisions. actionable insight.
The right BI solution can help business managers  Automated scorecards and metrics to help
in: envision their performance based on targets set for
 Reporting capabilities that can offer them role-specific projects and activities.
a widespread and reliable view of business and
operations. Formerly, non-technical users worked outside BI
 Interacting with those views using a web- infrastructure which held back their abilities to
browser with the help of various features. make quick and effective decisions. Thus, a
 Reconciling transaction and scheduling complete BI experience-browse, explore and
data to create a corporate sanctioned view of author-in a self-contained offline environment is
business information using multidimensional data necessary. In this ever changing business world,
management. companies are realising that non-technical users
 Providing meaning using an enterprise need a solution that offers most of the capabilities
dictionary. that executives, managers, analysts need but in a
 Providing facility for integrating external form that they are not burdened. An effective BI
data to their corporate information. solution provides them with this.[5]

_________________________________________________________________________________

Conclusion
BI is not only a group of processes, practices, References
applications and technologies, but it is this group [1] R. Fitriana, Eriyatno, T. Djatna “Progress
that over time, is a path leading to destination. It in Business Intelligence System research: A
helps each individual within an organisation to literature Review,” International Journal of Basic
make day-to-day decisions through better analysis & Applied Sciences IJBAS-IJENS Vol: 11 No: 03.
of different areas of the business. BI helps in [2] White Paper: The Business Intelligence –
problem solving by giving answers to each and Why should I care? – October 2011
every question. It provides access to external data [3] Business intelligence requirements for IT:
which helps in satisfying each employee’s different What every IT manager should know about
analytical need. BI enables users to define new business users’ real needs for BI – January 2011
views and reports for better understanding and [4] Microsoft Dynamics GP Business
utilization of information. BI helps in automated Intelligence – April 2007
generation of reports and its distribution throughout
the organisation which reduces human efforts. Thus [5] Business intelligence for business users: Insight
BI ensures making the fast, informed decisions that when and where you need it – May 2010
fuels success and helps business in moving towards
a bright future.
View publication stats

JECAS Ap 2013-FEM-Published PDF

Hochgeladen von

Dokumentinformationen

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

JECAS Ap 2013-FEM-Published PDF

Hochgeladen von

Copyright:

Verfügbare Formate

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

JEC&AS Ap 2013 - FEM - Published

Article · April 2013

The user has requested enhancement of the downloaded file.

Blue Ocean Research Journals

2 Optical Studies on Sol-Gel Derived Lead Chloride Crystals 5-9

Simulation of Plasma Transferred ARC (PTA) Hardfaced on Structural Steel

4 Elimination of Charge Sharing Problem in Dynamic Circuit 15-19

5 Effect Of Climate Change On Global Surface Temperature 20-24

6 Solar Powered Generator Free Electricity 25-29

7 Data Leakage Detection 30-34

Biotransformation of a Textile AZO Dye Acid Yellow 25 by Marinobacter

Techno-Economic Analysis of a Mixed Grainage for the Production of

10 Comparative Study of EMC Greenplum and Oracle Exadata 50-54

11 Comparative Study of 1G, 2G, 3G and 4G 55-63

12 A Novel Application for Android Based Handheld Devices 64-67

13 Dual Watermarking For High Protective Copyright System 68-71

To Identify Disease Treatment Relationship in Short Text Using Machine

15 A Review on Need of BI in an Organization 81-84

www.borjournals.com Blue Ocean Research Publications

Inteegrated Solar Wall

1. Introoduction During operatio

Fig .3.1 Coomplex modeel scheme

3..1 Meteorolog gical and airfflow model

3..2 Electrical model

heeat equation with

3.3 Therrmal Model

Optical Studies on Sol-Gel Derived Lead Chloride

Result And Discussion

and Eg iss the optical band

Fiigure 3. Flourrescence emisssion spectra ofo PbCl2 at

Taable 1. Measuured values of optical bandd gap and

PbbCl2 Optical direcct Emisssion peak

Thhe excitonic trransitions in lead

Simulation of Plasma Transferred ARC (PTA) Hardfaced

1. Introduction carried out on butt and fillet welds, but not on

3. Finite Element Simulation

Table.2 The temperature dependent material properties of substrate and TiC.

Fig 1. Photoograph of Fiig 2. Typical cross

Table. 3 PTA Hardfacing Experrimental Cond ditions

Figg.2 Typical Teemperature Coontour plot of hardfaced plaate.

Fig.3 Typicaal Temperaturre Counter ploot cut

Table 4 Comparison of measured

Heat Inpput, Penetrattion(mm) Beadd width (mm)

Elimination of Charge Sharing Problem in Dynamic

Introduction tanner. We will show that dynamic logic gates are

Above wwe have impleemented the dynamic

Dominoo logic CM MOS stage is either disscharged to low l level

Above w we have impplemented thee domino loggic immplemented and

Fig.4: Wavefform for dominno logic

Fig.5: Weaker PMO

Results and Conclusions [3] P. Larsson and C. Svensson, “Noise in digital

Effect Of Climate Change On Global Surface Temperature

1. Introduction years. Second cyclical variation results from the

SSN TSI [W/m^2] Linear (TSI [W/m^2])

Total Solar Irradiance (TSI)

3. Greenhouse gases and atmospheric During the pre-industrial Holocene, concentrations

Fig. 2 Shows the variation of Co2 concentration during 1958 onwards.

Co2 GSTemp Linear (Co2) Linear (GSTemp)

Giobal Surface Temperature

Paraboliic Dish reesults are usefful in the calcuulation: (or the

The parrabolic sufffer from

Sterling Engine arrrangement iss shown in Figure 1. As the t figure