Sie sind auf Seite 1von 7

1.

Langkah-langkahnya
a. Masuk ke http://www.ncbi.nlm.nih.gov/genbank/

b. Masukkan fasta

ATGAGAGTGATGGGGATAGAGAGGAATTATCCTTGCTGGTGGACATGGGGGATTATGATCTTGGGGAT
GA
TAATAATTTGTAATACTGCAGAAAACTTGTGGGTTACTGTCTACTATGGGGTACCTATATGGAAGGAT
GC
AAATACCACCTTATTTTGTGCATCAGATGCGAAAGCATATGACACAGAAGTGCATAATGTCTGGGCTA
CG
CATGCCTGTGTACCTACAGACCCCAGCCCACAAGAACTAAAAATGGAAAATGTGACAGAAGAGTTTAA
CA
TGTGGAAAAATAACATGGTAGAACAGATGCATACAGATATAATCAGTCTATGGGACCAAAGCCTAAAA
CC
ATGTGTACAGTTAACCCCTCTCTGCGTTACTTTAGATTGTAGCTATAACATCACCAATAATATCACCA
AT
AGCATCACCAATAGCTCAGTTAACATGAGAGAAGAAATAAAAAACTGCTCTTTCAATATGACCACAGA
AT
TAAGGGATAAGAATCGGAAGGTATATTCACTTTTTTATAAACTTGATGTAGTACAAATTAATAATGGT
AA
TAACAGTAGTAATCTGTATAGATTAATAAATTGTAATACCTCAGCCCTTACACAGGCTTGTCCAAAGG
TA
ACCTTTGAGCCAATTCCCATACATTATTGTGCCCCAGCTGGTTATGCGATTCTAAAATGTAATGATAA
GG
AGTTCAATGGAACAGGGCTATGCAAGAATGTCAGCACAGTACAATGCACACATGGAATCAGGCCAGTA
GT
ATCAACTCAACTGCTGTTAAATGGCAGTTTAGCAGAAGGAAAGGTAATGATTAGATCTGAAAATATCA
CA
AACAATGTCAAAAACATAATAGTACAACTTAACGAGTCTGTAACAATTAATTGTACCAGACCTAACAA
TA
ATACAAGAAGAAGTGTACGTATAGGACCAGGACAAACATTCTATGCAACAGGTGATATAATAGGGGAT
AT
AAGACAAGCACATTGTAATGTCAGTGGGTCACAATGGAATAAAACTTTACACCAGGTAGTTGAACAAT
TA
AGAAAATATTGGAACAACAATACAATAATCTTTAATAGCTCCTCAGGAGGGGATTTAGAAATTACAAC
AC
ATAGTTTTAATTGTGGAGGAGAATTTTTCTATTGTAATACATCAGGCCTGTTTAATAGTACTTGGGTA
AA
TGGCACTGCCAGCATAGAAAATGGCACTATAACTCTCCCATGCAGAATAAAGCAAATTATAAATATGT
GG
CAGAGAGTAGGACAAGCAATATATGCCCCTCCCATCCAAGGAGTAATAAGGTGTGTATCAAACATTAC
AG
GACTAATATTAACAAGAGATGGTGGGGGTAATAGCAATGAAAATGAAACCTTCAGACCTGGAGGAGGA
GA
TATGAGGGACAATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAAATTGAACCACTAGGAGTAG
CA
CCCACCAAGGCAAGGAGAAGAGTGGTGGAGAGAGAAAAAAGAGCAGTTACACTGGGAGCTGTATTCAT
TG
GGTTCTTAGGAACAGCTGGAAGCACAATGGGCGCGGCGTCAATAACGCTGACGGTACAGGCCAGAAAA
TT
ATTATCTGGCATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCTCAACAGCATCTGTTGA
AA
CTCACTGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAGGGATCA
AC
AGCTCCTAGGAATTTGGGGCTGCTCTGGAAAACTCATCTGCCCCACTAATGTGCCCTGGAACTCTAGC
TG
GAGTAATAAATCTCTAGATGAAATATGGGATAACATGACCTGGCTGCAATGGGATAAAGAAATTAGCA
AT
TACACAATCAAAATATATGAGCTAATTGAAGAATCGCAGATCCAGCAGGAAAGGAATGAAAAAGACTT
AT
TGGAATTGGACAAGTGGGCAAGTCTGTGGAATTGGTTTGACATATCAAAATGGCTGTGGTATATAAAA
AT
ATTTATAATGATAGTAGGAGGCCTAATAGGATTAAGAATAGTTTTTGCTGTGCTTTCTGTAATAAATA
GA
GTTAGGCAGGGATACTCACCCCTATCGTTTCAGACCCATACCCCGAACCCAAGGGGACTCGACAGGCC
CG
GAAGAATCGAAGAAGAAGGTGGAGAGCAAGACAGAGGCAGATCGATACGCTTAGTGAGCGGGTTCTTA
GC
ACTTGCCTGGGACGACCTGCGGAACCTGTGCCTCTTCAGCTACCACCGATTGAGAGACTTCATCTTGA
TT
GCAGCGAGGACTGTGGAACTTCTGGGACACAGCAGTCTCAAGGGGTTGAGACTGGGGTGGGAAGGACT
CA
AGTATCTGGGGAATCTCCTGTTGTATTGGGGTCGGGAACTAAAAATTAGTGCTATTAATTTGCTTGAT
AC
CATAGCAATAGCAGTAGCTGGCTGGACAGATAGGGTTATAGAAACAGTACAAAGGCTTGGTAGAGCTA
TT
CTCAACATACCTAGAAGAATCAGGCAGGGCTTCGAAAGGGCTTTACTATAA
Grafik:

Pertanyaan: apakah ini DNA,RNA atau asama amino? Dapatkah kamu


menjelaskan perbedaannya?
Ini adalah DNA, perbedaannya adalah dari sequensnya tidak terdapat urasil di
dalamnya. Sehingga dapat disimpulkan ini adalah DNA
2. Mengidentifikasi sekuens menggunakan Genscan
- Masukkan link http:/argonaute.mit.edu/GENSCAN.html

-
- Masukkan capture-an output genscan
- Pertanyaan
a. Apa sifat seq: Human Iso.smat
b. Berapa banyak genes, exons dan intron?

Genes: 1.01 Sngl + 55 2571 2517 0 0 51 41 495 0.453 33.50

Exons: Suboptimal exons with probability > 1.000

Intron: Nothing intron

3. Translasi
- Masuk ke http:web.expasy.org/translate/.
- 5'3' Frame 1
Met R V Met G I E R N Y P C W W T W G I Met I L G Met I
IICNTAENLWVTVYYGVPIWKDANTTLFC
ASDAKAYDTEVHNVWATHACVPTDPSP
Q E L K Met E N V T E E F N Met W K N N Met V E
Q Met H T D I I S L W D Q S L K P C V Q L T P L C V T L
D C S Y N I T N N I T N S I T N S S V N Met R E E I K N C
S F N Met T T E L R D K N R K V Y S L F Y K L D V V Q I
NNGNNSSNLYRLINCNTSALTQACPKVT
FEPIPIHYCAPAGYAILKCNDK
- 5'3' Frame 2
Stop E Stop W G Stop R G I I L A G G H G G L Stop S W
G Stop Stop Stop F V I L Q K T C G L L S T Met G Y L Y
G R Met Q I P P Y F V H Q Met R K H Met T Q K C I Met S
G L RMet P V Y L Q T P A H K N Stop K W K Met Stop Q
K S L T C G K I T W Stop N R C I Q I Stop S V Y G T K
A Stop N H V Y S Stop P L S A L L Stop I V A I T S P I I S
P I A S P I A Q L T Stop E K K Stop K T A L S I Stop P Q
N Stop G I R I G R Y I H F F I N L Met Stop Y K L I Met V I
T V V I C I D Stop Stop I V I P Q P L H R L V Q R Stop P L
S Q F P Y I I V P Q L V Met R F Stop N V Met I R
- 5'3' Frame 3
E S D G D R E E L S L L V D Met G D Y D L G D D N N
L Stop Y C R K L V G Y C L L W G T Y Met E G C K Y H L
I L C I R C E S I Stop H R S A Stop C L G Y A C L C T Y R
P Q P T R T K N G K C D R R V Stop H V E K Stop H G R
T D A Y R Y N Q S Met G P K P K T Met C T V N P S L R
Y F R L Stop L Stop H H Q Stop Y H Q Stop H H
Q Stop L S Stop H E R R N K K L L F Q Y D H R I K
G Stop E S E G I F T F L Stop T Stop C S T
N Stop Stop W Stop Stop Q Stop Stop S V Stop I N K
L Stop Y L S P Y T G L S K G N L Stop A N S H T L L C P
S W L C D S K Met Stop Stop Stop
- 3'5' Frame 1
PYHYILESHNQLGHNNVWELAQRLPLDK
P V Stop G L R Y Y N L L I Y T D Y Y C Y Y H Y Stop F V
L H Q V Y K K V N I P S D S Y P L I L W S Y Stop K S S F
L F L L S C Stop L S Y W Stop C Y W Stop Y Y W Stop C
Y S Y N L K Stop R R E G L T V H Met V L G F G P I
D Stop L Y L Y A S V L P C Y F S T C Stop T L L S H F P
F L V L V G W G L Stop V H R H A Stop P R H Y A L L C
H Met L S H L Met H K I R W Y L H P S I Stop V P H S R
Q Stop P T S F L Q Y Y K L L S S P R S Stop S P Met S T
SKDNSSLSPSLS
- 3'5' Frame 2
L I I T F Stop N R I T S W G T I Met Y G N W L K G Y L W
T S L C K G Stop G I T I Y Stop S I Q I T T V I T I I N L Y Y
I K F I K K Stop I Y L P I L I P Stop F C G H I E R A V F Y
F F S H V N Stop A I G D A I G D I I G D V I A T I Stop S N
A E R G Stop L Y T W F Stop A L V P Stop T D Y I
C Met H L F Y H V I F P H V K L F C H I F H F Stop F L W
A G V C R Y T G Met R S P D I Met H F C V I C F R
I Stop C T K Stop G G I C I L P Y R Y P I V D S N P Q V F
CSITNYYHPQDHNPPCPPARIIPLYPHHS
H
- 3'5' Frame 3
L S L H F R I A Stop P A G A Q Stop C Met G I G S K V T
FGQACVRAEVLQFINLYRLLLLLPLLICT
T S S L Stop K S E Y T F R F L S L N S V V I L K E Q F F I
S S L Met L T E L L V Met L L V I L L V Met L Stop L Q S K
VTQRGVNCTHGFRLWSHRLIISVCICS
T Met L F F H Met L N S S V T F S I F S S C G L G S V G
TQACVAQTLCTSVSYAFASDAQNKVVFA
S F H I G T P Stop Stop T V T H K F S A V L Q I I I I P K I I
I P H V H Q Q G Stop F L S I P I T L

Data paling akurat diantara 3’-5’ atau 5’-3’ adalah 5’-3’


Karena di frame 1 semuanya terblok merah atau bisa
disebut semuanya amino acid.