You are on page 1of 6

Cytokine 107 (2018) 59–64

Contents lists available at ScienceDirect

Cytokine
journal homepage: www.elsevier.com/locate/cytokine

Influence of correlation between HLA-G polymorphism and Interleukin-6 T


(IL6) gene expression on the risk of schizophrenia
Venkataram Shivakumara,b, Monojit Debnathc, Deepthi Venugopala,c, Ashwini Rajasekarana,c,
Sunil V. Kalmadya,b, Manjula Subbannaa,c, Janardhanan C. Narayanaswamya,b,

Anekal C. Amareshaa,b, Ganesan Venkatasubramaniana,b,
a
Translational Psychiatry Laboratory, Neurobiology Research Centre, National Institute of Mental Health and Neurosciences, Bangalore, India
b
Department of Psychiatry, National Institute of Mental Health and Neurosciences, Bangalore, India
c
Department of Human Genetics, National Institute of Mental Health and Neurosciences, Bangalore, India

A R T I C L E I N F O A B S T R A C T

Keywords: Converging evidence suggests important implications of immuno-inflammatory pathway in the risk and pro-
Schizophrenia gression of schizophrenia. Prenatal infection resulting in maternal immune activation and developmental neu-
HLA-G roinflammation reportedly increases the risk of schizophrenia in the offspring by generating pro-inflammatory
IL-6 cytokines including IL-6. However, it is not known how prenatal infection can induce immuno-inflammatory
Inflammation
responses despite the presence of immuno-inhibitory Human Leukocyte Antigen-G (HLA-G) molecules. To ad-
Infection
dress this, the present study was aimed at examining the correlation between 14 bp Insertion/Deletion (INDEL)
Neurodevelopment
polymorphism of HLA-G and IL-6 gene expression in schizophrenia patients. The 14 bp INDEL polymorphism
was studied by PCR amplification/direct sequencing and IL-6 gene expression was quantified by using real-time
RT-PCR in 56 schizophrenia patients and 99 healthy controls.
We observed significantly low IL6 gene expression in the peripheral mononuclear cells (PBMCs) of schizo-
phrenia patients (t = 3.8, p = .004) compared to the controls. In addition, schizophrenia patients carrying Del/
Del genotype of HLA-G 14 bp INDEL exhibited significantly lower IL6 gene expression (t = 3.1; p = .004) than
the Del/Ins as well as Ins/Ins carriers. Our findings suggest that presence of “high-expressor” HLA-G 14 bp Del/
Del genotype in schizophrenia patients could attenuate IL-6 mediated inflammation in schizophrenia. Based on
these findings it can be assumed that HLA-G and cytokine interactions might play an important role in the
immunological underpinnings of schizophrenia.

1. Introduction genes within MHC locus of chromosome 6 [8]. The MHC and cytokine
molecules have been demonstrated to regulate fundamental events of
Accumulating data from the recent genome wide association studies brain development such as neurite outgrowth, synapse formation, and
(GWAS) suggest contribution of common polygenic variation to the risk plasticity [9–11]. However, altered expressions of these immune mo-
of schizophrenia [1,2]. In addition to genetic variation, risk of schizo- lecules were shown to have deleterious effects on the developing brain
phrenia due to exposures to environmental adversities is widely ap- and subsequently increasing the risk of schizophrenia in the offspring
preciated [3,4]. This is evident from various gene-environment studies [11–13]. Based on this understanding recently, immune-mediated
implicating immune related genes that play a crucial role in gene-en- neurodevelopmental origin of schizophrenia has been postulated as one
vironment interaction. This understanding has been supported by a of the predominant research paradigms of schizophrenia pathogenesis
largest ever GWAS that identified 108 schizophrenia associated genetic [14,15].
loci, of which majority have immune-related functions [2]. Amongst The human leukocyte antigen-G (HLA-G) is a non-classical MHC
the immunity genes, the Major Histocompatibility Complex (MHC) as class-I molecule which predominantly possesses tolerogenic and anti-
well as cytokine genes have been studied extensively in schizophrenia inflammatory functions. It primarily suppresses the functioning of
[5–7]. A recent study demonstrated that the functional alleles that were natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) [16,17].
strongly implicated by schizophrenia GWAS was indeed represented by With its predominant expression at the feto-maternal interface, HLA-G


Corresponding author at: Department of Psychiatry, National Institute of Mental Health and Neurosciences, Hosur Road, Bangalore 560029, India.
E-mail address: gvs@nimhans.ac.in (G. Venkatasubramanian).

https://doi.org/10.1016/j.cyto.2017.11.016
Received 2 March 2017; Received in revised form 14 October 2017; Accepted 27 November 2017
Available online 06 December 2017
1043-4666/ © 2017 Elsevier Ltd. All rights reserved.
V. Shivakumar et al. Cytokine 107 (2018) 59–64

plays important immuno-modulatory role in the outcome of pregnancy. first-degree relatives or had co-morbid substance abuse/dependence.
It is noteworthy that HLA-G expression also influences cytokine pro- History was elicited carefully to rule out any recent high grade fever/
duction as well as polarization during pregnancy [18–21]. The crucial infection within the past six weeks or any co-morbid medical condition
role of HLA-G in influencing Th1/Th2 balance has been reported in that could influence immune system in all the subjects (patient/con-
physiological and various pathological conditions. HLA-G favouring trol).
Th2 dominance during normal pregnancy and promoting Th1 response
in preeclampsia was also demonstrated in some studies [19,22]. It was
2.2. Genotyping
previously hypothesized that perturbation of HLA-G expression due to
environmental adversities in early pregnancy might enhance the risk of
From all the consenting participants, peripheral blood (10 mL) was
schizophrenia in the offspring through cytokine-mediated neurodeve-
drawn from the median cubital vein into EDTA-coated vacutainers (BD
lopmental abnormality [23]. In our recent studies, we have shown as-
Vacutainer® tubes, Becton & Dickinson, NJ, USA) under aseptic condi-
sociation of soluble HLA-G (sHLA-G) and HLA-G genotypes with the
tions. 5 mL blood was processed for separation of plasma and leukocyte
core features of schizophrenia [24,25]. In addition, we have also re-
layer and the remaining 5 mL was used for separation of PBMCs. The
ported the influence of IL10 genotype on sHLA-G levels and their as-
leukocyte suspension was utilized for genomic DNA extraction.
sociation with the risk of schizophrenia [26].
Genomic DNA was isolated by spin column method (Qiagen, Inc,
However, the impact of functional interactions between HLA-G and
Limburg, Netherlands). Genotyping of HLA-G 14 bp INDEL (located in
pro-inflammatory cytokines on the risk of schizophrenia is currently not
Chr6: 29798582) was done by PCR amplification (Applied Biosystems
known. Amongst the pro-inflammatory cytokines, IL-6 plays crucial
VeritiTM) in 154 Schizophrenia patients and 170 healthy controls. For
roles in the central nervous system development and function [27].
PCR amplification, 1 µL of genomic DNA (100 ng) was added to a 30 µL
Higher expression of IL6 mRNA was found to alter fetal brain devel-
reaction mix containing 18 µL of Applied Biosystems True Allele PCR
opment during the early phases of pregnancy in rodents [28,29]. Data
Premix (Applied Biosystems, USA), 1µL of each primer (10 µM), and
obtained from clinical studies exhibit elevated serum and cerebrospinal
9µL of RNase free water. The forward and reverse primers were 5′
fluid (CSF) levels and increased mRNA expression of IL-6 in dorsolateral
GTGATGGGCTGTTTAAAGTGTCACC 3′; 5′ GGAAGGAATGCAGTTCAG
prefrontal cortex (DLPFC) in schizophrenia patients [30–32]. Notably,
CATGA 3′, respectively. The mixture was then initially subjected to
elevated plasma IL-6 levels were found to increase the risk for sub-
denaturation for 12 min at 95 °C, followed by 30 cycles of denaturation
sequent decline in cognitive function [33,34]. In addition to this, al-
for 30 s at 94 °C, annealing for 60 s at 64 °C, extension for 120 s at 72 °C,
tered IL-6 levels and IL6 polymorphisms were found to be associated
and final extension for 10 min at 72 °C. The amplified products were
with psychopathology, severity of the illness, cognition, brain mor-
separated by electrophoresis on 3% agarose gel, containing ethidium
phometry etc. in schizophrenia [4,35,36]. Taken together, a significant
bromide (0.5 µg/mL). The gel was visualized under ultraviolet illumi-
role of IL-6 in the immunopathogenetic risk of schizophrenia is a con-
nation using Gel Documentation system (VilberLourmat, France). The
sistent finding; however, the impact of IL6 on schizophrenia risk in
genotype profile of the 14 bp INDEL polymorphism was further vali-
correlation to immuno-dampening HLA-G molecules has not been ex-
dated by direct sequencing using Applied Biosystems 3730xI DNA
plored so far. To address this gap of knowledge, in this exploratory
analyzer in a subset of subjects.
investigation, we have examined HLA-G 14 bp Insertion/ Deletion
(INDEL) polymorphism and IL6 gene expression to understand whether
HLA-G gene variants have any role in determining IL6 mediated risk of 2.3. IL6 gene expression
schizophrenia.
The gene expression profile of IL6 was examined in 56 drug naïve/
2. Materials and methods drug free schizophrenia patients and 99 healthy subjects. Peripheral
blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque Plus
2.1. Subjects (GE Healthcare Bio-Sciences AB, Sweden), based on the principle of
differential migration of cells during centrifugation. Total RNA isolation
A total of 154 schizophrenia (DSM-IV) patients (age range: was carried out using commercial spin column method (Qiagen, Inc,
18–45 years) attending the clinical services at National Institute of Limburg, Netherlands) from the isolated PBMCs. The extracted RNA
Mental Health and Neurosciences (NIMHANS), Bangalore, India were was reverse transcribed to single-stranded cDNA using High Capacity
recruited for the study. Amongst them, 56 patients were antipsychotic- cDNA Reverse Transcription Kit (Applied Biosystems, USA). qPCR was
naïve/antipsychotic-free; 43 patients were never treated, antipsychotic- performed with a commercially available TaqMan Universal PCR
naive and presenting to the hospital for the first time & 13 patients were Master Mix (Applied Biosystems, Foster City, California) containing-
antipsychotic-free and without receiving any treatment for at least AmpliTaq Gold® DNA polymerase. IL-6 TaqMan probes and primers
3 months. This study was approved by the Institutional ethics com- were pre-formulated and designed by the same manufacturer, with
mittee. Patients and healthy volunteers were explained about the study primers spanning exon boundaries to avoid non-specific amplification
in their language and a written informed consent was obtained. The of gDNA due to cDNA contamination. The PCR amplification of IL-6 in
diagnosis was established using the Mini International Neuropsychiatric each sample was normalized to ACTB endogenous control (Assay id:
Interview Plus [37], which was confirmed independently by a qualified 4326315E). Multiplex Relative Standard Curve method [RSCM] was
psychiatrist. The patients were assessed for their demographic and applied for relative gene expression quantification. Five points of
clinical characteristics (history of presenting illness as well as any other twofold dilution series was used as the standard curve in every plate.
medical illness, family & personal history as well as antipsychotic- qPCR was performed on StepOnePlus™ Real-Time PCR Systems
naïve/antipsychotic-free status) with reliable information as ascer- (Applied Biosystems, Foster City, California) in a 96-well format.
tained by a first-degree relative. The Scale for Assessment of Positive Reactions were performed in a final volume of 10 μL containing,
Symptoms (SAPS) [38] and the Scale for Assessment of Negative TaqMan Universal PCR Master Mix, probes (final concentration of
Symptoms (SANS) [39] Likert-type scales were used to assess the clin- 250 nM) and primers for IL-6 (final concentration of 900 nM) and ACTB
ical symptoms of patients. Healthy controls (N = 170) were recruited (final concentration of 150 nM) as well as 1μL of RT reaction. The assay
purely on voluntary basis and were screened using MINI plus to rule out for every sample was run in quadruples, including the standards, and
any psychiatric diagnosis. A comprehensive mental status examination no-template control. Standard PCR conditions of 2 min at 50 °C, 10 min
was done. at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C was
None of the controls had family history of psychiatric disorder in followed.

60
V. Shivakumar et al. Cytokine 107 (2018) 59–64

Table 1 r = 0.11; p = .43; SANS total score: r = −0.04; p = .76). The impact of
Sociodemographic and clinical profile of study subjects. correlation between HLA-G 14 bp INDEL polymorphism and IL6 gene
expression was also examined in the patients as well as controls. It was
Characteristic Patients Controls Statistics P
(N = 56) (N = 99) observed that Del/Del carrying schizophrenia patients had significantly
[Mean ± SD] [Mean ± SD] lower level of IL-6 gene expression (t = 3.1; p = .004) than the Ins/Ins
and Ins/Del genotypes carriers (p > .05) (Fig. 2).
Age in years 32.6 ± 6.6 26.1 ± 4.5 7.28a < .05
Sex [M:F] 33:23 68:30 1.73b > .05
Age at Onset (in years) 28.6 ± 6.9 – 5. Discussion
Duration of Illness (in years) 2.9 ± 4.1 –
SANS 31.9 ± 28.9 –
Dysregulated immune system is critically implicated in both risk for
SAPS 27.7 ± 12.7 –
and progression of schizophrenia [14,40]. Importantly, chronic low-
a
Independent Samples t-Test [t]. grade inflammation both in the periphery and central nervous system
b
Chi-Square test [χ2]. elicited by altered levels of various pro-inflammatory cytokines like IL-
6, IL-1β, TNF-α, etc has been shown to contribute predominantly to the
3. Statistical analysis pathogenesis of schizophrenia [41–43]. Though the production of cer-
tain cytokines is influenced by HLA-G molecules, the importance of
The statistical analyses were performed using the Statistical Package HLA-G with respect to cytokine abnormality has so far not been in-
for Social Sciences (version-11) [SPSS Inc.,]. The following statistical vestigated in schizophrenia [44,45]. The objective of the study was to
tests were used: student’s t-test (two-tailed), chi-square test and explore the correlation between genetic variation within HLA-G locus
Pearson’s correlation. The significance was set at p < .05 (two-tailed). and IL6 gene expression in schizophrenia.

4. Results 5.1. IL6 gene expression in schizophrenia

The demographic and clinical characteristics of the study group We observed a significantly reduced mRNA level of IL6 gene in
have been summarized in Table 1. The groups were matched with re- drug-naïve schizophrenia patients than the healthy controls. This is in
spect to sex, however patients as a group were older than controls contradiction with a previous study, which demonstrated significantly
(p < .05); since, there was no significant correlation between age and higher leukocyte mRNA level of IL-6 in 24 patients with first episode
IL-6 gene expression either in patients or in controls, age was not used psychosis, of which ten patients had a diagnosis of schizophrenia-like
as a covariate in further analyses. The data of HLA-G 14 bp INDEL disorder [46]. Further, a post-mortem brain study has also shown ele-
polymorphism were taken from our previous study (not shown here) vated gene expression of IL-6 in the DLPFC of 20 schizophrenia patients
[24], where we had shown a strong association of Ins/Ins genotype and [30]. Over the past few years, converging evidence based on im-
Ins allele of 14 bp INDEL of HLA-G with schizophrenia risk. munological, genetic, gene expression and imaging studies have sug-
On analyzing the gene expression of IL6 in the PBMCs, we found gested significant implications of IL-6 in schizophrenia. Elevated serum
that there was a significant difference between the patient and control levels of IL-6 were reported by multiple studies, including a meta-
groups; a mean value of 1.43 ± 1.76 Relative Units (RU) was noted in analysis [43,47]. In a meta-analysis, IL-6 is proposed to be a state-re-
patients and 2.62 ± 3.35 RU in controls (t = 3.8, p = .004) (Fig. 1). lated marker of schizophrenia; increased level of IL-6 observed during
There was no significant correlation between IL-6 gene expression and acute exacerbations (acutely relapsed in-patients or first-episode psy-
illness variables (Illness duration: r = −0.01; p = .57; SAPS total score: chosis) was normalized with antipsychotic treatment [42].

Fig. 1. The group differences in IL6 gene expression


between patients and healthy controls. Gene expres-
sion is expressed as relative units (RU).

61
V. Shivakumar et al. Cytokine 107 (2018) 59–64

Fig. 2. The impact of HLA-G 14 bp INDEL poly-


morphism on IL6 gene expression. Gene expression is
expressed as relative units (RU).

Interestingly, findings on the CSF levels of IL-6 in schizophrenia pa- G on cytokine production.
tients were found to be inconsistent [48–50], with a recent meta-ana- In the present study, schizophrenia patients carrying the “high-ex-
lysis reporting no significant difference in the CSF IL6 levels between pressor” HLA-G 14 bp Del/Del genotype was shown to have a sig-
schizophrenia and control subjects [42]. In addition to this, the genetic nificantly lower IL6 gene expression. This finding suggests that en-
association studies of IL6 variants in schizophrenia have provided hanced production of HLA-G in Del/Del carrying schizophrenia patients
conflicting results. Positive association between IL6 polymorphism and could exert its anti-inflammatory effects by dampening the expression
schizophrenia was reported in certain populations [6,51], however, of IL-6, however, the precise underlying mechanism is yet to be as-
such association could not be replicated in other populations certained. In an interesting study, [61] HLA-G was proposed to mod-
[35,52,53]. Importantly, in Indian Bengalee population IL6 gene var- ulate tolerogenic attributes of dendritic cells through IL-6-STAT3
iation was not found to be associated with schizophrenia risk [41]. It is pathway. In this exploratory study, though a possible interaction be-
also interesting to note that a previous study on Indian schizophrenia tween anti-inflammatory HLA-G and pro-inflammatory IL-6 in schizo-
patients has shown significantly lower serum levels of IL-6 [54]. Al- phrenia is suggested, the lack of data on the underlying mechanism has
though the decreased mRNA level observed in the present study con- been the major limitation.
tradicts some of the previous findings, however, it lends further support
to the other Indian studies. Further systematic evaluation is warranted 6. Conclusion
to understand the reasons for such variation.
The evidence of chronic low grade inflammation in schizophrenia
5.2. Potential interactions between HLA-G and IL-6 in schizophrenia has been provided by multiple animal as well as human studies.
Inflammation is a complex process, mediated by co-ordinated actions of
HLA-G molecules are increasingly being shown to be associated many cytokines. IL-6 plays pivotal role in driving the inflammatory
with various neuropsychiatric disorders. For example, “low expressor” responses. In the present study, reduced expression of IL6 gene was
(HLA-G 14 bp Ins/Ins) genotype was found to be less prevalent in bi- observed, implying diminished inflammation in this subset of schizo-
polar patients born during winter season, indicating that 14 bp Ins/Ins phrenia patients.
may act as a protective genotype for bipolar disorder [55]. However, in The anti-inflammatory properties of HLA-G have been demonstrated
a recent study, we demonstrated that the Ins/Ins genotype of 14 bp in various conditions. However, the functional interactions between
INDEL was found to confer a strong risk for schizophrenia [24]. Further, HLA-G and IL-6 are not adequately known. Given the anti-inflammatory
the frequencies of 14 bp Ins/Ins genotype and 14 bp Ins allele were attributes of HLA-G, it seems likely that increased expression of HLA-G
found to be significantly higher in children with autistic spectrum might have immuno-dampening effect on IL-6. Del/Del genotype of
disorders as well as their mothers [56]. 14 bp INDEL of HLA-G is the “high expressor” genotype; schizophrenia
HLA-G 14 bp INDEL is a functionally relevant genetic polymorphism patients carrying this genotype shown reduced expression of IL6 gene.
which affects the production of HLA-G molecules. The presence of one This suggests that Del/Del genotype could provide protective effects to
of two 14 bp Del alleles (14 bp Del/Del and 14 bp Del/Ins genotypes) schizophrenia.
influence the higher production while 14 bp Ins/Ins is associated with The immuno-dampening attributes of HLA-G observed in schizo-
lower production of HLA-G [57,58]. As demonstrated by in vitro studies, phrenia patients could become an area of interest in the therapeutic
HLA-G (both soluble and membrane-bound) can modulate cytokine management of schizophrenia.
release by different cells [19,59]. The decidual mononuclear cells and
PBMCs were found to release reduced amount of IFN-γ and TNF-α when Acknowledgement
they were co-cultured with HLA-G expressing cells [59]. However, in
another co-culture experiment recombinant sHLA-G construct caused This study is supported by National Institute of Mental Health &
increased production of IFN-γ and TNF-α by uterine lymphocytes [45]. Neurosciences intra-mural Research Grant (NIMHANS/001/103/2013/
In addition, HLA-G homodimer was shown to induce secretion of IL-6, 00234) to MD and Wellcome Trust/DBT India Alliance Senior
IL-8, and TNF-α from decidual macrophages and NK cells [60]. Al- Fellowship Research Grant to GV (500236/Z/11/Z). V.S. is supported
though these findings provide conflicting views about the role of HLA-G by Department of Health Research, Young Scientist in Newer Research
on cytokine expression, they do emphasize the determining role of HLA- Areas: DHR/HRD/Young Scientist/Type-VI (2)/2015. AR is supported

62
V. Shivakumar et al. Cytokine 107 (2018) 59–64

by DST-INSPIRE fellowship. SVK and ACA are supported by the effects of cytokines and decidualization, Human Reprod. 23 (1) (2008) 144–152.
Wellcome Trust/DBT India Alliance. DV and MS are supported by UGC [19] T. Kanai, T. Fujii, N. Unno, T. Yamashita, H. Hyodo, A. Miki, Y. Hamai, S. Kozuma,
Y. Taketani, Human leukocyte antigen-G-expressing cells differently modulate the
Fellowship. release of cytokines from mononuclear cells present in the decidua versus periph-
eral blood, Am. J. Reprod. Immunol. 45 (2) (2001) 94–99.
Conflict of interest [20] P. Moreau, F. Adrian-Cabestre, C. Menier, V. Guiard, L. Gourand, J. Dausset,
E.D. Carosella, P. Paul, IL-10 selectively induces HLA-G expression in human tro-
phoblasts and monocytes, Int. Immunol. 11 (5) (1999) 803–811.
The authors declare that they have no conflicts of interest to dis- [21] Y. Yang, D.E. Geraghty, J.S. Hunt, Cytokine regulation of HLA-G expression in
close. human trophoblast cell lines, J. Reprod. Immunol. 29 (3) (1995) 179–195.
[22] J.R. Wilczynski, Th1/Th2 cytokines balance–yin and yang of reproductive im-
munology, Eur. J. Obstet. Gynecol. Reprod. Biol. 122 (2) (2005) 136–143.
References [23] M. Debnath, T.K. Chaudhuri, The role of HLA-G in cytokine homeostasis during
early pregnancy complicated with maternal infections: a novel etiopathological
approach to the neurodevelopmental understanding of schizophrenia, Med. Hypoth.
[1] S.M. Purcell, N.R. Wray, J.L. Stone, P.M. Visscher, M.C. O'Donovan, P.F. Sullivan,
66 (2) (2006) 286–293.
P. Sklar, Common polygenic variation contributes to risk of schizophrenia and bi-
[24] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, M. Subbana,
polar disorder, Nature 460 (7256) (2009) 748–752.
D. Venugopal, A.C. Amaresha, G. Venkatasubramanian, M. Berk, M. Debnath, The
[2] Ripke, et al., Biological insights from 108 schizophrenia-associated genetic loci,
impact of HLA-G 3' UTR variants and sHLA-G on risk and clinical correlates of
Nature 511 (7510) (2014) 421–427.
schizophrenia, Human Immunol. 77 (12) (2016) 1166–1171.
[3] J. van Os, B.P. Rutten, R. Poulton, Gene-environment interactions in schizophrenia:
[25] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, D. Venugopal,
review of epidemiological findings and future directions, Schizophrenia Bullet. 34
A.C. Amaresha, G. Venkatasubramanian, M. Debnath, Soluble human leukocyte
(6) (2008) 1066–1082.
antigen (sHLA)-G levels may predict early onset of schizophrenia in male patients,
[4] S.V. Kalmady, G. Venkatasubramanian, V. Shivakumar, S. Gautham,
Tissue Antigens 86 (1) (2015) 36–37.
A. Subramaniam, D.A. Jose, A. Maitra, V. Ravi, B.N. Gangadhar, Relationship be-
[26] A. Rajasekaran, V. Shivakumar, S.V. Kalmady, J.C. Narayanaswamy, M. Subbana,
tween Interleukin-6 gene polymorphism and hippocampal volume in antipsychotic-
D. Venugopal, A.C. Amaresha, G. Venkatasubramanian, M. Debnath, The impact of
naive schizophrenia: evidence for differential susceptibility? PloS one 9 (5) (2014)
IL10 polymorphisms and sHLA-G levels on the risk of schizophrenia, Asian J.
e96021.
Psychiat. 23 (2016) 39–43.
[5] M. Debnath, D.M. Cannon, G. Venkatasubramanian, Variation in the major histo-
[27] M. Erta, A. Quintana, J. Hidalgo, Interleukin-6, a major cytokine in the central
compatibility complex [MHC] gene family in schizophrenia: associations and
nervous system, Int. J. Biol. Sci. 8 (9) (2012) 1254–1266.
functional implications, Prog. Neuro-psychopharm. & Biol. Psychiat. 42 (2013)
[28] K.A. Garbett, E.Y. Hsiao, S. Kalman, P.H. Patterson, K. Mirnics, Effects of maternal
49–62.
immune activation on gene expression patterns in the fetal brain, Transl. Psychiat. 2
[6] M. Paul-Samojedny, A. Owczarek, M. Kowalczyk, R. Suchanek, M. Palacz, K. Kucia,
(2012) e98.
A. Fila-Danilow, P. Borkowska, J. Kowalski, Association of interleukin 2 (IL-2),
[29] S.E. Smith, J. Li, K. Garbett, K. Mirnics, P.H. Patterson, Maternal immune activation
interleukin 6 (IL-6), and TNF-alpha (TNFalpha) gene polymorphisms with paranoid
alters fetal brain development through interleukin-6, J. Neurosci.: the official
schizophrenia in a Polish population, J. Neuropsychiat. Clin. Neurosci. 25 (1)
journal of the Society for Neuroscience 27 (40) (2007) 10695–10702.
(2013) 72–82.
[30] S.G. Fillman, N. Cloonan, V.S. Catts, L.C. Miller, J. Wong, T. McCrossin, M. Cairns,
[7] H. Stefansson, R.A. Ophoff, S. Steinberg, O.A. Andreassen, S. Cichon, D. Rujescu,
C.S. Weickert, Increased inflammatory markers identified in the dorsolateral pre-
T. Werge, O.P. Pietilainen, O. Mors, P.B. Mortensen, E. Sigurdsson, O. Gustafsson,
frontal cortex of individuals with schizophrenia, Molecul. Psychiat. 18 (2) (2013)
M. Nyegaard, A. Tuulio-Henriksson, A. Ingason, T. Hansen, J. Suvisaari,
206–214.
J. Lonnqvist, T. Paunio, A.D. Borglum, A. Hartmann, A. Fink-Jensen, M. Nordentoft,
[31] L. Schwieler, M.K. Larsson, E. Skogh, M.E. Kegel, F. Orhan, S. Abdelmoaty, A. Finn,
D. Hougaard, B. Norgaard-Pedersen, Y. Bottcher, J. Olesen, R. Breuer, H.J. Moller,
M. Bhat, M. Samuelsson, K. Lundberg, M.L. Dahl, C. Sellgren, I. Schuppe-Koistinen,
I. Giegling, H.B. Rasmussen, S. Timm, M. Mattheisen, I. Bitter, J.M. Rethelyi,
C. Svensson, S. Erhardt, G. Engberg, Increased levels of IL-6 in the cerebrospinal
B.B. Magnusdottir, T. Sigmundsson, P. Olason, G. Masson, J.R. Gulcher,
fluid of patients with chronic schizophrenia–significance for activation of the ky-
M. Haraldsson, R. Fossdal, T.E. Thorgeirsson, U. Thorsteinsdottir, M. Ruggeri,
nurenine pathway, J. Psychiat. Neurosci.: JPN 40 (2) (2015) 126–133.
S. Tosato, B. Franke, E. Strengman, L.A. Kiemeney, I. Melle, S. Djurovic,
[32] X.Y. Zhang, D.F. Zhou, P.Y. Zhang, G.Y. Wu, L.Y. Cao, Y.C. Shen, Elevated inter-
L. Abramova, V. Kaleda, J. Sanjuan, R. de Frutos, E. Bramon, E. Vassos, G. Fraser,
leukin-2, interleukin-6 and interleukin-8 serum levels in neuroleptic-free schizo-
U. Ettinger, M. Picchioni, N. Walker, T. Toulopoulou, A.C. Need, D. Ge, J.L. Yoon,
phrenia: association with psychopathology, Schizophrenia Res. 57 (2–3) (2002)
K.V. Shianna, N.B. Freimer, R.M. Cantor, R. Murray, A. Kong, V. Golimbet,
247–258.
A. Carracedo, C. Arango, J. Costas, E.G. Jonsson, L. Terenius, I. Agartz,
[33] A. Economos, C.B. Wright, Y.P. Moon, T. Rundek, L. Rabbani, M.C. Paik, R.L. Sacco,
H. Petursson, M.M. Nothen, M. Rietschel, P.M. Matthews, P. Muglia, L. Peltonen,
M.S. Elkind, Interleukin 6 plasma concentration associates with cognitive decline:
D. St Clair, D.B. Goldstein, K. Stefansson, D.A. Collier, Common variants conferring
the northern Manhattan study, Neuroepidemiology 40 (4) (2013) 253–259.
risk of schizophrenia, Nature 460 (7256) (2009) 744–747.
[34] J.D. Weaver, M.H. Huang, M. Albert, T. Harris, J.W. Rowe, T.E. Seeman,
[8] A. Sekar, A.R. Bialas, H. de Rivera, A. Davis, T.R. Hammond, N. Kamitaki,
Interleukin-6 and risk of cognitive decline: MacArthur studies of successful aging,
K. Tooley, J. Presumey, M. Baum, V. Van Doren, G. Genovese, S.A. Rose,
Neurology 59 (3) (2002) 371–378.
R.E. Handsaker, M.J. Daly, M.C. Carroll, B. Stevens, S.A. McCarroll, Schizophrenia
[35] D. Frydecka, B. Misiak, E. Pawlak-Adamska, L. Karabon, A. Tomkiewicz,
risk from complex variation of complement component 4, Nature 530 (7589)
P. Sedlaczek, A. Kiejna, J.A. Beszlej, Interleukin-6: the missing element of the
(2016) 177–183.
neurocognitive deterioration in schizophrenia? The focus on genetic underpinnings,
[9] B.E. Deverman, P.H. Patterson, Cytokines and CNS development, Neuron 64 (1)
cognitive impairment and clinical manifestation, Eur. Arch. Psychiat. Clin.
(2009) 61–78.
Neurosci. 265 (6) (2015) 449–459.
[10] P.A. Garay, A.K. McAllister, Novel roles for immune molecules in neural develop-
[36] A. Stojanovic, L. Martorell, I. Montalvo, L. Ortega, R. Monseny, E. Vilella, J. Labad,
ment: implications for neurodevelopmental disorders, Front. Synaptic Neurosci. 2
Increased serum interleukin-6 levels in early stages of psychosis: associations with
(2010) 136.
at-risk mental states and the severity of psychotic symptoms,
[11] G.S. Huh, L.M. Boulanger, H. Du, P.A. Riquelme, T.M. Brotz, C.J. Shatz, Functional
Psychoneuroendocrinology 41 (2014) 23–32.
requirement for class I MHC in CNS development and plasticity, Science 290 (5499)
[37] D.V. Sheehan, Y. Lecrubier, K.H. Sheehan, P. Amorim, J. Janavs, E. Weiller, T.
(2000) 2155–2159.
Hergueta, R. Baker, G.C. Dunbar, The Mini-International Neuropsychiatric
[12] N. Escande-Beillard, L. Washburn, D. Zekzer, Z.P. Wu, S. Eitan, S. Ivkovic, Y. Lu,
Interview (M.I.N.I.): the development and validation of a structured diagnostic
H. Dang, B. Middleton, T.V. Bilousova, Y. Yoshimura, C.J. Evans, S. Joyce, J. Tian,
psychiatric interview for DSM-IV and ICD-10, J. Clin. Psychiat. 59(Suppl 20) (1998)
D.L. Kaufman, Neurons preferentially respond to self-MHC class I allele products
22–33;quiz 34–57.
regardless of peptide presented, J. Immunol. 184 (2) (2010) 816–823.
[38] N. Andreasen, The Scale for the Assessment of Positive Symptoms, SAPS, The
[13] Z.P. Wu, L. Washburn, T.V. Bilousova, M. Boudzinskaia, N. Escande-Beillard,
University of Iowa, Iowa City, IA, 1984.
J. Querubin, H. Dang, C.W. Xie, J. Tian, D.L. Kaufman, Enhanced neuronal ex-
[39] N. Andreasen, The Scale for the Assessment of Negative Symptoms, SAPS, The
pression of major histocompatibility complex class I leads to aberrations in neu-
University of Iowa, Iowa City, IA, 1983.
rodevelopment and neurorepair, J. Neuroimmunol. 232 (1–2) (2011) 8–16.
[40] G. Venkatasubramanian, M. Debnath, The TRIPS (Toll-like receptors in immuno-
[14] M. Debnath, M. Berk, Th17 pathway-mediated immunopathogenesis of schizo-
inflammatory pathogenesis) Hypothesis: a novel postulate to understand schizo-
phrenia: mechanisms and implications, Schizophrenia Bullet. 40 (6) (2014)
phrenia, Prog. Neuro-psychopharm. Biol. Psychiat. 44 (2013) 301–311.
1412–1421.
[41] M. Debnath, G. Venkatasubramanian, Recent advances in psychoneuroimmunology
[15] M. Debnath, G. Venkatasubramanian, M. Berk, Fetal programming of schizo-
relevant to schizophrenia therapeutics, Curr. Opin. Psychiat. 26 (5) (2013)
phrenia: select mechanisms, Neurosci. Biobehav. Rev. 49 (2015) 90–104.
433–439.
[16] E.D. Carosella, P. Moreau, J. Lemaoult, N. Rouas-Freiss, HLA-G: from biology to
[42] B.J. Miller, P. Buckley, W. Seabolt, A. Mellor, B. Kirkpatrick, Meta-analysis of cy-
clinical benefits, Trends Immunol. 29 (3) (2008) 125–132.
tokine alterations in schizophrenia: clinical status and antipsychotic effects, Biol.
[17] J.S. Hunt, M.G. Petroff, R.H. McIntire, C. Ober, HLA-G and immune tolerance in
Psychiat. 70 (7) (2011) 663–671.
pregnancy, FASEB J.: Official Publication of the Federation of American Societies
[43] S. Potvin, E. Stip, A.A. Sepehry, A. Gendron, R. Bah, E. Kouassi, Inflammatory cy-
for Experimental Biology 19 (7) (2005) 681–693.
tokine alterations in schizophrenia: a systematic quantitative review, Biol. Psychiat.
[18] O. Blanco, I. Tirado, R. Munoz-Fernandez, A.C. Abadia-Molina, J.M. Garcia-
63 (8) (2008) 801–808.
Pacheco, J. Pena, E.G. Olivares, Human decidual stromal cells express HLA-G:
[44] T. Kanai, T. Fujii, S. Kozuma, T. Yamashita, A. Miki, A. Kikuchi, Y. Taketani, Soluble

63
V. Shivakumar et al. Cytokine 107 (2018) 59–64

HLA-G influences the release of cytokines from allogeneic peripheral blood mono- T.J. Hwang, H.Y. Chan, J.J. Chen, W.J. Chen, H.G. Hwu, Genetic variants of IL-6
nuclear cells in culture, Molecul. Human Reprod. 7 (2) (2001) 195–200. and its receptor are not associated with schizophrenia in Taiwan, Neurosci. Lett.
[45] A. van der Meer, H.G. Lukassen, B. van Cranenbroek, E.H. Weiss, D.D. Braat, 468 (3) (2010) 330–333.
M.J. van Lierop, I. Joosten, Soluble HLA-G promotes Th1-type cytokine production [54] B. Singh, N.K. Bera, C.R. Nayak, T.K. Chaudhuri, Decreased serum levels of inter-
by cytokine-activated uterine and peripheral natural killer cells, Molecul. Human leukin-2 and interleukin-6 in Indian Bengalee schizophrenic patients, Cytokine 47
Reprod. 13 (2) (2007) 123–133. (1) (2009) 1–5.
[46] M. Di Nicola, A. Cattaneo, N. Hepgul, M. Di Forti, K.J. Aitchison, L. Janiri, [55] M. Debnath, M. Busson, S. Jamain, B. Etain, N. Hamdani, J. Oliveira, W. Boukouaci,
R.M. Murray, P. Dazzan, C.M. Pariante, V. Mondelli, Serum and gene expression K. Amokrane, H. Moins-Teisserenc, M. Lajnef, D. Bengoufa, A. Malafosse,
profile of cytokines in first-episode psychosis, Brain Behav. Immun. 31 (2013) F. Bellivier, C. Henry, J.P. Kahn, R. Krishnamoorthy, D. Charron, M. Leboyer,
90–95. R. Tamouza, The HLA-G low expressor genotype is associated with protection
[47] S.O. Nunes, T. Matsuo, M.S. Kaminami, M.A. Watanabe, E.M. Reiche, E.N. Itano, An against bipolar disorder, Human Immunol. 74 (5) (2013) 593–597.
autoimmune or an inflammatory process in patients with schizophrenia, schi- [56] F.R. Guerini, E. Bolognesi, M. Chiappedi, A. Ghezzo, M.P. Canevini, M.M. Mensi,
zoaffective disorder, and in their biological relatives, Schizophrenia Res. 84 (1) A. Vignoli, C. Agliardi, M. Zanette, M. Clerici, An HLA-G(*)14bp insertion/deletion
(2006) 180–182. polymorphism associates with the development of autistic spectrum disorders,
[48] V. Barak, Y. Barak, J. Levine, B. Nisman, I. Roisman, Changes in interleukin-1 beta Brain Behav. Immun. 44 (2015) 207–212.
and soluble interleukin-2 receptor levels in CSF and serum of schizophrenic pa- [57] X.Y. Chen, W.H. Yan, A. Lin, H.H. Xu, J.G. Zhang, X.X. Wang, The 14 bp deletion
tients, J. Basic Clin. Physiol. Pharm. 6 (1) (1995) 61–69. polymorphisms in HLA-G gene play an important role in the expression of soluble
[49] D.L. Garver, R.L. Tamas, J.A. Holcomb, Elevated interleukin-6 in the cerebrospinal HLA-G in plasma, Tissue Antigens 72 (4) (2008) 335–341.
fluid of a previously delineated schizophrenia subtype, Neuropsychopharmacology: [58] J. Di Cristofaro, D. El Moujally, A. Agnel, S. Mazieres, M. Cortey, A. Basire,
official publication of the American College of, Neuropsychopharmacology 28 (8) J. Chiaroni, C. Picard, HLA-G haplotype structure shows good conservation between
(2003) 1515–1520. different populations and good correlation with high, normal and low soluble HLA-
[50] D. Sasayama, K. Hattori, C. Wakabayashi, T. Teraishi, H. Hori, M. Ota, S. Yoshida, G expression, Human Immunol. 74 (2) (2013) 203–206.
K. Arima, T. Higuchi, N. Amano, H. Kunugi, Increased cerebrospinal fluid inter- [59] T. Kanai, T. Fujii, S. Kozuma, A. Miki, T. Yamashita, H. Hyodo, N. Unno, S. Yoshida,
leukin-6 levels in patients with schizophrenia and those with major depressive Y. Taketani, A subclass of soluble HLA-G1 modulates the release of cytokines from
disorder, J. Psychiat. Res. 47 (3) (2013) 401–406. mononuclear cells present in the decidua additively to membrane-bound HLA-G1, J.
[51] R. Zakharyan, M. Petrek, A. Arakelyan, F. Mrazek, S. Atshemyan, A. Boyajyan, Reprod. Immunol. 60 (2) (2003) 85–96.
Interleukin-6 promoter polymorphism and plasma levels in patients with schizo- [60] C. Li, B.L. Houser, M.L. Nicotra, J.L. Strominger, HLA-G homodimer-induced cy-
phrenia, Tissue Antigens 80 (2) (2012) 136–142. tokine secretion through HLA-G receptors on human decidual macrophages and
[52] P. Kapelski, M. Skibinska, M. Maciukiewicz, J. Pawlak, A. Permoda-Osip, natural killer cells, Proc. Nat. Acad. Sci. USA 106 (14) (2009) 5767–5772.
J. Twarowska-Hauser, Family-based association study of interleukin 6 (IL6) and its [61] S. Liang, V. Ristich, H. Arase, J. Dausset, E.D. Carosella, A. Horuzsko, Modulation of
receptor (IL6R) functional polymorphisms in schizophrenia in the Polish popula- dendritic cell differentiation by HLA-G and ILT4 requires the IL-6–STAT3 signaling
tion, J. Neuroimmunol. 285 (2015) 62–67. pathway, PNAS 105 (24) (2008) 8357–8362.
[53] Y.L. Liu, C.M. Liu, C.S. Fann, W.C. Yang, Y.H. Chen, L.J. Tseng, S.K. Liu, M.H. Hsieh,

64