AIATS Medical-2014 - Test-6 (Code-A) 02-02-2014 PDF

02.02.
2014
Test No. 6
AIPMT
Test No. 6
TOPICS OF THE TEST
Magnetic Effect of Current and Magnetism; Electromagnetic Induction and

Physics Alternating Currents; Electromagnetic Waves
Organic Chemistry : Some Basic Principles and Techniques, Hydrocarbons,

Chemistry
Environmental Chemistry, Haloalkanes and Haloarenes
Molecular Basis of Inheritance, Biology and Human Welfare: Improvement in

Food Production; Plant Breeding, Tissue Culture, Single Cell Protein,
Biofortification; Microbes in Human Welfare; In Household Food Processing,
Industrial Production, Sewage Treatment, Energy Generation and as Biocontrol
Biology Agents and Biofertilizers, Evolution, Human Health and Disease-I: Pathogens;
Parasites Causing Human Diseases (Malaria, Filariasis, Ascariasis. Typhoid,
Pneumonia, Common Cold, Amoebiasis, Ringworm); Basic Concepts of
Immunology-Vaccines
Test - 6 (Code A) All India Aakash Test Series for Medical-2014
Time : 3 Hrs. T EST – 6 MM : 720
[ PHYSICS]
Choose the correct answer :
1. Two charged particles are moving on identical 4. Lab demonstrator has built LCR series circuit as
helical path in opposite sense in a uniform magnetic shown in the figure. A student wants to decrease
resonance angular frequency of the circuit then he
field B  B0 iˆ . Select correct statement regarding
can try it by which of the following way(s)?
it (symbols have their usual meaning)
Soft iron
core Dielectric
(1) They must have same charge but unequal slab
masses
(2) They must have equal masses but different
charges
(3) The momentum to kinetic energy ratio must
p p
satisfy the relation V = V0cos  t
2k 1 2k 2
(1) By removing dielectric slab
(4) The charge to mass ratio must satisfy the
(2) By removing soft iron core
q q
relation 1  2 (3) By connecting an other capacitor in series
m1 m2
2. Select correct statement(s) regarding cyclotron (4) By replacing the dielectric slab with another
slab having more dielectric constant
(1) Charged particle accelerated only between two
dees 5. To ionise a molecule 10 eV energy is needed.
Which region of electromagnetic spectrum is able to
(2) Charged particle accelerated throughout its
circular path do this?
(3) Charged particle is accelerated in the dees but (1) Radiowaves

its speed up only between the two dees (2) Microwaves
(4) Both (2) & (3) (3) Ultraviolet rays
3. An observer is getting some magnetic field due to (4) Both (2) & (3)
a charge particle then
6. The ratio of contribution of electric and magnetic
(1) Charged particle necessarily be in motion field in the intensity of an electromagnetic wave is
(2) Charged particle may be in rest (c = speed of light)
(3) Charged particle must be in rest (1) 1 : 1 (2) 1 : c2
(4) Observer must be in rest (3) c2 : 1 (4) c : 1
Space for Rough Work
1/25
All India Aakash Test Series for Medical-2014 Test - 6 (Code A)
7. A short bar magnet is kept stationary and a coil is 9. Phase difference between voltage and current in
moving parallel to its axis, with constant velocity, as LCR series circuit at resonance is
shown in the figure. Which of the following best (1) 0° (2) 45°
represent variation of induced emf(e) in coil with
(3) 90° (4) 180°
time?
10. In LCR series circuit, 1, 2 and 0 are lower half
power, upper half power and resonance angular
S N frequencies respectively then
⎛ 2  1 ⎞ ⎛ 2  1 ⎞
(1) 0  ⎜ (2) 0  ⎜
V
⎝ 2 ⎟⎠ ⎝ 2 ⎟⎠
e e ⎛ 2  1 ⎞
(3) 0  12 (4) 0  ⎜
⎝ 2 ⎟⎠
(1) t (2) (0,0)
t
(0,0)
11. In an LCR series circuit voltage across resistor,
inductor and capacitor are same and is 50 V. If
capacitor is short circuited then the voltage across
e e inductor will be (Assume same a.c. voltage source
remains connected)
(3) (0,0)
t (4) (0,0)
t
(1) 25 2 V (2) 25 V
(3) 50 2 V (4) 100 V

8. Current (i) in a circuit varies with time (t) as shown.
12. An A.C. voltage V = 20 sin (80t) is applied to a
circuit. How many times current in circuit becomes
i zero in 2 second?
(1) 40 (2) 80
i0
(3) 160 (4) 240
13. A part of complex circuit is shown in the diagram.
t If at an instant current is from A to B and is 2 A and
(0, 0) T0
the potential difference between point A and B is
The rms value in T0 interval is di

zero, then the is
dt
i0 2
(1) (2) i0 1 10 V 0.2 H
3 3
A i=2A B
3 (1) 4 A/s (2) 20 A/s
(3) i0 (4) i0
2 (3) 30 A/s (4) 40 A/s
2/25
14. There are two L-R circuits shown. Key is closed 16. A metallic ring is kept on a hard paper (which is
simultaneously at t = 0. Current grow in both circuits transparent to magnetic field) such that its centre
are shown. coincide with the axis of a long solenoid as shown.
R R If current in solenoid is switched on then normal
reaction between ring and paper will
(1) L1 (2) L2
E E
i
imax
(1) K
(2)
t
R
Then (1) Decrease

(1) L1 > L2 (2) Increase
(2) L1 < L2
(3) Remain unchanged
(3) L1 = L2
(4) First decreases and then increases
(4) L1  L2
17. When key is at position 1 reading of ammeter is x.
15. An LCR series circuit is shown in the figure. If angular When key is shifted to position 2, what is reading
frequency of applied voltage signal is 1.5 × 102 rad/s, of ammeter just after shifting key from position
then the circuit behaves like 1 to 2 having same flux?
2 0.2 mH 8 F Key
1 2
3L R
L
2
E
A
 = 1.5 × 10 rad/s
2
(1) R only circuit 3

(1) x (2) x
(2) L-R circuit 2
(3) C-R circuit
2
(4) L-C circuit (3) x (4) Zero
3
3/25
18. Three pairs of inductor coils are shown in the

 
diagram. Rank them with increasing coefficient of
mutual inductance
(3) (0, 0)
t (4) t
(0, 0)
Soft iron core
2
A. 1
20. In L-C oscillation, if frequency of oscillation of
electrical energy is f0, then frequency of oscillation
of charge in the circuit will be
2 (1) 2f0
B. f0
1 (2)
2
(3) f0
(4) 4f0
2
21. In L-C oscillation charge in capacitor is maximum at
t = 0. The magnetic and electric energy will be
C. equal in magnitude at (T = Time period of oscillation
1
of charge)
2T 11T
(1) B < A < C (2) A < C < B (1) (2)
3 8
(3) B < C < A (4) C < B < A
19. Flux passing through a loop is changing with time T 5T
as shown in the figure. Select correct graph (3) (4)
3 6
between induced emf () and t.
 22. Select correct statement regarding ideal
= 2t2 transformer
(1) Input and output both have same frequency
and phase
t
(2) Input and output both have same power and
phase
 
(3) Input and output both have same power and
frequency
(1) (0, 0)
t (2) (0, 0)
t
(4) Input and output both have different frequency
but same power
4/25
23. Instantaneous energy density, average energy 27. A square plate of side 20 cm is kept in yz-plane in
density and poynting vector in a region where
a region where magnetic field B  (4iˆ  6 jˆ  2kˆ ) T .
electromagnetic wave is propagating is given U, Uav
and S respectively then, select correct match The magnitude of magnetic flux passing through the
loop is
1
a. U = 0E2 b. U 0 E 2 (1) 16 weber (2) 0.16 weber
2
(3) 0.4 40 weber (4) 2.4 weber
EB
c. Uav = 0E2 d. S 28. Self inductance L of a coil of length l and area of
0
cross-section A, and total number of turns N,
Then increase with increase in
(1) a, c & d (2) b & c (1) i and N (2) i and A
(3) a & d (4) b & d (3) i and l (4) N and A

24. Which of the following cannot do work? 29. The Gyromagnetic ratio of electron in hydrogen
atom in view of Bohr’s model is
(1) Time varying magnetic field
(1) Positive and increases with increase in orbit
(2) Electric field
(2) Positive and decreases with increase in orbit
(3) Lorentz force
(4) Uniform magnetic field (3) Negative and decreases with increase in orbit
25. When a bar magnet is kept at 40°C temperature (4) Negative and remains unchanged with orbit
then 30. A circular loop and a square loop are entering into
(1) All domains are perfectly align a region of uniform magnetic field with constant
speed
(2) Atoms have non zero magnetic moment and all
are perfectly aligned R v0
(3) Atoms have zero magnetic dipole moment
(4) Domains are partially aligned
26. Though protons also have spin motion therefore v0
have magnetic moment even then it is not
considered in magnetism of material but that of
electron is considered because R
(1) Proton lie inside nucleus (1) Induced emf in both are constant
(2) Magnetic dipole moment of proton is much (2) Induced emf in square loop is variable and in
larger than that of electron circular loop is constant
(3) Magnetic dipole moment of proton is much (3) Induced emf in circular loop is variable and in
smaller than that of electron square loop it is constant
(4) Net magnetic moment of protons is always zero (4) Induced emf in both loops are variable
5/25

m 33. Magnetic field due to a short bar magnet is BA on
31. A square loop PQRS of mass , side l is attached
2
its axis at d distance (d >> l) and B on its
with a balance by insulating wire. When block of
mass m is kept in the massless pan and current i perpendicular bisector at d distance. Select correct
flows in the loop, then balance beam is horizontal relation
as shown in the figure. The value of i is
(1) BA  2B
l/2 l/2
(2) BA  2B
Insulator
m wire

i (3) BA  B
P Q
(4) Both (1) & (2)
S R 34. The plane of dip circle is in magnetic meridian, now

l B0 it is rotated by 90° then
mg (1) Needle in dip circle will make 45° with

(1) lB horizontal
0
mg (2) Needle in dip circle will become parallel to

(2) 2lB horizontal
0
3mg (3) Needle in dip circle will become vertical

(3) 2lB
0
(4) Needle in dip circle will become free and stands
2mg in any direction
(4) lB0
35. Diamagnetism is universal property which is also
32. A charged particle is revolving along a circular path present in para and ferromagnetic material because
of radius r with time period T. The shape of graph
(1) Magnetism is produced in a substance primarily
drawn between magnetic moment and time period
due to alignment of atomic dipole
is
(1) Circular
due to alignment of domains
(2) Ellipse
(3) Parabola due to spin motion of the constituent electrons
(4) Rectangular hyperbola (4) Both (1) & (2)

6/25
36. Two straight parallel long conductors P and Q are 38. Some long straight conductors carrying current
2x apart, lying perpendicular to plane of paper. either into or out of plane are shown in figure. All
Current in P is out of plane and in Q it is into the conductors carry same magnitude of current. Line
plane. The variation of magnetic field along xx is integral of magnetic field taken clockwise around
best represented by each loop is most positive for
4
1
I I
(1) x x
P Q
2
x x
5
3
(1) 4 (2) 1
I Q I
(2) x x (3) 3 (4) 5
P
39. Two current loops are kept in uniform magnetic field
x x
as shown in the figures, then
i i
B0
i B
I Q I 0
(3) x x 1
P
x x i 2

(1) On loop 1, FN  0,   0

(2) On loop 1, FN 0,   0
I I
(4) x x
P Q (3) On loop 2, FN 0,  0
x x
(4) On loop 2, FN 0,   0

37. Current I is flowing in a long straight conductor kept 40. A proton is projected in a uniform magnetic field B

along x-axis, a current loop is kept near by it as with velocity v at angle (0° <  < 90°). After what
shown in the figure. The loop displaces time velocity of charged particle will be identical to
initial velocity
y v
m
I (1)
qB
2m
x (2)
i0 qB
4m
(3)
(1) Along +ve x-axis (2) Along –ve x-axis qB
(3) Along +ve y-axis (4) Along –ve y-axis (4) Both (2) & (3)
7/25
41. A positron and an electron moving with same 0 i R
(1) Zero (2)
velocity v 0 each, enter into a perpendicular 2
magnetic field B0 directed into the plane of paper as 0 iR 0 i R
shown. The separation between them after time (3) (4)
2 4
m 44. A rod PQ is made of wood and copper. It is rotating
is
2eB with angular speed  about axis normal to plane
y through P. The potential difference between point P
and R is plotted against x. Select correct plot.
v0
t = 0 ep x
v0
L1 L2
P Wood Cu Q
 x R
2mv 0 mv 0
(1) eB0 (2) eB
0
mv 0 2 mv 0 V P – VR V P – VR
(3) (4) 2eB
eB0 0
42. Which of the following is correct regarding ideal (1) (2)

toroid of closely wound turns as shown in the figure? x x
L1 L2 L1 + L2
VP–VR VP–VR
C
Q P
(3) (4)
x x
L1 L2 L1 L2
I
I 45. Select correct statement regarding electromagnetic
(1) Magnetic field at P = 0, at Q  0 wave
(2) Magnetic field at P  0, at C  0 (1) Concept of electromagnetic wave was given by
(3) Magnetic field at Q  0, at C  0 Maxwell
(4) Magnetic field at P = 0, at C  0 (2) Hertz produces and detected electromagnetic

waves in lab
43. A circular loop of radius R carrying current i is kept
on xy plane so that centre of ring is at origin. The (3) Electromagnetic wave is transverse in nature
total flux passing through x-y plane is (4) All of these
8/25
[ CHEMISTRY ]
46. How many structural isomers of alcohols with the (1) II > III > I (2) I > II > III
formula C4H9OH are possible if all the carbon are (3) I > III > II (4) II > I > III
in straight chain?
51. Which one of the following cannot act as an
(1) 4 (2) 5 electrophile?
(3) 2 (4) 3 (1) BF3 (2) C2H5O–
47. Which one of the following structures does not have
 
molecular formula C5H10? (3) NO2 (4) CH3 – C = O
(1) (2) 52. The following reaction is an example of

CH2
Zn-dust
(3) (4) CH2 CH2 + ZnBr2
48. Which of the following is secondary butyl group? Br Br

(1) -elimination (2) -addition
(1) CH3–CH2–CH– (2) CH3–CH–CH–
(3) -addition (4) -elimination
CH3 CH3 CH3
53. IUPAC name of the following compound is
CH3 CH2 – CH – CH2
(3) H3C–C– (4) CH3CH2CH2CH2– CN CN CN
CH3 (1) 3-cyanopentane-1,5-dinitrile
49. How many cyclic (only structural) isomers of (2) Propane-1,2,3-tricarbonitrile
molecular formula C3H6O are possible? (3) Propane-1,2,3-trinitrile
(1) 6 (2) 4 (4) Propane-tricyanide
(3) 3 (4) 2 54. Which one of the following is the most stable
50. The correct order of stability of the following cycloalkane?
structures is
+
(1) (2)
O O
CH2 = CH – C – H : CH2 – CH = C – H
(I) (II) (3) (4)
_ 55. The total number of geometrical isomers for the

O compound hexa-1, 3, 5-triene is
+
: CH2 – CH = C – H (1) 2 (2) 3
(III) (3) 4 (4) 5
9/25
56. Arrange the following carbocation in the order of 61. On complete combustion of 24.6 g of an organic
stability compound, 19.8 g of CO2 and 10.14 g of H2O is
obtained. The approximate percentage of C and H
 
in the organic compound is respectively
 
(1) 22% and 4.6% (2) 22% and 78%
(3) 78% and 22% (4) 4.6% and 95.4%

(I) (II) (III) (IV)
62. Which one of the following pairs of compounds are
(1) I > II > IV > III (2) I > IV > II > III isomers to each other?
(3) IV > I > II > III (4) IV > I > III > II
(1) and
57. Which one of the following molecules will show
resonance?
(2) CH3–CH2–CH2–CH3 and

(1) (2)
O N (3) H3C – N – CH3 and H3C – N – C2H5
CH3 H
(3) (4) All of these
N O O
H (4) C6H5 – C – Cl and C2H 5 – C – Cl

58. H2C = CH – C  C – H
63. The correct order of negative inductive effect is
The hybridisation of the 1st carbon atom is
(1) F > NH2 > NO2 (2) NO2 > NH2 > F
(1) sp (2) sp2
(3) NO2 > F > NH2 (4) F > NO2 > NH2
(3) sp3 (4) sp and sp2
64. Which one of the following will give most stable
59. The prussian blue colour obtained during the enol-form?
Lassaigne test of nitrogen is due to the formation of
(1) Fe4[Fe(CN)6]3 (2) K4[Fe(CN)6] O

(1) (2)
(3) Na3[Fe(CN)6] (4) Fe(CNS)3
O
60. On treating sodium fusion extract with sodium
O
nitroprusside, a violet colour formation indicate the O
presence of
(1) Sulphur (2) Phosphorus (3) (4)
(3) Nitrogen (4) Carbon O

10/25
65. Which of the following will have maximum number
of hyperconjugative structures? 70. In pyridine number of conjugated -electrons
CH3 C2H5 N
(1) (2) is
(1) 6 (2) 8
CH – CH3 C(CH3)3 (3) 0 (4) 5
71. The number of metamers possible for the molecular
(3) CH3 (4)
formula C4H10O is
(1) 7 (2) 4
66. Which of the following is temporary effect?
(3) 3 (4) 5
(1) Inductive effect (2) Electromeric effect
72. Which of the following compound has empirical
(3) Resonance effect (4) Hyperconjugation formula same as the empirical formula of
67. Which one of the following is homolytic fusion? CH3COOH?
(1) A – A  •A + •A (2) A – B  A+ + B– O
(3) A – B  A– + B+ (4) A2B  2A+ + B–2
(1) CH 3 – CH2 – C – O – O – H
68. The type of reaction is
OH– O
C6H5CHO + CH3COCH3
(2) CH 3 – CH2 – C – OH
C6H5CH (OH)CH2COCH3
(1) Addition (2) Substitution O
(3) Condensation (4) Elimination (3) CH 3 – C – O – CH3
69. Which of the following pair of structure constitute
resonance structures? O
(4) H – C – O – H
O
+
(1) CH3 – N and H3C – O – N = O 73. Identify the product (C) in the following series of
– reaction.
O
– Br2 (1 eq) alc. KOH
O O (A) (B) NBS (C)
h
(2) CH3 – C and CH3 – C
– Br
CH2 CH2 Br
(1) (2)
OH
(3) (CH3)2CO and CH3 – C
CH2 Br
(4) CH3–CH = CH–CH3 and CH3–CH2–CH = CH2 (3) (4)
11/25
74. Identify the product (A) in the following reaction 77. An alkylbromide (A) forms a Grignard reagent which
on treatment with water yield n-hexane. When A is
CH3 –
C2H5O treated with sodium in dry ether, 4, 5-diethyloctane
CH 3 – C – CH2Br A is formed. The structure of A is
SN1 (Major)
CH3 (1) CH3CH2CH2CH2CH2CH2Br
CH3
Br
(1) CH 3 – C – CH2CH3
(2) CH3CH2CH2CH2CHCH3
OC 2H5
CH 3 Br
(2) CH3 – C – CH2OC2H5 (3) CH3CH2CH2CHCH2CH3
CH 3
Br Br
CH3
(4) CH3CHCHCH2CH2CH3
(3) CH3 – C = CHCH3
CH3 78. During antidebromination of meso-dibromobutane
the major compound formed is
(4) CH 3 – C – CH3
(1) n-butane (2) 1-butene
CH3
75. The major product formed in the reaction is (3) Cis-2-butene (4) Trans-2-butene
CF3CH = CH2 + HCl  79. The product (A) formed in the following reaction
Cl CH3
(1) CF3CH – CH3 , by Markownikoff’s rule High Temp.
+ Cl2 UV
(A)
(2) CF3CH2CH2Cl, by anti-Markownikoff’s rule (Excess)
CH3
(3) CCl3CH = CH2, by substitution reaction
(4) CF2CH2CH2F , by rearrangement reaction Cl
CH3 Cl CH3
Cl
76. Compound A(C 6 H 14 ) gives three different (1) (2)
monochlorides on photochemical chlorination. One CH3 Cl CH3
of the monochlorides is inert to E-2 elimination, then
that monochloride is
Cl
CCl3 Cl CH3
(1) (2)
Cl Cl (3) (4)
Cl CCl3 Cl CH3
(3) (4) Cl Cl
12/25
80. Arrange the following compounds in order of 83. Alkyl iodides can be best prepared by
decreasing reactivity towards nucleophilic aromatic
CCl4
substitution. (1) RCH2COOAg  I 2   RCH2I
acetone
Cl Cl Cl (2) RCH2Cl + NaI  
 RCH2I + NaCl
NO2
(3) CH4 + I2  CH3I
(4) All of these
(i) NO2 NO2 84. Which of the following reactions is feasible?
(ii) (iii) Cl NH2
NaNH2,NH3
(1) (i) > (ii) > (iii) (2) (iii) > (ii) > (i) (1)
(3) (ii) > (iii) > (i) (4) (i) > (iii) > (ii)
81. Which of the following compound is most reactive Br

H3C CH3
towards chlorination in presence of anhydrous NaNH2,NH3
AlCl3? (2)
H3C CH3
Cl COOH
NH2
(1) (2) H3C CH3
H3C CH3
NO2 CH3
Br NH2
(3) (4) H3C H3C
CH3 NaNH2, CH3
NH3
(3)
82. The major product in the following reaction is
CH3CH2CHBrCH3 + (CH3)3COK  ? CH3 CH3
(1) CH3CH2CHCH3 Cl
CH3O CH2CH3
OC(CH3)3 NaNH2,NH3
(4)
(2) CH 3CH2CHCH3
OH NH2
CH3O CH2CH3
(3) CH3CH2CH = CH2
(4) CH3CH = CHCH3

13/25
85. Which of the following statements about (1) i > ii > iii > iv (2) iv > iii > ii > i
Borodine-Hunsdiecker reaction is not true?
(3) iv > ii > iii > i (4) iv > iii > i > ii
(1) Hunsdiecker reaction occurs by a free-radical
mechanism 89. When isobutyl magnesium bromide in dry ether is
heated with absolute ethyl alcohol. The products
(2) It is used to reduce the length of carbon chain
formed are
(3) Bromides are obtained in good yield by this
reaction (1) CH3 – CH – CH2OH and CH3CH2MgBr
(4) The yield of alkyl or aryl halide decreases in the CH3
order : 3° > 2° > 1°
86. Which of the following is most reactive for (2) CH3 – CH – CH2CH2CH3 and Mg(OH)Br
electrophilic addition reaction?
CH 3
(1) CH3 – C CH
(2) CH3 – CH CH2 (3) CH 3 – CH – CH 3 and CH3CH2O MgBr
CH3
(3)
(4) CH3 – CH – CH3, CH  CH and Mg(OH)Br
(4) CH CH
CH 3
87. Conversion of chlorobenzene to phenol by Dow’s
process follows 90. The reaction,
(1) Free radical mechanism (CH3)3CBr + CH3CH2ONa  P
(2) Carbocation mechanism (Major)
(3) Benzyne mechanism
(1) CH 3 – C = CH 2
(4) Carbanion mechanism
88. The correct order of reactivity of the following CH3
alcohols towards conc. HCl is
CH3
CH3
(i) F – CH2 – CH (2) CH3 – C – OCH2CH3
OH CH3
(ii) F – CH2 – CH2 – CH – CH3
CH2CH3
OH
(3) CH3 – C – OCH3
(iii) CH3 – CH – CH3
CH3
OH
(iv) PH–CH2–OH (4) (CH3)3C–CH2CH3
14/25
[ BIOLOGY ]
91. Choose correct labels for given diagram. 92. Transforming principle transferred from S-strain
bacteria had enabled R bacteria to synthesize
______ and become ______.
(A)
(1) Proteinaceous coat, non-virulent
(2) Polysaccharide coat, non-virulent
(3) Proteinaceous coat, virulent
(4) Polysaccharide coat, virulent
1. Infection
93. Read the following statements w.r.t. DNA packaging
in prokaryotes
(1) DNA is not scattered throughout the cell
2. Blending (2) Large loops are held by proteins
(3) Involves DNA and positively charged proteins
3. (C) (4) More than one option is correct
Radioactivity 94. What is the number of glycosidic linkages in DNA
detected
in cell (B) of Escherichia coli?
(1) 4.6  106
(1) A – Radioactive capsid (2) 2  4.6  106
B – Supernatant (3) 4.6  106 – 2
C – Centrifugation (4) 4.6  106 – 1

95. How many of the given functions are performed by
(2) A – Radioactive capsid RNA in eubacteria?
B – Sediment Catalyst, Genetic material, Splicing, 28S rRNA
C – Agitation as ribozyme, Peptidyl transferase
(3) A – Radioactive DNA (1) Three (2) Four

(3) Two (4) Five
B – Sediment
96. DNA dependent DNA polymerases can
C – Centrifugation (1) Initiate the process of replication
(4) A – Radioactive DNA (2) Initiate replication randomly at any place
(3) Catalyse polymerisation only in one direction
B – Supernatant
(4) Use deoxyribonucleotide triphosphates as
C – Centrifugation substrate
15/25
97. Choose correct option w.r.t. regulatory sequences 102. Minisatellite represent _____DNA sequence
which are part of transcription unit arranged tandemly in _______ copy numbers.
(1) Present upstream or downstream to the (1) Small, few (2) Large, many
promoter
(3) Small, many (4) Large, few
(2) May be defined as regulatory genes
(3) Do not code for any RNA or protein 103. Which of the following complex is formed at first
during the initiation of translation in Rhizobium ?
(4) More than one option is correct
98. In which of the following RNA unusual nucleotides (1) 50S subunit – mRNA complex
are present in eukaryotes? (2) 60S subunit – mRNA complex
(1) rRNA, hnRNA (2) mRNA, tRNA
(3) 30S subunit – mRNA complex
(3) hnRNA, mRNA (4) hnRNA, tRNA
(4) 40S subunit – mRNA complex
99. How many types of amino acids will be coded by
the given sequence of nitrogenous bases in the 104. Which of the following hosts were used for cloning
mRNA? in HGP?
AUG UUU UUC UUC AUG UGG UUU UAG (1) Bacteria, Algae (2) Algae, Yeast
(1) Four (2) Five
(3) Yeast, Protozoan (4) Bacteria, Yeast
(3) Three (4) Six
105. Choose correct option w.r.t. genes of lac operon
100. Which of the following sequence represents the
negative control of lac operon? Gene Expression Type Product
(1) Lactose  Binds with promoter  Transcription (1) y Constitutive Structural Non Catalytic
stops gene protein
(2) Repressor  Binds with promoter  (2) p Non- Non structural Catalytic
Constitutive gene protein
Transcription proceeds
(3) Lactose  Binds with operator  Transcription (3) o Absent Structural gene No protein
proceeds
(4) i Constitutive Regulatory Non catalytic
(4) Regulatory proteins  Binds with operator  gene protein
Transcription stops
101. Hypothetical DNA sequence (for one strand) for two 106. Saccharum barberi was crossed with _______
humans is given. Which of the following type of resulting in formation of sugarcane varieties which
variation is represented by these sequences? possess _____.
A– ATGCTATATATTTAATTATGCTTCC (1) Tropical canes, High fibre content

B– ATGCTATATAATTAATTATCCTTCC (2) North Indian cane, High sugar content
(1) VNTR (2) Satellite DNA (3) Nobel cane, High yield
(3) SNP’s (4) Repetitive DNA (4) South Indian cane, High fibre content
16/25
107. Choose incorrect option : 111. The shift from grain to meat does not solve the
problem of food scarcity as it takes
Variety Crop Developed in
(1) IR - 8 Rice Philippines (1) 30 kg of grain to produce 1 kg of meat
(2) TN - 1 Rice Taiwan (2) 3-10 kg of grain to produce 10 kg of meat

(3) Jaya Rice Mexico (3) 3 kg of grain to produce 10 kg of meat
(4) Sonora-64 Wheat Mexico (4) 3-10 kg of grain to produce 1 kg of meat
108. Choose the correct sequence of steps for 112. Which of the following explant is used for recovery
conventional method of breeding for disease of healthy plants from diseased plant?
resistance.
(1) Embryo, Pollen
a. Selection of hybrid (2) Apical, Axillary bud
b. Hybridisation (3) Protoplast, Anther
c. Mutating the crop (4) Pollen, Apical bud
d. Screening germplasm for resistance 113. Which of the following step is not involved in the
formation of somatic hybrid?
e. Testing of variety
(1) Fusion of naked protoplasts
(1) c  d  b  a  e (2) Digesting cell with cellulases and nucleases
(2) d  c  b  a  e (3) Hybrid protoplasts are grown to form new plant
(3) d  b  a  e (4) Both (2) & (3)
114. How many of the given features are associated with
(4) b  d  c  a  e
tissue culture?
109. Solid stems in wheat leads to non-preference by
Based on totipotency, Somaclone production,
(1) Stem borers Slow method, Thousands of plants produced,
(2) Stem sawfly Form intergeneric hybrids, Fast production,
Used for crop improvement
(3) Jassids
(1) Four (2) Five
(4) Bollworms
(3) Six (4) Three
110. Protina, Shakti and Rattan are rich in 115. Which of the following is very time consuming and
(1) Iron and Minerals tedious step in plant breeding?
(1) Testing of cultivars
(2) Vitamin A and Calcium
(2) Selection of hybrid
(3) Lysine and Tryptophan
(3) Selection of parents
(4) Calcium and Iron (4) Cross hybridisation
17/25
116. Green revolution was dependent on plant breeding 121. Which of following pair of products are produced by
technique for developing high yielding verieties of fermentative activity of bacteria?
(1) Rice, maize, wheat (1) Toddy, Bread

(2) Rice, castor, wheat (2) Dosa, Idli
(3) Rice, maize, potato (3) Swiss cheese, Toddy
(4) Wheat, tomato, pea (4) Bread, Roquefort cheese
117. The two main features, the plant breeders have 122. Antibiotics
tried to incorporate into crop plants are
(1) Are obtained from prokaryotic and eukaryotic
(1) Increased yield, improved quality organisms
(2) Resistance to pest, salinity tolerance
(2) Are most significant discoveries of 19th century
(3) Pathogen resistance, drought resistance
(3) Are used to treat deadly diseases like
(4) Pest tolerance, increased yield gal ghotu, colour blindness
118. Variety of wheat resistant to hill bunt disease is (4) Means ‘pro life’ w.r.t. pathogen
(1) Karan Rai 123. Fruit juices are made clearer by the activity of
(2) Himgiri (1) Lipases and cellulases
(3) Pusa Komal
(2) Pectinases and proteases
(4) Pusa Sadabahar
(3) Cellulases and nucleases
119. Pusa Sawani and Prabhani Kranti are varieties of
okra produced through ______, ______ plant (4) Lipases and amylases
breeding respectively. 124. Lactic acid bacteria (LAB)
(1) Conventional and conventional (1) Completely digest the milk proteins
(2) Mutational and conventional (2) Can check disease causing microbes
(3) Conventional and mutational
(3) Produce acid at any temperature
(4) Mutational and mutational
120. IARI, New Delhi has developed biofortified spinach
125. Blood cholesterol lowering agent is obtained from a
which is rich in
(1) Amino acids and iron (1) Bacteria, Monascus
(2) Protein and minerals (2) Fungus, Trichoderma
(3) Vitamins and minerals (3) Bacteria, Streptococcus
(4) Oil and micronutrients (4) Fungus, Monascus

18/25
126. Choose odd one w.r.t. sewage 131. Baculoviruses are

(1) Is municipal waste-water (1) Narrow spectrum bacteriocides
(2) Major component is human excreta (2) Non specific insecticides
(3) Contains small amount of organic matter and
(3) Broad spectrum fungicides
microbes
(4) May have pathogenic microbes (4) Specific insecticides
127. In STP, secondary treatment involves 132. Which of the following autotrophic organism is
widely distributed in aquatic and terrestrial
(a) Agitation (b) Aeration
environments and can fix atmospheric nitrogen?
(c) Decomposition (d) Filtration
(1) Frankia (2) Rhizobium
(e) Chlorination
(3) Glomus (4) Anabaena
Choose correct option
133. Millions of gallons of waste water is treated
(1) (a), (d), (e) (2) (a), (c), (d)
everyday across the globe by using
(3) (a), (b), (c) (4) (b), (c), (e)
(1) Chemical treatment
128. Microbes produce different types of gaseous end
products during growth and metabolism. Certain (2) Physical treatment
bacteria can produce large amount of CH4. These
(3) Microbial treatment
bacteria are found in
(4) Conventional treatment
(1) Activated sludge, dung
(2) Anaerobic sludge, cattle rumen 134. Mesh like structures formed during sewage
treatment represents
(3) Gobar, cattle excreta
(1) Protozoa + Fungi
129. Biogas is mixture of (2) Bacteria + Fungi
(1) CH4, CO, N2 (2) CH4, O2, H2 (3) Yeast + BGA
(3) CO2, CH4, H2 (4) CS2, H2S, H2 (4) Protozoa + Bacteria

130. Organic farmer holds the view 135. Choose correct match
(1) Of eradicating pests completely (1) Penicillin – Used in World War-I
(2) Of keeping pests at manageable levels
(2) Aspergillus – Butyric acid
(3) That eradication of pests is possible and
(3) Streptococcus – ‘Clot buster’
desirable
(4) Of controlling pest by chemical methods (4) Brewer’s yeast – Bread making
19/25
136. If we observe any wild plant or animal, they exist in 141. Which surviving connecting link is a correct
different sizes, configurations even within same evidence of organic evolution?
species. It is due to
(1) Lung fish between fish and reptiles
(1) Food chains (2) Variations
(2) Archaeopteryx between reptiles and birds
(3) Selective breeding (4) Genetic drift
(3) Coelacanth between cartilage and bony fish
137. The basic unit of evolution according to synthetic
theory of evolution is (4) Echidna between reptiles and mammals
(1) Individual (2) Population 142. Appearance of antibiotic resistance in bacteria is an

example of
(3) Race (4) Species
(1) Adaptive radiation
138. The high frequency of sickle cell gene in parts of
Africa is explained by (2) Transduction
(1) The selective advantage that is accrued to the (3) Pre-existing variation in the population
heterozygotes because of their resistance to
(4) Divergent evolution
malaria
143. Which of the following is an element of the writings
(2) Affected individuals reached Africa and are
of Malthus that influenced Darwin?
founders of the present population
(3) Gene flow (1) Artificial selection
(4) Inbreeding (2) The potential for population growth exceeds

what the environment can support
139. Of the following which mixture, Miller used to solve
the problem of origin of life? (3) Species become better adapted to their local
environments through natural selection
(1) Methane – Ammonia – Oxygen – Water
(4) Favourable variations accumulated in a
(2) Methane – Ammonia – Hydrogen – Water population after many generations of being
(3) Ethane – Ammonia – Oxygen – Water perpetuated by natural selection
(4) Ethane – Ammonia – Hydrogen – Water 144. In which geological period seed ferns originated?
140. The process of evolution of different species in a (1) Carboniferous (2) Cretaceous
given geographical area starting from a point and
(3) Silurian (4) Devonian
literally radiating to other areas of geography is
called as 145. For origin of life, it was necessary that there must
have been a supply of replicators i.e. self producing
(1) Adaptive radiation
molecules. It is supposed that the first replicators
(2) Divergent evolution must have been
(3) Convergent evolution (1) Viruses (2) RNA
(4) Parallel evolution (3) DNA (4) Proteins
20/25
146. Initially early humans/hominids were food-gatherers 150. There is a great diversity in the feature of Darwin’s
but later they became food producers with the finches. Their beaks are adapted for various feeding
advent of agriculture around habits. The following finches are found in
Galapagos islands, except
(1) 10,000 years ago
a. Fruit eaters
b. Fish eaters
c. Insect eaters
d. Carrion feeders
147. Colonization of a new habitat by a very small
e. Cactus eaters
number of individuals leads to
f. Seed eaters
(1) Bottle-neck effect
(1) a, c & e
(2) Founder effect
(2) b, c & d
(3) Stabilising of allelic frequencies in the original
population (3) b & d
(4) Disruptive selection (4) c, d & e
148. Giraffes in an attempt to forage leaves on tall trees A

151. can lead to stabilisation in which more
stretched their neck resulting in elongation. This trait individuals acquire mean character value. Which of
was passed on to succeeding generations. Such the following option correctly fills up the blank A.
ideas are explained in
(1) Variation
(1) Origin of species by Natural Selection
(2) Mutation
(2) Philosophic Zoologique
(3) Natural selection
(3) Descent of man in relation to sex
(4) Genetic recombination
(4) Process of Organic Evolution
152. What is true for wombat, banded anteater,
149. Choose the incorrect match linking human Tasmanian wolf and sugar glider?
evolution to brain size and dietary preference
(1) These are Australian eutherian mammals
Hominid Brain Dietary
species volume preference (2) These are adapted for burrowing
(1) Australopithecus 450 c.c. Nuts, fruits (3) These are examples of adaptive radiation from
(2) Homo habilis 700 c.c. Fruits, roots a common ancestor
(3) Homo erectus 900 c.c. Meat
(4) These show convergent evolution in an isolated
(4) Neanderthal man 850 c.c. Meat geographical area
21/25
153. The following evolutionary changes have occurred 157. Darwin’s theory of natural selection to explain
due to anthropogenic activity, except organic evolution was based on
(1) Selection of melanic form of peppered moths (1) Modifications of organs through use and disuse
during industrial revolution
(2) Prodigality of reproduction, struggle for
(2) Extinction of giant reptiles existence and survival of the fittest
(3) Selection of antibiotic resistant strains of (3) Inheritance of acquired characters
bacteria
(4) Appearance of sudden large variations, then
(4) Extinction of cheetah inheritance and survival of those having these
154. Which of the following factor/s do not affect variations
Hardy-Weinberg equilibrium? 158. Choose the incorrect statement
a. Gene migration (1) Postzygotic isolating mechanisms lead to hybrid
b. Genetic recombination zygotes developing abnormally or failing to
develop entirely or hybrids not being able to
c. Random mating become established in nature
d. Genetic drift (2) Mutations are random and directionless while
e. Gene flow Darwinian variations are small and directional
Options (3) A deviation from the genotype frequencies

predicted by Hardy-Weinberg principle is
(1) a & b (2) a, b & c caused by random mating
(3) c only (4) c & e (4) Genetic drift is statistical accident where
155. Choose the correct statement regarding natural frequencies of a particular alleles may be
selection : changed drastically by chance alone in small
populations
(1) In a mixed population, those that can better
adapt, they survive and increase their progeny 159. Which of the following cells are not included in
cellular barriers?
(2) The weaker variant gets completely wiped out
(1) Neutrophils (2) Helper T cells
(3) Mostly the selection is of disruptive type
(3) NK cells (4) Macrophages
(4) The largest and strongest organisms in a
population are selected 160. The short-lived antibody-secreting B-cells are called
156. Mammals evolved from therapsid reptiles in Triassic (1) Plasma cells
period. The type of skull in these reptiles was (2) Histiocytes
(1) Diapsid skull (2) Anapsid skull (3) Keratinocytes
(3) Parapsid skull (4) Synapsid skull (4) Dendritic cells
22/25
161. The four polypeptide chains of the antibody 165. Short-lived immunity acquired from mother to foetus
molecule are held together by across placenta and through mother’s milk to infant
is respectively due to
(1) Peptide bonds
(2) Disulphide bonds (1) IgG, IgM
(3) Ionic bonds (2) IgA, IgG
(4) van der Waal’s interactions (3) IgG, IgA

162. Many diseases are spread by insect vectors. One (4) IgG, IgD
such major vector is mosquito which spreads all of
the following diseases, except 166. Which of the following disease is acquired from soil
but not through faeco-oral route?
(1) Chikungunya
(1) Tetanus, Ringworm
(2) Filariasis
(3) Ascariasis (2) Ascariasis, Amoebiasis
(4) Malaria (3) Typhoid, Tetanus
163. Choose the option which describes the physical (4) Tetanus, Taeniasis
barrier of innate immunity.
167. Choose the option where the disease does not
(1) Acid in the stomach, saliva in the mouth, tears match with its mode of transmission from the patient
from eyes prevent microbial growth to the healthy person.
(2) Mucus coating of the epithelium lining the (1) Pneumonia – Air-borne/droplet
respiratory, gastrointestinal and urinogenital
tracts help in trapping microbes entering our (2) Typhoid – Contaminated food and
body water
(3) Chemical like interferons protects cells from (3) Filariasis – Bite by female Anopheles
viral infection vector
(4) Rejection of an allograft (4) Sleeping sickness – Bite by tse-tse fly
164. Natural killer cells kill virus-infected cells and some
168. The presence of typhoid fever in a person can be
tumour cells by producing
confirmed by
(1) Histamine and prostaglandin
(1) ELISA test
(2) Perforins that form channels in the plasma
membrane of target cells (2) Widal test
(3) Phagocytic effect (3) Wayson-stain test
(4) Lysozyme (4) Schick’s test

23/25
169. Read the following four statements A, B, C and D 173. Most diseases can be diagnosed by observing the
which are the description of events in the life cycle symptoms in the patient. Which group of symptoms
of Plasmodium vivax. Select the right option having are indicative of amoebiasis?
both the correct statements.
(1) Difficulty in respiration, fever, chills, cough,
a. Parasites reproduce asexually in the red blood headache
cells, bursting the red blood cells and causing
(2) Constipation, abdominal pain, cramps, blood
cycles of fever and other symptoms.
clots and mucous in stools
b. Sexual stages gametocytes develop in stomach
of mosquito. (3) Nasal congestion and discharge, cough, sore
throat, headache
c. Fertilisation and development take place in the
stomach/intestine of mosquito. (4) High fever, malaise, stomachache, loss of
appetite and constipation
d. Female mosquito takes up gametes with blood
meal. 174. The following table shows certain diseases, their
causative organisms and symptoms. Choose the
Options option which correctly fills the gaps in the table.
(1) a & b (2) b & c Name of Causative
Symptoms
disease organism
(3) a & c (4) c & d
(i) Ascariasis Ascaris __________ (A)
170. Grafts from just any source – an animal, another
primate or any human being cannot be made since (ii) _________ (B) Trichophyton Appearance of dry,
scaly lesions on
the grafts would be rejected by various parts of body
(1) B-cells (2) Cytotoxic T-cells

(iii) _________ (C) Rhino virus Nasal congestion and
discharge, sore throat,
cough, headache
(3) Helper T-cells (4) Suppressor T-cells
(iv) Filariasis ________ (D) Inflammation of
lower limbs
171. For successful grafting or organ transplantation, it
is essential to match the tissues of the recepient (1) A – Internal bleeding, muscular pain, fever,
and donor. Most successful match will be if the graft anemia and blockage of intestinal passage
is taken from
C – Pneumonia
(1) Parent (2) Sibling
(2) B – Ringworm
(3) Identical twin (4) Fraternal twin
D – Wuchereria
172. When the body is exposed to an antigen for the first
(3) A – High fever, stomach pain, constipation,
time, a low intensity primary response is elicited.
headache and loss of appetite
During this response, the antibodies formed are of
the class C – Common cold
(1) IgM (2) IgG (4) B – Athlete’s foot
(3) IgA (4) IgE D – Dracunculus medinensis
24/25
175. Which of the following class of immunoglobulins can 178. Which of the following is not classified as vaccine?
trigger the complement cascade? (1) Bacterial exotoxin as toxoid
(1) IgA (2) IgM (2) Attenuated or killed pathogens as vaccines
(3) IgD (4) IgE (3) Interferons
176. Read the statements a-d. How many statements (4) Polysaccharide capsules of bacteria
are true for passive immunity?
179. About 65 mya, the dinosaurs suddenly disappeared
a. Anti-tetanus serum administered after an injury. from earth. What can be the possible reason for this
b. An injection of anti-venom after snake bite. mass extinction?
(1) They evolved into birds
c. A newborn vaccinated against Hepatitis-B.
(2) Climatic changes killed them
d. Life time immunity attained by suffering from
chicken pox once. (3) A large meteorite had hit the earth
(1) One (2) Two (4) More than one option is correct
(3) Three (4) Four 180. Gambusia is a
177. Which of the following diseases can be treated by (1) Fresh water fish
antibiotics? (2) Larvivorous fish
(1) Mumps (2) Dengue (3) Bony, viviparous fish
(3) Hansen’s disease (4) Hepatitis (4) All of these

25/25
Test Booklet Code A
Test No. 5
AKASH TE
A ST
IA for
D
SE
IN
MEDICAL
RI
AL L
Entrance Exams.
ES
2014
AIPMT
Test - 5 (Code A) (Answers & Hints) All India Aakash Test Series for Medical-2014
T EST – 5
ANSWERS
1. (1) 37. (4) 73. (4) 109. (4) 145. (4)
2. (4) 38. (1) 74. (3) 110. (1) 146 (2)
3. (4) 39. (3) 75. (4) 111. (2) 147. (3)
4. (1) 40. (2) 76. (2) 112. (3) 148. (3)
5. (4) 41. (2) 77. (2) 113. (4) 149. (4)
6. (3) 42. (1) 78. (4) 114. (4) 150. (1)
7. (4) 43. (2) 79. (1) 115. (4) 151. (4)
8. (1) 44. (1) 80. (2) 116. (2) 152. (2)
9. (3) 45. (2) 81. (1) 117. (2) 153. (3)
10. (2) 46. (3) 82. (4) 118. (2) 154. (2)
11. (2) 47. (1) 83. (1) 119. (4) 155. (3)
12. (3) 48. (3) 84. (3) 120. (3) 156. (4)
13. (2) 49. (1) 85. (2) 121. (4) 157. (2)
14. (4) 50. (1) 86. (2) 122. (2) 158. (2)
15. (3) 51. (1) 87. (4) 123. (4) 159. (3)
16. (3) 52. (4) 88. (3) 124. (1) 160. (3)
17. (3) 53. (3) 89. (1) 125. (3) 161. (3)
18. (4) 54. (1) 90. (4) 126. (1) 162. (2)
19. (1) 55. (3) 91. (4) 127. (3) 163. (3)
20. (1) 56. (1) 92. (4) 128. (4) 164. (3)
21. (3) 57. (2) 93. (3) 129. (4) 165. (2)
22. (2) 58. (3) 94. (4) 130. (2) 166. (4)
23. (1) 59. (2) 95. (2) 131. (4) 167. (3)
24. (1) 60. (3) 96. (4) 132. (3) 168. (2)
25. (4) 61. (2) 97. (1) 133. (2) 169. (4)
26. (2) 62. (4) 98. (3) 134. (4) 170. (2)
27. (3) 63. (2) 99. (4) 135. (1) 171. (4)
28. (1) 64. (1) 100. (4) 136. (4) 172. (2)
29. (1) 65. (1) 101. (2) 137. (3) 173. (3)
30. (4) 66. (3) 102. (4) 138. (1) 174. (2)
31. (3) 67. (1) 103. (3) 139. (3) 175. (4)
32. (3) 68. (2) 104. (1) 140. (1) 176. (3)
33. (3) 69. (2) 105. (2) 141. (3) 177. (3)
34. (3) 70. (3) 106. (3) 142. (2) 178. (4)
35. (2) 71. (1) 107. (4) 143. (3) 179. (4)
36. (3) 72. (1) 108. (4) 144. (4) 180. (4)
1/8
All India Aakash Test Series for Medical-2014 Test - 5 (Code A) (Answers & Hints)
Hints to Selected Questions

[ PHYSICS]
1. Answer (1) 10. Answer (2)
2. Answer (4)
W 6.4  10 19
Flux does not depend upon shape and size of body. VB  VA   4V
q 1.6  10 19
3. Answer (4)
11. Answer (2)
K = for conductors.
4. Answer (1) q

F = qE 4R 2
qE 1 b2 q1
a 
m  2 a 2 q2
a1 q1 m2 2q 2m 4
Hence,    1 b2 a b
a2 q2 m1 q m 1  
2 a 2 b a
5. Answer (4)
1 q
q V 
40 R
12
0° V1 q1 b
Hence, 
V2 q2 a
q q V1 = V2
Resultant of forces will be zero. q1 a

Hence, 
6. Answer (3) q2 b

Total enclosed charge is zero. 13. Answer (2)
Hence electric flux = 0.
kq1q2
8. Answer (1) F
d2

  E·ds
F kq q
5
 12 2
in  ve  5  10 units 16 d
out  4  105 units 1 d 2


16 d 2
Q
Net flux = –1 × 105 =  d
0 ⇒ d 
4
Q  0  105  8.85  107 C 14. Answer (4)
9. Answer (3)
⎛ V ˆ V ˆ V ˆ ⎞
Equipotential surface is always perpendicular to E  ⎜ i  j k⎟
⎝ x y z ⎠
electric field.
2/8
kq kq  Work done is zero.

Potential on inner surface should be = 
b a 24. Answer (1)
But since it is earthed, potential is zero. 0A 0 A
d d
kq kq  a B
  0 ⇒ q   q
b a b A B
17. Answer (3)
k = qV
A 0 A 0 A
Hence kinetic energy does not depend upon mass. d d
18. Answer (4) 0 A
Ceq 
It is an accelerated motion. d

  E ·A l
R
A
A  20iˆ
4
R1 ⎛ r2 ⎞
E  5iˆ  4 jˆ  9kˆ ⎜ ⎟
R2 ⎝ r1 ⎠
20. Answer (1)
4
P ⎛r ⎞
P = 2P  ⎜ 1/2 ⎟
q ⎝ r1 ⎠
4
⎛ 1⎞
⎜ ⎟
–q
P ⎝2⎠
–q +q 1

16
P   2(q )(a )
R2 = 16R1
21. Answer (3)
26. Answer (2)
C1 = C C2 = 2C
Kirchhoff’s first law.
10 V 27. Answer (3)
v d  V . Hence drift velocity is doubled.

A B
28. Answer (1)
Using Kirchhoff’s law,
Colour coding.
q q
VA    10  VB
C 2C 29. Answer (1)
VA = VB = 0 30. Answer (4)
q q
  10 E1  E2 l1
C 2C 
E1  E2 l 2
⎡ 3 ⎤
q ⎢ ⎥  10 31. Answer (3)
⎣ 2C ⎦
2 1R1   2R2
q  10   6  40 C  eff 
3 R1  R2
3/8
2 37. Answer (4)
38. Answer (1)
6 1.5  Slope of V-R graph gives electric field.
I I 39. Answer (3)
3 Potential difference is same hence work done is
same.
6V
40. Answer (2)
6
I 4A Emf is potential drop when current is Zero.
1.5
33. Answer (3) E=2V
34. Answer (3) V = 0.4 
Potential difference across 8 4 V 41. Answer (2)
Using Kirchhoff’s second law, 43. Answer (2)
VA  12  12  18  4  10  VB 44. Answer (1)

45. Answer (2)
VA  VB  48 V
[ CHEMISTRY]
Cr2(SO4)3 , formed by SO2 , is oxidized. 54. Answer (1)
47. Answer (1)
55. Answer (3)
3MnO4– + 5FeC2O4 
56. Answer (1)
3Mn+2 + 12H2O + 5Fe+3 + 10CO2
57. Answer (2)
48. Answer (3)
49. Answer (1) Van Arkel Method (vapour phase refining).
EAN = 24 + 6 + 6 = 36 58. Answer (3)

CFSE = +2 × 0.4 –2 × 0.6
60. Answer (3)
= +0.8 – 1.2
For the same number of unpaired electrons, colour
= –0.4 t
is same.
2
=  t 61. Answer (2)
5
2.68
Moles of complex =  0.01 As P is higher, so pairing does not occur.
267.5
64. Answer (1)
2.87
Moles of AgCl =  0.02
143.5 In metal carbonyls, along with  bond, a bond is
It means 2Cl – ions and formula will be formed between filled orbital of metal and vacant
[CoCl(NH3)5]Cl2. antibonding * orbital of C of CO.
4/8
It is E.C. of Cr24.
Lime
4FeO·Cr2O3 + 8Na2CO3 + 7O2
66. Answer (3) (A)
2Fe2O3 + 8N2CrO4 + 8CO2
Size decreases as we move left to right in lanthanoid (B) (C)
series.
67. Answer (1) 2Na2CrO4 +H2SO4 Na 2Cr 2O 7 + Na2SO4 + H2O

(C) (E) yellow
More number of ions, more will be the conductivity.
Na2Cr2O7 + 2KCl  K2Cr2O7 + 2NaCl
68. Answer (2)
80. Answer (2)
It is cis-platin.
Chalcopyrites is an ore having formula CuFeS2.
Both are same.
O O
70. Answer (3) O Cr Cr O
O
a. Square planar –O O–
b. Tetrahedral 82. Answer (4)
c. Square planar 83. Answer (1)
71. Answer (1) [Pt(NH3)2Cl4] is non-ionisable.
84. Answer (3)

CH 2 – COO 
–
NH 2  OH - - - - O
CH3 – C = N N = C – CH3
72. Answer (1) Ni
CH3 – C = N N = C – CH3
73. Answer (4)
O - - - - HO
74. Answer (3)
Two H-bonds.
(n – 2)f, (n–1)d and ns
85. Answer (2)
75. Answer (4)
2CuFeS2 + O2  Cu2S + 2FeS + SO2 is roasting.
76. Answer (2)
86. Answer (2)
77. Answer (2)
CN– – a strong ligand.
1 87. Answer (4)

2Au+4CN– + H2O + O2  2[Au(CN)2]– + 2OH–
2 88. Answer (3)
2[Au(CN)2]– + Zn  [Zn(CN)4]–2 + 2Au 89. Answer (1)
5/8
[ BIOLOGY ]
105. Answer (2)

91. Answer (4)
 The ploidy of plant produced after the cross is 6x.
 Bacterial binary fission is amitotic.
 Apomictic condition shall retain 6x condition in
 Clone is produced asexually.
subsequent progeny.
 Asexual reproduction is uniparental.
106. Answer (3)
92. Answer (4)
Young sporophyte (embryo) consists of coleoptile,
Algae reproduce asexually by zoospores commonly. plumule, radicle, coleorhiza and scutellum.
Sexual reproduction occurs on completion of a period Both have thalamus in fruit formation.
of vegetative growth.
108. Answer (4)
94. Answer (4)
Banana is parthenocarpic and pseudocarpic fruit.
Strobilanthus kunthiana is a perennial, monocarpic
plant. 109. Answer (4)
Eichhornia - Terror of Bengal spread aggressively 111. Answer (2)
through offsets.
Only outer integument is fleshy (Fleshy testa).
96. Answer (4)
112. Answer (3)
97. Answer (1)
98. Answer (3) Germinating seed has mature embryo.
100. Answer (4) Chemotropic movement.
Temperature and humidity affect viability of pollen 114. Answer (4)

grains.
Homogamy promotes self-pollination.
101. Answer (2)
115. Answer (4)
Any one cell of nucellus behaves as megaspore
mother cell. Pod colour – Chromosome No. 5.
102. Answer (4) 116. Answer (2)
Central cell is haploid and develop into endosperm Grasshopper – XX-XO mechanism of sex
after double fertilization. determination.
103. Answer (3) 117. Answer (2)

104. Answer (1) Aa = 3 : 1
 Diplospory avoids meiosis in megaspore mother Bb = 1 : 2 : 1
cell.
Aa Bb = (3 : 1) (1 : 2 : 1)
 Apospory and adventive embryony do not involve
the participation of megaspore mother cell. =3:6:3:1:2:1
6/8
118. Answer (2) 132. Answer (3)
AaBb × aabb 0 1
 0
ab 2 2
AB AaBb Mulatto 1 133. Answer (2)
Ab Aabb Less dark than mulatto True breeding groups are homozygous
2 (IAIA, IBIB, IOIO)
aB aaBb Less dark than mulatto
134. Answer (4)
ab aabb White 1
135. Answer (1)
Phenotypic ratio – 1 : 2 : 1
Maize and wheat are anemophilous plants.
119. Answer (4)
136. Answer (4)
Grasshopper with XX-XO mechanism.
137. Answer (3)
120. Answer (3)
Euglena and Vorticella show vertical binary fission
121. Answer (4) with body divided into two equal halves.
It causes transition. 138. Answer (1)
122. Answer (2) 139. Answer (3)
H.J. Muller induced mutation in X-chromosomes of 140. Answer (1)
Drosophila.
141. Answer (3)
123. Answer (4)
Sertoli cells function in response to FSH.
Haemophilic male do not survive beyond adolescent
stage. 142. Answer (2)
124. Answer (1) 60% of seminal plasma is contributed by seminal

vesicles.
Klinefelter’s individual shows overall masculine
development. 143. Answer (3)
125. Answer (3) 144. Answer (4)
Total number of gametes = 2n 145. Answer (4)
= 24 = 16 146 Answer (2)
126. Answer (1) 147. Answer (3)
Normal Drosophila is diploid. Maintenance of endometrium is by progesterone.
127. Answer (3) 148. Answer (3)
128. Answer (4) 149. Answer (4)
Sickle cell anaemia shows point mutation. 150. Answer (1)
129. Answer (4) 151. Answer (4)
130. Answer (2) 152. Answer (2)
131. Answer (4) Non-oxynol 9 disrupts sperm membrane.
7/8
153. Answer (3) 167. Answer (3)
154. Answer (2) 168. Answer (2)
155. Answer (3) 169. Answer (4)
156. Answer (4) 170. Answer (2)
157. Answer (2) 171. Answer (4)
158. Answer (2) 172. Answer (2)
159. Answer (3) 173. Answer (3)
160. Answer (3) 174. Answer (2)
161. Answer (3) 175. Answer (4)
162. Answer (2) 176. Answer (3)
163. Answer (3) 177. Answer (3)
164. Answer (3) 178. Answer (4)
165. Answer (2) 179. Answer (4)
166. Answer (4) 180. Answer (4)

8/8

AIATS Medical-2014 - Test-6 (Code-A) 02-02-2014 PDF

Hochgeladen von

Dokumentinformationen

Originalbeschreibung:

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

AIATS Medical-2014 - Test-6 (Code-A) 02-02-2014 PDF

Hochgeladen von

Copyright:

Verfügbare Formate

02.02.

TOPICS OF THE TEST

Magnetic Effect of Current and Magnetism; Electromagnetic Induction and

Organic Chemistry : Some Basic Principles and Techniques, Hydrocarbons,

Molecular Basis of Inheritance, Biology and Human Welfare: Improvement in

Time : 3 Hrs. T EST – 6 MM : 720

(3) Charged particle is accelerated in the dees but (1) Radiowaves

(3) 50 2 V (4) 100 V

The rms value in T0 interval is di

Then (1) Decrease

(1) R only circuit 3

18. Three pairs of inductor coils are shown in the

(1) a, c & d (2) b & c (1) i and N (2) i and A

(3) a & d (4) b & d (3) i and l (4) N and A

S R 34. The plane of dip circle is in magnetic meridian, now

mg (1) Needle in dip circle will make 45° with

mg (2) Needle in dip circle will become parallel to

3mg (3) Needle in dip circle will become vertical

(4) Rectangular hyperbola (4) Both (1) & (2)

42. Which of the following is correct regarding ideal (1) (2)

(4) Magnetic field at P = 0, at C  0 (2) Hertz produces and detected electromagnetic

(1) (2) 52. The following reaction is an example of

48. Which of the following is secondary butyl group? Br Br

_ 55. The total number of geometrical isomers for the

(3) 78% and 22% (4) 4.6% and 95.4%

(2) CH3–CH2–CH2–CH3 and

H (4) C6H5 – C – Cl and C2H 5 – C – Cl

(1) Fe4[Fe(CN)6]3 (2) K4[Fe(CN)6] O

(1) Sulphur (2) Phosphorus (3) (4)

(3) Nitrogen (4) Carbon O

(4) CH3–CH = CH–CH3 and CH3–CH2–CH = CH2 (3) (4)

Space for Rough Work

81. Which of the following compound is most reactive Br

(4) CH3CH = CHCH3

C – Centrifugation (4) 4.6  106 – 1

(3) A – Radioactive DNA (1) Three (2) Four

A– ATGCTATATATTTAATTATGCTTCC (1) Tropical canes, High fibre content

(2) TN - 1 Rice Taiwan (2) 3-10 kg of grain to produce 10 kg of meat

(1) Rice, maize, wheat (1) Toddy, Bread

(2) Protein and minerals (2) Fungus, Trichoderma

(3) Vitamins and minerals (3) Bacteria, Streptococcus

(4) Oil and micronutrients (4) Fungus, Monascus

126. Choose odd one w.r.t. sewage 131. Baculoviruses are

(1) CH4, CO, N2 (2) CH4, O2, H2 (3) Yeast + BGA

(3) CO2, CH4, H2 (4) CS2, H2S, H2 (4) Protozoa + Bacteria

Space for Rough Work

(1) Individual (2) Population 142. Appearance of antibiotic resistance in bacteria is an

(4) Inbreeding (2) The potential for population growth exceeds

148. Giraffes in an attempt to forage leaves on tall trees A

Options (3) A deviation from the genotype frequencies

(3) Ionic bonds (2) IgA, IgG

(4) van der Waal’s interactions (3) IgG, IgA

(4) Malaria (3) Typhoid, Tetanus

(3) Phagocytic effect (3) Wayson-stain test

(4) Lysozyme (4) Schick’s test

(1) B-cells (2) Cytotoxic T-cells

(3) Three (4) Four 180. Gambusia is a

Space for Rough Work

Hints to Selected Questions

Resultant of forces will be zero. q1 a

7. Answer (4) 12. Answer (3)

out  4  105 units 1 d 2