6 DDF

सरल अनु म पु नरावृ ि त च हक के योग से आम (मैि जफेरा इं डका एल.
) के
संकर का ल णन
Characterization of mango (Mangifera indica L.)

hybrids using SSR markers
ANSHUMAN SINGH
DIVISION OF FRUITS AND HORTICULTURAL TECHNOLOGY

INDIAN AGRICULTURAL RESEARCH INSTITUTE
NEW DELHI-110 012
2011
Characterization of mango (Mangifera indica L.)
hybrids using SSR markers
By
ANSHUMAN SINGH
A Thesis submitted to the Faculty of Post Graduate School,
Indian Agricultural Research Institute, New Delhi,
in partial fulfilment of the requirements
for the award of the degree of
DOCTOR OF PHILOSOPHY
in
HORTICULTURE
2011
Approved by
Chairman Dr. A.K. Singh ____________________
Members Dr. S.K. Singh ____________________
Dr. Manish Srivastav ____________________
Dr. N.K. Singh ____________________
Dr. A.K. Singh ____________________
Dr. Girish Jha ____________________

CERTIFICATE
This is to certify that the thesis entitled “Characterization of mango (Mangifera indica L.)
hybrids using SSR markers" submitted to the Faculty of the Post Graduate School, Indian
Agricultural Research Institute, New Delhi, in partial fulfilment of the requirements for the
award of the degree of Doctor of Philosophy in Horticulture by Anshuman Singh embodies
the results of bonafide work carried out by him under my supervision and guidance. No part of
the thesis has been submitted by him for any other degree or diploma.
I further certify that any help or information received during the work on this thesis has been
duly acknowledged.
Place: New Delhi (A. K. Singh)

Date: 12.09.2011 Chairman
Advisory Committee
DEDICATED
TO
MY BELOVED PARENTS
ACKNOWLEDGEMENTS
I humbly and whole heartedly thank God for giving me strength and blessings to excel in my academic
pursuit.
With deep sense of veneration and gratitude, I express my profound indebtedness to Dr. A.K. Singh,
Chairman of my Advisory Committee and Head, Division of Fruits & Horticultural Technology, IARI,
New Delhi, for suggesting the research problem, versed advice, sustained interest, valuable and generous
guidance and constructive criticism during the course of this investigation and preparation of
manuscript.
I am highly obliged to Dr. S. K. Singh, Co-chairman of my Advisory committee, for his wise counseling,
constant encouragement, and above all the ever-willing help throughout this endeavour.
I am also grateful to the members of my Advisory Committee; Dr. Manish Srivastav, Senior Scientist,
Division of Fruits and Horticultural Technology, Dr. N. K. Singh, Principal Scientist, National Research
Centre on Plant Biotechnology, IARI, New Delhi, Dr. A.K. Singh, Senior Scientist, Division of Genetics,
IARI, New Delhi and Dr. Girish Jha, Senior Scientist, Division of Agricultural Economics, IARI, New
Delhi for their valuable suggestions and guidance.
I express my sincere thanks to Dr. Subodh Joshi, Professor, Discipline of Horticulture, for his co-
operation, valuable suggestions and help during the study.
I feel privileged to express my gratitude to Dr. O. P. Awasthi, Principal Scientist, Dr. A.K. Dubey, Senior
Scientist, Dr. A. Nagaraja, Scientist, Dr. V.B. Patel, Scientist, Dr. Jai Prakash, Scientist and Dr. Amit
Goswami, Scientist, Division of Fruits and Horticultural Technology, IARI, New Delhi for their guidance,
suggestions and moral support throughout the course of study.
No words can appreciate the help and support rendered to me by Vikram Pratap Singh and Namo
Narayan Dixit during the course of research work. Candid thanks to all my juniors, especially Arvind
Verma, Arjun Singh, Vinay Kumar Singh (VC), Chandraswami, Himanshu, Kuldeep Tiwari, Om Prakash
Singh, Nageshwar Patel, Vikash Yadav, Bipin Kumar (Scientist) and Om Prakash Gupta for all the help
they rendered to me.
Diction is not enough to express my special debt of gratitude to my loving, caring and best friends
Ashutosh Singh, Dr. Jitendra Kumar Singh, Anoop Singh (Anna), Prashant Singh, Md. Sazid, Dr. Ashish
Kumar (Adhikari), Nishant Sinha and Pramod Kumar.
No words would be adequate to express my indebtedness to my beloved parents, family members and
relatives whom I owe everything I have achieved. But for their everlasting love and patronage nothing
would be materialized.
Lastly, the financial assistance from IARI in the form of Senior Research Fellowship and the wealth of
information provided by IARI library are duly acknowledged.
Place: New Delhi
Date: September 12, 2011 (ANSHUMAN SINGH)

CONTENTS
S. No. CHAPTER PAGE No.
1. INTRODUCTION 1-4
2. BACKGROUND 5-21
3. MATERIALS AND METHODS 22-28
4.1. RESEARCH PAPER-1 29-34
4.2 RESEARCH PAPER-2 35-39
5. GENERAL DISCUSSION 40-43
6. SUMMARY AND CONCLUSION 44-47
7. REFERENCES I-XVII
8. ABSTRACT
9. ANNEXURES
LIST OF TABLES
S. NO. TITLE AFTER PAGE
3.1 List of mango hybrids selected for the study 22
3.2 List of SSR primers (forward and reverse) and their base sequences 22
4.1.1 The composition of PCR reaction mixture 30
4.1.2 List of primers selected for the fingerprinting ofmango hybrids 30
4.1.3 No. of alleles and allele size obtained using SSR markers in mango hybrids 31
4.1.4 Heterozygosity (H) and Polymorphism information content (PIC) of SSR primers 31
4.1.5 Jaccard’s similarity values generated by Simple Sequence Repeat primers in 48 31

mango hybrids
4.2.1 No. of fingerprints generated, No. of unique fingerprints and probability of identity 37
of SSR markers
4.2.2 Description of unique fingerprints identified in mango hybrids 37

LIST OF FIGURES
4.1.1 Dendrogram based on UPGMA analysis of 48 mango hybrids using SSR markers 31
4.1.2 Principal Co-ordinates Analysis of 48 mango hybrids using SSR markers 31
4.2.1 Barcode representation of DNA fingerprints of 48 mango hybrids 37

LIST OF PLATES
4.1.1 Amplification profile of mango hybrids using the primer MiSHRS-1 31
4.1.5 Amplification profile of mango hybrids using the primer LMMA-1 32
4.1.6 Amplification profile of mango hybrids using the primer LMMA-10 32

LIST OF ABBREVIATIONS
AFLP - Amplified Fragment Length Polymorphism
bp - Base pairs
CTAB - Cetyl Trimethyl Ammonium Bromide
DAMD - Directed Amplification of Minisatellite DNA
DNA - Deoxyribonucleic acid
dNTP - 2 deoxyribonucleotide 5’ Triphosphate
EDTA - Ethylene Diamine Tetra Acetic acid
IPGRI - International Plant Genetic Resource Institute
ISSR - Inter Simple Sequence Repeat Markers
NTSYS - Numerical Taxonomical System
PCR - Polymerase Chain Reaction
PVP - Poly Vinyl Pyrolidine
PCA - Principal Co-ordinate Analysis
RAPD - Random Amplified Polymorphic DNA
RFLP - Restriction Fragment Length Polymorphism
SSRs - Simple Sequence Repeats
STMS - Sequence Tagged Microsatellite Site
TBE - Tris Borate EDTA
TE - Tris EDTA Buffer
VNTRs - Variable Number Tandem Repeats
UPGMA - Unweighted Pair-group Method of Arithmetic Average

1. INTRODUCTION
Mango (Mangifera indica L.) is the choicest fruit of India and occupies a prominent place
among the best fruits of the world. It is widely grown in the tropical and subtropical regions
world over. India has rich mango varietal wealth and the country has the richest wealth of mango
germplasm in Southeast Asia. Reportedly, there are over 1,000 varieties of mango found in India
(Mukherjee, 1951; Singh, 1996). However, there is a lot of confusion in nomenclature of the
mango cultivars. Pandey (1986) noted that lack of systematic approach in naming of mango
cultivars in the past has resulted in a great confusion in their nomenclature due to many
synonyms and duplication of names in the absence of any rules governing nomenclature. The
originator or breeder of a cultivar was free to allot any name at his will. Realizing the gravity of
the situation, the International Society for Horticultural Science has recognized the Division of
Fruits and Horticultural Technology, Indian Agricultural Research Institute, New Delhi (India)
as the International Registration Authority for Mango Cultivars.
In spite of the rich existing diversity, only a dozen mango varieties are grown
commercially in India. Moreover, the traditional commercial mango varieties of India suffer
from notable drawbacks like alternate bearing, mango malformation, spongy tissue and poor
shelf-life which impose limitations on their profitable cultivation. In order to overcome these
obstacles, various centres in India initiated mango breeding programmes to develop superior
high yielding hybrids free from the above defects. Mukherjee et al. (1961) were the first to
describe inter-varietal hybridization in mango with 1.45 per cent success. Mango hybridization
programme at Indian Agricultural Research Institute, New Delhi yielded two promising hybrids
Mallika (Neelum x Dashehari) and Amrapali (Dashehari x Neelum) in 1970s. These hybrids
possess many desirable features such as precocity, prolific and regular bearing, better keeping
quality and dwarf plant stature (Singh, 1996).
Of late, hybrid Amrapali has emerged as the premium choice of farmers in the country
particularly in the eastern states. Similarly, mango hybrid Mallika is becoming very popular
among the farmers in Karnataka and Maharashtra (Anonymous, 2011). In spite of its desirable
characters, variety Amrapali suffers from few demerits such as high susceptibility to mango
malformation, uneven fruit size, unattractive fruit appearance and decline in productivity after
few years. This necessitated succesive hybridization involving cross combinations of Amrapali,
Dashehari, Sentation and Lal Sundari as parents. The inclusion of coloured varieties like
Sensation and Lal Sundari as male parents in hybridization programme was to impart the
desirable red peel characteristic into the newly developed hybrids.
Mango breeding in India is in tune with the modern mango breeding programmes in other
countries which have focused on cultivars with higher production, red peel colour, distinct TSS:
acid ratio, disease resistance and extended shelf-life. These criteria are justified by the identified
needs of the growers and of the world-wide mango market (Campbell and Zill, 2009). Indian
mango breeders have realized this recent trend in mango breeding to catch the emerging export
market as well as to meet the demands of domestic consumers.
A notable feature of Indian mango indusry is the negligible presence of Indian exporters
in world mango market. Subrahmanyam (1990) noted that although the international trade in
mango was increasing rapidly, India continued to lag behind in total mango exports as compared
to other exporting countries like Mexico, Philippines and Venezuela. Though there is a vast
potential for export to western countries, constraints like suitability of a few varieties for export,
pests and disease problems have restricted the expansion of the exports from India. Removal of
some of the constraints will increase the potential for exports to USA and Japan. Research efforts
are also needed for prolonging the shelf life of fruit so that it could be made available for longer
period in the international market. The existing scenario reminds us the importance of frontier
sciences like marker assisted breeding and their integration with conventional fruit breeding for
obtaining desirable results with more precision.
Keeping in view its mandate as the International Registration Authority for Mango
Cultivars (Pandey, 1986), the Division of Fruits and Horticultural Technology of the Indian
Agricultural Research Institute, New Delhi (India) periodically carries out morphological,
physico-chemical and molecular characterization of available mango germplasm. Selvan (2006)
carried out the morphological characterization of newly developed mango hybrids from IARI
and found considerable variation among hybrids with respect to traits such as plant height, trunk
girth, plant spread, tree volume, leaf area, bearing shoot length, panicle emergence and flowering
duration. Selvan (2006) also investigated the physico-chemical characteristics of these hybrids
and noted appreciable variation with respect to attributes like fruit weight, fruit length, fruit
width, peel thikness, TSS, acidity and TSS: acid ratio. However, as morphological and physico-
chemical characters are the results of genotype x environment interaction and are likely to be
affected by the prevailing environmental condition, it was necessary to have precise information
regarding their genetic relatedness at molecular level with the help of some effective DNA
markers.
Characterization of the available germplasm is a prerequisite for their conservation as

well as utilization in the future breeding programmes. Genetic characterization serves the twin
purposes of the identification of genotypes and to determine their genetic divergence.
Additionally, one has to take notice of issues like intellectual property rights and trade related
agreements under the WTO umbrella (Ravishankar et al., 2000). Historically mango genotypes
have been characterized using morphological markers (Singh, 1969) and isozymes (Degani et al.,
1990, 1992). Morphological markers are limited in number, have complex inheritance pattern,
and are affected by environmental conditions (Lakshminarayana, 1980). Similarly, isozymes are
available in limited numbers and produce low level of polymorphism. Molecular markers, on the
other hand, are practically unlimited in number, remain unaffected by the environment and
growth conditions, and are simply inherited (Karihaloo et al., 2003). Different molecular markers
such as randomly amplified polymorphic DNA (RAPDs; Barbosa de Souza and Sarmanho da
Costa Lima, 2004), amplified fragment length polymorphism (AFLPs; Eiadthong et al., 2000),
inter-SSRs (Pandit et al., 2007) and simple sequence repeats (SSRs; Duval et al., 2005; Honsho
et al., 2005; Schnell et al., 2005; Viruel et al., 2005) have been tested for genetic diversity
assesment in mango.
The term DNA fingerprinting in its original sense refers to the method developed in 1985
by Sir Alec Jeffreys (Jeffreys et al., 1985) and his associates for the detection of highly variable
DNA fragments by hybridization of specific multilocus probes to electrophoretically separated
restriction fragments. The DNA fingerprints, resembling barcodes, are unique to the individual
and hence can be utilized in much the same way as conventional fingerprints to identify
individuals with absolute certainty. Fingerprinting a vast number of mango cultivars is a
significant contribution to mango cultivation, as presently several mango cultivars have many
synonyms in different regions, which make identification difficult and create confusion.
Simple Sequence Repeat (SSR) markers, also known as microsatellites, are tandemly
repeated motifs of 1-6 nucleotides found in all prokaryotic and eukaryotic genomes (Zane et al.,
2002). Microsatellites, with a polymorphism based on different numbers of repeated motifs at a
given locus, are becoming markers of choice in many fruit breeding programmes since they are
multi-allelic and amenable to automation. In addition to their usefulness in mapping and
breeding, have become the markers of choice for fingerprinting purposes in most plant species
(Gupta and Varshney, 2000), due to their high polymorphism, co-dominancy and reproducibility.
Of the various molecular techniques that are used for fingerprinting, microsatellite or simple
sequence repeat (SSR) markers are widely used in many areas of crop improvement because of
the high variability in the number of repeat units. These markers have several advantages over
other genetic markers since they can be scored unambiguously and results are highly
reproducible. In addition, microsatellite markers are co-dominant, highly polymorphic due to
variable number of repeats and show transferability among closely related genera. Assessment
of the genetic structure of closely related populations is also possible with SSRs. Based on their
informativeness and robustness, the use of SSRs has been preferred to determine the genetic
relationships among mango genotypes.
Keeping in view the new worldwide trend in mango breeding with emphasis on marker
assisted breeding, the mandate of IARI, importance of fingerprinting the mango hybrids and the
effectiveness of SSR markers in discriminating closely related genotypes, an experiment entitled
“Characterization of mango (Mangifera indica L.) hybrids using SSR markers” was
undertaken with the following objectives:
Objectives
1. To apply SSR markers to a set of mango hybrids for genetic diversity analysis.
2. To carry out molecular fingerprinting of selected mango hybrids developed at IARI.

2. BACKGROUND
The present experiment aimed to asses the genetic relatedness among mango hybrids as
well as to prepare their molecular fingerprints. This chapter briefly reviews the origin,
distribution and existing genetic diversity in mango. Additionally, the earlier work done on
genetic diversity analysis and DNA fingerprinting in mango and other fruit crops with molecular
markers has been reviewed. The effectiveness of morphological and biochemical markers in
genetic diversity estimation as compared to DNA-based markers, especially SSR markers, has
also been reviewed.
The exact place of mango origin is a controversial issue. Authors present conflicting
accounts of mango origin and distribution. Some consider India as the centre of origin due to the
high degree of mango diversity observed here (Ravishankar et al., 2000). However, available
taxonomic and molecular evidences support an evolution of mango within a larger geographical
area including northwestern Myanmar, Bangladesh and Northeastern India (De Candolle, 1904;
Popenoe, 1932; Mukherjee, 1997). Based on the recent findings (Mukherjee, 1997 and Bompard
and Schnell, 1997), the centre of origin and diversity of the genus Mangifera is now firmly
established in Southeast Asia. However, the origin of Mangifera indica has been a matter of
speculation for many years. It is now apparent on the basis of taxonomic and recent molecular
evidence that mango probably evolved within a large area including north western Myanmar,
Bangladesh and northeastern India (Mukherjee, 1997).
Notwithstanding the confusion regarding exact place of origin, it is likely that mango
cultivation started in India, where over 1000 varieties are recognized; most of them being
selections from naturally occurring open-pollinated seedlings (Iyer and Degani, 1997).
Mukherjee (1972) noted that the commercial mango cultivars have originated predominantly in
India through seedling selections of the variants due to recombination and segregation of
characters in the progenies.
Traders spread mango cultivation outside its centre of origin and domestication to other
tropical and subtropical regions where selections of the cultivars best adapted to particular
conditions were made. Portuguese spread mangoes to eastern and western Africa and Brazil and
from Brazil probably to the Caribbean islands (Nakasone and Paull, 1998), whereas Spaniards
introduced this crop to Mexico from the Philippines (Singh, 1996). In the 19th century mangoes
were introduced to Florida first from the Caribbean and later from India (Campbell, 1992).
The existing genetic diversity in mango is attributed to genetic as well as environmental

factors. Allopolyploidy, out crossing, wide spread hybridization and recombination of characters,
in addition to wide range of agro climatic conditions prevailing in different mango growing
regions, have contributed immensely to the exiting diversity in mango (Ravishankar et al., 2000).
As with other field and horticultural crops, precise estimation of genetic variability is an
important pre-requisite for the genetic improvement of mango. It provides the fruit breeder with
an accurate description of the germplasm material which is essential for their identification,
conservation, management and utilization in genetic improvement programmes. Knowledge
about the extent of genetic diversity/relatedness in mango germplasm is vital for developing
coherent strategies for future gains in productivity and quality.
2.1 Research Area I (Objective I)
To apply SSR markers to a set of mango hybrids for genetic diversity analysis
There is considerable confusion in mango cultivar nomenclature because many clonally

propagated mango cultivars have unique local and regional names. As in other fruit tree species,
mango cultivars are currently identified on the basis of morphological traits based on descriptors
(IPGRI, 2006). Characterization and diversity estimates are made from the analysis of markers,
which vary with the entities analyzed. These markers may be morphological, biochemical or
DNA markers. An ideal marker should be highly heritable, easy to measure and evaluate, easily
discriminate between individuals and provide comparable results (Hillis and Mortiz, 1990).
2.1.1. Morphological markers

Chadha and Pal (1986) noted that there are hundreds of mango cultivars being grown in
India. However, hardly 25-40 mango cultivars are of commercial importance. Commercially
grown mango cultivars have been identified on the basis of vegetative and reproductive
parameters such as leaf size, leaf shape, shoot length, panicle length, fruit size, fruit shape, peel
colour, stone size and stone weight. These parameters, based on morphological traits, constitute
the morphological markers, which are the oldest and most widely used genetic markers for the
germplasm characterization and cultivar identification. Extensive studies have been carried out
on the morphological diversity of Indian mangoes and scores of morphological markers have
been reported in mango by several workers for the purpose of evaluation of cultivars and hybrids
(Maries, 1901-02; Burns and Prayag, 1921; Mukherjee, 1948; Naik and Gangolly, 1950;
Gangolly et al., 1957; Singh, 1969; Rajan et al., 1999; Singh et al. 2009).
Ain-e-Akbari, an encyclopaedia written during the reign of Mughal emperor Akbar

provides the earliest description of mango cultivars (Mukherjee, 1948). The first attepmt to
scientifically describe mango cultivars was made by Maries (1901-1902), who collected 500
mango varieties from India and described them on the basis of modern botanical knowledge.
Woodhouse (1909) described the mango varieties of Bhagalpur (Bihar) and suggested a system
based mainly on fruit characters. Rolphs (1915) attached a special importance to fruit characters,
particularly fruit shape, while classifying the mango varieties grown in Florida. Wester (1920)
gave a descriptive list of mango varieties in India. Popenoe (1932) for the first time classified
mango varieties in a natural way on the basis of fruit characters, colouration of panicle axis,
laterals and pubescence on the panicle branches, and number of embryos in seed. Mukherjee
(1948) prepared identification key for 72 varieties from Bengal, Bihar and Uttar Pradesh using
characters like fruit shape and size, colouration of emerging leaves, panicle axis and laterals, size
of flowers, length of inflorescence and ridges on petals.
Naik and Gangolly (1950) described fruit as well as vegetative characters in 335 varieties
of mango from South India. They classified these varieties into three groups based on fruit size
and shape, viz., round, intermediate and markedly long. Each of these groups was further
subdivided into two co-horts depending upon whether the fruit had prominent beak or not.
Pandey (1984) compiled an International Check- List of Mango Cultivars, which contained chief
characteristic features of 793 cultivars and their synonyms from India, Bangladesh, Israel, South
Africa, Florida and Philippines. Mukherjee (1985) conducted a survey in the mango growing
belts in West Bengal and described several clones of important mango varieties. An
internationally accepted descriptor list for characterization of mango germplasm was also
prepared by Mukherjee (1985) which facilitated uniform description at the global level. It
contains characterization and evaluation descriptors covering morphological features of leaf,
inflorescence, fruit and tolerance to biotic and abiotic stress conditions.
Iyer and Subramanyam (1986) screened the mango varieties at Indian Institute of
Horticultural Research, Bengaluru and classified them on the basis of flowering time, sex ratio,
fruit retention, harvesting time, fruit weight, TSS, acidity, total sugars and TSS: acid ratio. Zaied
et al. (2007) evaluated some mango species by fruit characters and fingerprint. Eight local
mango genotypes were evaluated on the basis of physical (fruit weight, fruit length, fruit volume,
fruit diameter, fiber percentage and juice weight) and chemical characteristics (TSS, titratable
acidity, TSS/acid ratio, total sugar). Singh et al. (2009) carried out genetic diversity analysis
among five commercially important mango cultivars of India (Banganapalli, Dashehri, Langra,
Amrapali and Mallika) using morphological markers. Morphological analysis based on 17 fruit
characters detected prominent variation in the landraces ‘Banganapalli’, ‘Langra’, and
‘Dashehari’ and some variation in the cultivar ‘Mallika’.
Although morphological markers offer advantages in terms of simple process and

inexpensive assays, they suffer from notable drawbacks. In the first place, expression of
morphological markers depends on the prevailing environmental conditions. Moreover, the
actual identity of some cultivars is still in question because similar cultivars grown in different
areas often have various names (Lakshminarayana, 1980). These drawbacks limit the importance
of morphological markers and necessitate the use of DNA-based markers which are known to
give unbiased estimates of genetic diversity in different crop species. Traditional methods of
cultivar identification are time consuming and error prone due to environmental variations
affecting expression of these characteristics. Often, phenotypically indistinguishable trees may
be genotypically similar or vice-versa. Characterization based on horticultural traits thus needs
complementation with molecular markers as they can contribute greatly to the utilization of
genetic diversity through descriptive information of structure of genotypes, analyses of
relatedness, the study of identity and location diversity.
2.1.2 Biochemical markers
Assessment of diversity has traditionally been through morphological characters, which
has often found to be rather less effective. Biochemical markers like isozymes were the next to
be used and have been the choice in several cases (Scandalios, 1969). Isozymes have been the
most frequently used biochemical markers for study of perennial fruit crops because they show
co- dominant expression, lack epistatic and pleiotropic interactions and are consistently
expressed despite the environmental conditions. They have been utilized extensively to
differentiate cultivars, to identify parents and characterize progeny.
Gan et al. (1981) reported for the first time the use of isozymes to note the genetic
variation in mango cultivars. Later, Degani et al. (1990) working on different enzymes viz., GPI
(EC 5.3.1.1), TPI (triosephosphate isomerse), LAP (Leucine aminopeptidase), IDH (isocitrate
dehydrogenase), PGM (Phosphogluco mutase) and ACO (1- aminocyclopropane-1- carboxylic
acid oxidase) identified six loci with 17 allellomorphs in 41 mango cultivars derived from self
and open-pollinated trees. The outcross origin of some mango cultivars was supported by the
isozymic banding patterns. Reported parentage of some other cultivars was not consistent with
their isozymic banding patterns. For example, Edward was earlier reported to be a cross between
Haden and Carabao (Lynch and Krome, 1951). However Carabao was excluded as a parent
based on PGM banding.
Schnell and Knight (1992) used isocitrate dehydrogenase (IDH), leucine aminopeptidase
(LAP), phosphoglucose isomerase (PGI), phosphoglucomutase (PGM) and triosephosphate
isomerase (TPI) enzyme systems to differentiate seedlings from zygotic embryos of five
polyembryonic mango cultivars. They found that there were significant differences among
cultivars for the frequency of occurrence of nucellar and zygotic seedlings. Degani et al. (1992)
later demonstrated that there are two different zones of PGI activity in mango, PGI-1 and PGI -2,
based upon a study of 139 mango cultivars and seedlings.
Truscott et al. (1993) characterized 88 mango cultivars on the basis of isocitrate

dehydrogenase, cytosol aminopeptidase, glucose-6-phosphate isomerase, phosphoglucomutase
and triose phosphate isomerase. The outcross origin of some cultivars was supported by
zymogram. They reported parentage of some other cultivars did not conform to their banding
pattern. Jintanawongse and Changatragoon (2000) used several enzyme systems to identify
mango hybrids and true hybrids resulting from hybridization using eleven isozyme systems.
Eventhough the enzyme studies detailed above have met some success in cultivar identification
and deciphering parentage, still there is limitation like low level of polymorphism exhibition.
Furthermore, a small portion of the genome is represented by these markers.
Although different enzyme systems have been found effective for assessing genetic
diversity in fruit crops, isozyme analysis has its inherent disadvantages like limited number of
enzyme loci, and developmental and seasonal dependent enzyme expression. With the advent of
molecular biology techniques, DNA-based markers have replaced enzyme markers in germplasm
identification and characterization. Because of its plasticity, ubiquity and stability, DNA is the
ideal molecule for such analysis. Although molecular markers have been used to create extensive
linkage maps for many annual plants (Helentjaris 1987; Bernatzky and Tanksley, 1986;
McCouch et al. 1988), not many attempts have been made for their use in fruit crops. Genetic
analysis and breeding of woody perennial fruit species can be complicated by many factors
including long periods of juvenility, high ploidy levels, lack of described Mendelian markers and
so on (Rowland and Levi, 1994). Hence, the task of developing molecular marker-based genetic
maps is both challenging and important.
2.1.3 DNA markers

The importance of genetic variations in facilitating plant breeding and/or conservation
strategies has long been recognized (Sehgal and Raina, 2008). Molecular markers are useful
tools for assaying genetic variation and provide an efficient means to link phenotypic and
genotypic variation (Varshney et al., 2005). In recent years, the progress made in the
development of DNA based marker systems has advanced our understanding of genetic
resources. These molecular markers are classified as: (i) hybridization based markers, i.e.,
restriction fragment length polymorphisms (RFLPs), (ii) PCR-based markers i.e. random
amplification of polymorphic DNAs (RAPDs), amplified fragment length polymorphisms
(AFLPs), inter simple sequence repeats (ISSRs) and microsatellites or simple sequence repeats
(SSRs), and (iii) sequence based markers, i.e., single nucleotide polymorphisms (SNPs)
(Varshney et al., 2007; Sehgal and Raina 2008). Majority of these molecular markers have been
developed either from genomic DNA library (e.g. RFLPs or SSRs) or from random PCR
amplification of genomic DNA (e.g. RAPDs) or both (e.g. AFLPs) (Varshney et al., 2007).
Availability of an array of molecular marker techiques and their modifications led to
comparative studies among them in many crops including fruit crops (Schnell and Knight, 1993).
Molecular markers provide an attractive and more reliable alternative to morphological

and biochemical markers. In mango, phenotypic markers have been the commonly used method
of describing cultivars. Although this approach is useful to distinguish distantly related cultivars,
its reliable application has proven more difficult when it comes to differentiating closely related
lines or off types of a particular cultivar. This is because phenotypically indistinguishable trees
can be genotypically different (Schnell et al., 1995), and therefore variants of a given cultivar
cannot be easily detected by phenotypic assessment. Consequently, a more refined technique,
such as molecular markers that are highly polymorphic is required. DNA-based markers can be
gainfully used in mango breeding for marker assisted selection (MAS) and for cultivar
identification (Lavi et al., 1993).
2.1.3.1. Random Amplified Polymorphic DNA (RAPD)

The potential of RAPD markers to establish genetic relationships among Mangifera
species, in the identification of Mangifera indica L. cultivars and in the validation of genetic
relationships among them has been demonstrated by many authors (Abirami et al., 2008; Bajpai
et al., 2008; Bally et al., 1996; Cordeiro et al., 2006a; Cordeiro et al., 2006b; De Souza and
Lima, 2004; Hemant Kumar et al., 2001; Karihaloo et al., 2003, Lopez-Valenzuela et al., 1997;
Rahman et al., 2007; Rajwana et al., 2008; Ravishankar et al., 2000; Schnell and Knight, 1993;
Schnell et al., 1995).
2.1.3.2. Variable Number Tandem Repeat Sequence (VNTRS)

Adato et al. (1995) analyzed DNA fingerprint information of some mango genotypes
using minisatellite multilocus probes. Genomic DNA of 26 mango cultivars and 14 mango
rootstocks probed with 33.6, R18.1, 22.3, (GGAT)4, (GTG)5, and (GATA)4 revealed resolvable
and complex band pattern. DNA fingerprinting pattern of mango cultivar and rootstocks showed
high polymorphism between unrelated cultivars. Each cultivar or rootstock can be identified by
its DSP pattern. The probability of two unrelated cultivars and rootstocks having the same
pattern is 8 x 10 -6 and 1.2 x 10-5, respectively. The presence of many specific bands and low
levels of band sharing between cultivars reflects the high level of informativeness of probe 33.6.
The loci detected by other microsatellites were of low polymorphism. Based on DNA fingerprint
information, genetic distances between 20 mango cultivars were evaluated and an evolutionary
tree was established. Analysis of DNA fingerprint band patterns of 12 progeny resulting from a
cross between Tommy Atkins and Keitt mango revealed neither linked or nor allelic bands. The
results suggested that DNA fingerprints in mango are likely to be useful for identification and
breeding purposes.
2.1.3.3. Restriction Fragment Length Polymorphism (RFLP)

Description of Restriction Fragment Length Polymorphism (RFLP) as a DNA profiling
technique and elucidation of its potential use in varietal identification by Botstein et al. (1980)
opened new avenues in genetic studies and varietal improvement programmes. Capote et al.
(2003), Chunwongse et al. (2000), Eiadthong et al. (1999a) and Ravishankar et al. (2004) have
employed the RFLP technique for genetic studies in mango.
2.1.3.4. Amplified Fragment length Polymorphism (AFLP)

Amplified fragment length polymorphism (AFLP) is a PCR-based technique which
allows inspection of polymorphism at fairly a large number of loci within a very short span of
time and at the same time requires a very small amount of DNA. The usefulness of AFLP marker
system in genetic diversity analysis and fingerprinting of mango cultivars/genotypes has been
reported by Eiadthong et al. (1999c), Fang et al. (1999), Jing Gui et al. (2000), Kashkush et al.
(2001) and Yamanaka et al. (2006).
2.1.3.5. Inter Simple Sequence Repeat markers (ISSR)

Amplification of inter-simple-sequence-repeats (ISSRs) is a relatively novel technique
and has proven to be a powerful, rapid, simple, reproducible and inexpensive way to assess
genetic diversity or to identify closely related cultivars in many species, including fruit trees
(Gonzalez et al., 2002). A number of reports are available regarding the potential application of
ISSR markers in genetic diversity estimation and fingerprinting in mango (Bajpai et al., 2008;
Eiadthong et al.,1999c; Gonzalez et al., 2002; He et al., 2007; Pandit et al., 2007; Samant et al.,
2010; Singh et al., 2007; Singh et al., 2009; Srivastava et al., 2007; Xie et al., 2007).
2.1.3.6. Simple Sequence Repeat (SSR) markers

Among the molecular markers available for genetic studies, SSR markers have gained
considerable importance owing to many desirable attributes including hypervariability,
multiallelic nature, codominant inheritance, reproducibility, relative abundance, extensive
genome coverage (including organellar genomes), chromosome specific location, amenability to
automation and high throughput genotyping (Parida et al. 2009). In contrast, RAPD assays are
not sufficiently reproducible, whereas RFLPs are not readily adaptable to high throughput
sampling. AFLP is complicated as individual bands are often composed of multiple fragments
mainly in large genome templates (Varshney et al. 2007). SSRs have been succesfully used for
genetic diversity estimation and DNA fingerprinting in mango (Duval et al., 2006, Galvez-Lopez
et al., 2009; Nayak, 2010; Hirano et al., 2010; Olano et al., 2005; Schnell et al., 2005; Schnell et
al., 2006; Shareefa, 2008; Ukoskit, 2007; Viruel et al. 2005).
Duaval et al. (2006) analyzed the genetic diversity of Caribbean mangoes using
microsatellite markers. The selected loci displayed 4 to 14 alleles with a mean value of 7.3 per
locus and a total of 140 alleles of which 121 are specific to M .indica. A dendrogram was
constructed from the 304 accessions. These accessions displayed 207 different genotypes. Some
suspected identification errors in the germplasm bank were confirmed. Eight accession identities
could be corrected according to morphological observations confirmed by molecular pattern
comparisons with the original Floridian varieties.
Galvez-Lopez et al. (2009) investigated genetic relationships among

112 mango (Mangifera indica) plants native to 16 states of Mexico and four controls
[three mango cultivars (Ataulfo, Manila and Tommy Atkins) and one accession of Mangifera
odorata] based on simple sequence repeat (SSR) markers. SSR analysis indicated high genetic
similarity among mango populations that were clustered in two major groups: mangoes from
Gulf of Mexico coastline and mangoes from Pacific Ocean coastline and locations far away from
the sea.
Nayak (2010) estimated genetic relationship among mango hybrids using SSR markers.
The Jaccard’s pair-wise similarity values, generated by 28 primers, revealed moderate to high
degree of genetic variability among hybrids. The dendrogram, generated from the UPGMA
cluster analysis, grouped the genotypes into four main clusters.
Hirano et al. (2010) compared the genetic structure of mango accessions from Myanmar
with that of mango accessions from Florida, India, and Southeast Asia with 11 SSR markers. The
Myanmar accessions exhibited considerable genetic diversity (unbiased heterozygosity, UHe =
0.698) and a high number of private alleles. Despite the low degree of genetic differentiation
among accessions, Myanmar’s accessions were distinguishable from mango accessions from
Florida, India, and Southeast Asia in a principal coordinates plot. Genetic differentiation of the
Myanmar accessions from other groups was also observed in a Bayesian cluster analysis. No
population structure among Myanmar accessions was revealed by a neighbor-joining tree. The
results revealed a broad genetic background and genetic distinctiveness of mango in Myanmar.
Olano et al. (2005) used 25 SSR markers to evaluate the genetic background of 63
Florida mango varieties, as well as cultivars from India, Asia and other locations. The parentage
analysis, performed in a multistage process resulted in four parent-offspring sets. The results
indicated that as few as four Indian cultivars, and the ‘Turpentine’ land race were involved in the
early cultivar selections. Sixty-three of the 85 parents identified across the four generations were
other Florida cultivars. Results of the study indicated that the Florida types are more closely
related to Indian than to Southeast Asian types. It was also confirmed that the Florida group is
not more diverse than either of the parental groups.
Schnell et al. (2005) reported the development and characterization of 15 microsatellite

loci isolated from Mangifera indica L. These markers were evaluated using 59 Florida cultivars
and four related species from the USDA germplasm collection for mango. The polymorphic
information content (PIC) values were low to moderate varying from 0.21 to 0.63 for the
polymorphic loci. Two of the loci (MiSHRS-30 and MiSHRS-34) were monomorphic in the
Florida cultivars, although they are polymorphic in other populations of mango and within the
four related species. Four loci (MiSHRS-33, MiSHRS-36, MiSHRS-44 and MiSHRS-48) depart
significantly from HWE (P <0.05) in the population and show significant heterozygote
deficiency. Heterozygote excess was not observed at any locus and nine loci showed significant
LD (P < 0.05). All 15 primer sets amplified one or two products in each of the four related
species.
Schnell et al. (2006) reported the development of 14 new microsatellite markers for
mango and used these to estimate the genetic diversity and propagation error among 223
accessions. The 14 microsatellite loci had an average of 7.6 alleles per locus and average
polymorphism content value of 0.462. Propagation error was estimated to be 6.0% a value
similar to other error rates in vegetatively propagated tree crops. Mango can be divided into
polyembryonic and monoembryonic types and genetic diversity was found to be greater among
polyembryonic types than monoembryonic types. A parentage analysis was performed on the
Florida mangoes based on date of selection and date of introduction of cultivars into Florida. The
results suggested that a few as four Indian cultivars, the landraces known as Saigon and the local
Turpentine types were the parents of early Florida mango cultivars.
Shareefa (2008) analyzed 50 mango genotypes with 28 SSR markers. DNA profiling of
50 genotypes detected 82 SSR loci. The size of the alleles detected ranged from 90 to 450 bp.
The Jaccard’s similarity coefficient values, which ranged from 0.44 to 0.88 with an average
value of 0.612, indicated sufficient diversity among genotypes studied. The dendogram, based on
UPGMA cluster analysis, grouped the genotypes mainly according to their geographical origin
and/or their pedigree information. The genotypes, related by descent, were grouped into one
cluster. Majority of the northern and eastern Indian genotypes groped together and were different
from the western and southern genotypes.
Ukoskit (2007) reported the isolation of microsatellite markers from mango using 5'
anchored PCR. A 5' anchored PCR was utilized to develop microsatellite markers in mango. Di-
repeat primers containing 3 or 7 degenerate bases at the 5' end of the primers were used to
amplify genomic DNA flanked by simple sequence repeats. The PCR products were cloned to
generate enriched microsatellite libraries. Clones containing microsatellite fragments were
randomly selected and subsequently sequenced. A specific primer was designed and used in
combination with a 5' anchored primer to produce a locus-specific microsatellite marker. The
total of 16 microsatellite markers revealed 46 alleles among the fragments amplified from the 8
mango varieties. Fourteen polymorphic microsatellite markers produced an average of 2.8 alleles
ranging from 2 to 6 alleles per locus with the average of 0.475. Polymorphism information
content (PIC) varied from 0.186 to 0.637. Microsatellite markers developed from this experiment
offer potential use of the markers for varietal identification and genome mapping.
Viruel et al. (2005) reported the sequence and variability parameters of 16 microsatellite
primer pairs obtained from two mango (Mangifera indica L.) genomic libraries after digestion of
DNA of the cultivar Tommy Atkins with HaeIII and RsaI and enrichment in CT repeats.
Although no significant differences were recorded between the two libraries in the
informativeness of the markers obtained, the RsaI library was shown to be more useful than the
HaeIII taking into account the efficiency of the library and the feasibility of clone sequencing.
The polymorphism revealed by those microsatellites was evaluated in a collection of 28 mango
cultivars of different origins. The analysis of the 16 SSRs in 28 mango genotypes detected a total
of 88 bands, with an average of 5.5 bands/SSR, ranging from 3 to 9 bands/SSR. In 14 of the
SSRs, one or two bands were present in each genotype, suggesting the detection of a single
locus. These SSRs have been shown to be highly efficient for genotype identification in this
species. Moreover, the particular characteristics of microsatellites make such markers very
interesting for variability and pedigree studies.
2.2. Research Area II (Objective II)
To carry out molecular fingerprinting of selected mango hybrids developed at IARI
2.2.1 Efficiency of SSR markers in fingerprinting

Recently, the application of DNA markers has become very popular in fruit crop
improvement. Various classes of DNA markers, each with their own advantages and
disadvantages, are available. Most of them are used for identification on the one hand, and for
the improvement of conventional breeding on the other. DNA fingerprinting involves the
creation of band patterns by means of hybridization of mini- or microsatellite probes with
genomic DNA (Jeffreys et al., 1985).
Regarding identification, DNA finegrprinting can be employed for individual

identification of cultivars or rootstocks for different horticultural purposes, such as breeders’
rights, identification of pollen parent(s) and determination of genetic relatedness (Hillel et al.,
1990; Lavi et al., 1993). Improvement of breeding projects includes detection of genetic linkage
between horticulturally important traits and DNA band and a significant decrease in the number
of backcross generations required in a gene introgression breeding programme (Hillel et al.,
1990). The aim of DNA fingerprinting technology is to aid the fruit breeders in the protection of
Plant Breeders Rights of elite varieties, aid in the identification of cultivars and identify elite
progeny at early stages of development. This will shorten the time to production of new cultivars
and reduce the costs of breeding in perennial fruit crops like mango.
Isozymes were the first markers to be used for fingerprinting mango cultivars (Degani et
al., 1990). RAPD markers have also been used for fingerprinting mango cultivars (Schnell et al.
1995; Lopez-Valenzuela et al., 1997). However, the efficiency of RAPD markers in accurate
parentage analysis is not up to the mark. Eiadthong et al. (1999c) employed anchored simple
sequence repeat markers to analyze mango genotypes, but they were unable to find markers
unique to either monoembryonic or polyembryonic types. The inherent limitations in these
marker techniques necessitated the application of simple sequence repeats (SSRs) in DNA
fingerprinting of mango genotypes, because this marker technique detects a high degree of
polymorphism.
SSRs are typically codominant and multiallelic, with expected heterozygosity frequently
greater than 0.7, allowing precise discrimination even of closely related individuals. The simple
sequence repeats (SSRs) have become the marker of choice for fingerprinting the majority of
fruit crops. It is essential to have easily assessable, reliable, genetic markers for variety
identification and distinction, and for the development of efficient fruit breeding methods.
Due to the specificity of the PCR assay and its high information content, it also allows
the determination of identity between individuals based on formal estimates derived from allele
frequencies. As microsatellite marker information can be easily shared between laboratories
based on primer sequences, interlaboratory comparisons of data are straightforward, improving
cooperative efforts in the standardization of fingerprinting data (Kirst et al., 2005).
Viruel et al. (2005) developed the first reported set of 16 microsatellite markers for
mango, of which 14 produced the expected one or two amplification products per genotype.
These 14 microsatellites were used in the genotyping of 28 mango genotypes and they
successfully discriminated all the genotypes with average number of alleles per locus being 5.3.
Shareefa (2008) utilized SSR markers to construct the cultivar specific fingerprints of
mango genotypes. The probability of identity of molecular profiles of genotypes taken at random
indicated high degree of confidence in the fingerprints. The findings of this study validated the
potential application of SSR markers in varietal identification and germplasm conservation.
Wahdan et al. (2011) employed SSR markers for DNA fingerprinting of two Egyptian
mango strains Hania and Aml. Of the 42 primers screened, 36 primers gave reproducible
polymorphic DNA amplification patterns. 60.7% of the scored fragments were considered
putative genotypes-specific markers in both strains. The polymorphic information content (PIC
values) ranged from 0.25 to 0.75, with a mean value 0.51 for all loci. The heterozygosity level
was 0.68 and 0.53 for Hania and Aml strains, respectively. The banding patterns produced by
these 36 primers are helpful in distinguishing the strains from the other; proving the usefulness
of SSR markers as an efficient method for genotype identification.
Besides mango, SSR markers have been employed for DNA fingerprinting in a number
of fruit crops. Guilford et al. (1997) reported that the high degree of polymorphism and the
simple Mendelian segregation of apple microsatellite markers provide a potential system for
identification and parentage analysis of apple cultivars. Hokanson et al. (1998) also
demonstrated the effectiveness of microsatellites in unambiguous identification of apple
accessions.
Testolin et al. (2000) assayed microsatellite polymorphism in 50 peach and nectarine

cultivars. All microsatellites were polymorphic, showing 2–8 alleles per locus. Heterozygosity
ranged from 0.04–0.74 (mean 0.47); the discrimination power (PD) ranged from 0.04–0.84
(mean 0.60). Cultivar heterozygosity varied greatly, with one cultivar (‘Independence’) being
homozygous at all loci. The set of microsatellites discriminated all cultivars investigated, except
several sport mutations, i.e., ‘Dixitime’ vs. ‘Springcrest’, ‘Compact Redhaven’ vs. ‘Redhaven’,
and two pairs of cultivars, ‘Venus’ vs. ‘Orion’ and ‘Elegant Lady’ vs. ‘Rome Star’, whose
pedigrees are controversial. In most cases, the parenthood was confirmed. The comparison of
three long-living ‘Redhaven’ accessions supplied by different repositories did not provide any
evidence of somatic instability of microsatellites. Hence, microsatellites, ranked according to
their information content, are recommended as markers of choice for peach fingerprinting.
Gaspero et al. (2000) isolated 11 microsatellites from grape vine (Vitis vinifera) and used
to study the degree of conservation of these sequences across different Vitis species and
concluded that nucleotide variations which occur in microsatellite flanking region provide new
molecular tools for investigating the evolution of species. Hinrichsen et al. (2000) analyzed
RAPD, AFLP, SSR, STMS in grape DNA fingerprinting and they found that SSR and STMS
results were more reliable and stable than RAPD and AFLP.
Hormaza (2002) screened a collection of 48 apricot genotypes with 37 SSR primer pairs
developed in different species of Prunus in order to identify and characterize the genotypes and
establish their genetic relations. Thirty one of those primer pairs resulted in correct
amplifications and 20 produced polymorphic repeatable amplification patterns with the 48
genotypes studied. A total of 82 alleles were detected for the 20 loci. All the genotypes studied
could be unequivocally distinguished with the combination of SSRs used. The results obtained
evidence for the cross-species transportability of microsatellite sequences, allowing the
discrimination among different genotypes of a given fruit-tree species with sequences developed
in other species.
Hadonou et al. (2004) developed 21 new microsatellites in the model diploid perennial
species Fragaria vesca from an enriched genomic library developed using F. vesca ‘Ruegen’.
All 15 of the F. vesca accessions studied could be distinguished unambiguously using the 26
polymorphic microsatellite loci.
Bianchi et al. (2004) reported molecular characterization of 29 Prunus spp. rootstocks

using SSR markers. The DNA from the rootstocks was analyzed using five pre-selected SSR
primers. They reported that the use of only five microsatellite markers was sufficient to obtain
polymorphisms for the discrimination of 29 rootstocks.
Dang et al. (2005) reported 14 microsatellite markers for genetic analysis and cultivar
identification of walnut genotypes. The SSR markers distinguished pairs of closely related
cultivars and were able to uniquely characterize all walnut cultivars with the exception of
budsports. They provide a more powerful and reliable system for the molecular characterization
of walnut germplasm than those previously tested.
Novelli et al. (2006) developed simple sequence repeat markers (SSRs) in citrus and
evaluated the efficiency of these markers for characterization of sweet orange. Four intraspecific
polymorphic microsatellite markers were found to be able to distinguish between important
cultivars and were considered to be useful for purposes such as the certification of varieties and
the identification of zygotic plants from controlled crosses between sweet orange cultivars.
Onyango et al. (2010) employed eight nuclear and four chloroplast microsatellite markers
for the characterization of 133 banana (Musa spp.) accessions from East Africa, Bioversity
International and Polynesia to determine variation patterns existing in the Musa AA and AAB
genomes of East Africa and to determine the usefulness of microsatellites markers in
differentiating accessions within the two Musa genome groups. Group average clustering
produced major clusters corresponding to the genome composition of AAA, AAA-EA, AAB
(plantains), AAB (dessert bananas), AA and AB. At least four distinct subclusters of ‘Apple
Banana’ (AAB genome) were observed, namely ‘Mysore’ (AAB genome), ‘Sukari Ndizi’ (AAB
geome), ‘Prata’ (AAB genome) and ‘Silk’ (AAB genome). The East African ‘Muraru’ (AA
genome) dessert bananas formed a distinct cluster with a high similarity to AAA dessert bananas,
suggesting the possibility of shared ancestry between them.
Turkoglu et al. (2010) analyzed ten SSR loci, previously developed for Prunus, to
examine genetic relationships among 23 rootstock candidates for sweet and sour cherries. The
results of the study showed that microsatellites can be effectively used for fingerprinting
purposes in Prunus. In fact, all microsatellite primer pairs tested produced good and various
levels of amplifications.
Conventional breeding of fruit trees in general and that of mango in particular is quite
lengthy, cost intensive and inefficient. The application of DNA fingerprinting technology to
mango has the potential of significantly improving the breeding projects. It is noted that the
establishment of a basis for the application of this system in mango will enable its eventual use
for marker assisted selection (MAS) and reduction in the number of backcross generations
needed for gene introgression. In this way, breeding projects could become more cost effective,
shorter and efficient (Lavi et al., 1993).
3. MATERIALS AND METHODS
This chapter presents a brief account of experimental material selected and methods
adopted for carrying out the present research experiment.
3.1 Research Area I (Objective I)
To apply SSR markers to a set of mango hybrids for genetic diversity analysis
3.1.1 Plant material

Forty eight mango hybrids (Mangifera indica L.), derived from different cross
combinations, were included in the present experiment (Table 3.1). Of these hybrids, 47 have
been developed by the Division of Fruits and Horticultural Technology, IARI, New Delhi. Some
of these hybrids have been released for commercial cultivation. A few others are considered
potential for future release. Additionally, mango hybrid Ratna, which represents western Indian
mango gene pool, was also included in the present study. The trees were tagged in January-
February, 2010 at the time of flushing, when leaf material for DNA extraction was collected.
Due care was taken in the selection of leaf samples so as to have only young, tender and healthy
leaves.
3.1.2 Collection and processing of leaf material

For each genotype, 5 g of flushing, tender and healthy leaves from single tree of each
accession were plucked, put into labelled polyethylene bags and placed in an icebox. On
reaching the laboratory, leaves were washed under tap water and cleaned with tissue paper. The
midribs and thick veins of the leaves were removed. Samples were wrapped in aluminum foil,
labeled properly, fixed by dipping briefly in liquid nitrogen and stored at –80 0C till DNA
extraction.
3.1.3 DNA isolation
Genomic DNA was extracted by the cetylhexadecyl-trimethyl ammonium bromide

(CTAB) method (Saghai-Maroof et al., 1984) with minor modifications (Porebski et al. 1997;
Khanuja et al. 1999). Essentially, the extraction buffer composition was 4% w/v C TAB, 1.4M
NaCl, 100mM Tris-HCl (pH- 8), 20mM EDTA, I% PVP w/v and 0.2% â mercaptoethanol. The
solutions, regents and instruments used are described in Annexure I.
Leaf samples were ground to fine powder in pre-cooled mortar and pestle in liquid
nitrogen. Powdered leaf material was quickly transferred to centrifuge tubes containing 20 ml
pre-heated CTAB extraction buffer and vortexed to disperse the tissue powder. The tubes were
then incubated at 65 0C for 1 hour, with intermittent shaking. At the end of the incubation, tubes
were cooled to room temperature and 15 ml chloroform: isoamyl alcohol (24:1) was added,
following which mixing of contents by inversion was carried out for about 10 minutes. The
samples were then centrifuged at 250C for 15 minutes at 12,000 rpm. The supernatant aqueous
phase, containing nucleic acids was pipetted out into fresh centrifuge tubes. Nucleic acids were
precipitated by adding half volume of NaCl (Porebski et al., 1997) and one volume of chilled
isopropanol (Khanuja et al., 1999) and letting it stand for a few hours at 4 0C (Porebski et al.,
1997). To aid the precipitation, the tubes were spun at 10 0C for 10 minutes at 10,000 rpm. The
resulting supernatant was discarded and DNA pellet was given two 70% ethanol washes and a
final wash with absolute ethanol. The aqueous part was decanted and the pellet was dried free of
ethanol. The DNA was dissolved in 1 ml TE buffer.
3.1.4 DNA purification

The dissolved DNA was transferred to 2ml eppendorf tubes; 2µl of RNase A (25 mg/ml)
was added and incubated for 1 hour at 37 0C. Subsequently, DNA was treated with an equal
volume of phenol: chloroform: isoamyl alcohol (25:24:1 mixture) and mixed the content by
gentle swirling for 5 minutes. The tubes were centrifuged at 10,000 rpm for 5 minutes and the
supernatant was collected in a fresh tube. This was followed by two extractions with chloroform:
Isoamyl alcohol (24:1). RNA-free, purified DNA was precipitated by adding 0.1 volume sodium
acetate and 2.5 volumes chilled isopropanol to the aqueous phase and then collected by spinning
at 12,000 rpm for 15 minutes. The precipitate was washed twice with 70 % ethanol, air-dried and
dissolved in TE buffer and stored at -20 0C.
3.1.5. DNA quantification

For DNA quantification, the isolated DNA was run in 0.8% agarose gel. Agarose gel was
prepared by melting 0.8 g of agarose in 100 ml of 1X TBE. Upon cooling, ethidium bromide
was added at the rate of 0.5 µg/ml and the contents weregently swirled and poured in a gel
casting tray with a properly placed comb. Polymerization of gel was allowed for 30 minutes,
after which the comb was taken out carefully without any damage to the wells. The gel was
transferred to an electrophoresis tank having appropriate quantity of 1X TBE buffer. Two µl of
loading dye 1 x was added to each sample tube after completion of purification. The purified
DNA samples were loaded into the gel wells with phage DNA as a control. Electrophoresis was
carried out in 1 x TBE buffer at 50 V for 1 hour, i.e. till the bromophenol blue dye travelled less
than 2/3 of the gel length. The gel visualized under UV light on a UV-transilluminator and
photographed by using Polaroid Gelcam and Digital DC-40. The quantity of DNA estimated in
the sample by its comparison with the control phage DNA by visual judgment. Compact band
at the corresponding position to phage DNA indicated height and weight of DNA.
3.1.6 DNA dilutions

Part of each DNA sample was diluted with sterilized distilled water to yield a working
concentration of 25-30 ng/µl. The diluted samples were stored at 4 C for immediate use while the
original concentrates were kept for long term storage at – 20 oC.
3.1.7 SSR Analysis
3.1.7.1 Selection of Primer

The primers used for the study were 15 microsatellites loci from mango reported by
Schnell et al. (2005) and 10 microsatellites by Viruel et al. (2006). List of primers used along
with their sequences are given in Table 3.2. The primer was provided by the manufacturer in a
lyophilized form. Based on the molecular weight of a given primer, a stock solution of 100 M
was prepared by adding the required amount of TE buffer and the stock was kept at –20oC. From
the stock solution, a working sample was prepared by adding 5µl primer solution and 95 µl
autoclaved distilled water.
3.1.7.2 Optimization of PCR conditions for Simple Sequence Repeats (SSRs)

Variation in template DNA primer, MgCl2 and Taq DNA polymerase had an effect on
DNA amplification. To determine optimal amplification reaction conditions, a factorial
experiment was conducted wherein PCR was carried out at two concentrations of MgCl2 (1μl
and 2 μl), two concentrations of Taq DNA polymerase (0.5 U and 0.75 U), three concentrations
of template DNA (10 ng, 25 ng and 50 ng) and 2.5 μl primer (forward and reverse each) in a
volume of 15 μl at different annealing temperatures. PCR was carried out in Perkin Elmer 9,600
Thermocycler (USA). 25 ng of template DNA per reaction mixture was found to yield optimum
amplification for SSR primers. Based on the consistency of bands, the optimum concentration of
PCR components was standardized (Table 4.1.1).
3.1.7.3 PCR amplification

Following the experiments for optimization of component concentrations, PCR
amplification was carried out with 25 ng of genomic DNA, 2μl MgCl2, 0.75 U Taq DNA
polymerase, 1x PCR buffer without MgCl2, 1.25 μl of each of primers and 200 μM of dNTPs.
The volume was made up to 15 μl with sterile distilled water. PCR tubes containing the above
components were capped and centrifuged at 10,000 rpm for 2 minutes to allow proper settling of
reaction mixture. Thermocycling was carried out in a PE-Thermocycler. Thermocycling
conditions were as follows:
1. Denaturation at 95 0C for 5 minutes.

2. Denaturation (35 cycles) at 940C for 1 minute, primer annealing at 55 0C for 1 minute and
primer extension at 720C for 2 minutes.
3. Final extension step at 720C for 10 minutes at 40C.
3.1.8 Gel electrophoresis
3.1.8.1 Gel preparation

PCR amplified products were run in 4% high resolution agarose (Metaphor) gels.
Appropriate quantity of agarose and 1X TBE buffer were mixed thoroughly and boiled for about
2 minutes to dissolve the contents. The mixture was cooled to 500C and 2μl ethidium bromide
(1mg/ml solution) was added per 100 ml gel. Molten gel was cast in a gel tray with appropriate
comb. Polymerization of the gel was allowed for 30 minutes after which the comb was taken out
carefully. The gel was transferred to an electrophoresis tank having an appropriate quantity of
1X TBE buffer.
3.1.8.2 Electrophoresis
Two μl loading dye (Annexure I) was added to each PCR tube containing amplified
products and loaded in the slots of the metaphor agarose gel. 2.5 μl GeneRulerTM (100 bp ladder)
was loaded in the first lane of each gel to determine sizes of identified bands. Electrophoresis
was carried out at 5 V/cm for 2.5 hours. The gels were photographed on a UV transilluminator
using a Polaroid camera.
3.1.9 Data scoring and analysis

Each band was treated as one SSR marker. Scoring of bands was done from the
photographs. Homology of bands was based on their migration distance in the gel. The presence
of a band was scored as ‘1’, absence of a band as ‘0’ and missing datum was denoted by ‘9’.
3.1.9.1 Jaccard’s similarity coefficient (J)

The Jaccard’s similarity coefficient (J) was used to calculate the similarity between pair’s
accessions (Jaccard, 1968).
J=y/n–d
Where,
y = Number of bands common to sample a and b
n = Total number of bands present in all samples

d = Number of bands not present in a or b, but present in other samples
The genetic associations between accessions were evaluated by calculating the Jaccard’s
similarity coefficient for pair wise comparisons based on the proportion of shared bands
produced by the primers. The pairwise similarity matrix between cultivars was determined by the
index of Nei and Lie (1979).The similarity matrix was subjected to the cluster analysis of
unweighted pair group method for arithmetic mean (UPGMA) and a dendrogram was generated.
These computations were performed using the program NTSYS-PC (Numerical Taxonomy
System) Ver. 2.11 (Rohlf, 2000). The informativeness of a genetic marker is measured by the
number of alleles and allele frequencies. Two measures of informativeness are heterozygosity
and polymorphism information content.
3.1.9.2 Heterozygosity (H)

Heterozygosity is the widely used measure of the allelic diversity or informativeness of a
genetic marker. The informativeness of a genetic marker increases as the heterozygosity
increases. In outbred populations, heterozygosity estimates the probability that a randomly
sampled individual is heterozygous. The heterozygosity of genetic marker is estimated by
n
H = 1-(  Pi2)
i=1
Where, Pi is the ith allele and n is the number of alleles (Nei, 1973; Ott, 1992).
3.1.9.3 Polymorphism information content (PIC)

The basic information that determines their application in genetic mapping of both the
marker system was calculated for each marker by using the PIC (Lynch and Walsh, 1998). PIC
expresses the discrimination power of the locus by taking into account not only the number of
alleles that are expressed, but also their relative frequencies and frequency of alleles per locus.
Polymorphism information content (PIC) was calculated as described by Botstein et al. (1980)
using the formula:
n n-1 n
PIC= 1- (  pi ) - [  2 pi2 pj2]
2
i=1 i=1 i=1
Where, pi and pj equal to the frequency of ith and jth allele of a marker.
3.2 Research Area II (Objective II)
To carry out molecular fingerprinting of selected mango hybrids developed at IARI.
The plant material and methods adopted for Objective II were same as in Objective I of
the present experiment. The data with respect to number of fingerprints generated and number of
unique fingerprints were obtained by calculations on Microsoft Office Excel 2007. Based on the
fingerprinting pattern, a barcode of fingerprints was constructed. The probability of identity of
SSR markers was calculated with the help of following formula.
3.2.1 Probability of Identity (P)

Probability of identity is the probability of obtaining a similar pattern of bands for two
different cultivars. It is calculated as
n-1 n
P = 1-  pi4 +   (2pipj)2
i=1 i=1
Where, pi and pj are the frequency of ith and jth allele, respectively. The probability of
identity measures the probability that two randomly drawn diploid genotypes will be identical
assuming observed allele frequencies and random assortment (Paetkau et al., 1995). The PI over
a number of loci was calculated as the product of the PI for those loci.
4.1 RESEARCH PAPER-1
Genetic diversity analysis among mango hybrids using SSR markers

Anshuman Singh, A. K. Singh
Division of Fruits and Horticultural Technology,
Indian Agricultural Research Institute, New Delhi-110012
Abstract
Genetic diversity among 48 mango (Mangifera indica L.) hybrids was evaluated by
simple sequence repeat (SSR) markers. Out of 25 SSR primers screened, 17 produced
polymorphic bands. These primers detected 59 scorable loci, of which 45 were polymorphic. The
size of the alleles detected ranged from 100 bp to 480 bp. Polymorphis Information Content
(PIC) of SSR markers ranged from 0.023 (MiSHRS 39) and 0.295 (MiSHRS 23). The
heterozygosity of SSR markers used in this study ranged from 0.042 (MiSHRS-29) to 0.489
(MiSHRS-37). The genetic relationship among mango hybrids, based on Jaccard’s Similarity
Coefficient, ranged from 0.38 to 0.97. The dendrogram, based on UPGMA cluster analysis,
grouped the mango hybrids into three major groups. The clustering of hybrids in dendrogram
was more or less based on their parentage. The five most diverse hybrids, namely, H-12-2, H-9-
6, Pusa Arunima, H-9-5 and H-1-13 constituted a separate cluster. The Principal Coordinates
Analysis also exhibited more or less similar distribution of mango hybrids.
Key words: Mango, SSRs, genetic diversity
4.1.1 INTRODUCTION
Mango (Mangifera indica L.) is a diploid fruit species (2n=40). India has the richest
wealth of mango germplasm in Southeast Asia. Reportedly, there are over 1,000 varieties of
mango found in India (Mukherjee, 1951; Singh, 1996). Out-breeding reproductive behaviour,
somatic and bud mutation and the wide range of agro climatic conditions prevailing in India have
all contributed to the genetic diversity of this crop (Mukherjee, 1972). Traditionally,
morphological characters have been used to estimate genetic diversity in mango and related
species. Correct identification and selection of genotypes is a prerequisite for the success of
mango improvement programmes. However, identification and selection of genotypes is often
difficult and ineffective when it is based on morphological parameters. This necessitates use of
frontier technologies such as DNA-based markers for correct labeling and identification of
genotypes.
In spite of rich genetic diversity of mango in India, there is a lot of confusion in

nomenclature of the mango cultivars. It is mainly due to existence of many synonyms and
duplication of names. This situation imposes difficulty in mango selection and hybridization
programmes. Contrary to the morphological markers, molecular markers provide quick and
unambiguous estimates of genetic diversity in mango. Different molecular markers such as
randomly amplified polymorphic DNA (RAPDs; Barbosa de Souza and Sarmanho da Costa
Lima, 2004), amplified fragment length polymorphism (AFLPs; Eiadthong et al., 2000; Fang et
al., 1999; Jing Gui et al., 2000; Kashkush et al., 2001 and Yamanaka et al., 2006), ISSRs (Pandit
et al., 2007) and simple sequence repeats (SSRs; Duval et al., 2005; Honsho et al., 2005; Schnell
et al., 2005; Viruel et al., 2005) have been employed for genetic studies in mango. Among these
molecular markers, SSRs have become markers of choice for genotyping in mango. Keeping in
mind, many desirable attributes of SSRs or microsatellites, the present study sought to estimate
the genetic diversity among newly developed mango hybrids for facilitating their inclusion in
future mango improvement programmes.
4.1.2 MATERIALS AND METHODS
4.1.1.1 Experimental material
The details related to experimental material have been furnished under Paragraph 3.1.1,
Chapter-3. Collection and processing of leaf material was done according to standard
methodology described under Paragraph 3.1.2, Chapter-3.
4.1.1.2 DNA extraction, purification, quantification and dilution
DNA extraction from young fresh leaves, its purification, quantification and dilution was
carried out according to methods described under Paragraphs 3.1.3, 3.1.4, 3.1.5 and 3.1.6,
respectively (Chapter-3).
4.1.1.3 SSR Analysis

The details pertaining to selection of primer pairs, optimization of PCR conditions, PCR
amplification, gel electrophoresis and data analysis have been given under Paragraphs 3.1.7,
3.1.8 and 3.1.9 of Chapter-3.
4.1.3 RESULTS
4.1.3.1 Primer screening
Out of the 25 SSR primers screened, 17 were scorable (Table 4.1.2) and were selected for
the genotyping of mango hybrids. Five SSR primer pairs (MiSHRS-1, MiSHRS-18, MiSHRS-
23, MiSHRS-33 and LMMA-3) exhibited monomorphic banding pattern among the mango
hybrids.
4.1.3.2 Band statistics
The 17 SSR primers generated 59 scorable bands in mango hybrids, of which 45 were
polymorphic (84.9 %). The number of alleles detected varied from 2 (MiSHRS 29, MiSHRS 32
and MiSHRS 33) to 6 (MiSHRS 23 and LMMA 1). The average number of alleles per primer
pair was 3.47. The allele size ranged from 100 bp (MiSHRS 18) to 480 bp (MiSHRS 39). The
number of alleles and allele size obtained using SSR markers are given in Table 4.1.3.
4.1.3.3 Properties of SSR markers
The characteristics of PCR products, namely, the Polymorphism Information Content

(PIC) and heterozygosity (H) are presented in Table 4.1.4.
4.1.3.3.1 Polymorphism Information Content (PIC)
The Polymorphic Information Content (PIC) is a parameter indicative of the degree of

informativeness of a marker. In present experiment, SSR markers gave low PIC values ranging
from 0.023 (MiSHRS 39) and 0.295 (MiSHRS 23). The average PIC value for MiSHRS primer
series was 0.165, whereas it was 0.198 in LMMA primer series.
4.1.3.3.2 Heterozygosity (H)
The heterozygosity of SSR markers used in this study ranged from 0.042 (MiSHRS-29)
to 0.489 (MiSHRS-37). The average heterozygosity value for MiSHRS primer series was 0.249,
whereas it was 0.266 in LMMA primer series.
4.1.3.4 Genetic relationships
Genetic relationships among mango hybrids were determined based on the Jaccard’s pair
wise similarity coefficients which depicted moderate degree of genetic diversity among the
hybrids. Jaccard’s similarity values generated by 17 Simple Sequence Repeat primers in 48
mango hybrids are given in the Table 4.1.5. From the Jaccard’s pair wise similarity coefficients,
Jaccard’s Similarity Coefficient values ranged from 0.38 (between H-1-13 and H-6-8) to 0.97 (
between H-13-4 and H-13-7), with the mean value of 0.59. Jaccard’s similarity values between
the released IARI hybrids (Pusa Arunima, Pusa Pratibha, Pusa Shreshth and Pusa Peetambar)
were above 0.50, except between Pusa Pratibha and Pusa Peetambar, which exhibited a similarity
value of 0.46. As these two hybrids are less similar, they can be used as parents in future
hybridization programme to evolve superior heterotic hybrids.
4.1.3.5 Cluster analysis

UPGMA clustering reflects the history of breeding and selection of the cultivars studied,
grouping the cultivars according to geographical origin and type. The dendrogram generated
from the Unweighted Pair Group Arithmetic Average (UPGMA) cluster analysis broadly placed
48 mango hybrids into two major clusters. Cluster ‘A’ comprised of the five most diverse
hybrids, namely, H-12-2, H-9-6, Pusa Arunima, H-9-5 and H-1-13. Cluster ‘B’ was again
bifurcated into two sub-clusters, namely, Cluster ‘B’ 1 and Cluster ‘B’ 2. Cluster ‘B’ 1 consisted
of 17 hybrids and Cluster ‘B’ 2 consisted of 26 hybrids. The dendrogram revealed that H-13-4
and H-13-7 were the most similar hybrids with 97 % similarity. Contrary to this, hybrids H-1-13
and H-6-8 were the most divergent with a diversity value of 62%.
4.1.3.6 Principal Co-ordinates Analysis (PCA)

Three dimensional scatter diagram of PCA was generated for supplementing the findings
reported in the cluster analysis. The principal co-ordinate analysis of 48 mango hybrids also
generated more or less similar distribution of hybrids (Figure 4.1.3).
4.1.4 DISCUSSION
The findings of present study are consistent with earlier reports on mango with the use of
SSR markers. Shareefa (2008) and Nayak (2010) reported similar values of SSR polymorphism
(71 to 81.8 %), number of alleles and allele size in mango. In present experiment, most of the
SSR primers detected multiple loci, which can be attributed to the allopolyploid nature of mango
(Mukherjee, 1950). Earlier, Shareefa (2008) and Nayak (2010) reported very low to moderate
PIC values of SSR markers in mango. PIC values of these markers were also low to moderate in
Florida mango cultivars (Schnell et al., 2005). With respect to heterozygosity values of SSR
markers, our results are consistent with the findings of Shareefa (2008) and Nayak (2010) in
mango with SSR markers.
The Jaccard’s similarity values clearly depicted rich genetic variability in the hybrid
population studied. The rich genetic variation found in hybrid progeny could be attributed the
cross pollinated nature of mango crop, high degree of heterozygosity and high discriminatory
power of the SSR markers. Again, the diverse genetic backgrounds of parents seem to have
contributed to rich genetic variation observed in hybrid population. Amrapali, the female parent
of most of the hybrids, has been derived from the cross of ‘Dashehari’ and ‘Neemum’,
representing the north and south Indian mango germplasm pool, respectively. The male parents
of hybrids, namely, Sensation, Lal Sundari, Alphonso, Dashehari and others also represent
different genetic and geographical backgrounds. Thus, diverge genetic and geographical
backgrounds of the parents could have resulted in high genetic variability in F1 population.
The grouping of the hybrids in dendrogram was more or less based on their parentage.
The hybrids related to each other by descent were placed together. Owing to parental similarity,
hybrids H-12-2, H-9-6, Pusa Arunima, H-9-5 and H-1-13 constituted a separate cluster. They are
progenies of Amrapali x Sensation cross. A similar trend was noted with respect to clustering of
H-13-4 and H-13-7 (offsprings of Amrapali x Sensation), Pusa Pratibha and Pusa Shreshth
(offsprings of Amrapali x Sensation) and Pusa Peetambar and H-2-10 (progenies of Amrapali x
Lal Sundari). The tendency of clustering among mango hybrids revealed that they had stronger
affinity towards female parent Amrapali. Shareefa (2008) also reported clustering of H-1-1
(released as Pusa Pratibha) and H-1-6 (released as Pusa Shreshth) together.
4.2 RESEARCH PAPER-2
Molecular fingerprinting of mango hybrids using SSR markers

Anshuman Singh, A. K. Singh
Division of Fruits and Horticultural Technology,
Indian Agricultural Research Institute, New Delhi-110012
Abstract
DNA fingerprinting is a valuable tool for plant cultivar identification and discrimination.
The use of simple sequence repeat (SSR) markers for DNA fingerprinting of mango hybrids
could benefit the declaration of distinctiveness of new mango hybrids for plant variety protection
(PVP), granting the Plant Breeder’s Rights and the legal protection of new cultivars. The
importance of DNA fingerprinting and marker-assisted characterization of gene sequences
of mango has been emphasized to improve mango cultivars for disease resistance and also
sensory attributes including flavor. In present experiment, 48 mango hybrids were analyzed
using 17 SSR markers. These 17 SSRs were able to distinguish all the hybrids. A total of 76
fingerprints were identified, of which 5 were unique fingerprints. It is expected that these unique
fingerprints could be linked with important horticultural traits and could be helpful in the
selection of these traits in future breeding programmes. A combined fingerprint of 48 hybrids
was developed based on 59 loci and represented as a barcode diagram. The average probability
of identity of the fingerprint developed was estimated to be 0.6284 indicating high degree of
confidence in the fingerprints.
Key words: Mango, SSRs, hybrids, fingerprints
4.2.1 INTRODUCTION
The production of certified plant material in fruit tree species including mango requires
the application of fast and reliable techniques to identify both old and new genotypes. Traditional
methods to identify cultivars and rootstocks are based on phenotypic observations. However, this
is a slow process due to the long juvenile period of the trees and it is subjected to environmental
influences. The incorporation of new methodologies into fruit certification schemes will
accelerate and optimize the identification process, by allowing the fingerprinting of each
genotype at any stage of development and independently of environmental factors that may
influence the phenotype.
During the recent past, we have witnessed fast and important advances in the methods
used to analyze and study nucleic acids in both animals and plants. These studies have resulted in
the development of different kinds of DNA markers that have been successfully applied in plant
and fruit tree breeding. Among other applications, DNA markers are a useful tool for selection
and gene introgression when they are linked to genes of interest, for the construction of genetic
maps and for the identification of cultivars and the study of the similarity and the genetic
distance among them. Almost any kind of DNA markers can be used for fingerprinting fruit tree
species. The most widely used have been RAPDs, RFLPs, AFLPs and, more recently ISSRs and
SSRs.
Besides the development of RAPDs and AFLP markers, newer PCR-based techniques are
being increasingly used for fingerprinting purposes. Microsatellite markers or SSRs are currently
becoming the preferred technique for the molecular characterisation of different plant species
(Gupta & Varshney, 2000). Simple sequence repeats (SSRs; Duval et al., 2005; Honsho et al.,
2005; Schnell et al., 2005; Viruel et al., 2005) have been employed for fingerprinting studies in
mango. In addition to their usefulness for fingerprinting mango cultivars, the codominant nature
of SSRs allows a better understanding of the pedigree relationships among the cultivars studied.
The objective of the present experiment was to carry out molecular fingerprinting of mango
hybrids by applying SSR markers.
4.2.2 MATERIALS AND METHODS
4.2.2.1 Experimental material
The details related to experimental material have been furnished under Paragraph 3.1.1,
Chapter-3. Collection and processing of leaf material was done according to standard
methodology described under Paragraph 3.1.2, Chapter-3.
4.2.2.2 DNA extraction, purification, quantification and dilution
DNA extraction from young fresh leaves, its purification, quantification and dilution was
carried out according to methods described under Paragraphs 3.1.3, 3.1.4, 3.1.5 and 3.1.6,
respectively (Chapter-3).
4.2.2.3 Fingerprinting patterns and unique fingerprints

The data with respect to number of fingerprints generated and number of unique
fingerprints were obtained by calculations on Microsoft Office Excel 2007. Based on the
fingerprinting pattern, a barcode of fingerprints was constructed.
4.2.2.4 Probability of identity

The probability of identity of SSR markers was calculated by the formula of Paetkau et
al. (1995) as given under Paragraph 3.2.1 of Chapter-3.
4.2.3 RESULTS
4.2.3.1 Fingerprinting pattern
Analysis of 48 mango hybrids with 17 SSR primer pairs identified a total of 59 alleles.
The fingerprint pattern of the 48 mango hybrids based on the 59 markers is presented as barcode
diagram in Figure 4.2.1. The cultivars analyzed could be distinguished unambiguously using the
combined molecular profiles from 17 primer pairs. Number of fingerprints generated, number of
unique fingerprints and probability of identity of SSR markers are presented in the Table 4.2.1. A
total of 76 fingerprints were identified. The fingerprints generated by individual SSR primers
ranged from 2 to 12. Highest number of fingerprints (12) were generated by primer pairs
MiSHRS-23 and LMMA-1 each. However, these two primers failed to identify any unique
fingerprints.
4.2.3.2 Unique fingerprints
Five SSR loci each detected one unique fingerprint in five mango hybrids. Description of
unique fingerprints is given in Table 4.2.2. Interestingly, the hybrids in which unique fingerprints
were detected are all progenies of Amrapali x Sensation cross. Two unique fingerprints were
identified in hybrid H-9-6. The size of unique fingerprints ranged from 90(MiSHRS-18) to 350
base pairs (MiSHRS-39).
4.2.3.3 Probability of identity
The probability of identity which measures the probability that two randomly drawn
genotypes will be identical assuming the observed allele frequencies and random assortment was
calculated for each primer pairs. The probability of chance identity varied from 0.1215 for
MiSHRS-29 to 0.8848 for LMMA-1. The average probability of identity was 0.6284 indicating
that the DNA fingerprints of these cultivars are highly genotype specific. The average probability
of identity was higher in LMMA series as compared to MiSHRS series.
4.2.4 DISCUSSION
The use of DNA markers to obtain a genotypes specific profile has distinct advantages
over morphological and biochemical methods. The morphological markers are influenced by the
environmental conditions, are labour intensive and above all time consuming. Biochemical
markers such as isozymes and protein patterns though minimally influenced by the environment,
offer limited polymorphism and often do not allow discrimination between closely related
genotypes. DNA markers overcome most of these disadvantages of morphological and
biochemical markers.
An unambiguous characteristic pattern of cultivars obtained using DNA markers have

been termed as a DNA fingerprint. Characterization and quantification of diversity in plant
genetic resources are important to identify cultivars and clones, decipher relationships including
parentages, and to efficiently manage germplasm collections. Analysis of the genetic
constitution, change and evolution in clonally propagated species assumes importance for
unambiguous identification of clones, solving disputes related to intellectual property rights, and
to aid clonal selection of superior variants.
The potential of SSR markers in fingerprinting has already been reported by several
workers. SSR analysis of 48 mango hybrids revealed that all hybrids analyzed could be
distinguished unambiguously using the combined molecular profiles from 17 primer pairs. The
schematic representation of DNA fingerprints of 48 mango hybrids presented indicates that there
were no two molecular profiles which were identical to each other.
Unique fingerprints are genotype and marker specific alleles. Such alleles are unique in
the sense that they are produced by a particular marker and are present only in one genotype and
absent in all other analyzed accessions. The occurrence of unique alleles specific to different
mango genotypes has earlier been reported by Shareefa (2008). Occurrence of a unique allele is a
feature of the germplasm pool in which they are observed. Detection of unique fingerprints also
indicates the higher information content of a particular marker.
The presence of unique fingerprints may be explained by the high rates of mutation at
SSR loci. Presence of unique allele is an indicative of the diverse genetic base of a genotype. In
present study, we identified unique fingerprints in hybrid progenies of Amrapali and Sensation.
These hybrids represent wide genetic base as both of the parents are of different geographical
origin. Amrapali (Dashehari x Neelum) carries the genes from north and south Indian mango
germplasm. Similarly, Sensation represents the mango gene pool from Florida. It is assumed that
sometimes unique alleles may serve as indicators of a particular region of the genome specific to
a particular trait of horticultural importance. The genotypes carrying the unique alleles may
prove useful for introducing diversity in the future mango breeding projects.
The existence of a set of single locus, co-dominant and highly polymorphic markers that
are distributed along the whole genome and quickly and easily detectable would be a powerful
tool for variability analysis and fingerprinting. SSRs are the only molecular markers currently
available that fit all these requirements. The use of such a set by different research groups would
be allow direct comparison of results, which is hardly feasible with most widely used DNA
markers in the recent past.
6. GENERAL DISCUSSION
The findings of the present study are being discussed in the light of available scientific
literature in succeeding paragraphs.
In our study, some of the primers amplified one or two bands in each genotype,
suggesting the detection of a single locus, whereas in some genotypes, multiple bands were
amplified. Mango has been described as allopolyploid (Mukherjee, 1950). The presence of
multiple bands could be due to the remnants of the ancestral polyploidization and/or to genomic
rearrangements accumulated in the course of long period of cultivation of these species where a
wide variability in clones of the same cultivar has been repeatedly reported particularly in Indian
cultivars (Iyer and Degani, 1997).
The efficiency of a marker technique in discriminating genotypes largely depends upon

the polymorphism it can detect. In the present study, the Polymorphism Information Content
(PIC) of SSR primers was low. PIC values of these primers in Florida cultivars were also low to
moderate varying from 0.21 to 0.63 for the polymorphic loci (Schnell et al., 2005). Nayak
(2010), who also analyzed mango hybrids with SSR primers, reported very low to moderate PIC
values. Notwithstanding lower PIC and heterozygosity values obtained in the present
experiment, SSR markers were able to discriminate closely related hybrid progenies.
The genetic relationship among mango hybrids, based on Jaccard’s Similarity

Coefficient, ranged from 0.38 to 0.97. Earlier reports in this regard are in tune with our finding.
Shareefa (2008), working on mango with SSR markers, reported similarity values in the range of
0.45 to 0.88. Earlier studies on genetic diversity among fifty Indian mango cultivars using RAPD
techniques revealed that similarity was in the range of 61% to 95 % (Hemant Kumar et al.,
2001). Karihaloo et al. (2003) reported that Jaccard’s similarity values among Indian mangos
ranged from 0.318 and 0.75 with a mean of 0.565. Singh et al. (2005) reported that ISSR analysis
of 79 mango accessions revealed Jaccard’s similarity range between 0.516 to 0.991 with a mean
of 0.669. The genetic similarity between different mango genotypes based on the Jaccard’s
similarity coefficient ranged from 0.79 (between Chausa and Dashehari and between Langra and
Mallika) and 0.41 (between Olour and Sensation depicting agood degree of genetic diversity
among different genotypes (Abirami et al., 2008). Bajpai et al. (2008) reported that Jaccard’s
similarity coefficient of 46 mango germplasm collected from eastern and northern regions of
India varied from 0.88 (between Papia and Safeda Calcutta) to 0.378 (Lucknow Safeda and
Anopan) when analyzed using RAPD markers, whereas varied from 0.83 (between Amin
Ibrahimpur and Amin Prince) to 0.467 (between Kishan Bhog and Amin Khurd) with ISSR
markers.
Out-crossing behavior of mango crop, high degree of heterozygosity, the diverse genetic
backgrounds of parents and high discriminatory power of the SSR markers seem to have
contributed to the rich genetic variability in hybrid population studied. As with other vegetatively
propagated clonal crops, the differences among mango hybrids can result from epigenic
modifications in response to the environment (Kaeppler et al., 2000). Somatic and bud mutations
also play a minor role in clonal polymorphism in woody plants including mango. Naik (1948)
observed significant variation among the trees of same clones in an orchard with respect to fruit
shape, colour and quality which was ascribed to bud mutations. Oppenheimer (1956) reported a
wide variability in the performance of the trees belonging to same variety in same orchard, after
surveying many orchards in India. Mukherjee et al. (1985) conducted a survey of mangoes in
eastern India and identified some superior clones. Singh and Chadha (1981) in a study of mango
orchards of ‘Dashehari’ located four clones which were superior in performance.
It could be expected that most of the somatic mutations that occur during plant growth
would have no effect on phenotype, although they could be identified at the molecular level.
Micrsatellite marker polymorphism are derived mainly from variability in the number of repeats
in the micrsatellite stretch, and thus in allele length, as opposed to variations in the primary
sequence (Ellegren, 2004). Sleepage of DNA polymerase during replication seems to have a
major role in the generations of mutations in microsatellite sequences (Eisen, 1999).
The dendrogram, based on UPGMA cluster analysis, grouped the mango hybrids into
three major groups. The grouping of the hybrids in dendrogram was more or less based on their
parentage. The hybrids related to each other by descent were placed together. Owing to parental
similarity, hybrids H-12-2, H-9-6, Pusa Arunima, H-9-5 and H-1-13 constituted a separate
cluster. They are progenies of Amrapali x Sensation cross. A similar trend was noted with
respect to clustering of H-13-4 and H-13-7 (offsprings of Amrapali x Sensation), Pusa Pratibha
and Pusa Shreshth (offsprings of Amrapali x Sensation) and Pusa Peetambar and H-2-10
(progenies of Amrapali x Lal Sundari). The tendency of clustering among mango hybrids
revealed that they had stronger affinity towards female parent Amrapali. Viruel et al. (2005)
demonstrated that UPGMA cluster analysis and Principal coordinates analysis based on SSR data
grouped the genotypes according to their origin reflecting the pedigree of the cultivars. The
clustering of hybrids in separate groups in dendrogram indicated that they might share similar
alleles.
The use of DNA markers to obtain a genotypes specific profile has distinct advantages
over morphological and biochemical methods. The morphological markers are influenced by the
environmental conditions, are labour intensive and above all time consuming. Many of the
vegetative characteristics represent continuous variation and a high degree of plasticity, and
which many times do not reflect the real diversity of the Mangifera spp. germplasm.
Biochemical markers such as isozymes and protein patterns though minimally influenced by the
environment, offer limited polymorphism and often do not allow discrimination between closely
related genotypes. DNA markers overcome most of these disadvantages of morphological and
biochemical markers.
An unambiguous characteristic pattern of cultivars obtained using DNA markers have

been termed as a DNA fingerprint. Characterization and quantification of diversity in plant
genetic resources are important to identify cultivars and clones, decipher relationships including
parentages, and to efficiently manage germplasm collections. Analysis of the genetic
constitution, change and evolution in clonally propagated species assumes importance for
unambiguous identification of clones, solving disputes related to intellectual property rights, and
to aid clonal selection of superior variants.
The potential of SSR markers in fingerprinting has already been reported by several
workers. SSR analysis of 48 mango hybrids revealed that all hybrids analyzed could be
distinguished unambiguously using the combined molecular profiles from 17 primer pairs. The
schematic representation of DNA fingerprints of 48 mango hybrids presented indicates that there
were no two molecular profiles which were identical to each other.
Unique fingerprints are genotype and marker specific alleles. Such alleles are unique in
the sense that they are produced by a particular marker and are present only in one genotype and
absent in all other analyzed accessions. The occurrence of unique alleles specific to different
mango genotypes has earlier been reported by Shareefa (2008). Occurrence of a unique allele is a
feature of the germplasm pool in which they are observed. Detection of unique fingerprints also
indicates the higher information content of a particular marker.
The presence of unique fingerprints may be explained by the high rates of mutation at
SSR loci. Presence of unique allele is an indicative of the diverse genetic base of a genotype. In
present study, we identified unique fingerprints in hybrid progenies of Amrapali and Sensation.
These hybrids represent wide genetic base as both of the parents are of different geographical
origin. Amrapali (Dashehari x Neelum) carries the genes from north and south Indian mango
germplasm. Similarly, Sensation represents the mango gene pool from Florida. It is assumed that
sometimes unique alleles may serve as indicators of a particular region of the genome specific to
a particular trait of horticultural importance. The genotypes carrying the unique alleles may
prove useful for introducing diversity in the future mango breeding projects.
The existence of a set of single locus, co-dominant and highly polymorphic markers that
are distributed along the whole genome and quickly and easily detectable would be a powerful
tool for variability analysis and fingerprinting. SSRs are the only molecular markers currently
available that fit all these requirements. The use of such a set by different research groups would
be allow direct comparison of results, which is hardly feasible with most widely used DNA
markers in the recent past.
7. SUMMARY AND CONCLUSION
In traditional mango breeding programmes, germplasm accessions are identified on the

basis of morphological parameters. The perennial nature of mango, long juvenile phase, complex
floral biology, low fruit set and heavy fruit drop impose considerable difficulties in the effective
and early selection of horticulturally important traits based on phenotypic parameters. In general,
mango trees take 4-5 years to come into flowering and fruit set. Thus, mango breeders have to
wait for a longer period for evaluating promising selections and hybrids derived from
improvement programmes. Use of molecular markers can overcome these problems. Marker-
assisted selection (MAS) increase the breeding efficiency by shortening the selection period.
Molecular techniques for establishing the identity and evaluating genetic diversity have
improved during the last few decades. DNA markers offer significant resources for cultivar
identification and studying genetic relatedness among the genotypes. Due to the co-dominant
inheritance, reproducibility and amenability to high throughput, SSRs have become a tool of
choice for investigations of critical importance to crop germplasm managers, such as the
establishment of unique genetic identities or fingerprints, determination of genetic relatedness
between accessions, and the assessment of genetic diversity contained within a collection.
The present investigation is an attempt to characterize forty eight mango hybrids using
Simple Sequence Repeat (SSR) markers. The objectives of the study were:
1. To apply SSR markers to a set of mango hybrids for genetic diversity analysis.
2. To carry out molecular fingerprinting of selected mango hybrids developed at IARI.
The salient findings of the experiment are summarized as follows:
Out of the 25 SSR primers screened, 17 generated scorable bands and were selected for
the genotyping of mango hybrids. The 17 SSR primers produced 59 scorable bands in mango
hybrids, of which 45 were polymorphic (84.9 %). The number of alleles detected varied from 2
(MiSHRS 29, MiSHRS 32 and MiSHRS 33) to 6 (MiSHRS 23 and LMMA 1). The average
number of alleles per primer pair was 3.47. The size of amplicons ranged from 100 bp (MiSHRS
18) to 480 bp (MiSHRS 39). In the present experiment, SSR markers gave low PIC values
ranging from 0.023 (MiSHRS 39) and 0.295 (MiSHRS 23). The average PIC value for MiSHRS
primer series was 0.165, whereas it was 0.198 in LMMA primer series. The heterozygosity of
SSR markers used in this study ranged from 0.042 (MiSHRS-29) to 0.489 (MiSHRS-37). The
average heterozygosity value for MiSHRS primer series was 0.249, whereas it was 0.266 in
LMMA primer series.
Genetic relationships among mango hybrids were determined based on the Jaccard’s pair
wise similarity coefficients which depicted moderate degree of genetic diversity among the
hybrids. Jaccard’s Similarity Coefficient values ranged from 0.38 (between H-1-13 and H-6-8) to
0.97 ( between H-13-4 and H-13-7), with the mean value of 0.59. It is thus, apparent that hybrids
H-1-13 and H-6-8 exhibited least pair wise similarity, whereas hybrids H-13-4 and H-13-7 were
the most similar. Jaccard’s similarity values between the released IARI hybrids (Pusa Arunima,
Pusa Pratibha, Pusa Shreshth and Pusa Peetambar) were above 0.50, except between Pusa
Pratibha and Pusa Peetambar, which exhibited a similarity value of 0.46. As these two hybrids
are less similar, they can be used as parents in future hybridization programme to evolve superior
heterotic hybrids.
UPGMA clustering reflects the history of breeding and selection of the cultivars studied,
grouping the cultivars according to parentage, geographical origin and type. The dendrogram
generated from the Unweighted Pair Group Arithmetic Average (UPGMA) cluster analysis
broadly placed 48 mango hybrids into two major clusters. Cluster ‘A’ comprised of the five most
diverse hybrids, namely, H-12-2, H-9-6, Pusa Arunima, H-9-5 and H-1-13. Cluster ‘B’ was again
bifurcated into two sub-clusters, namely, Cluster ‘B’ 1 and Cluster ‘B’ 2. Cluster ‘B’ 1 consisted
of 17 hybrids and Cluster ‘B’ 2 consisted of 26 hybrids. The dendrogram revealed that H-13-4
and H-13-7 were the most similar hybrids with 97 % similarity. Contrary to this, hybrids H-1-13
and H-6-8 were the most divergent with a diversity value of 62%. Three dimensional scatter
diagram of PCA was generated for supplementing the findings reported in the cluster analysis.
The principal co-ordinate analysis of 48 mango hybrids also generated more or less similar
distribution of hybrids.
Analysis of 48 mango hybrids with 17 SSR primer pairs identified a total of 59 alleles. It
is clear from the barcode representation of DNA fingerprints that the cultivars analyzed could be
distinguished unambiguously using the combined molecular profiles from 17 primer pairs. A
total of 76 fingerprints were identified. The fingerprints generated by individual SSR primers
ranged from 2 to 12. The highest numbers of fingerprints (12) were generated by primer pairs
MiSHRS-23 and LMMA-1 each. However, these two primers failed to identify any unique
fingerprints. The SSR primers detected 5 unique fingerprints in mango hybrids. Interestingly, the
hybrids in which unique fingerprints were detected are all progenies of Amrapali x Sensation
cross. Two unique fingerprints were identified in hybrid H-9-6. The size of unique fingerprints
ranged from 90(MiSHRS-18) to 350 base pairs (MiSHRS-39).
The probability of identity which measures the probability that two randomly drawn
genotypes will be identical assuming the observed allele frequencies and random assortment was
calculated for each primer pairs. The probability of chance identity varied from 0.1215 for
MiSHRS-29 to 0.8848 for LMMA-1. The average probability of identity was 0.6284 indicating
that the DNA fingerprints of these cultivars are highly genotype specific. The average probability
of identity was higher in LMMA series as compared to MiSHRS series.
Based on the findings of the present investigation, following conclusions can be drawn:
1. The high degree of divergence observed among mango hybrids could be attributed to
the highly cross pollinated nature of the mango crop, different parental combinations of hybrids
and high discriminatory power of the SSR markers.
2. The grouping of the hybrids in dendrogram is more or less based on their parentage.
The hybrids related to each other by descent were placed together.
3. The results indicated that SSR markers are useful not only for varietal identification
and detection of duplicate entries, but also for the use in future mango breeding programmes to
design crosses that maximize genetic variability with the objective of developing superior mango
hybrids suited to emerging consumer demands.
4. The molecular fingerprinting of mango hybrids using SSR markers assumes
significance in the face of demand for exacting quality in international trade, need for ensuring
fidelity in planting stocks and solving the disputes related to intellectual property rights on
indigenous biodiversity.
8. REFERENCES
Abirami, K., Singh, S.K., Singh, R., Mohapatra, T. and Kumar, A.R. 2008. Genetic diversity
studies on polyembryonic and monoembryonic mango genotypes using molecular
markers. Indian Journal of Horticulture, 65 (3): 258-262.
Adato, A., Sharon, D. and Lavi, U. Hillel, J. and Gazit, S. 1995. Application of DNA fingerprints
for identification and genetic analyses of mango (Mangifera indica L.) genotypes.
Journal of the American Society for Horticultural Science, 120:259–264.
Anonymous. 2011. Director’s Report. 49th Convocation of P. G. School, IARI. New Delhi.
Bajpai, A., Srivastava, N., Rajan, S. and Chandra, R. 2008. Genetic diversity and discrimination
of mango accessions using RAPD and ISSR markers. Indian Journal of Horticulture,
65(4): 377-382.
Bally, I.S.E., Graham, G.C. and Henry, R.J. 1996. Genetic diversity of Kensington mango in
Australia. Australian Journal of Experimental Agriculture, 36:243–247.
Barbosa, S.V.A. and da Costa, L.P.S. 2004. Genetic variability of mango germplasm genotypes
detected by RAPD markers. Acta Horticulturae, 645: 303–310.
Bernatzsky, R. and Tanksley, S.D. 1986. Towards a saturated linkage map in tomato based on
isozymes and random cDNA sequences. Genetics, 112:887-898.
Bianchi, V.J., Sansavini, S. and Fachinello, J.C. 2004. Microsatellite markers for identification of
Prunus spp. rootstocks. Scientia Agricola, 61(3): 303-306.
Bompard, J.M. and Schnell, R.J. 1997. Taxonomy and Systematics. In ‘The Mango: Botany,
Production and Uses’. (R. E. Litz, Ed.). pp. 21-48. CAB International, Wallingford.
Bostein, B., White, R.L., Stocknick, M. and Davis, R.W. 1980. Construction of genetic linkage
map using restriction fragment length polymorphism. American Journal of Human
Genetics, 32: 314-331.
Burns, W. and Prayag, S.H. 1921. The Book of Mango. Bulletin No.103. Department of
Agriculture, Bombay.
Campbell, R.J. 1992. A Guide to Mangoes in Florida. Fairchild Tropical Gardens, Miami,
Florida, USA.
Campbell, R.J. and Zill, G. 2009. Mango selection and breeding for alternative markets and uses.
Acta Horticulturae, 820:189-196.
Capote, M., Cueto, J., Becker, D and Rohde, W. 2003. Development and application of various
DNA marker types for the characterization of genetic diversity within commercial
mango varieties. Cuba Journal of Genetics and Breeding, 57: 175-184.
Chadha, K.L. and Pal, R.N. 1986. Mangifera indica L. In: CRC Handbook of Flowering.Vol.5
(Halevy, A.H., ed.). CRC Press Inc, Boca Raton, Florida, pp. 211-223.
Chunwongse, J., Phumichai, C., Barbrasert, C., Chunwongse, C., Sukonsawan, S. and
Boonreungrawd, R. 2000. Molecular mapping of mango cultivars ‘Alphonso’ and
‘Palmar’. Acta Horticulturae, 509:193–206.
Cordeiro, M.C.R., Pinto, A. C. Q., Ramos, V. V., Faleiro, F. G. and Fraga, L. M. S. S. 2006b.
RAPD markers utilization and other parameters in the determination of mango hybrids
genitors. Revista Brasileira de Fruticultura, Jaboticabal - SP. 282: 164-167.
Cordeiro, M.C.R., Pinto, A. C. Q., Ramos, V. V F., Faleiro, G. and Fraga, L. M. S.S. 2006a.
Identification of plantlet genetic origin in polyembryonic mango (Mangifera indica, L.)
CV. Rosinha seeds using RAPD markers. Revista Brasileira de Fruticultura.,
Jaboticabal - SP. 283: 454-457.
Dang, G. S., Woeste, K., Aradhya, M. K., Koemstedt, A., Potter, D., Charles, A. L. and Mc
Granahan, D. 2005. Characterization of 14 microsatellite markers for genetic analysis
and cultivar identification of walnut. Journal of American Society of Horticultural
Science, 130 (3): 348-354.
De Candolle, A. 1904. Origin of Cultivated Plants. Kegan Paul, Trench, London.
De Souza, V.A.B. and. Lima, P.S.C. 2004. Genetic variability in mango genotypes detected by
RAPD markers. Acta Horticulturae, 645: 303-310.
Degani, C., Cohen, M., El-Batsri, R. and Gazit, S. 1992. PGI isozyme diversity and its genetic
control in mango. Horticultural Science, 27: 252–254.
Degani, C., El-Batsri, R. and Gazit, S. 1990. Enzyme polymorphism in mango. Journal of the
American Society for Horticultural Science, 115: 844–847.
Duval, M. F., Bunel, J., Sitbon, C. and Risterucci, A. M. 2005. Development of microsatellite
markers for mango (Mangifera indica L.). Molecular Ecology Notes, 5: 824–826.
Duval, M.F., Bunel, J., Sitbon, C., Risterucci, A.M., Calabre, C. and Bellec, F.L. 2006. Genetic
diversity of Caribbean mangoes (Mangifera indica L.) using microsatellite markers.
Proceedings of the 8th International Mango Symposium, February 5-10, 2006, Sun City,
South Africa.
Eiadthong, W., Yonemori, K., Kanzaki, S., Sugiura, A., Utsunomiya, N. and Subhadrabandhu, S.
2000. Amplified fragment length polymorphism analysis for studying genetic
relationships among Mangifera species in Thailand. Journal of the American Society for
Horticultural Science, 125: 160–164.
Eiadthong, W., Yonemori, S., Sugiura, A., Utsunomiya, N. and Subhadrabandhu, S. 1999a.
Analysis of phylogenetic relationship in Mangifera by restriction site analysis of an
amplified region of cpDNA. Scientia Horticulturae, 80:145–55.
Eiadthong, W., Yonemori, K., Sugiura, A., Utsunomiya, N., and Subhadrabandhu, S. 1999c.
Identification of mango cultivars of Thailand and evaluation of their genetic variation
using the amplified fragments by simple sequence repeat-SSR- anchored primers.
Scientia Horticulturae, 82: 57–66.
Eisen, J. A. 1999. Mechanistic basis for microsatellite instability. in D. B. Goldstein and C.
Schlötterer, eds. Microsatellites: evolution and applications. Oxford University Press,
Oxford.
Ellegren, H. 2004. Microsatellites: simple sequences with complex evolution. Nature Reviews
Genetics, 5: 435– 445.
Fang, J.G., Liu, D.J., Zhang, Z., Hillel, J. and Lavi, U. 1999. The construction of the
fingerprinting of two mango cultivars using AFLP. Journal of Nanjing Agricultural
University, 22 (2):25-27.
Galvez-Lopez, D., Herna Ndez-Delgado, S., Gonzalez-Paz, M., Noe Becerra-Leor, E., Salvador-
Figueroa, M. and Mayek-Perez, N. 2009. Genetic Analysis of Mango Landraces from
Mexico Based on Molecular Markers. Plant Genetic Resources: Characterization and
Utilization, 7 (3): 244-251.
Gan, Y.Y., Zaini, S. and Idris, A. 1981. Genetic variation in the grafted vegetatively propagated
mango (Mangifera indica L.). Pertanika, 4: 53-63.
Gangolly, S.P., Singh, R., Hatyal, S.L. and Singh, D. 1957. The Mango. Indian Council of
Agricultural Research, New Delhi.
Gaspero, G., Peterlunger, E. and Testolin, R. 2000. Conservation of microsatellite loci within the
genus Vitis. Theoretical and Applied Genetics, 101: 301-308.
Gonzalez, A., Coulson, M. and Brettel, R. 2002. Development of DNA markers (ISSRs) in
mango. Acta Horticulturae, 575 (1): 139-143.
Guilford, P., Prakash, S., Zhu, J. M., Rikkerink, E., Gardiner, S., Basset, H. and Forster, R. 1997.
Microsatellites in Malus x domestica apple: abundance, polymorphism and cultivar
identification. Theoretical and Applied Genetics, 94: 249-254.
Gupta, P. K. and Varshney, R. K. 2000. The development of and use of microsatellite markers
for genetic analysis and plant breeding with emphasis in bread wheat. Euphytica, 113:
163-185.
Hadonou, A.M.., Sargent, D.J., Wilson, F., James, C.M. and Simpson, D.W. 2004. Development
of microsatellite markers in Fragaria, their use in genetic diversity analysis, and their
potential for genetic linkage mapping. Genome, 47: 429–438.
He, Xin-hua, Guo, Yong –Ze, Li, Yang-rui and Ou, Shi-Jin. 2007. Assessment of genetic
diversity of mango and its relatives by cpISSR markers. Agricultural Sciences in China,
62:137-142.
Helentjaris, T. 1987. A genetic linkage map for maize based on RFLPs. Trends in Genetics,
3:217-221.
Hemanth Kumar, N. V., Narayanswamy, P. D., Prasad, T., Mukunda, G. K. and Sondur, S. N.
2001. Estimation of genetic diversity of commercial mango (Mangifera indica L.)
cultivars using RAPD markers. Journal of Horticultural Science and Biotechnology, 76:
529–533.
Hillel, J., Schaap, T., Haberfeld, A,. Jeffreys, A.J., Plotzky, Y., Cahaner, A. and Lavi, U. 1990.
DNA fingerprints applied to gene introgression in breeding programs. Genetics, 124:
783–789.
Hillis, D. M., and Moritz, C. 1990. An overview of applications of molecular systematics. In:
Molecular systematics. (D. M. Hillis and C. Moritz, eds.). Sinauer, Sunderland, Mass, pp
502-515.
Hinrichsen, P., Narvaez, C., Valenzuela, J., Munoz, C., Bowers, J.E. and Meredith, C.P. 2000.
Fingerprinting of grape cultivars grown in Chile: comparison of methods based on
anonymous sequences and a set of microsatellite loci. Acta Horticulturae, 528:163-170.
Hirano, R., Oo, T. H. and Watanabe, K. N. 2010. Myanmar Mango Landraces Reveal Genetic
Uniqueness over Common Cultivars from Florida, India, and Southeast Asia. Genome,
53 (4):321-330.
Hokanson, S. C., Szewc-McFadden, A. K., Lamboy, W. F. and McFerson, J. R. 1998.

Microsatellite SSR markers reveal genetic identities, genetic diversity and relationships
in a Malus x domestica Borkh. core subset collection. Theoretical and Applied Genetics,
97: 671- 683.
Honsho, C., Nishiyama, K., Eiadthong, W. and Yonemori, K. 2005. Isolation and
characterization of new microsatellite markers in mango (Mangifera indica). Molecular
Ecology Notes, 5: 152–154.
Hormaza, J.I. 2002. Molecular characterization and similarity relationships among apricot
(Prunus armeniaca L.) genotypes using simple sequence repeats. Theoretical and
Applied Genetics, 104:321–328
IPGRI. 2006. Descriptors for Mango (Mangifera indica L.). International Plant Genetic
Resources Institute, Rome, Italy.
Iyer, C.P.A. and Degani, C. 1997. Classical breeding and genetics. In: The Mango, Botany,
Production and Uses. (Litz, R.E., ed.), CAB International, Wallingford, UK, pp 49- 67.
Iyer, C.P.A. and Subramanyam, M.D. 1986. Creeping, a promising genotype for introduction of
dwarfness in mango. Indian Journal of Horticulture, 43: 221-223.
Jaccard, P. 1968. Nouvelles recherches sur la distribution florale. Bull Soc. Vaud Sci. Nat., 44:
223-270.
Jeffreys, A. J., Wilson, V. and Thein, S. L. 1985. Individual specific fingerprint of human DNA.
Nature, 316: 76-79.
Jintanawongse, S. and Changtragoon, S. 2000. Identification of cultivars and certification of
hybrids in mango (Mangifera indica L.) by isozyme markers. Acta Horticulturae, 509:
177-184.
JingGui, F., Zhen, Z., ZhengQiang, M., DaJun, L., SanHong, W. and Lavi, U. 2000. The
polymorphism and segregation patterns of AFLP markers in the F1 progenies from the
cross of two mango cultivars. Scientia Agricultura Sinica, 33 (3):19-24.
Kaeppler, S. M., Kaeppler, H. F. and Rhee, Y. 2000. Epigenetic aspects of somaclonal variation
in plants, Plant Molecular Biology, 43: 179–188.
Karihaloo, J. L., Dwivedi, Y. K., Archak, S. and Gaikwad, A. B. 2003. Analysis of genetic
diversity of Indian mango cultivars using RAPD markers. Journal of Horticultural
Science and Biotechnology, 78 (3): 285-289.
Kashkush, K., Jinggui, F., Tomer, E., Hillel, J. and Lavi, U. 2001. Cultivar identification and
genetic map of mango (Mangifera indica ). Euphytica, 122: 129–136.
Khanuja, S.P.S., Shasany, A.K., Darokar, M.P. and Kumar, S. 1999. Rapid isolation of DNA
from dry and fresh samples of plants producing large amounts of secondary metabolites
and essential oil. Plant Molecular Biology Reporter, 17 (1): 74.
Kirst, M., Cordeiro, C. M., Rezende, G. D. S. P. and Grattapaglia, D. 2005. Power of
microsatellite markers for fingerprinting and parentage analysis in Eucalyptus grandis
breeding populations. Journal of Heredity, 96 (2): 161–166.
Lakshminarayana S. 1980. Mango. In: Tropical and Subtropical Fruits. (Nagy, S. and Shaw
P.E., eds.) AVI Publishing, Westport/Connecticut, pp. 184–257.
Lavi, U., Cregan, P.C., Schaap, T. and Hillel, J. 1993. Application of DNA markers for
identification and breeding of perennial fruit trees. Plant Breeding Reviews, 7: 195–226.
Lavi, U., Sharon, D., Tomer, E., Adato, A. and Gazit, S. 1993. Conventional and modern
breeding of mango cultivars and rootstocks. Acta Horticulturae, 341:146-151.
Lopez Valenzuela, J. A., Martinez, O. and Paredes-Lopez, O. 1997. Geographic differentiation
and embryo type identification in Mangifera indica L. cultivars using RAPD markers.
Horticultural Science, 32: 1105–1108.
Lynch, S.J. and W. J. Krome. 1951. Mango varieties originated in Florida. Mango studies,
Florida Mango Forum. Stuart Daily News. Stuart, Florida. pp. 89-107
Maries, C. 1901-02. Indian mangoes. Journal of the Royal Horticultural Society, 26:755
McCouch, S.R., Kochert, G., Yu, Z.H. Khush, G.S., Coffman, W.R. and Tanksley, S.D. 1988.
Molecular mapping of rice chromosomes. Theoretical and Applied Genetics, 76:815-
829.
Mukherjee, S. K. 1951. The origin of mango. Indian Journal of Genetics, 2:49.
Mukherjee, S. K. 1997. Introduction: Botany and Importance. In ‘The Mango: Botany,
Production and Uses’. (Ed. R. Litz). Pp. 21-48 (CAB International, Wallingford).
Mukherjee, S.K. 1948. The varieties of mango (Mangifera indica L.) and their classification.
Bulletin of the Botanical Society of Bengal, 2:101-133.
Mukherjee, S.K. 1950. Mango: its allopolyploid nature. Nature, 166: 196–197.
Mukherjee, S.K. 1951. The origin of Mango. Indian Journal of Genetics, 2: 49.
Mukherjee, S.K. 1972. Origin of mango. Economic Botany, 26: 260-264.
Mukherjee, S.K. 1985. Systematic and ecogeographic studies on crop genepools 1. Mangifera L.
IBPGR, Rome.
Mukherjee, S.K., Majumder, P.K., and Chaterjee, S.S. 1961. An improved technique of mango
hybridization. Indian Journal of Horticulture, 18:302-304.
Naik K.C., 1948, Improvement of the mango (Mangifera indica L.) by selection and
hybridization. Ind. J. Agri. Sci., 18: 35-41.
Nakasone, H.Y. and Paull, R.E. 1998. Mango. In: Tropical Fruits. CAB International,
Wallingford, UK.
Nayak, D. 2010. Characterization of mango hybrids for fruit quality traits. Ph. D. thesis
submitted to P. G. School, IARI, New Delhi.
Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proceeding of National
Academy of Science, USA, 70: 3321–3323.
Nei, M. and Li, W. 1979. Mathematical model for studying genetic variation in terms of
restriction endonucleases. Proceedings of the National Academy of Sciences. USA, 76:
5256–5273.
Novelli, M.V., Cristofani, M., Souza, A.A. and Machado, M.A. 2006. Development and
characterization of polymorphic microsatellite markers for the sweet orange Citrus
sinensis L. Osbeck. Genetics and Molecular Biology, 29 (1):90-96.
Olano, C.T., Aymond, R., Schnell, J., Quintanilla, W.E. and Campbell, R.J. 2005. Pedigree
analysis of Florida mango cultivars. Proceedings of Florida State Horticultural Society,
118: 192-197.
Onyango, M., Haymer, D., Keeley, S. and Manshardt, R. 2010. Analysis of genetic diversity and
relationships in East African 'Apple banana' (AAB genome) and 'Muraru' (AA genome)
dessert bananas using microsatellite markers. Acta Horticulturae, 879:623-636.
Oppenheimer, C., 1956, Study tour report on subtropical fruit growing and research in India and
Ceylon. State of Israel Ministry of Agriculture. Report, October. Bulletin, 3.
Ott, J. 1992. Strategies for characterizing highly polymorphic markers in human gene mapping.
American Journal of Human Genetics, 52(2): 283-290.
Paetkau, D., Calvert, W., Stirling, I. and Strobeck, C. 1995. Microsatellite analysis of population
structure in Canadian Polar bears. Molecular Ecolology, 4: 347–354.
Pandey, S.N. 1984. International Checklist of Mango Cultivars. Published by the International
Registration Authority of Mango cultivars. Division of Fruits and Horticultural
Technology, Indian Agricultural Research Institute, New Delhi, India. 284 p.
Pandey, S.N. 1986. Mango cultivars: nomenclature and registration. Acta Horticulturae,
182:259-264.
Pandit S. S., Mitra, S., Giri, A. P., Pujari, K. H., Patil, B. P., Jambhale, N. D. and Gupta, V. S.
2007. Genetic diversity analysis of mango cultivars using inter simple sequence repeat
markers. Current Science, 93: 1135–1141.
Parida, S. K., Kalia, S. K., Sunita, K., Dalal, V., Hemaprabha, G., Selvi, A., Pandit, A., Singh,
A., Gaikwad, K., Sharma, T. R., Srivastava, P. S., Singh, N. K. and Mohapatra, T. 2009.
Informative genomic microsatellite markers for efficient genotyping applications in
sugarcane. Theoretical and Applied Genetics, 118:327–338.
Popenoe, W. 1932. Manual of Tropical and Subtropical Fruits. Macmillan, New York.
Porebski, S., Grant Bailey, L. and Bernald, R. B. 1997. Modification of a CTAB DNA extraction
protocol for lants containing high polysaccharide and polyphenol components. Plant
Molecular Biology Reporter, 15: 8-15..
Rahman, M. L., Rabbani, M. G., Siddique, M. N. A., Rahman, M. A., Garvey, E. J. and Rahman,
E. H. M. S. 2007. Molecular Characterization of 28 Mango Germplasm Using RAPD.
Plant Tissue Culture & Biotechnology, 17 (1): 71-77.
Rajan, S., Negi, S.S. and Kumar, R. 1999. Catalogue on mango (Mangifera indica L.)
germplasm. Central Institute for Subtropical Horticulture, Lucknow, India.
Ravishankar, K. V., Anand, L. and Dinesh, M. R. 2000. Assessment of genetic relatedness
among mango cultivars of India using RAPD markers. Journal of Horticultural Science
and Biotechnology, 75: 198–201.
Ravishankar, K. V., Chandrashekara, P., Sreedhara, S. A., Dinesh, M. R., Anand, L. and
Saiprasad, G. V. S. 2004. Diverse genetic bases of Indian polyembryonic and
monoembryonic mango (Mangifera indica L.) cultivars. Current Science, 87: 870–871.
Rohlf, F.J. 2000. NTSYS - PC Numerical Taxonomy and multivariate analysis system Ver. 1.60.
Exeter Publ. Ltd., Setauket, New York.
Rolphs, P. H. 1915. Mangoes in Florida. Bull.127, Agricultural Experiment Station, University of
Florida.
Rowland, L.J. and Levi, A. 1994. RAPD-based genetic linkage map of blueberry derived from a
cross between diploid species (Vaccinium darrowi and V. elliottii). Theoretical and
Applied Genetics. 87:863-868.
Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R .A. and Allard, R. W. 1984. Ribosomal
DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal
location, and population dynamics. Proceeding of National Academy of Science, USA,
81(24): 8014-8018.
Samant, D., Singh, A. K., Srivastav, M. and Singh, N. K. 2010. Assessment of genetic diversity
in mango using Inter-simple Sequence Repeat markers. Indian Journal of Horticulture,
67 (4): 1-8.
Scandalios, J.G. 1969. Genetic control of multiple forms of enzymes in plants: A review.
Biochemical Genetics, 3:37-79.
Schnell, R. J. and Knight, R.J. 1993. Genetic relationships among Mangifera spp. based on
RAPD markers. Acta Horticulturae, 341: 86-92.
Schnell, R. J., Brown, J. S., Olano, C. T., Meerow, A. W., Campell, R. J., Kuhn, D. N. 2006.
Mango genetic diversity analysis and pedigree inferences for Florida cultivars using
microsatellite markers. Journal of the American Society for Horticultural Science, 131
(2): 214-224.
Schnell, R. J., Olano, C. T., Quintanilla, W. E. and Meerow, A. W. 2005. Isolation and
characterization of 15 microsatellite loci from mango (Mangifera indica L.) and cross-
species amplification in closely related taxa. Molecular Ecology Notes, 5 (3): 625–627.
Schnell, R. J., Ronning, C. M. and Knight, R. J., Jr 1995. Identification of cultivars and
validation of genetic relationships in Mangifera indica L. using RAPD markers.
Theoretical and Applied Genetics, 90: 269–271.
Schnell, R..J. and Knight , R.J. 1992. Frequency of zygotic seedlings from five polyembryonic
mango rootstocks. Horticultural Science, 27: 252–254.
Sehgal, D. and Raina, S. N. 2008. DNA markers and germplasm resource diagnostics: new
perspectives in crop improvement and conservation strategies. In: Utilization of
biotechnology in plant sciences. (Arya I. D., Arya, S. eds.). Microsoft Printech (I) Pvt.
Ltd, Dehradun, pp. 39–54.
Selvan, Tamil. M. 2006. Characterization of newly evolved mango hybrids. Ph. D. thesis
submitted to P. G. School, IARI, New Delhi.
Singh, A. K., Devanshi, Sharma, P., Singh, R., Singh, B., Koundal, K.R. and Singh, N. K. 2007.
Assessment of genetic diversity in Ziziphus mauritiana using inter-simple sequence
repeat markers. Journal of Plant Biochemistry and Biotechnology, 16 (1): 35-40.
Singh, H. and Chadha, K. L., 1981, Evaluation of some mango cultivars on the basis of their bio-
chemical composition. Ind. J. of Hort., 38 (1-4): 70-73.
Singh, L.B., 1969. Mango (Mangifera indica L.). In: Outlines of Perennial Crop Breeding in the
Tropics, (F.P. Ferwerda and F. Wit Eds.) Landbouwhogeschool, Wageningen,
Netherlands, pp. 309–327.
Singh, R.N. 1996. Mango. Indian Council of Agricultural Research, New Delhi, India.
Singh, S., Gaikwad, A.B. and Karihaloo, J.L. 2009. Morphological and molecular analysis of
intracultivar variation in Indian mango (Mangifera indica L.) cultivars. Acta
Horticulturae, 829: 205-212.
Shareefa, M. 2008. DNA fingerprinting of mango (Mangifera indica L.) genotypes using
molecular markers. Ph. D. thesis submitted to P. G. School, IARI, New Delhi.
Srivastava, A. P., Chandra, R., Saxena, S., Rajan, S., Ranade, S. A. and Prasad, V. 2007. A PCR
based assessment of genetic diversity and parentage analysis among commercial mango
cultivars and hybrids. Journal of Horticultural Sciences and Biotechnology, 82(6): 951–
959.
Subrahmanyam, K.V. 1990. International trade in mango: India’s role. Acta Horticulturae
269:89-96.
Testolin, R., Marrazzo, T., Cipriani, G., Quarta, R., Verde, I., Dettori, M. T., Pancaldi M.
and Sansavini, S. (2000). Microsatellite DNA in peach (Prunus persica L. Batsch) and
its use in fingerprinting and testing the genetic origin of cultivars. Genome, 43: 512–520.
Truscott, M., Human, C., and Visser, G. J. 1993. Frequency of zygotic seedlings from
polyembryonic mango rootstocks. Journal of the South African Society of Horticultural
Science, 2: 109-7.
Turkoglu, Z., Bilgener, S., Ercisli, S., Bakir, M., Koc, A. Akbulut, M., Gercekcioglu, R., Gunes,
M. and Esitken, A. 2010. Simple sequence repeat-based assessment of genetic
relationships among Prunus rootstocks. Genetics and Molecular Research, 9 (4): 2156-
2165.
Ukoskit, K. 2007. Development of Microsatellite Markers in Mango (Mangifera indica L.) using
5' anchored PCR. Thammasat International Journal of Science and Technology, 12(3):
1-7.
Varshney, R.K., Graner, A. and Sorrells, M. E. 2005. Genic microsatellite markers in plants:
features and applications, Trends in Biotechnology, 23: 48–55.
Varshney R. K., Thudi, M., Aggarwal, R. and Borner, A. 2007. Genic molecular markers in
plants: development and applications. In: Genomics assisted crop improvement:
genomics approaches and platforms (Varshney RK, Tuberosa R, eds.). Vol 1. Springer,
Dordrecht, pp 13–29.
Viruel, M. A., Escribano, P., Barbieri, M., Ferri, M. and Hormaza, J. I. 2005. Fingerprinting,
embryo type and geographic differentiation in mango (Mangifera indica
L.)Anacardiaceae with microsatellites, Molecular Breeding, 15: 383-393.
Wahdan, M. T., Abdelsalam, A. Z., El-Naggar, A. A. and Hussein, M. A. 2011. Preliminary
Horticultural Studies To Describe And Identify Of Two New Egyptian Mango Strains
Using DNA Fingerprint. Journal of American Science, 7(2): 641-650.
Wester, P.J. 1920. A descriptive list of mango varieties in India. Philippines Agricultural
Review, 4: 265.
Woodhouse, E.J. 1909. The mangoes of Bhagalpur. Quarterly Journal of Department of
Agriculture, Bengal. 3: 168.
Xie, J.H., Ma, W.H. and Liu, C.M. 2007. Analysis of genetic relationships among mango germ
plasm using ISSR markers. Acta Horticulturae, 763: 185-190.
Yamanaka, N., Hasran, M., Xu, D. H., Tsunematsu, H., Idris, S. and Ban, T. 2006. Genetic
relationship and diversity of four Mangifera species revealed through AFLP analysis.
Genetic Resources and Crop Evolution, 53: 949–954.
Zaied, N. S., Khafagy, S.A.A. and Saleh, M.A. 2007. Evaluation of Some Mango Species by
Fruit Characters and Fingerprint. Research Journal of Agriculture and Biological
Sciences, 3 (4): 316-320.
Zane, L., Bargelloni, L. and Patarnello, T. 2002. Strategies for microsatellite isolation : A
Review, Molecular Ecology, 11: 1-16.
सरल अनु म पुनरावृि िच हक के योग से आम (मैि जफे रा इं िडका एल.) के
संकर का ल णन
सार
आम (मैि जफे रा इंिडका एल.) भारत का सवािधक लोकि य फल है और संसार के उ कृ फल म से एक हैI
भारत िव म आम का अ णी उ पादक देश हैI भारत िव का सबसे वृहद् आम- जनन क है, और यहाँ
किथत प से आम क १००० से अिधक जाितयाँ पायी जाती हI तथािप, यहाँ आम क जाितय के
नामकरण म ब त सी ांितयां हI भावी संर ण और भिव य के जनन काय म म योग हेत,ु उपल ध
जनन का यथाथ ल णन अितआव यक हैI पारं प रक प से आम ा प का ल णन आका रक य िच हक
से करते हI आका रक य िच हक सीिमत सं या म पाए जाते ह, उनक वंशागित ज टल होती है और वो
पयावरणीय दशा से भािवत होते हI इसके िवपरीत, आणिवक िच हक सामा यतः असीिमत सं या म
उपल ध होते ह, पयावरणीय और पादप वृि दशा से भािवत नह होते और उनक वंशागित सरल होती
हैI इस त य को यान म रखते ए, वतमान योग का उ े य सरल अनु म पुनरावृि (एसएसआर) िच हक
के योग से आम के संकर म आनुवांिशक िविवधता का मू यांकन और उनक डीएनए फगर टग करना थाI
स ह एसएसआर िच हक के योग से आम के अड़तालीस संकर का िव ेषण कया गयाI अड़तालीस संकर के
डीएनए रेखा-िच से ५९ एसएसआर िब दुपथ क पहचान क गयीI िचि हत िवकि पय का प रमाण १००
बीपी से ४८० बीपी के म य थाI आम के संकर के म य आनुवांिशक स ब ध जैकाड एक पता मान के आधार
पर ात कया गया जो ०.३८ और ०.९७ क सीमा के म य थे और ०.५९ के औसत मान के साथ पया
िविवधता द शत करते हI यूपीजीएमए समूह िव ेषण पर आधा रत ु मारेख ने संकर को तीन मु य समूह म
िवभ कयाI संकर के िलए जाित िविश फगर ट िवकिसत कये गए और उ ह बार कोड आरे ख के पम
तुत कया गयाI ऐसा िव ास कया जाता है क इस अ ययन के िन कष आम के उपल ध जनन के
संर ण और ल णन म सहायक िस होने के साथ ही भिव य फसल सुधार प रयोजना म भी मह वपूण
योगदान दगेI
ABSTRACT
Mango (Mangifera indica L.) is the choicest fruit of India and occupies a prominent place among
the best fruits of the world. India is the leading producer of mango in the world. India is the
world’s richest mango germplasm centre and reportedly, there are over 1,000 varieties of mango
found in India. However, there is a lot of confusion in nomenclature of the mango cultivars.
Accurate characterization of the available germplasm is a prerequisite for their conservation as
well as utilization in the future breeding programmes. Traditionally mango genotypes have been
characterized using morphological markers. Morphological markers are limited in number, have
complex inheritance pattern, and are affected by environmental conditions. Contrary to this,
molecular markers are practically unlimited in number, remain unaffected by the environment
and growth conditions, and are simply inherited. Keeping in view this fact, the present
experiment was carried out for estimating the genetic diversity among mango hybrids and to
prepare their DNA fingerpints using SSR markers. Forty eight mango hybrids were analyzed
using 17 SSR markers. These primers detected 59 scorable loci, of which 45 were polymorphic.
The size of the alleles detected ranged from 100 bp to 480 bp. Polymorphis Information Content
(PIC) of SSR markers ranged from 0.023 to 0.295. The genetic relationship among mango
hybrids, based on Jaccard’s Similarity Coefficient, ranged from 0.38 to 0.97. The dendrogram,
based on UPGMA cluster analysis, grouped the mango hybrids into three major groups. The
Principal Coordinates Analysis also exhibited more or less similar distribution of mango hybrids.
Cultivar specific fingerprints were developed for the hybrids and represented as barcode
diagram. The findings of this study will prove helpful in the accurate identification of mango
hybrids facilitating germplasm conservation. It is expected that mango breeders will fruitfully
utilize the results of this study to expediate mango improvement programme in future.
ANNEXURE-I
1. Solutions, chemicals and reagents used for DNA extraction
1. Liquid Nitrogen
2. Cetyl Trimethyl Ammonium Bromide (CTAB) Buffer for DNA extraction:
(i) CTAB (10%)

10g CTAB was dissolved in sterile distilled H2O and volume was made upto 100 ml with
distilled water.
(ii) Sodium chloride (NaCl, 4M)

292.2g of NaCl was dissolved in distilled H2O and volume was made upto 100 ml. The
solution was autoclaved prior to use.
(iii) Tris: Cl buffer (pH 8.0, 1M)

12.11 g of Tris salt was dissolved in distilled H2O and volume was made upto 100 ml and
pH was adjusted to 8.0 using 1 N HCl. The solution was autoclaved prior to use.
(iv) Ethylene Diamine Tetra Acetic acid (EDTA, 0.5 M)

18.62 g EDTA was dissolved in sterile distilled H2O. The pH of the solution was adjusted
to 8.0 using IN NaOH. The volume was made upto 100 ml using sterile distilled H2O and the
solution was autoclaved.
(v) 2-Mercaptoethanol (2%)

2% solution provided by manufacturer was used directly.
Buffer composition
Component Stock sol. Working Vol. of stock taken to

buffer prepare 200 ml buffer
1. CTAB 10% 1.5% 40 ml
2. NaCl 4M 1.4 M 70 ml
3. Tris 1M 100mM 20 ml
4. EDTA 0.5 M 20 mM 8 ml
5. Mercaptoethanol 2% 2% 4 ml
6. Distilled H2O - - 58 ml
200 ml
3. Isopropanol
4. Sodium Acetate solution (3M, pH 5.6)

30.75 g sodium acetate was dissolved in sterile distilled H2O, pH was adjusted to 5.6 with
glacial acetic acid and volume made upto 50 ml. The solution was autoclaved and stored till use.
5. Chloroform: Isoamyl alcohol (24:1) mixture 96 ml of chloroform was mixed with 4 ml of

isoamyl alcohol. It was stored in amber coloured bottle.
6. 70% Ethanol 70 ml of absolute ethanol was mixed well with 30ml of sterile water and stored
in a stoppered bottle till use.
II. DNA purification

1. Phenol: Chloroform: isoamyl alcohol (25:24:1) mixture
100 ml of Tris saturated phenol was added to a mixture of 96 ml chloroform and 4 ml
isoamyl alcohol. The mixture was mixed well prior to use and stored in amber coloured bottle.
2. RNaseA (20 mg/ml) solution

RNaseA : 20 mg
Tris-Cl (pII 7.5) : 10mM
NaCl : 15mM
Sterile water was added to make the volume to 1 ml. The solution was heated at 100oC
for 15 minutes to inactivate any DNase present and then stored in aliquots at –20oC.
3. Pronase (10 mg/ml) solution prepared in sterile distilled water.
III. Solvent for DNA

Tris: EDTA (TE) buffer (10 mM Tris: 1mM EDTA, pH 8.0) III 10 ml of Tris (1M)
buffer, pH 8.0 and 0.2 ml of 0.5 M EDTA, pH 8.0 was mixed with sterile distilled H2O and
volume made upto 100 ml. The solution was autoclaved prior to use.
IV DNA Quantification
1. Hoechst Dye (H-33258) 10 X solution:

10 mg of Hoechst 33258 dye was dissolved in sterile distilled H2O and volume made
upto 100 ml and stored in an amber coloured bottle at 4oC.
2. 10 X TNE buffer stock solution (100 mM Tris: 10mM EDTA: 2M NaCl, pH 7.4) 12.11 g
Tris, 3.72 g EDTA and 116.89 g of NaCl were dissolved in sterile distilled water and volume
was made upto 100 ml using distilled water. The pH was adjusted to 7.4 with conc. HCl solution,
filtered before use and stored at 4oC.
3. Assay solution
Component Low range DNA assay High range DNA

10-500 ng/ml final DNA conc. assay 100-5000 ng/ml
Hoechst 33258 stock 10 µl l 100 µl

soln
10 X TNE 10 ml 10 ml
Distilled H2O 90 ml 90 ml
Prepared fresh each time
4. DNA standard
i. Low range assay:
1 µl/ml of calf thymus DNA standard was used at 1:10 dilution (100 µg/ml). 2ml
of calf thymus DNA (100 g/ml) was mixed with 2ml assay solution for low range which
gave 100 ng/ml standard solution.
ii. High range assay
2µl thymus DNA standard (1g/ml) was mixed in 2 ml assay solution for high
range assay gave 1000 ng/ml standard solution.
V. Gel Electrophoresis
1. Agarose gel (0.8%)
1.6 g agarose was added to 200 ml with 1 X TBE buffer, the contents were mixed
thoroughly and boiled for 2-5 minutes to dissolve the contents. The mixture was cooled
down to 40 oC. The molten gel was cast in a gel tray with a comb containing teeth to
produce wells.
2. Ethidium bromide (10 mg ml-1)

10 mg of ethidium bromide was dissolved in sterile water and volume made up to
1 ml. The solution was stored in an amber coloured bottle, at 4 oC.
3. Loading dye (10X) solution

1. Bromophenol Blue : 0.25%
2. Xylene cyanol FF : 0.25%
3. Glycerol : 50%
4. TAE :1X
4. Tris: Boric acid : EDTA (TBE) buffer – 10 X (stock) solution. PH 8.0

Tris : 108 g
Boric acid : 55
0.5 M EDTA : 40 ml
Distilled H2O : Volume made upto 1litre
VI. PCR Cocktail
1. Taq DNA Polymerase
A stock solution of 3 units l-1 was provided by the manufacturer
(Fermentas) was stored at –20oC.
2. 10 X Assay buffer
10 X PCR assay buffer for Taq DNA polymerase containing 25mM µl-1
magnesium chloride provided by the manufacturer (Fermentas) was used. Storage
was at –20oC.
3. Deoxyribonucleotide Triose phosphate

A mix of 25mM dATP , dGTP, dCTP , and dTTP) were provided by the
manufacturer (Fermentas) and stored at –20 oC till use.
4. Magnesium chloride
A solution of 25 mM provided by the manufacturer (Fermentas), stored at
–20oC, was used.
5. Primer
The primer was provided by the manufacturer in a lyophilized form. Based
on the molecular weight of a given primer, a solution of 10 µM was prepared by
adding the required amount of sterile water. Storage was at –20oC.
ANNEXURE-II
Reagents and Chemicals
1. DNA extraction
(a) C-TAB buffer Source
Tris Ameresco
NaCl Ameresco
EDTA Ameresco
C-TAB Ameresco
â-Mercaptoethanol Ameresco
(b) Chloroform: Isoamulalcohol (24:1) Ameresco
(c) Isopropanol Ameresco
(d) Tris EDTA (TE) in 10: 1 ratio

Tris Ameresco
EDTA Ameresco
(e) Chloroform Isoamyl alcohol (24:1) Mixture Ameresco
(f) Ethanol Ameresco
2. DNA quantification
(a) 10 X TNE buffer
Tris Ameresco
NaCl Ameresco
EDTA Ameresco
(b) Hoeschst 3.3258 dye Sigma
(c) Calf thymus DNA Sigma
3. SSR Analysis
1. Taq DNA polymerase Fermentas
2. Buffer Fermentas
3. MgCl2 Fermentas
4. dNTP mixture Fermentas
5. Primer Axygen
4. Agarose Gel Electrophoresis

Agarose (molecular biology grade) Biochem
TAE components Sigma
Ethidium bromide solution Ameresco
Loading dye (6X) Sigma
DNA ladder (Gene ruler 100 bp) MBI fermantas
Instruments
1. DNA extraction and quantification

Microfuge Eppendorf
Centrifuge Eppendorf
Micropippets Eppendorf
Waterbath Onbitek
Beep freezer (-20 0C) Kelvinator
Refrigerator Kelvinator
Dy NA Quant 200 flourimeter Hoefer
Quarts cuvltte Sigma
Eppendorf tubes Tarsons
pH meter Systronics
Vortex Tarsons
Water purification system Millipore
3. Gel electrophoresis
1. Gel electrophoresis unit Scientific system
2. UV transilluminator UVP
3. Camera (polaroid Gelcam and Digital Kodak
DC40)
4. Poser Pack 300 Biorad

5. Microwave oven BPL sanyo
6. Lab Shaker Kuhner
Table 3.1 List of mango (Mangifera indica L.) hybrids selected for the study
S. No. HYBRID PARENTAGE

1 Pusa Pratibha Amrapali x Sensation
2 H-1-3 Amrapali x Sensation
4 Pusa Shreshth Amrapali x Sensation
11 H-2-3 Amrapali x Lal Sundari
14 Pusa Peetambar Amrapali x Lal Sundari
21 H-6-1 H-8-11 x IIHR- 95
23 H-6-6 Amrapali x Alphonso
33 Ratna Neelum x Alphonso
39 H-9-9 Amrapali x Pusa Arunima
41 Pusa Arunima Amrapali x Sensation
43 H-13-3 Neelum x Dashehari
Table 3.2 List of SSR primers (forward and reverse) and their base sequence
Sl. Locus Gene Bank Sequence (5’ 3’) Repeat motif

No. Accession No.
1 MiSHRS-1 AY942817 F: TAACAGCTTTGCTTGCCTCC (CT/AG)14
R: TCCGCCGATAAACATCAGAC
2 MiSHRS-4 AY942818 F: CCACGAATATCAACTGCTGCC (CT/AG)11
R: TCTGACACTGCTCTTCCACC
3 MiSHRS-18 AY942819 F: AAACGAGGAAACAGAGCAC (AAC/GTT)8
R: CAAGTACCTGCTGCAACTAG
4 MiSHRS-23 AY942820 F: AGGTCTTTTATCTTCGGCCC (TATG/CATA)7
R: AAACGAAAAAGCAGCCCA
5 MiSHRS-26 AY942821 F: TGTAGTCTCTGTTTGCTTC (GTT/ACC)6
R: TTCTGTGTCGTCAAACTC
6 MiSHRS-29 AY942822 F: CAACTTGGCAACATAGAC (TG/CA)9
R: ATACAGGAATCCAGCTTC
7 MiSHRS-30 AY942823 F: AGAATAAAGGGGACACCAGAC (GTTGTGT/
R: CCATCATCGCCCACTCAG ACACAAC)3
8 MiSHRS-32 AY942824 F: TTGATGCAACTTTCTGCC (CA/TG)9
R: ATGTGATTGTTAGAATGAACTT
9 MiSHRS-33 AY942825 F:CGAGGAAGAGGAAGATTATGAC (CGG/CCT)7
R: CGAATACCATCCAGCAAAATAC
10 MiSHRS-34 AY942826 F: TGTGAAATGGAAGGTTGAG (GTT)5GCA(GTT)5
R: ACAGCAATCGTTGCATTC
11 MiSHRS-36 AY942827 F: GTTTTCATTCTCAAAATGTGTG (CT/AG)15
R: CTTTCATGTTCATAGATGCAA
12 MiSHRS-37 AY942828 F: CTCGCATTTCTCGCAGTC (AG/CT)9
R: TCCCTCCATTTAACCCTCC
13 MiSHRS-39 AY942829 F: GAACGAGAAATCGGGAAC (GTT/AAC)8
R: GCAGCCATTGAATACAGAG
14 MiSHRS-44 AY942830 F: AACCCATCTAGCCAACCC (TC/GA)11(TA)10
R: TTGACAGTTACCAAACCAGAC (CA/TG)9(TA)3(CA/
TG)3
15 MiSHRS-48 AY942831 F: TTTACCAAGCTAGGGTCA (GA/TC)15
R: CACTCTTAAACTATTCAACCA
16 LMMA1 AY628373 F: ATGGAGACTAGAATGTACAGAG (GA)13
R: ATTAAATCTCGTCCACAAGT
17 LMMA2 AY628374 F: AAATAAGATGAAGCAACTAAAG (GA)11
R: TTAGTGATTTTGTATGTTCTTG
18 LMMA3 AY628375 F: AAAAACCTTACATAAGTGAATC (GA)16
R: CAGTTAACCTGTTACCTTTTT
19 LMMA4 AY628376 F: AAAAACCTTACATAAGTGAATC (GA)13
20 LMMA5 AY628377 F: AGAATAAGCTGATACTCACAC (GA)9
R: TAACAAATATCTAATTGACAGG
21 LMMA6 AY628378 F: ATATCTCAGGCTTCGAATGA (GA)14
R:TATTAATTTTCACAGACTATGTTCA
22 LMMA7 AY628379 F: ATTTAACTCTTCAACTTTCAAC (CT)15
R: AGATTTAGTTTTGATTATGGAG
23 LMMA8 AY628380 F: CATGGAGTTGTGATACCTAC (GA)12
R: CAGAGTTAGCCATATAGAGTG
24 LMMA9 AY628381 F: TTGCAACTGATAACAAATATAG (GA)13
R: TTCACATGACAGATATACACTT
25 LMMA10 AY628382 F: TTCTTTAGACTAAGAGCACATT (GA)10
R: AGTTACAGATCTTCTCCAATT
Table 4.1.1 Composition of PCR reaction mixture
Sl. No. Component Concentration Volume required for

single tube (μl)
1 Taq Buffer 10 X 1.5
2 MgCl2 25 mM 2.0
3 dNTP 25 mM 0.2
4 Primer (forward and reverse) 5 picomoles 2.5
5 DNA 25 ng/μl 2.0
6 Taq polymerase 0.75 U 1.5
7 Sterilized Distilled Water 5.3
Total Reaction Volume 15
Table 4.1.2 List of primers selected for the fingerprinting of mango hybrids
Sl. No. Locus Primer sequence

1 MiSHRS-1 F: TAACAGCTTTGCTTGCCTCC
2 MiSHRS-18 F: AAACGAGGAAACAGAGCAC
R: CAAGTACCTGCTGCAACTAG
3 MiSHRS-23 F: AGGTCTTTTATCTTCGGCCC
R: AAACGAAAAAGCAGCCCA
4 MiSHRS-29 F: CAACTTGGCAACATAGAC
R: ATACAGGAATCCAGCTTC
5 MiSHRS-30 F: AGAATAAAGGGGACACCAGAC
R: CCATCATCGCCCACTCAG
6 MiSHRS-32 F: TTGATGCAACTTTCTGCC
R: ATGTGATTGTTAGAATGAACTT
7 MiSHRS-33 F:CGAGGAAGAGGAAGATTATGAC
R: CGAATACCATCCAGCAAAATAC
8 MiSHRS-36 F: GTTTTCATTCTCAAAATGTGTG
R: CTTTCATGTTCATAGATGCAA
9 MiSHRS-37 F: CTCGCATTTCTCGCAGTC
R: TCCCTCCATTTAACCCTCC
10 MiSHRS-39 F: GAACGAGAAATCGGGAAC
R: GCAGCCATTGAATACAGAG
11 MiSHRS-48 F: TTTACCAAGCTAGGGTCA
R: CACTCTTAAACTATTCAACCA
12 LMMA-1 F: ATGGAGACTAGAATGTACAGAG
13 LMMA-2 F: AAATAAGATGAAGCAACTAAAG
14 LMMA-3 F: AAAAACCTTACATAAGTGAATC
15 LMMA-4 F: AGATTTAAAGCTCAAGAAAAA
R: AAAGACTAATGTGTTTCCTTC
16 LMMA-8 F: CATGGAGTTGTGATACCTAC
17 LMMA-10 F: TTCTTTAGACTAAGAGCACATT
Table 4.1.3 No. of alleles and allele size obtained using SSR markers in mango hybrids
Sl.No. Locus Primer sequence No. of alleles Allele Size

(bp)
1 MiSHRS-1 F: TAACAGCTTTGCTTGCCTCC 3 180-220
2 MiSHRS- F: AAACGAGGAAACAGAGCAC 3 100-120
18 R: CAAGTACCTGCTGCAACTAG
3 MiSHRS- F: AGGTCTTTTATCTTCGGCCC 6 140-250
23 R: AAACGAAAAAGCAGCCCA
4 MiSHRS- F: CAACTTGGCAACATAGAC 2 180-200
29 R: ATACAGGAATCCAGCTTC
5 MiSHRS- F: AGAATAAAGGGGACACCAGAC 3 220-300
30 R: CCATCATCGCCCACTCAG
6 MiSHRS- F: TTGATGCAACTTTCTGCC 2 210-230
32 R: ATGTGATTGTTAGAATGAACTT
7 MiSHRS- F:CGAGGAAGAGGAAGATTATGAC 2 250-270
33 R:
CGAATACCATCCAGCAAAATAC
8 MiSHRS- F: GTTTTCATTCTCAAAATGTGTG 3 200-250
36 R: CTTTCATGTTCATAGATGCAA
9 MiSHRS- F: CTCGCATTTCTCGCAGTC 3 140-250
37 R: TCCCTCCATTTAACCCTCC
10 MiSHRS- F: GAACGAGAAATCGGGAAC 4 380-480
39 R: GCAGCCATTGAATACAGAG
11 MiSHRS- F: TTTACCAAGCTAGGGTCA 3 200-400
48 R: CACTCTTAAACTATTCAACCA
12 LMMA1 F: 6 120-250
ATGGAGACTAGAATGTACAGAG
13 LMMA2 F: 4 300-400
AAATAAGATGAAGCAACTAAAG
14 LMMA3 F: AAAAACCTTACATAAGTGAATC 3 120-250
15 LMMA4 F: AGATTTAAAGCTCAAGAAAAA 5 230-350
R: AAAGACTAATGTGTTTCCTTC
16 LMMA8 F: CATGGAGTTGTGATACCTAC 3 270-300
17 LMMA10 F: TTCTTTAGACTAAGAGCACATT 4 160-225
Table 4.1.4 Heterozygosity and Polymorphism Information content (PIC) of SSR markers
Locus Primer Sequence Heterozygosity Polymorphism

(H) Information
content (PIC)
MiSHRS-1 F: TAACAGCTTTGCTTGCCTCC
R: TCCGCCGATAAACATCAGAC 0.044 0.073
MiSHRS-18 F: AAACGAGGAAACAGAGCAC
R: CAAGTACCTGCTGCAACTAG 0.256 0.144
MiSHRS-23 F: AGGTCTTTTATCTTCGGCCC
R: AAACGAAAAAGCAGCCCA 0.413 0.295
MiSHRS-29 F: CAACTTGGCAACATAGAC
R: ATACAGGAATCCAGCTTC 0.042 0.041
MiSHRS-30 F: AGAATAAAGGGGACACCAGAC
R: CCATCATCGCCCACTCAG 0.238 0.171
MiSHRS-32 F: TTGATGCAACTTTCTGCC
R: ATGTGATTGTTAGAATGAACTT 0.251
0.340
MiSHRS-33 F:CGAGGAAGAGGAAGATTATGAC
R: CGAATACCATCCAGCAAAATAC 0.321 0.248
MiSHRS-36 F:CGAGGAAGAGGAAGATTATGAC
R: CGAATACCATCCAGCAAAATAC 0.067 0.042
MiSHRS-37 F: CTCGCATTTCTCGCAGTC
R: TCCCTCCATTTAACCCTCC 0.489 0.249
MiSHRS-39 F: GAACGAGAAATCGGGAAC
R: GCAGCCATTGAATACAGAG 0.117 0.023
MiSHRS-48 F: TTTACCAAGCTAGGGTCA
R: CACTCTTAAACTATTCAACCA 0.422 0.283
LMMA-1 F: ATGGAGACTAGAATGTACAGAG
R: ATTAAATCTCGTCCACAAGT 0.326 0.208
LMMA-2 F: AAATAAGATGAAGCAACTAAAG
R: TTAGTGATTTTGTATGTTCTTG 0.337 0.247
LMMA-3 F: AAAAACCTTACATAAGTGAATC
R: CAGTTAACCTGTTACCTTTTT 0.108 0.073
LMMA-4 F: AAAAACCTTACATAAGTGAATC
R: CAGTTAACCTGTTACCTTTTT 0.204 0.219
LMMA-8 F: CATGGAGTTGTGATACCTAC
R: CAGAGTTAGCCATATAGAGTG 0.359 0.242
LMMA-10 F: TTCTTTAGACTAAGAGCACATT
R: AGTTACAGATCTTCTCCAATT 0.264 0.201
Table 4.2.1 No. of fingerprints generated, No. of unique fingerprints and probability of identity
of SSR markers
Sl. No. Primer No. of No. of unique Probability of

fingerprints fingerprints identity
generated
1 MiSHRS- 1 3 1 0.2314
2 MiSHRS- 18 3 1 0.5931
3 MiSHRS- 23 12 0 0.7385
4 MiSHRS- 29 2 0 0.1215
5 MiSHRS- 30 3 1 0.5168
6 MiSHRS- 32 2 0 0.5505
7 MiSHRS- 33 2 0 0.5816
8 MiSHRS- 36 3 0 0.2332
9 MiSHRS- 37 4 0 0.7668
10 MiSHRS- 39 5 1 0.7952
11 MiSHRS- 48 4 0 0.7456
12 LMMA- 1 12 0 0.8848
13 LMMA- 2 5 0 0.8067
14 LMMA- 3 4 0 0.8658
15 LMMA- 4 5 0 0.7589
16 LMMA- 8 3 0 0.7491
17 LMMA- 10 4 1 0.7429
Total 76 5 0.6284 (Av.)
Table 4.2.2 Desription of unique fingerprints identified in mango hybrids
Sr. SSR Locus No. of unique fingerprints Hybrid Size of fingerprints

No. (bp)
1 MiSHRS-1 1 H-9-6 220

2 MiSHRS-18 1 H-9-3 90
3 MiSHRS-30 1 Pusa Arunima 300
4 MiSHRS-39 1 Pusa Shreshth 350
5 LMMA-10 1 H-9-6 250

Fig. 4.2.1 Barcode representation of DNA fingerprints of 48 mango hybrids
Cluster B 2
Cluster B 1
Cluster A
Fig. 4.1.1 Dendrogram based on UPGMA analysis of forty eight mango hybrids using SSR
markers (P* Pusa)
Fig. 4.1.2 Principal Co-ordinates Analysis of 48 mango hybrids using SSR markers
Plate 4.1.1 Amplification profile of mango hybrids using the primer MiSHRS-1
Note- Arrow indicates unique fingerprint of approximately 220 bp size in hybrid H-9-6
(Amrapali x Sensation)
Note- Arrow indicates unique fingerprint of approximately 300 bp size in hybrid Pusa Arunima
Note- Arrow indicates unique fingerprint of approximately 350 bp size in hybrid H-9-6
Plate 4.1.5 Amplification profile of mango hybrids using the primer LMMA-1
Plate 4.1.6 Amplification profile of mango hybrids using the primer LMMA-10
Note- Arrow indicates unique fingerprint of approximately 250 bp size in hybrid Pusa Shreshth

6 DDF

Hochgeladen von

Dokumentinformationen

Originalbeschreibung:

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

6 DDF

Hochgeladen von

Copyright:

Verfügbare Formate

सरल अनु म पु नरावृ ि त च हक के योग से आम (मैि जफेरा इं डका एल.

Characterization of mango (Mangifera indica L.)

DIVISION OF FRUITS AND HORTICULTURAL TECHNOLOGY

Chairman Dr. A.K. Singh ____________________

Members Dr. S.K. Singh ____________________

Dr. Manish Srivastav ____________________

Dr. N.K. Singh ____________________

Dr. A.K. Singh ____________________

Dr. Girish Jha ____________________

Place: New Delhi (A. K. Singh)

Place: New Delhi

Date: September 12, 2011 (ANSHUMAN SINGH)

S. No. CHAPTER PAGE No.

3. MATERIALS AND METHODS 22-28

4.1. RESEARCH PAPER-1 29-34

4.2 RESEARCH PAPER-2 35-39

5. GENERAL DISCUSSION 40-43

6. SUMMARY AND CONCLUSION 44-47

S. NO. TITLE AFTER PAGE

3.1 List of mango hybrids selected for the study 22

4.1.1 The composition of PCR reaction mixture 30

4.1.2 List of primers selected for the fingerprinting ofmango hybrids 30

4.1.5 Jaccard’s similarity values generated by Simple Sequence Repeat primers in 48 31

4.2.2 Description of unique fingerprints identified in mango hybrids 37

S. NO. TITLE AFTER PAGE

4.1.2 Principal Co-ordinates Analysis of 48 mango hybrids using SSR markers 31

4.2.1 Barcode representation of DNA fingerprints of 48 mango hybrids 37

S. NO. TITLE AFTER PAGE

4.1.1 Amplification profile of mango hybrids using the primer MiSHRS-1 31

4.1.2 Amplification profile of mango hybrids using the primer MiSHRS-23 31

4.1.3 Amplification profile of mango hybrids using the primer MiSHRS-30 31

4.1.4 Amplification profile of mango hybrids using the primer MiSHRS-39 32

4.1.5 Amplification profile of mango hybrids using the primer LMMA-1 32

4.1.6 Amplification profile of mango hybrids using the primer LMMA-10 32

CTAB - Cetyl Trimethyl Ammonium Bromide

DAMD - Directed Amplification of Minisatellite DNA

DNA - Deoxyribonucleic acid

dNTP - 2 deoxyribonucleotide 5’ Triphosphate

EDTA - Ethylene Diamine Tetra Acetic acid

IPGRI - International Plant Genetic Resource Institute

ISSR - Inter Simple Sequence Repeat Markers

NTSYS - Numerical Taxonomical System

PCR - Polymerase Chain Reaction

PVP - Poly Vinyl Pyrolidine

PCA - Principal Co-ordinate Analysis

RAPD - Random Amplified Polymorphic DNA

RFLP - Restriction Fragment Length Polymorphism

SSRs - Simple Sequence Repeats

STMS - Sequence Tagged Microsatellite Site

TBE - Tris Borate EDTA

TE - Tris EDTA Buffer

VNTRs - Variable Number Tandem Repeats

UPGMA - Unweighted Pair-group Method of Arithmetic Average

Characterization of the available germplasm is a prerequisite for their conservation as

2. To carry out molecular fingerprinting of selected mango hybrids developed at IARI.

The existing genetic diversity in mango is attributed to genetic as well as environmental

2.1 Research Area I (Objective I)

There is considerable confusion in mango cultivar nomenclature because many clonally

2.1.1. Morphological markers

Ain-e-Akbari, an encyclopaedia written during the reign of Mughal emperor Akbar

Although morphological markers offer advantages in terms of simple process and

Truscott et al. (1993) characterized 88 mango cultivars on the basis of isocitrate