CLINICAL MICROBIOLOGY REVIEWS, Apr. 2008, p. 291–304 Vol. 21, No.

2
0893-8512/08/$08.00⫹0 doi:10.1128/CMR.00030-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Human Bocavirus: Passenger or Pathogen in Acute Respiratory

Tract Infections?
Oliver Schildgen,1‡* Andreas Müller,2 Tobias Allander,3 Ian M. Mackay,4,5
Sebastian Völz,2 Bernd Kupfer,2‡ and Arne Simon1
Institute for Virology, University of Bonn, Bonn, Germany1; Children’s Hospital Medical Center, University of Bonn, Bonn, Germany2;
Karolinska Institutet, Department of Microbiology Tumor and Cell Biology, Laboratory for Clinical Microbiology,
Karolinska University Hospital, Stockholm, Sweden3; Queensland Paediatric Infectious Diseases Laboratory,
Sir Albert Sakzewski Virus Research Centre, Royal Children’s Hospital, Brisbane, Australia4; and
Clinical Medical Virology Centre, University of Queensland, Brisbane, Australia5

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

INTRODUCTION .......................................................................................................................................................291
TAXONOMY ...............................................................................................................................................................292
BIOLOGY OF BOCAVIRUS.....................................................................................................................................292
LABORATORY DIAGNOSIS....................................................................................................................................292
HBoV AND RESPIRATORY TRACT DISEASE ....................................................................................................293
Possible Role of Coinfections ................................................................................................................................295
EPIDEMIOLOGY .......................................................................................................................................................295
Prevalence of HBoV ................................................................................................................................................297
Seasonal Distribution of HBoV Detection...........................................................................................................297
Transmission ...........................................................................................................................................................298
CLINICAL OBSERVATIONS ...................................................................................................................................299
Limitations of Available Studies...........................................................................................................................300
Symptoms Presumably Associated with HBoV Infection ..................................................................................300
Chest Radiography Findings.................................................................................................................................301
HBoV and Acute Wheezing....................................................................................................................................301
HBoV in Immunocompromised Patients .............................................................................................................301
Laboratory Results for HBoV-Infected Patients.................................................................................................301
TREATMENT AND PREVENTION.........................................................................................................................302
CONCLUSIONS AND FURTHER RESEARCH ....................................................................................................302
ACKNOWLEDGMENTS ...........................................................................................................................................302
REFERENCES ............................................................................................................................................................302

INTRODUCTION viruses were not sought using PCR, and several other known
respiratory pathogens, including human rhinoviruses (HRVs)
Human bocavirus (HBoV) was first described in September
and human coronaviruses (HCoVs), were not sought by any
2005 by Tobias Allander and coworkers at the Karolinska
means. The fact that HBoV was not detected randomly in the
University Hospital, Stockholm, Sweden (2). The finding re-
material but was detected significantly more often in the ab-
sulted from the intensive investigation of two chronologically
sence of other detected viruses nevertheless suggested that
distinct pools of nasopharyngeal aspirates (NPAs) obtained
HBoV may be a causative agent of previously unexplained
from mostly pediatric patients with suspected acute respiratory
respiratory tract disease. All 14 children without codetection
tract infections (ARTIs). Thus, HBoV joined the ranks of
had been admitted to an inpatient medical treatment center
viruses colloquially termed “respiratory viruses,” which are
after presenting with symptoms of cough and fever during the
detected predominantly in patients with infection of the respi-
previous 1 to 4 days.
ratory tract. A random PCR-cloning-sequencing approach was
Since the first report, the worldwide presence of HBoV in
employed. In the original study, HBoV DNA was subsequently
children with ARTI has been confirmed by over 40 studies.
identified in 17 out of 540 NPAs (3.1%). Coincident detection
However, most published studies describe virus prevalence and
of another virus occurred for three patients (17.6% of positive
were not designed to address the issue of disease association.
patients), including two instances of human respiratory syncy-
Thus, to date, the evidence for an association between HBoV
tial virus (RSV) and one detection of human adenovirus
and respiratory tract disease is incomplete. The many preva-
(AdV) (2). No other viruses were detected in 14 of 17 HBoV-
lence studies have found an unusually high number of coinfec-
positive symptomatic patients, at a glance suggesting a high
tions where HBoV occurs simultaneously with other viruses,
occurrence of sole detections. However, common respiratory
making the association of HBoV with disease more complex.
Moreover, Koch’s revised postulates cannot be applied to
HBoV, since neither a method for HBoV culture nor an ani-
* Corresponding author. Mailing address: Institute for Virology, Sigmund-
Freud-Str. 25, D-53105 Bonn, Germany. Phone: 49-(0)228-28711186. Fax:
mal model of infection has been established (26). This situa-
49-(0)228-28714433. E-mail: schildgen@virology-bonn.de. tion applies to most newly identified viruses, including HCoV-
‡ These authors contributed equally to this work. NL63 (72) and HCoV-HKU1 (82), polyomaviruses KI (2) and

291
292 SCHILDGEN ET AL.
WU (29), and the HRVs, HRV-QPM, NAT-001, and NAT-
045 (51). Many newly identified viruses have probably re-
mained undetected until now exactly because of their inability
to replicate in vitro under standard conditions and may there-
fore never fulfill Koch’s postulates. Well-designed clinical stud-
ies will be needed to confirm the causative role of a virus for a
disease, as proposed by Fredericks and Relman (26). A num-
ber of these studies will be required before a causative role for
HBoV in respiratory tract disease can be established.
This review includes all HBoV studies published online up
to early 2007, includes prospectively collected data from the
winter season from 2005 to 2006 (74), and discusses virological
and clinical aspects of this newly identified virus.
TAXONOMY
HBoV is a putative member of the family Parvoviridae (sub-
family Parvovirinae, genus Bocavirus). Until the identification
of HBoV, human parvovirus B19 (B19V) (subfamily Parvoviri-
nae, genus Erythrovirus) had been the only human pathogen in
the family. B19V is the causative agent of fifth disease, hydrops
fetalis (53), and aplastic anemia, in particular in patients with
preexisting hematopoietic disease (20, 21, 23, 30, 42, 76).
HBoV was classified as a bocavirus based on genomic structure
and amino acid sequence similarity shared with the namesake
members of the genus, bovine parvovirus (13) and canine
minute virus (9, 65). Consequently, the first human member of
this virus genus has been provisionally termed human bocavi-
rus (2, 52). Other human parvoviruses of interest include the
newly identified human parvovirus 4 (PARV4), which is cur-
rently unclassified, and the five current species of human ad-
eno-associated viruses (AAV), which reside in the genus De-
pendovirus. PARV4 is detected in human plasma used in the
manufacture of medicinal products, but no pathogenic roles
have as yet been demonstrated (28). The AAVs rely on an-
other “helper” virus to replicate, usually an AdV, but in their
absence AAVs integrate in a site-specific manner into the
human genome.
The International Committee on Virus Taxonomy defines
species within the genus Bocavirus as probably antigenically
distinct, with natural infection confined to a single host species.
Species are ⬍95% related by nonstructural gene DNA se-
quence. To date, studies of HBoV have addressed only the
molecular criterion. This is indeed the main criterion, since
there have been no comparative antigenic studies among any
of the species of this genus. Although humans are assumed to
be the natural host of HBoV, it should be noted that no studies
have investigated lower animals for the presence of HBoV.
BIOLOGY OF BOCAVIRUS
The members of the family Parvoviridae are small, nonen-
veloped viruses. They have isometric nucleocapsids with diam-
eters of 18 to 26 nm that contain a single molecule of linear,
negative-sense or positive-sense, single-stranded DNA. The
complete genome has a length of approximately 4,000 to 6,000
nucleotides (nt) (1, 2).
The complete genome length of HBoV has not been deter-
mined, but at least 5,299 nt were identified in one of the
reference strains. It can be assumed from the genome structure
CLIN. MICROBIOL. REV.
of other parvoviruses that the genomic DNA of bocavirus is
flanked by hairpin structures. These structures cannot be de-
ciphered by sequencing methods alone; thus, the complete
sequence of the entire genome will not be available until the
flanking structures are elucidated (2).
The genome contains three proposed open reading frames,
with two open reading frames putatively encoding the non-
structural proteins (NS1 and NP-1) and one encoding two viral
capsid proteins, VP1 and VP2; the VP2 sequence is nested
within VP1 (2). The function of the HBoV NS1 protein is
unknown, but one could speculate on its role in HBoV DNA
replication, since the related protein in other parvoviruses is
likely to be involved in the binding and hydrolysis of nucleoside
triphosphates and to have helicase activity (85). NP-1 is absent
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
from other parvoviruses and its function is unknown (2, 65).
Phylogenetic analyses have shown that two genetically distinct
but very closely related clusters cocirculate in the United
States, Sweden, Canada, and France (7, 35). As expected, the
deduced coding sequence for the structural proteins VP1 and
VP2 from different isolates showed high variability compared
to the coding sequences for the nonstructural NS1 and NP-1
proteins, reflecting the more immunogenic character of the
virion-associated proteins.
The cells hosting HBoV replication have not been deter-
mined. Parvoviruses in general require proliferating cells for
their replication. Studies of animal bocaviruses suggest infec-
tion of respiratory and gut epithelium and lymphatic organs
(18, 19). HBoV DNA is present in patients with ARTI and
sometimes reaches high copy numbers in respiratory tract se-
cretions, consistent with infection of the respiratory epithelium
(1). HBoV DNA has also been detected in the sera of patients
with ARTI and in the feces of patients with ARTI and/or
gastroenteritis, suggesting the possibility that a range of cells
may support HBoV replication in vivo (1, 27, 50, 56, 73).
Until recently, HBoV infection could be identified only by
the detection of its nucleotide sequence. In a recent report,
Brieu et al. described parvovirus-like particles in HBoV DNA-
positive NPAs by electron microscopy (12). Confirmation of
these findings by immunoelectron microscopy with a (hitherto
unavailable) HBoV-specific antibody would support the as-
sumption that HBoV DNA, at least at high copy numbers, is
virion associated. Antibodies elicited in humans against HBoV
structural proteins have also recently been demonstrated
(22, 33).
LABORATORY DIAGNOSIS
To date, the detection of HBoV has been performed pre-
dominantly on NPAs and swabs and has been possible only
with PCR-based methods, since no virus culture method, ani-
mal model of infection, or antibody preparation for antigen
detection has been available (2). No comparative studies to
identify an optimal sampling site have been reported, and the
selection of a sampling site is also hindered by a lack of knowl-
edge about the site of HBoV replication. Specimen handling
and storage is infrequently detailed in the published studies.
However, the most frequent approach is certainly immediate
or batched column-based nucleic acid extraction and PCR
testing of convenient populations by use of patient material
that has been previously stored after routine microbial testing.
VOL. 21, 2008
Oligonucleotide sequences from PCR methods described to
date are summarized in Table 1, but as of yet no comparative
studies have identified an optimal gene target or oligonucleo-
tide set(s). For diagnostic purposes, more-conserved genetic
regions are preferred; thus, primers directed toward the NS1
gene should yield the most robust assays. However, the limited
genetic variability of HBoV allows multiple suitable PCR tar-
gets, including the frequently targeted NP1 gene. The use of
real-time PCR serves to minimize the risk of amplicon car-
ryover contamination, reduce the result turnaround time, and
add an extra layer of specificity (if an oligoprobe-based ap-
proach is employed) and can prove less costly overall. Different
research groups have described real-time PCR assays that per-
mit some degree of quantification of the viral load in respira-
tory secretions (1, 37, 45, 62). Since there is no way to stan-
dardize respiratory tract specimen collection, respiratory virus
quantification by PCR is better described as being semiquan-
titative (47).
Nevertheless, recent results obtained by “quantitative” real-
time PCR suggest that high HBoV viral loads (defined as ⬎104
copies/ml) are frequently present as the sole viral finding for
children admitted for acute wheezing, while the clinical signif-
icance of low to moderate viral loads is uncertain. High viral
load in the respiratory tract was frequently associated with the
detection of HBoV DNA in the blood (1). HBoV DNAemia
declined after the resolution of symptoms, suggesting that high
viral load may represent primary infection. Fry et al. (27)
compared patients with pneumonia to healthy control subjects.
Quantitative results were not reported in detail but, impor-
tantly, they found that the healthy controls exclusively had low
numbers of HBoV DNA copies in respiratory specimens, while
both high and low HBoV DNA loads were found among those
cases with pneumonia. Low to moderate viral load is relatively
commonplace among studies (62, 38, 45), suggesting that a
large proportion of HBoV detection by PCR may represent
virus shedding of uncertain clinical relevance. Thus, standard-
ized diagnostic tests that can more accurately identify primary
infections, which are more likely the true symptomatic cases,
are a top priority for future HBoV research. The predictive
value of high virus copy numbers as well as the diagnostic value
of PCR testing of blood samples should be further investi-
gated, but if its limitations are kept in mind, quantitative PCR
is a useful interim tool for understanding the course of HBoV
infection. Preliminary serological studies have recently been
published (22, 33) and it is expected that serology will be a very
useful diagnostic addition to the study of HBoV infection, as it
has been for B19V (83).
HBoV AND RESPIRATORY TRACT DISEASE
The fact that HBoV is prevalent in samples from patients
with ARTI does not guarantee a causative role for the symp-
toms. For example, many viruses are transmitted via the respi-
ratory tract without triggering substantial respiratory symp-
toms. Establishing the causative role of a specific agent in
disease is a thorough process requiring multiple studies (26). It
is particularly difficult to do so in the absence of culture sys-
tems and/or animal models, which is a problem common to
studies of other newly identified viruses. Nevertheless, the
pathogenicity of newly identified HCoV or HRV strains has
HBoV: PASSENGER OR PATHOGEN? 293
not been a major issue of debate, most likely because of their
genetic relatedness to other established respiratory pathogens.
With HBoV, the situation is different and confounded by sev-
eral facts. First, HBoV is not related to a known human respi-
ratory pathogen. Second, HBoV may be shed persistently,
since other human parvoviruses (B19V, PARV4, and the
AAVs) have the capacity for asymptomatic persistence (41, 44,
50). Third, HBoV is commonly detected in association with
other respiratory viruses which have an established pathogenic
potential. These facts raise the possibility that HBoV detection
in respiratory tract samples simply reflects asymptomatic per-
sistence or prolonged viral shedding. Another hypothesis is
that HBoV is reactivated or produces a transient asymptomatic
superinfection that is triggered by the presence of another
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
replicating respiratory agent. A few studies providing data
relevant to these issues have been published (1, 2, 27, 33, 35,
48, 49).
The first description of HBoV by Allander et al. (2) did,
as mentioned earlier, include a study indicating a statistical
association between the detection of HBoV on one hand
and the patient suffering from otherwise unexplained ARTI
on the other hand. Diagnostics for other viruses was incom-
plete. However, simple asymptomatic shedding of HBoV
would still not result in the observed skewed distribution of
HBoV findings.
Manning et al. (49) identified HBoV in stored respiratory
tract samples and compared the frequencies of reported symp-
toms associated with each of the different agents sought. Of the
21 HBoV-positive patients, 20 children had symptoms of ARTI
versus 1 asymptomatic child, a situation similar to that for RSV
but different from what was found for AdVs. The most com-
mon clinical diagnosis was “lower RTI,” made for 15 patients
(72%).
To date, five studies have included control groups of asymp-
tomatic children (1, 27, 35, 48, 49). All studies found highly
significant prevalence differences between individuals with
ARTI and asymptomatic individuals. Kesebir and coworkers
detected HBoV DNA from 22 of 425 NPAs of symptomatic
children, while none of the 96 asymptomatic children tested
positive for HBoV (35). Allander et al. found no positives
among 64 asymptomatic children compared to 49 of 259 (19%)
positive samples from children with acute wheezing (1). Un-
fortunately, in these studies the type of specimen varies be-
tween both groups, with an unknown impact on the efficiency
of collection, nucleic acid extraction, and PCR sensitivity. In
the study of Allander et al., the asymptomatic children were
slightly older than the children with ARTI (1).
Maggi et al. tested 335 children with ARTI and 51 asymp-
tomatic children (30 healthy infants and 21 preadolescent
healthy children) and detected 4.5% positives among the nasal
swabs of ARTI cases and no HBoV in nasal swabs of asymp-
tomatic children (48). However, the main weakness of this
study is that cases and controls were sampled during different
years, which may have falsely lowered the detection of virus in
the asymptomatic group.
One recently published study by Fry et al. (27), performed in
Thailand but coordinated by the Centers for Disease Control
and Prevention (Atlanta, GA), included nasopharyngeal swabs
from 1,168 patients with community-acquired pneumonia, 512
patients with “influenza-like illness,” and 280 asymptomatic
294 SCHILDGEN ET AL. CLIN. MICROBIOL. REV.

TABLE 1. Overview of those published protocols describing oligonucleotide sequences used for PCR detection of HBoV
Target
Study (reference) Detection method Primer name (sequence) Probe sequence and labelinga
region

Allander et al., Real-time PCR Boca-forward (GGAAGAGACACTGGCAGAC FAM-CTGCGGCTCCTGCTCCTGTGAT- NP-1

2007 (1) (LightCycler) AA); Boca-reverse (GGGTGTTCCTGATGA TAMRA
TATGAGC)
Allander et al., PCR 188F (GAGCTCTGTAAGTACTATTAC); None NP-1
2005 (2) 542R (CTCTGTGTTGACTGAATACAG)
Arden et al., 2006 PCR HBoV 01.2 (TATGGCCAAGGCAATCGTCCA None NP1
(5); Sloots et AG); HBoV 02.2 (GCCGCGTGAACATGAG
al., 2006 (68) AAACAGA)
Bastien et al., PCR VP1/VP2F (GCAAACCCATCACTCTCAAT None VP1/2
2006 (7) GC); VP1/VP2R (GCTCTCTCCTCCCAGTG
ACAT)
Bastien et al., PCR VP/VP2–1017F (GTGACCACCAAGTACTTA None VP1/2
2007 (8) GAACTGG); VP/VP2–1020R (GCTCTCTCC

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

TCCCAGTGACAT)
Foulonge et al., Real-time PCR BocaRT1 (CGAAGATGAGCTCAGGGAAT); FAM-CACAGGAGCAGGAGCCGCAG- NP1
2006 (24) (LightCycler) BocaRT2 (GCTGATTGGGTGTTCCTGAT) TAMRA
Sequencing BocaSEQ1 (AAAATGAACTAGCAGATCTTG None
ATG); BocaSEQ4 (GAACTTGTAAGCAGA
AGCAAAA); BocaSEQ2 (GTCTGGTTTCCT
TTGTATAGGAGT); BocaSEQ3 ( GACCCA
ACTCCTATACAAAGGAAAC)
Kesebir et al., PCR GGACCACAGTCATCAGACCCACTACCATC None VP1
2006 (35) GGGCTG
Kleines et al., Real-time PCR Same as that found in the work of Allander et GGAAGAGACACTGGCAGACAAC- NP1
2007 (37) (LightCycler) al., 2005 (2) fluorescein; LC-Red 640-CATCACAGG
AGCAGGAGCCG
Kupfer et al., PCR OS1 (CCCAAGAAACGTCGTCTAAC); OS2 None NP1
2006 (39); (GTGTTGACTGAATACAGTGT)
Simon et al.,
2007 (66)
Lin et al., 2007 Real-time PCR Forward primer (AGCTTTTGTTGATTCAAG FAM-TCTAGCCGTTGGTCACGCCCTG NS
(43) (TaqMan) GCTATAATC); reverse primer (TGTTTCCC TG-TAMRA
GAATTGTTTGTTCA)
Lu et al., 2006 Real-time PCR Primer, fwd (TGCAGACAACGCYTAGTTGT FAM-CCAGGATTGGGTGGAACCTGC NS1
(45) (iCycler iQ real- TT); Primer, rev (CTGTCCCGCCCAAGAT AAA-Black_Hole_Quencher
time detection ACA)
system 关Bio-Rad兴) Primer, fwd (AGAGGCTCGGGCTCATAT FAM-AGGAACACCCAATCARCCACCT 2478–2497;
CA); Primer, rev (AGAGGCTCGGGCTCAT ATCGTCT-Black_Hole_Quencher 2558–2537
ATCA)
Manning et al., Nested PCR Outer sense primer (TATGGGTGTGTTAATC None NS
2006 (49) ATTTGAAYA); outer antisense primer (GT
AGATATCGTGRTTRGTKGATAT); inner
sense primer (AACAAAGGATTTGTWTTY
AATGAYTG); inner antisense primer (CCC
AAGATACACTTTGCWKGTTCCACCC)
Outer primers used were CCAGCAAGTCCTC None NP
CAAACTCACCTGC and GGAGCTTCAGG
ATTGGAAGCTCTGTG; inner primers fol-
lowed the sequence of the primer sequences
188F and 542R
Qu et al., 2007 Real-time PCR TAATGACTGCAGACAACGCCTAG; TGTCC FAM-TTCCACCCAATCCTGGT-MGB
(59) (TaqMan) CGCCCAAGATACACT
Neske et al., 2007 Real-time PCR (Light BoV2466a (TGGACTCCCTTTTCTTTTGTA FAM-TGAGCTCAGGGAATATGAAAG NP1; VP2
(56) Cycler) and GGA) targeting NP1 2466–2443 (real-time ACAAGCATCG-TAMRA
phylogenetic PCR); BoV3885s (ACAATGACCTCACAGC
analysis TGGCGT) (phylogenetic analysis); BoV4287s
(CAGCCAGCACAGGCAGAATT) (phyloge-
netic analysis); BoV4456a (TCCAAATCCTG
CAGCACCTGTG) (phylogenetic analysis);
BoV4939a (TGCAGTATGTCTTCTTTCTGG
ACG) (phylogenetic analysis)
Regamey et al., Real-time PCR Primer forward (CACTGGCAGACAACTCAT AGCAGGAGCCGCAGCCCGA NS1
2007 (60) (TaqMan) CACA); primer reverse (GATATGAGCCCG
AGCCTCTCT)
Schenk et al., Real-time PCR HBoV-UP (AGGAGCAGGAGCCGCAGCC); HBoV-P: FAM-ATGAGCCCGAGCCTC NP1
2007 (62) (LightCycler) HBoV-DP (CAGTGCAAGACGATAGGT T-TAMRA
GGC)
Smuts and Seminested PCR NP-1 s1 (TAACTGCTCCAGCAAGTCCTC None NP1
Hardie, 2006 CA); NP-1 as1 (GGAAGCTCTGTGTTGAC
(69) TGAAT); NP-1 as1 and NP-1 s2 (CTCACCT
GCGAGCTCTGTAAGTA)
VP s1 (GCACTTCTGTATCAGATGCCTT); None VP1/2
VP as1 (CGTGGTATGTAGGCGTGTAG);
VP s2 (CTTAGAACTGGTGAGAGCACTG)
a
FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; MGB, minor groove binder (Applied Biosystems).
VOL. 21, 2008
individuals. HBoV DNA was detected in only 3 asymptomatic
individuals (1%), whereas 20 out of 512 (3.9%) outpatients
with “influenza-like illness” (according to the WHO definition)
and 53 (4.5%) out of 1,168 hospitalized patients with the di-
agnosis “pneumonia” tested positive for HBoV (27). For chil-
dren aged from 0 to 4 years, the HBoV prevalence was 12%
among pneumonia cases and 2% among asymptomatic con-
trols. To date, this is the only study from which all groups have
been sampled in the same way, making these data more robust.
Among hospitalized children of ⬍5 years of age with the di-
agnosis “pneumonia,” HBoV was the third most commonly
detected virus (12%). Higher prevalence could be confirmed
only for RSV and HRV (27). Viral loads of this study were
reported separately (45). Most positive samples among all
groups had low viral loads but, importantly, high loads were
seen only among cases and not among asymptomatic controls.
A main concern regarding studies comparing virus preva-
lences in respiratory tract samples of symptomatic and asymp-
tomatic individuals is the risk for bias related to respiratory
tract sampling. An inflammatory process, regardless of cause,
will produce a cell-rich mucoid secretion, easily available for
sampling, while asymptomatic individuals have very little
nasopharyngeal secretion at all. Thus, the detection of, e.g., an
intracellular persisting virus could very well be enhanced by an
inflammatory process regardless of its cause. The main alter-
native hypothesis to HBoV being a pathogen is that the virus is
persisting or being shed for long periods from the respiratory
tract at copy numbers near the lower limit of PCR detection.
Because of these possibilities, comparisons of prevalence
among symptomatic versus asymptomatic subjects must be in-
terpreted with great care unless viral loads are reported.
It is also possible to establish a statistical association be-
tween HBoV and disease without using asymptomatic controls.
Allander et al. (1) studied patients hospitalized for acute
wheezing in Finland and found that the occurrence of HBoV in
blood was linked in time with an acute infectious episode and
normally disappeared after recovery. In another statistical
analysis of the data, HBoV-positive patients with and without
other pathogens detected in the respiratory tract were com-
pared. HBoV was significantly more prevalent in patients
where no other virus explaining the symptoms was detected.
Interestingly, only the cases with high HBoV loads showed this
association. Thus, in two ways, internal symptomatic controls
could be used to support a statistical association between
HBoV and disease in this study. Results were highly significant
and at the same time 76% of HBoV-cases were codetections
with other viruses, showing that frequent codetections are not
necessarily an argument against disease association. The study
suggested that high-load and viremic HBoV infection is asso-
ciated with respiratory tract symptoms, while detection of a low
viral load in the nasopharynx alone has uncertain relevance. It
was hypothesized that these two entities represent primary
infection and persistence, respectively, each accounting for
approximately half of the HBoV findings in this particular
material. This hypothesis has recently been confirmed by ap-
plying serology to the same material (33). Further studies are
needed in order to determine the length of possible viral shed-
ding or persistence. Regamey et al. detected HBoV DNA in
one patient’s respiratory specimen 3 weeks after the acute
phase of infection (60).
HBoV: PASSENGER OR PATHOGEN? 295
In summary, several studies have found a statistical associ-
ation between HBoV and acute respiratory symptoms, in a way
that is consistent with a causal role. However, accurately es-
tablishing a causal relationship will require further studies,
since current data also indicate that HBoV does not have a
causal role for many of the ARTI cases in which it is detected.
The diagnostic value in the individual case of detecting HBoV
DNA in the respiratory tract therefore remains unclear.
Possible Role of Coinfections
While the main hypothesis explaining the frequently ob-
served HBoV codetections involves some kind of innocuous
persistence or prolonged shedding, a possible role for HBoV as
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
a true copathogen remains uncertain and uninvestigated. Its
frequent presence alongside other viruses cannot be ques-
tioned (Table 2). The results of our University of Bonn study
reported a codetection frequency of 36%. Such high percent-
ages have been reported by most studies which have looked for
coinfections, with codetection frequencies of 18% to 90% be-
ing reported (2, 27). Manning and coworkers detected one or
more additional viruses in 43% (23/53) of HBoV-positive sam-
ples (49). The overall frequency of codetection among HBoV-
negative samples that were positive for other viral pathogens in
the same study was 17% (47/271) (P ⬍ 0.001). One explanation
for the wide range of results is the nonstandardized diagnostic
panel common to published studies. In addition, differences in
test sensitivity have to be considered, in particular in light of
the high proportion of low-load infections (14, 77). Codetec-
tion of another virus with HBoV, usually when the latter is at
low viral load, occurs frequently from patients with ARTI, but
HBoV is still rare in asymptomatic individuals. One hypothesis
for this is that detection of innocuous HBoV shedding is en-
hanced by airway inflammation caused by another virus, as
discussed above. Another is that HBoV is involved in the
pathogenesis and, in some way, the aggravation of symptoms,
so that it is frequently observed in hospitalized patients. Yet
another possibility is that HBoV is a helper virus which aids
other viruses or itself requires the aid of another ongoing
infection for activation or reactivation of replication. There are
currently no data defining a mechanism by which HBoV could
be described as either a pathogen or a passenger. To date, it
remains uncertain whether codetection with any respiratory
viruses results in more-serious clinical outcomes. This is not a
question unique to HBoV infections but an important facet of
ARTIs in general that must be addressed in the future, per-
haps with the aid of animal models.
EPIDEMIOLOGY
Reports suggest that HBoV has worldwide endemicity. It
has been detected over several years in many countries, includ-
ing Sweden, Australia, the United States, Japan, Germany,
South Africa, Jordan, France, Canada, Iran, Spain, The Neth-
erlands, Korea, Thailand, Switzerland, and China (1, 2, 4–7, 14,
15, 24, 25, 27, 34–37, 39, 43, 45, 46, 48–50, 52, 54, 55, 59, 60, 62,
66, 68, 69, 73, 74, 77).
Based on phylogenetic analysis of predicted amino acid
alignments, HBoV exists worldwide as a single lineage com-
posed of two subtly different genotypes, as shown in Fig. 1. The
 TABLE 2. Basic data from 23 analyzed studies 296
No. (%) of Patients
No. (%) of HBoV- Median age (range) % patients with with
Study (reference) Study region No. of NPAs testeda Other viral copathogens (no.; %)
positive samples (mo)b Hospitalized relevant coinfection
comorbiditiesg (%)

Allander et al., Stockholm, Sweden 540 17 (3.1) HBoV pos only, 13.5 —d 9 (64) 18 RSV (2/17; 12%); AdV (1/17; 6%)
2005 (2) (8–48)
Allander et al., Turku, Finland 259 49 (19) HBoV pos only (n ⫽ — NA 76 Rhinovirus, enterovirus (43%);
2007 (1) 12), 15.6 (9.6–38.4) AdV (16%); RSV (14%)
Arnold et al., 2006 San Diego, CA 1,474 82 (5.6) 12.0 (10 days to 16 yr) 57 21 (31; 19% 12 RSV (9/82; 11%)
(6) prematurity)
Bastien et al., 2006 Saskatchewan, Canada 1,209 18 (1.5) 138.0 (9 mo–60 yr) 50 NA *f *
(7)
SCHILDGEN ET AL.

Choi et al., 2006 Seoul, South Korea 515 58 (11.3) NA — †e 38 AdV (7/58; 12%); RSV (5/58; 9%);
(14) HMPV (5/58; 9%);
Parainfluenza viurs 3 (3/58; 5%)
Chung et al., 2006 Seoul, South Korea 336 (225 “virus negative”; 27 (8); 17/225 (7.5) 14 (1–69); 15 (1–83) — NA 37 RSV (5/27;19%); HMPV (4/27;
(15) 111 “virus positive”) of the “virus of the “virus 15%); AdV (1/27;4%)
negative” negative”
Foulongne et al., Montpellier, France 589 26 (4.4) 13.0 (4–43) — 16 (62) 35 RSV (5/26; 19%); AdV (2/26; 8%);
2006 (24) HMPV (2/26; 8%)
Fry et al., 2007 (27) Nonthaburi, Thailand 792 53 (4.5) NA (1 mo–ⱖ65 yr) — NA 83 RSV (23%); human parainfluenza
virus (23%); AdV (2%);
influenza virus A/B (9%);
rhinovirus (42%)
Kaplan et al., 2006 Amman, Jordan 312 57 (18.3) 8.0 — NA 72 AdV (25/57; 44%); RSV (23/57;
(34) 40%); HMPV (1/57; 2%),
influenza virus A (1/57; 2%)
Kleines et al., 2007 Aachen, Germany 94 12 (12.8) 7.8 (1–30) — 5/12 (41) 42 RSV (42%)
(37)
Kesebir et al., 2006 New Haven, CT 425 22 (5.2) 12.5 (1–24) 75 12 (60) 5* *
(35)
Lin et al., 2007 (43) Zhejiang Province, 257 7 (2.7) “Infants and children” — NA NA NA
China
Ma et al., 2006 (46) Sapporo, Japan 318 18 (5.7) 15.0 (9–31) 89 NA ‡h ‡
Maggi et al., 2007 Pisa, Italy Total of 335: A (infants), A, 9 (4.5); B, no A, 16 ⫾ 13 100% 1 (11) neurological 44 RSV (3/9; 33%); rhinovirus,
(48) n ⫽ 200; B (adults), n HboV detected; influenza virus A, HMPV (1/9;
⫽ 84; C (asmptom. C, no HboV 11%)
children), n ⫽ 51 detected
Manning et al., Edinburgh, Scotland 924i 4 (1.6) 1.0–2.3 yrc 0 0 43 Rhinovirus, RSV, parainfluenza
2006 (49) virus, AdV
c
Monteny et al., Rotterdam, The 257 children with fever (4) 1.0–2.3 yr 0 0 33 Rhinovirus, RSV, parainfluenza
2007 (54) Netherlands virus, AdV
Naghipour et al., Rasht, Guilan, Iran 261 21 (8.3) 13 ⫾ 2 — 5 (24) asthma 33 RSV, AdV, or influenza virus A
2007 (55)
Qu 2007 et al., (59) Beijing, China 252 5 (5.5) 9 (3.4–11.3) — 0 10 HCoV 229E
Regamey et al., Berne, Switzerland 112 5 (4.2) NA 0 0 56 RSV, AdV, rhinovirus (2⫻), HCoV
2006 (60) NL63
Sloots et al., 2006 Queensland, Australia 324 18 (5.6) NA — NA 56 RSV (2/38; 5%); AdV (1/18; 6%);
(68) HMPV (1/18; 6%)
Smuts and Hardie, Cape Town, South 341 38 (11.0) ⬍36 mo — NA 37 RSV (14/40; 35%); rhinovirus (4/
2006 (69) Africa 40;10%); influenza virus (5/40;
13%); HCoV (3/40;8%); AdV
(1/40; 3%)
Vicente et al., 2007 San Sebastián, Spain 527 (stool) 48 (9.1) ⬍36 mo 40 HBoV-positive respiratory
(73) samples: 25 (62.5%)
coinfections with other viruses
(13 RSV, 3 rhinovirus, 3
influenza virus A, 2 HCoV-
OC43, 1 AdV, 1 influenza virus
B); 48 HBoV-positive fecal
samples: 28 (58.3%)
coinfections with another
intestinal pathogenj
CLIN. MICROBIOL. REV.

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

VOL. 21, 2008 HBoV: PASSENGER OR PATHOGEN? 297

greatest variability was observed within the 285-bp portion of

(1/87; 1%); influenza virus B (1/
RSV (14/87; 16%); influenza virus

10%); parainfluenza virus 1/2/3

VP1/VP2 (Fig. 1C), whereas significantly lower genetic vari-
A (9/87; 10%); AdV (9/87;

ability was seen for viral sequences within the NS1 and the
RSV (3/11; 27%); norovirus

NP-1 genes (Fig. 1A and B).

Prevalence of HBoV
(1/11; 9%)

87; 1%)

The proportion of respiratory specimens from symptomatic

hospitalized children that contain HBoV sequences has ranged
from 1.5% to 19% (1, 7) Most children infected with HBoV
have been younger than 24 months (2, 15, 55, 59, 68, 69), but
Relevant comorbidities are those underlying diseases or conditions that may have, or are known to have, any influence on the clinical severity of a viral respiratory infection.

older children may also be affected (7, 14). For example, 4 of

36

39

27 (15%) positive specimens in the study of Chung et al. were

obtained from children of ⬎36 months of age (15). Thus, it

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

seems reasonable to include older children into prospective
surveillance studies. As expected, studies which included only
hospitalized children and children with wheezing (14) pre-
NA

NA

sented a higher illness severity than those studies that analyzed

Salmonella enterica serovar Enteritidis (n ⫽ 1), Campylobacter jejuni (n ⫽ 5), rotavirus (n ⫽ 14), norovirus (n ⫽ 7), C. jejuni and norovirus (n ⫽ 1).

respiratory specimens from outpatients as well (6, 59, 60). In

order to determine a more realistic prevalence of HBoV in
respiratory tract samples, future prospective studies should
also include appropriately age-matched children and adults
embodying a clinical description of “asymptomatic” as well as
—

patients presenting with mild illness.

*, this study included NPA samples that had tested negative for influenza virus A/B, parainfluenza virus 1/2/3, AdV, and RSV.

There are few systematic studies including adults, but avail-

able studies indicate a very low virus prevalence by PCR in the
respiratory tract of adults (2, 7, 27, 49).
22 (18 days to 8 yr)
9 (3 mo to 17 mo)

Recently, seroepidemiological data were published from Ja-

pan by Endo et al. (22). Anti-HBoV antibodies were detected
in 145 of 204 (71.1%) serum samples from people aged from 0
‡, this study included NPA samples that had tested negative for influenza virus A/B, RSV, and HMPV.

month to 41 years from the Hokkaido Prefecture. The sero-

prevalence was lowest (5.6%) in the age group from 6 to 8
months and highest in the age groups older than 6 years (94.1
†, this study included patients without predisposing risk factors, such as an underlying disease.

to 100%). The findings of high antibody prevalence and low

virus prevalence among individuals older than 6 years are con-
87 (10.3)
11 (2.8)

sistent with each other and suggest that there may be protec-
tive immunity after past infection. Positive antibody titers were
also detected in the age group younger than 6 months, but this
phenomenon is explained by the antibody transfer via the pla-
This study included children with fever from 3 months to 6 years of age.

centa to the fetus predominantly in the third trimester of

pregnancy (22).
–, this study included NPA samples from hospitalized patients.
389

835

Seasonal Distribution of HBoV Detection

Study included 924 NPA samples from 574 individuals.

According to the literature, HBoV DNA-positive ARTIs

occur in children across a range of months. The peak “respi-
ratory season” varies from year to year (79). Therefore, it is not
feasible to draw conclusions concerning the epidemiology of a
Würzburg, Germany

newly identified virus based on snapshot analyses of single

pos, positive; NA, data not available.
Bonn, Germany

seasons or even multiple respiratory seasons. In accordance

with the University of Bonn’s data, most authors reporting
from regions with temperate climates have observed a higher
asmptom., asymptomatic.

occurrence of HBoV detections during the winter and spring

months (2, 69). Choi et al. (Korea 2000 to 2005) reported a
relatively high occurrence of HBoV in the late spring and early
summer. They did not reveal any obvious correlation to
Weissbrich et al.,
Völz et al., 2007

changes in the parallel RSV season (14). Maggi et al. from

2006 (77)

Italy could not confirm a seasonal distribution of the HBoV

(74)

infections in their study of hospitalized infants with RTI (48),

h
d
a
b
c

g
f

i
j

but they found significant differences between years, with no

298 SCHILDGEN ET AL. CLIN. MICROBIOL. REV.

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

FIG. 1. Phylogenetic analysis of HBoV. Phylogenetic trees are based on 61 partial NS1 genes (245 nt, corresponding to nt positions 1509
to 1753 in the ST1 isolate [accession number DQ000495]) (A), 167 partial NP-1 genes (242 nt, corresponding to nt positions 2340 to 2581
in the ST1 isolate) (B), and 133 partial VP1/VP2 genes (285 nt, corresponding to nt positions 4547 to 4831 in the ST1 isolate) (C). Sequences
were aligned using the program CLUSTAL_X, version 1.83 (71). Phylogenetic relationships of the aligned sequences were inferred from the
generated alignment by the neighbor-joining method (61). The reliability of the tree topology was evaluated by 500 replicates of bootstrap
resampling (84). Phylogenetic trees were visualized using the TREEVIEW software tool (58). Trees show the HBoV sequences used for the
analysis and their individual geographical origins. The numbers in parentheses indicate the numbers of isolates for the respective locations.
For reasons of clarity, this figure does not include GenBank accession numbers. Detailed information on GenBank accession numbers of
sequences used for the phylogenetic analysis is available upon request. (D) Phylogenetic placement of HBoV and other members of the
genus Parvovirinae. Bootstrapped (n ⫽ 1,000) neighbor-joining tree based on 80% of the complete genomic nucleotide sequence. Bootstrap
values (%) are indicated at each branching point. B19, erythrovirus B19; PTMPV, pig-tailed macaque parvovirus; RMPV, rhesus macaque
parvovirus; SPV, simian parvovirus; ChPV, chipmunk parvovirus; BPV2 and BPV3, bovine parvovirus 2 and 3; GPV, goose parvovirus;
MDPV, Muscovy duck parvovirus; AMDV, Aleutian mink disease virus; PPV, porcine parvovirus; CPV, canine parvovirus; RPV-1a, rat
parvovirus-1a; KRPV, Kilham rat parvovirus; MPV1, mouse parvovirus 1; MVM, minute virus of mice; MVC, minute virus of canines.

HBoV detected in any specimen from 2000 to 2002 (n ⫽ 43, Transmission

including 30 specimens from symptomatic infants). The
weakness of most retrospective studies is that more speci-
mens are collected during the winter months, because that is
the epidemic season for most viral RTIs. Both more-active
sampling and enhanced detection of HBoV by other infec-
tions, as discussed above, could therefore lead to false ob-
servations of seasonal patterns. It must also be kept in mind
that the numbers reported in most studies probably reflect a
mix of incidence and carrier prevalence. The true incidence
and seasonality of primary HBoV infection remain un-
known.
Nothing is known about the routes of HBoV transmission.
Because of its sometimes very high copy numbers in respi-
ratory tract secretions, aerosol and contact transmission are
likely effective, as they are for other respiratory viruses.
Hand-to-hand, hand-to-surface, and self-inoculation routes
have certainly proven to be efficient steps in the transmis-
sion of the “common cold.” Since we know that HBoV DNA
exists in some capacity within feces, the possibility of fecal-
oral transmission must also be considered. Further studies
should include more testing of stool samples for HBoV to
VOL. 21, 2008
FIG. 1—Continued.
confirm the extent and nature of virus DNA shedding and
the capacity of the virus to survive disinfectants (10, 11, 17,
31, 38) and permit broader investigations of a possible role
for HBoV as an enteric pathogen. So far there have been no
studies on the tenacity of the virus or about the effect of
commonly used hospital-grade disinfectants. Since other
parvoviruses are known to be highly resistant to disinfec-
tants (10, 11), such investigations will be important but will
require an HBoV culture system or animal model of infec-
tion.
Kesebir and coworkers reported 3 infants (14%) of 22
with presumed nosocomial HBoV infection (35). The in-
fected infants were 1, 4, and 6 months of age at the time
their NPAs were sampled and had been hospitalized since
birth. Two of the three patients had HBoV-positive NPAs
within a period of 4 days and had been cared for by the same
medical personnel on the same ward. Phylogenetic analysis
of the two positives showed identical nucleotide sequences
in both the NP1 and VP1/VP2 gene region; however, be-
HBoV: PASSENGER OR PATHOGEN? 299
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
cause of the low genetic variability of HBoV, the signifi-
cance of such a finding should not be exaggerated. Notably,
vertical transmission could not be excluded. Three of 12
HBoV-positive children reported in the study of Kleines et
al. developed symptoms of ARTI after at least 4 weeks of
hospitalization (37). Since the incubation period of HBoV
infection is unknown, it is not possible to state that this was
nosocomial transmission.
The presence of HBoV DNA in the blood combined with
suspected persistence could have implications for transfusion
medicine, since organs or blood products derived from acutely
infected donors could be contaminated and serve as a source of
infection (1, 59). However, unlike PARV4, HBoV was not
detected in plasma pools (28).
CLINICAL OBSERVATIONS
While the role for HBoV in causing any symptoms remains
unclear, studies of the symptoms reported for HBoV-positive
300 SCHILDGEN ET AL. CLIN. MICROBIOL. REV.

TABLE 3. Diagnosis at discharge from hospital (%)

% Patients from indicated study with indicated diagnosis upon dischargea:
Study (reference) Upper Asthma Gastrointestinal Febrile
Croup Bronchitis Bronchiolitis Pneumonia
RTI exacerbation symptoms seizures

Allander et al., 2005 (2) NA NA NA NA NA NA NA NA

Allander et al., 2007 (1) 0b 0 25 67 75 8 0 0
Arnold et al., 2006 (6) 24 4 NA 26 24 24 16 NA
Bastien et al., 2006 (7) 22 NA NA 11 17 NA NA NA
Choi et al., 2006 (14) 5 8 NA 25 56 11 NA NA
Chung et al., 2006 (15) 24 0 76 0 0 0 12 NA
Foulongne et al., 2006 (24) 15 NA NA 46 11 27 NA NA
Kaplan et al., 2006 (34) NA NA NA NA NA NA NA NA
Kesebir et al., 2006 (35) NA NA NA NA NA NA 25 NA
Ma et al., 2006 (46) —c NA 44 11 33 5 NA NA
Maggi et al., 2007 (48) 0 0 0 55 45 0 11 0

Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest

Manning et al., 2006 (49) 29 NA NA NA NA NA NA NA
Naghipour et al., 2007 (55) 0 0 14 NA 46 10 NA NA
Qu et al., 2007 (59) 0 0 29 NA 62 NA 9 5d
Völz et al., 2007 (74) 9 9 45 3 64 NA 9 9
Weissbrich et al., 2006 (77) 40 NA 16 3 17 NA NA 9
a
Data are percentages for all investigated patients unless otherwise indicated. NA, data not available.
b
Allander et al. (1) reported the diagnosis of acute otitis media for 42% of HBoV-positive children with bronchial obstruction without viral coinfection.
c
Study included only patients with lower RTIs.
d
Qu et al. reported one patient (10 months of age) with an acute life-threatening event.

patients nevertheless provide an important starting point. Be-
sides some case reports (39, 62, 66), 23 research study publi-
cations were included in this review that contained data about
symptoms and outcomes for and radiological findings and lab-
oratory results from HBoV-positive hospitalized children (Ta-
bles 2 and 3) (1, 2, 6, 7, 14, 15, 24, 25, 27, 34, 35, 37, 43, 46, 49,
54, 55, 59, 60, 68, 69, 73, 77). We also added our data, which
were collected in the winter of 2005/2006 (74).
Limitations of Available Studies
Only a few studies of HBoV have collected clinical data
prospectively (the University of Bonn study presented here
[Germany] and the studies of Regamey et al. [Switzerland]
[60], Monteny et al. [The Netherlands] [54], Allander et al.
[Finland] [1], and Fry et al. [Thailand] [27]). In the remaining
studies we cite, laboratory, clinical, and radiological findings
have been acquired retrospectively, similar to many studies of
human metapneumovirus (HMPV) infection (78, 81). Only
nonstandardized, research-only, in-house PCR diagnostics
have been employed to date. Because of the obligate use of
PCR, one cannot truly talk about “infection”; rather, each
HBoV DNA-positive specimen should be described as a virus
“detection.”
Considering that prolonged shedding of HBoV or reactiva-
tion by other infections may account for a remarkable number
of the HBoV detections discussed above, it is a severe limita-
tion that diagnostic assays separating these cases from primary
infections are not yet available. Most published studies have
not taken this into consideration.
A lack of international consensus about the definition of
certain respiratory diseases is another obstacle to accurately
characterizing the clinical outcomes of HBoV infection, just as
it is for any respiratory infection. There is no agreement about
the definition of obstructive bronchitis, recurrent obstructive
bronchitis in infants, bronchiolitis, bronchopneumonia, or lo-
bar pneumonia (3, 70). Six out of the 23 analyzed studies used
the diagnosis “bronchiolitis” (6, 7, 14, 24, 25, 46, 77). The
percentages of “bronchiolitis” within the diagnostic spectrum
ranged from 3.2% to 46% (24, 77). Two studies provided
differing definitions (6, 14), whereas the remaining publica-
tions did not even comment on the clinical criteria. Only 7
of 23 studies (1, 2, 6, 27, 35, 37, 46) definitively stipulated a
radiological confirmation of the clinical diagnosis “pneumo-
nia.” Most studies did not make a distinction between
(central) bronchopneumonia and segmental or lobar pneu-
monia.
Symptoms Presumably Associated with HBoV Infection
Clinical symptoms most frequently reported in individuals
where HBoV is the only detected virus include cough, rhinor-
rhea, and fever, which are also the most common nonspecific
symptoms leading to respiratory viral testing in children. The
most common clinical diagnoses given to HBoV-positive pa-
tients, with or without coinfections, include upper RTI, bron-
chitis, bronchiolitis, pneumonia, and acute exacerbation of
asthma. This clinical spectrum is in accordance with other viral
ARTIs, similar to the situation with RSV infections (75) and
with HMPV infections (78, 80). There are no described distinct
clinical signs differentiating HBoV-positive infections from
those ascribed to other viruses (2, 37). This could imply that
HBoV indeed has a clinical picture similar to those seen for
other ARTIs or simply that because of the mentioned diag-
nostic problems with HBoV many of the studied patients were
actually suffering from other infections. Symptoms seem to
persist for 1 to 2 weeks on average (range, 2 days to 3 weeks)
(1, 60); Monteny et al. reported a prolonged course of fever
(⬎7 days or recurring) in HBoV-infected patients (54). HBoV
has also been detected in individuals with skin rash, although
no causal association has been identified (6, 15, 54). Allander
at al. reported a 42% incidence of acute otitis media in solely
VOL. 21, 2008
HBoV-positive patients (2). Except for this report, there are
few data on bacterial coinfections.
The possibility that HBoV, like the closely related bovine
and canine bocaviruses (18, 19), could cause gastroenteritis
was raised in the first report on HBoV (2). Gastrointestinal
symptoms have been described for up to 25% of all patients (6,
35, 54). Maggi et al. (48) detected HBoV DNA in stools of a
6-month-old boy followed for neurological problems who had
presented with diarrhea and bronchopneumonia. Both respi-
ratory and stool specimens were positive for HBoV and anti-
gen negative for rotaviruses, AdVs, astroviruses, and calicivirus
1 and 2. Vicente at al. investigated the presence of HBoV
DNA in 527 stool samples from ambulatory patients with gas-
troenteritis (⬍36 months of age) with or without additional
respiratory symptoms (73). Of these, 48 (9.1%) were positive
for HBoV DNA. Other enteric pathogens were found in 58%
of all HBoV-positive fecal samples (Table 2). In contrast, Lee
et al. detected HBoV DNA in only 0.8% of 942 hospitalized
children with gastroenteritis (40). Neske and coworkers re-
ported a high frequency of HBoV DNA in stool samples de-
rived from children who were also positive for HBoV DNA in
NPAs (56).
Chest Radiography Findings
In the University of Bonn study, the majority of HBoV-
positive patients (10/11) showed symptoms severe enough
for physicians dealing with the patients to perform a chest
radiograph, and 8 of 10 (80%) patients with a chest radio-
graph had visible abnormalities (74). In these 11 patients no
coinfections were observed. This high percentage of pathol-
ogy is in accordance with the results of other clinical re-
search groups, which found similar pathology in 43% to 83%
of cases (2, 24, 25).
The most common diagnosis in this study was (central) bron-
chopneumonia; in 18% a segmental/lobar pneumonia was di-
agnosed (74). Cases of HBoV-positive central pneumonia as
well as interstitial and lobar pneumonia, especially in newborns
and infants, have been described.
HBoV and Acute Wheezing
ARTIs have frequently been detected in infants with recur-
rent airway obstruction (“wheezing”) and in older children and
adults with asthma exacerbations (32, 63, 64, 80). In fact, the
highest frequency of laboratory confirmations are described by
studies of children with acute expiratory wheezing, usually
attributed to viruses. Recently published clinical studies report
asthma exacerbation as a clinical entity in up to 27% of HBoV-
positive patients (6, 24, 25), but several of the analyzed studies
did not explicitly exclude relevant viral pathogens such as RSV
and the HRVs. Half of the patients in the original study by
Allander and coworkers presented with asthma as an underly-
ing disease (2). Allander et al. subsequently reported that 49 of
259 (19%) children hospitalized for acute wheezing in Finland
were HBoV positive and speculated that this unusually high
percentage could imply that wheezing is the main manifesta-
tion of HBoV infection. Fry et al. (27) found a statistical
association between HBoV detection and reporting wheezing
among patients with pneumonia in Thailand. Naghipour et al.
HBoV: PASSENGER OR PATHOGEN? 301
found that 5 HBoV-infected patients (24%) had a history of
asthma (55), while Maggi investigated respiratory specimens
from 22 adult patients with acute asthma exacerbation and did
not detect HBoV (48). Chung et al. investigated nasopharyn-
geal specimens from 231 children (1 month to 5 years of age)
hospitalized with acute wheezing (16). Besides RSV (13.8%),
HBoV was the most frequently detected virus (13.8%) in 5.6%
without coinfection; HMPV and HCoV-NL63 were detected in
7.8% and 1.3% of wheezing children, respectively.
HBoV in Immunocompromised Patients
Several clinical research groups have reported HBoV-posi-
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
tive immunosuppressed/immunodeficient patients (6, 49, 69).
Arnold and coworkers described two pediatric patients positive
for HBoV after organ transplantation (6). Smuts and cowork-
ers reported HBoV detections for eight human immunodefi-
ciency virus-infected pediatric patients (69), and Manning and
coworkers described two HBoV-positive immunosuppressed
adult patients (49). Kupfer et al. have recently published the
clinical case of a severe infection in a 28-year-old HBoV-
positive female patient with malignant B-cell lymphoma (39).
On admission, the patient had a pancytopenia, high fever, and
clinical and radiological signs of pneumonia (reticulonodular
infiltrates in the computed tomography scan of the thorax).
Despite the application of antibiotics, antifungals, and the an-
tiviral ganciclovir, fever continued for 14 days. HBoV DNA
was detected retrospectively, suggesting HBoV as the sole po-
tential pathogen in NPAs. Since unexplained pulmonary dis-
ease is common in this group of patients, the role of HBoV in
causing the symptoms is unclear. However, in studies to date,
most symptomatic adults positive for HBoV DNA have fallen
into a category of immunosuppression. On the other hand, this
may be the result of a selection bias, since these are the adult
or elderly patients in which respiratory diagnostic specimens
are taken in case of an infection. HBoV has not been identified
in lymphoid tissue and in bone marrow and brain, respectively,
from human immunodeficiency virus type 1-infected and un-
infected adults upon autopsy (50).
Laboratory Results for HBoV-Infected Patients
Very few investigators have been able to document the
course of markers of inflammation such as C-reactive protein
(CRP) or white blood cell (WBC) count for HBoV-positive
patients. None of the first 11 HBoV-positive children treated
in our center (University of Bonn) in 2005/2006 fulfilled the
laboratory criteria of a suspected bacterial coinfection (WBC,
⬎15 ⫻ 109/liter; CRP, ⬎40 mg/liter) (67). The median WBC
count was 11.3 ⫻ 109/liter (range, 6.7 ⫻ 109 to 16.7 ⫻ 109) and
the median CRP concentration was 12.5 mg/liter (range, ⬍0.03
to 114) (74). Others reported median WBC and CRP concen-
trations of similar magnitudes (46). In Allander’s recent report
on 12 children with HBoV infection (no viral coinfection) (1),
9 displayed a radiologically confirmed pneumonia. The median
WBC was 9.1 (6.3 to 16.3) ⫻ 109/liter and the median CRP was
18 (0 to 78) mg/liter.
302 SCHILDGEN ET AL.
TREATMENT AND PREVENTION
The clinical impact of HBoV infection is uncertain, and to
date there have been no studies on the benefits of particular
therapeutic approaches for HBoV-infected individuals and no
proposals for novel therapeutics. Prospective controlled stud-
ies evaluating specific treatment approaches for patients in-
fected by HBoV will require analytically sensitive, specific, and
clinically relevant diagnostic procedures. In our center (Uni-
versity of Bonn), the high frequency of radiographically
confirmed pneumonia (70%) might explain the use of antimi-
crobial chemotherapy for 82% of HBoV-positive patients.
A rapid HBoV testing method capable of identifying clini-
cally relevant cases could reduce the unjustified and generally
ineffective use of antibiotics in these patients.
If HBoV turns out to contribute significantly to the disease
burden on children, possibilities for vaccine development will
likely be investigated, like it has been for RSV, HMPV, and
parainfluenza viruses. To date, no such studies have been re-
ported.
CONCLUSIONS AND FURTHER RESEARCH
Our current knowledge of HBoV infection suggests that the
virus is sometimes a passenger and sometimes a pathogen in
acute respiratory tract disease. A better understanding of the
natural course of HBoV infection and an expanded arsenal of
diagnostic tests capable of discriminating carriage from infec-
tion will be necessary before any clinical questions can be
comprehensively addressed. Detection of HBoV DNA in
blood and serological assays have shown promising preliminary
results. To date, retrospective studies report a peak of HBoV
detections during the first and second years of life. Some case
reports have raised concerns about serious clinical outcomes
among immunosuppressed individuals. To date there is neither
a method for virus culture nor an animal model of infection,
but hopefully the introduction of serological detection of spe-
cific antibodies will permit us some insight into the pathogen-
esis and natural course of HBoV infection.
Many additional questions cannot yet be answered by the
studies that have been reported and should be addressed by
future studies. How is HBoV transmitted, and is HBoV a
causative agent of gastrointestinal diseases? Does the virus
persist in the human host? Could coinfection with HBoV in-
crease the severity of concurrent viral infections? What is the
immune response to HBoV infection? Can HBoV cause exac-
erbations of asthma and chronic obstructive pulmonary dis-
ease?
HBoV might be one of the most recently identified respira-
tory viruses, but its nature has attracted as much interest and
raised as many questions as many of its better-characterized
relatives. After decades of research, the most widespread and
frequent causes of human infections, the respiratory viruses,
are still as confounding as ever.
ACKNOWLEDGMENTS
This work was partially supported by grants from the Else-Kröner-
Fresenius-Stiftung (grant number A 01/05//F 00) and the European
Commission (contract number LSHM-CT-2006-037276).
CLIN. MICROBIOL. REV.
REFERENCES
1. Allander, T., T. Jartti, S. Gupta, H. G. Niesters, P. Lehtinen, R. Osterback,
T. Vuorinen, M. Waris, A. Bjerkner, A. Tiveljung-Lindell, B. G. van den
Hoogen, T. Hyypia, and O. Ruuskanen. 2007. Human bocavirus and acute
wheezing in children. Clin. Infect. Dis. 44:904–910.
2. Allander, T., M. T. Tammi, M. Eriksson, A. Bjerkner, A. Tiveljung-Lindell,
and B. Andersson. 2005. Cloning of a human parvovirus by molecular screen-
ing of respiratory tract samples. Proc. Natl. Acad. Sci. USA 102:12891–
12896.
3. American Academy of Pediatrics. 2006. Diagnosis and management of bron-
chiolitis. Pediatrics 118:1774–1793.
4. Anderson, L. J. 2007. Human bocavirus: a new viral pathogen. Clin. Infect.
Dis. 44:911–912.
5. Arden, K. E., P. McErlean, M. D. Nissen, T. P. Sloots, and I. M. Mackay.
2006. Frequent detection of human rhinoviruses, paramyxoviruses, corona-
viruses, and bocavirus during acute respiratory tract infections. J. Med. Virol.
78:1232–1240.
6. Arnold, J. C., K. K. Singh, S. A. Spector, and M. H. Sawyer. 2006. Human
bocavirus: prevalence and clinical spectrum at a children’s hospital. Clin.
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
Infect. Dis. 43:283–288.
7. Bastien, N., K. Brandt, K. Dust, D. Ward, and Y. Li. 2006. Human bocavirus
infection, Canada. Emerg. Infect. Dis. 12:848–850.
8. Bastien, N., N. Chui, J. L. Robinson, B. E. Lee, K. Dust, L. Hart, and Y. Li.
2007. Detection of human bocavirus in Canadian children in a 1-year study.
J. Clin. Microbiol. 45:610–613.
9. Binn, L. N., E. C. Lazar, G. A. Eddy, and M. Kajima. 1970. Recovery and
characterization of a minute virus of canines. Infect. Immun. 1:503–508.
10. Bonvicini, F., G. Gallinella, G. A. Gentilomi, S. Ambretti, M. Musiani, and
M. Zerbini. 2006. Prevention of iatrogenic transmission of B19 infection:
different approaches to detect, remove or inactivate virus contamination.
Clin. Lab. 52:263–268.
11. Brauniger, S., J. Peters, U. Borchers, and M. Kao. 2000. Further studies on
thermal resistance of bovine parvovirus against moist and dry heat. Int. J.
Hyg. Environ. Health 203:71–75.
12. Brieu, N., B. Gay, M. Segondy, and V. Foulongne. 2007. Electron microscopy
observation of human bocavirus (HBoV) in nasopharyngeal samples from
HBoV-infected children. J. Clin. Microbiol. 45:3419–3420.
13. Chen, K. C., B. C. Shull, E. A. Moses, M. Lederman, E. R. Stout, and R. C.
Bates. 1986. Complete nucleotide sequence and genome organization of
bovine parvovirus. J. Virol. 60:1085–1097.
14. Choi, E. H., H. J. Lee, S. J. Kim, B. W. Eun, N. H. Kim, J. A. Lee, J. H. Lee,
E. K. Song, S. H. Kim, J. Y. Park, and J. Y. Sung. 2006. The association of
newly identified respiratory viruses with lower respiratory tract infections in
Korean children, 2000-2005. Clin. Infect. Dis. 43:585–592.
15. Chung, J. Y., T. H. Han, C. K. Kim, and S. W. Kim. 2006. Bocavirus infection
in hospitalized children, South Korea. Emerg. Infect. Dis. 12:1254–1256.
16. Chung, J. Y., T. H. Han, S. W. Kim, C. K. Kim, and E. S. Hwang. 2007.
Detection of viruses identified recently in children with acute wheezing.
J. Med. Virol. 79:1238–1243.
17. Dowell, S. F., T. J. Torok, J. A. Thorp, J. Hedrick, D. D. Erdman, S. R. Zaki,
C. J. Hinkle, W. L. Bayer, and L. J. Anderson. 1995. Parvovirus B19 infection
in hospital workers: community or hospital acquisition? J. Infect. Dis. 172:
1076–1079.
18. Durham, P. J., R. H. Johnson, H. Isles, R. J. Parker, R. G. Holroyd, and I.
Goodchild. 1985. Epidemiological studies of parvovirus infections in calves
on endemically infected properties. Res. Vet. Sci. 38:234–240.
19. Durham, P. J., A. Lax, and R. H. Johnson. 1985. Pathological and virological
studies of experimental parvoviral enteritis in calves. Res. Vet. Sci. 38:209–
219.
20. Eis-Hubinger, A. M., D. Dieck, R. Schild, M. Hansmann, and K. E. Schne-
weis. 1998. Parvovirus B19 infection in pregnancy. Intervirology 41:178–184.
21. El-Mahallawy, H. A., T. Mansour, S. E. El-Din, M. Hafez, and S. Abd-el-
Latif. 2004. Parvovirus B19 infection as a cause of anemia in pediatric acute
lymphoblastic leukemia patients during maintenance chemotherapy. J. Pe-
diatr. Hematol. Oncol. 26:403–406.
22. Endo, R., N. Ishiguro, H. Kikuta, S. Teramoto, R. Shirkoohi, X. Ma, T.
Ebihara, H. Ishiko, and T. Ariga. 2007. Seroepidemiology of human bocavi-
rus in Hokkaido prefecture, Japan. J. Clin. Microbiol. 45:3218–3223.
23. Fattet, S., P. Cassinotti, and M. B. Popovic. 2004. Persistent human parvo-
virus B19 infection in children under maintenance chemotherapy for acute
lymphocytic leukemia. J. Pediatr. Hematol. Oncol. 26:497–503.
24. Foulongne, V., Y. Olejnik, V. Perez, S. Elaerts, M. Rodiere, and M. Segondy.
2006. Human bocavirus in French children. Emerg. Infect. Dis. 12:1251–
1253.
25. Foulongne, V., M. Rodiere, and M. Segondy. 2006. Human bocavirus in
children. Emerg. Infect. Dis. 12:862–863.
26. Fredericks, D. N., and D. A. Relman. 1996. Sequence-based identification of
microbial pathogens: a reconsideration of Koch’s postulates. Clin. Microbiol.
Rev. 9:18–33.
27. Fry, A. M., X. Lu, M. Chittaganpitch, T. Peret, J. Fischer, S. F. Dowell, L. J.
Anderson, D. Erdman, and S. J. Olsen. 2007. Human bocavirus: a novel
VOL. 21, 2008
parvovirus epidemiologically associated with pneumonia requiring hospital-
ization in Thailand. J. Infect. Dis. 195:1038–1045.
28. Fryer, J. F., E. Delwart, F. M. Hecht, F. Bernardin, M. S. Jones, N. Shah, and
S. A. Baylis. 2007. Frequent detection of the parvoviruses, PARV4 and
PARV5, in plasma from blood donors and symptomatic individuals. Trans-
fusion 47:1054–1061.
29. Gaynor, A. M., M. D. Nissen, D. M. Whiley, I. M. Mackay, S. B. Lambert, G.
Wu, D. C. Brennan, G. A. Storch, T. P. Sloots, and D. Wang. 2007. Identi-
fication of a novel polyomavirus from patients with acute respiratory tract
infections. PLoS Pathog. 3:e64.
30. Hayes-Lattin, B., T. J. Seipel, K. Gatter, M. C. Heinrich, and R. T. Maziarz.
2004. Pure red cell aplasia associated with parvovirus B19 infection occurring
late after allogeneic bone marrow transplantation. Am. J. Hematol. 75:142–
145.
31. Hota, B. 2004. Contamination, disinfection, and cross-colonization: are hos-
pital surfaces reservoirs for nosocomial infection? Clin. Infect. Dis. 39:1182–
1189.
32. Jartti, T., P. Lehtinen, T. Vuorinen, R. Osterback, B. van den Hoogen, A. D.
Osterhaus, and O. Ruuskanen. 2004. Respiratory picornaviruses and respi-
ratory syncytial virus as causative agents of acute expiratory wheezing in
children. Emerg. Infect. Dis. 10:1095–1101.
33. Kantola, K., L. Hedman, T. Allander, T. Jartti, P. Lehtinen, O. Ruuskanen,
K. Hedman, and M. Soderlund-Venermo. 2008. Serodiagnosis of human
bocavirus infection. Clin. Infect. Dis. 46:540–546.
34. Kaplan, N., W. Dove, A. Abu-Zeid, H. Shamoon, S. Abd-Eldayem, and C. A.
Hart. 2006. Human bocavirus infection among children, Jordan. Emerg.
Infect. Dis. 12:1419–1420.
35. Kesebir, D., M. Vazquez, C. Weibel, E. D. Shapiro, D. Ferguson, M. L.
Landry, and J. S. Kahn. 2006. Human bocavirus infection in young children
in the United States: molecular epidemiological profile and clinical charac-
teristics of a newly emerging respiratory virus. J. Infect. Dis. 194:1276–1282.
36. Khetsuriani, N., N. N. Kazerouni, D. D. Erdman, X. Lu, S. C. Redd, L. J.
Anderson, and W. G. Teague. 2007. Prevalence of viral respiratory tract
infections in children with asthma. J. Allergy Clin. Immunol. 119:314–321.
37. Kleines, M., S. Scheithauer, A. Rackowitz, K. Ritter, and M. Hausler. 2007.
High prevalence of human bocavirus detected in young children with severe
acute lower respiratory tract disease using a standard PCR protocol and a
novel real-time PCR protocol. J. Clin. Microbiol. 45:1032–1034.
38. Kramer, A., I. Schwebke, and G. Kampf. 2006. How long do nosocomial
pathogens persist on inanimate surfaces? A systematic review. BMC Infect.
Dis. 6:130.
39. Kupfer, B., J. Vehreschild, O. Cornely, R. Kaiser, G. Plum, S. Viazov, C.
Franzen, R. L. Tillmann, A. Simon, A. Muller, and O. Schildgen. 2006.
Severe pneumonia and human bocavirus in an adult. Emerg. Infect. Dis.
12:1614–1616.
40. Lee, J. I., J. Y. Chung, T. H. Han, M. O. Song, and E. S. Hwang. 2007.
Detection of human bocavirus in children hospitalized because of acute
gastroenteritis. J. Infect. Dis. 196:994–997.
41. Lefrere, J. J., A. Servant-Delmas, D. Candotti, M. Mariotti, I. Thomas, Y.
Brossard, F. Lefrere, R. Girot, J. P. Allain, and S. Laperche. 2005. Persistent
B19 infection in immunocompetent individuals: implications for transfusion
safety. Blood 106:2890–2895.
42. Lehmann, H., and S. Modrow. 2004. Parvovirus B19—ein häufig unterschätzter
Infektionserreger mit vielen Krankheitsbildern. Monatsschr. Kinderheilkd. 152:
203–214.
43. Lin, F., A. Zeng, N. Yang, H. Lin, E. Yang, S. Wang, D. Pintel, and J. Qiu.
2007. Quantification of human bocavirus in lower respiratory tract infections
in China. Infect. Agents Cancer 2:3.
44. Lindblom, A., A. Isa, O. Norbeck, S. Wolf, B. Johansson, K. Broliden, and T.
Tolfvenstam. 2005. Slow clearance of human parvovirus B19 viremia follow-
ing acute infection. Clin. Infect. Dis. 41:1201–1203.
45. Lu, X., M. Chittaganpitch, S. J. Olsen, I. M. Mackay, T. P. Sloots, A. M. Fry,
and D. D. Erdman. 2006. Real-time PCR assays for detection of bocavirus in
human specimens. J. Clin. Microbiol. 44:3231–3235.
46. Ma, X., R. Endo, N. Ishiguro, T. Ebihara, H. Ishiko, T. Ariga, and H. Kikuta.
2006. Detection of human bocavirus in Japanese children with lower respi-
ratory tract infections. J. Clin. Microbiol. 44:1132–1134.
47. Mackay, I. (ed.). 2007. Real-time PCR in microbiology: from diagnosis to
characterisation. Caister Academic Press, Norwich, United Kingdom.
48. Maggi, F., E. Andreoli, M. Pifferi, S. Meschi, J. Rocchi, and M. Bendinelli.
2007. Human bocavirus in Italian patients with respiratory diseases. J. Clin.
Virol. 38:321–325.
49. Manning, A., V. Russell, K. Eastick, G. H. Leadbetter, N. Hallam, K.
Templeton, and P. Simmonds. 2006. Epidemiological profile and clinical
associations of human bocavirus and other human parvoviruses. J. Infect.
Dis. 194:1283–1290.
50. Manning, A., S. J. Willey, J. E. Bell, and P. Simmonds. 2007. Comparison of
tissue distribution, persistence, and molecular epidemiology of parvovirus
B19 and novel human parvoviruses PARV4 and human bocavirus. J. Infect.
Dis. 195:1345–1352.
51. McErlean, P., L. A. Shackelton, S. B. Lambert, M. D. Nissen, T. P. Sloots,
and I. M. Mackay. 2007. Characterisation of a newly identified human
HBoV: PASSENGER OR PATHOGEN? 303
rhinovirus, HRV-QPM, discovered in infants with bronchiolitis. J. Clin.
Virol. 39:67–75.
52. McIntosh, K. 2006. Human bocavirus: developing evidence for pathogenic-
ity. J. Infect. Dis. 194:1197–1199.
53. Modrow, S., and B. Gärtner. 2006. Parvovirus B19 Infektionen in der
Schwangerschaft. Dtsch. Árztebl. 103:A2869–A2876.
54. Monteny, M., H. G. Niesters, H. A. Moll, and M. Y. Berger. 2007. Human
bocavirus in febrile children, The Netherlands. Emerg. Infect. Dis. 13:180–
182.
55. Naghipour, M., L. E. Cuevas, T. Bakhshinejad, W. Dove, and C. A. Hart.
2007. Human bocavirus in Iranian children with acute respiratory infections.
J. Med. Virol. 79:539–543.
56. Neske, F., K. Blessing, F. Tollmann, J. Schubert, A. Rethwilm, H. W. Kreth,
and B. Weissbrich. 2007. Real-time PCR for diagnosis of human bocavirus
infections and phylogenetic analysis. J. Clin. Microbiol. 45:2116–2122.
57. Reference deleted.
58. Page, R. D. 1996. TreeView: an application to display phylogenetic trees on
personal computers. Comput. Appl. Biosci. 12:357–358.
59. Qu, X. W., Z. J. Duan, Z. Y. Qi, Z. P. Xie, H. C. Gao, W. P. Liu, C. P. Huang,
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest
F. W. Peng, L. S. Zheng, and Y. D. Hou. 2007. Human bocavirus infection,
People’s Republic of China. Emerg. Infect. Dis. 13:165–168.
60. Regamey, N., U. Frey, C. Deffernez, P. Latzin, and L. Kaiser. 2007. Isolation
of human bocavirus from Swiss infants with respiratory infections. Pediatr.
Infect. Dis. J. 26:177–179.
61. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.
62. Schenk, T., B. Huck, J. Forster, R. Berner, D. Neumann-Haefelin, and V.
Falcone. 2007. Human bocavirus DNA detected by quantitative real-time
PCR in two children hospitalized for lower respiratory tract infection. Eur.
J. Clin. Microbiol. Infect. Dis. 26:147–149.
63. Schildgen, O., T. Geikowski, T. Glatzel, A. Simon, A. Wilkesmann, M.
Roggendorf, S. Viazov, and B. Matz. 2004. New variant of the human meta-
pneumovirus (HMPV) associated with an acute and severe exacerbation of
asthma bronchiale. J. Clin. Virol. 31:283–288.
64. Schildgen, O., A. Wilkesmann, and A. Simon. 2006. Wheezing in patients
with human metapneumovirus infection. J. Allergy Clin. Immunol. 117:223.
65. Schwartz, D., B. Green, L. E. Carmichael, and C. R. Parrish. 2002. The
canine minute virus (minute virus of canines) is a distinct parvovirus that is
most similar to bovine parvovirus. Virology 302:219–223.
66. Simon, A., P. Groneck, B. Kupfer, R. Kaiser, G. Plum, R. L. Tillmann, A.
Muller, and O. Schildgen. 2007. Detection of bocavirus DNA in nasopha-
ryngeal aspirates of a child with bronchiolitis. J. Infect. 54:e125–e127.
67. Simon, A., K. Khurana, A. Wilkesmann, A. Muller, S. Engelhart, M. Exner,
O. Schildgen, A. M. Eis-Hubinger, J. R. Groothuis, and U. Bode. 2006.
Nosocomial respiratory syncytial virus infection: impact of prospective sur-
veillance and targeted infection control. Int. J. Hyg. Environ. Health 209:
317–324.
68. Sloots, T. P., P. McErlean, D. J. Speicher, K. E. Arden, M. D. Nissen, and
I. M. Mackay. 2006. Evidence of human coronavirus HKU1 and human
bocavirus in Australian children. J. Clin. Virol. 35:99–102.
69. Smuts, H., and D. Hardie. 2006. Human bocavirus in hospitalized children,
South Africa. Emerg. Infect. Dis. 12:1457–1458.
70. Smyth, R. L., and P. J. Openshaw. 2006. Bronchiolitis. Lancet 368:312–322.
71. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G.
Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic Acids
Res. 25:4876–4882.
72. van der Hoek, L., K. Pyrc, M. F. Jebbink, W. Vermeulen-Oost, R. J. Berk-
hout, K. C. Wolthers, P. M. Wertheim-van Dillen, J. Kaandorp, J. Spaar-
garen, and B. Berkhout. 2004. Identification of a new human coronavirus.
Nat. Med. 10:368–373.
73. Vicente, D., G. Cilla, M. Montes, E. G. Perez-Yarza, and E. Perez-Trallero.
2007. Human bocavirus, a respiratory and enteric virus. Emerg. Infect. Dis.
13:636–637.
74. Völz, S., O. Schildgen, D. Klinkenberg, V. Ditt, A. Müller, R. L. Tillmann, B.
Kupfer, U. Bode, M. J. Lentze, and A. Simon. 2007. Prospective study of
human bocavirus (HBoV) infection in a pediatric university hospital in
Germany 2005/2006. J. Clin. Virol. 40:229–235.
75. Weigl, J. A., W. Puppe, and H. J. Schmitt. 2003. Can respiratory syncytial
virus etiology be diagnosed clinically? A hospital-based case-control study in
children under two years of age. Eur. J. Epidemiol. 18:431–439.
76. Weinstein, M. 2005. Atypical presentation of parvovirus infection. Pediatr.
Infect. Dis. J. 24:283–284.
77. Weissbrich, B., F. Neske, J. Schubert, F. Tollmann, K. Blath, K. Blessing,
and H. W. Kreth. 2006. Frequent detection of bocavirus DNA in German
children with respiratory tract infections. BMC Infect. Dis. 6:109.
78. Wilkesmann, A., O. Schildgen, A. M. Eis-Hubinger, T. Geikowski, T. Glatzel,
M. J. Lentze, U. Bode, and A. Simon. 2006. Human metapneumovirus in-
fections cause similar symptoms and clinical severity as respiratory syncytial
virus infections. Eur. J. Pediatr. 165:467–475.
79. Wilkesmann, A., O. Schildgen, A. M. Eis-Hubinger, M. J. Lentze, U. Bode,
304 SCHILDGEN ET AL.
and A. Simon. 2007. Human metapneumovirus in hospitalized children—a
review. Klin. Padiatr. 219:58–65. (In German.)
80. Williams, J. V. 2005. The clinical presentation and outcomes of children infected
with newly identified respiratory tract viruses. Infect. Dis. Clin. N. Am. 19:569–584.
81. Williams, J. V., P. A. Harris, S. J. Tollefson, L. L. Halburnt-Rush, J. M.
Pingsterhaus, K. M. Edwards, P. F. Wright, and J. E. Crowe, Jr. 2004.
Human metapneumovirus and lower respiratory tract disease in otherwise
healthy infants and children. N. Engl. J. Med. 350:443–450.
82. Woo, P. C., S. K. Lau, C. M. Chu, K. H. Chan, H. W. Tsoi, Y. Huang, B. H.
Wong, R. W. Poon, J. J. Cai, W. K. Luk, L. L. Poon, S. S. Wong, Y. Guan, J. S.
Peiris, and K. Y. Yuen. 2005. Characterization and complete genome se-
CLIN. MICROBIOL. REV.
quence of a novel coronavirus, coronavirus HKU1, from patients with pneu-
monia. J. Virol. 79:884–895.
83. Young, N. S., and K. E. Brown. 2004. Parvovirus B19. N. Engl. J. Med.
350:586–597.
84. Zharkikh, A., and W. H. Li. 1995. Estimation of confidence in phylogeny:
the complete-and-partial bootstrap technique. Mol. Phylogenet. Evol.
4:44–63.
85. Zhi, N., I. P. Mills, J. Lu, S. Wong, C. Filippone, and K. E. Brown. 2006.
Molecular and functional analyses of a human parvovirus B19 infectious
clone demonstrates essential roles for NS1, VP1, and the 11-kilodalton
protein in virus replication and infectivity. J. Virol. 80:5941–5950.
Downloaded from http://cmr.asm.org/ on June 14, 2019 by guest