Infection, Genetics and Evolution 53 (2017) 155–159

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Research paper

Polymorphisms in pfdhfr and pfdhps genes after five years of artemisinin

combination therapy (ACT) implementation from urban Kolkata, India
Moytrey Chatterjee a, Swagata Ganguly b, Pabitra Saha c, Subhasish K. Guha d, Ardhendu Kumar Maji a,⁎
a
Protozoology Unit, Department of Microbiology, Calcutta School of Tropical Medicine, 108, C. R. Avenue, Kolkata 700 073, India
b
Department of Microbiology, NRS Medical College, 138 AJC Bose Road, Kolkata 700 014, India
c
Department of Zoology, APC Roy Government College, Himachal Bihar, Matigara, Siliguri 734 010, West Bengal, India
d
Department of Tropical Medicine, Calcutta School of Tropical Medicine, 108, C. R. Avenue, Kolkata 700 073, India

a r t i c l e i n f o a b s t r a c t

Article history: Background: In India, sulphadoxine-pyrimethamine (SP) is now in use as a partner drug of ACT (AS + SP) to treat
Received 15 December 2016 uncomplicated falciparum malaria since 2010. Declined trend of AS + SP efficacy has been reported from north-
Received in revised form 17 May 2017 eastern states of the country. It is not possible to determine the efficacy of SP alone from any study with ACT. So,
Accepted 18 May 2017 this work was designed to study the pattern of polymorphisms in pfdhfr and pfdhps genes to predict the SP resis-
Available online 19 May 2017
tance status among parasite population of urban Kolkata after five years of ACT implementation.
Methods: A total of 125 P. falciparum positive patients were enrolled in the study during December 2014 to July
Keywords:
ACT
2016 and treated with AS + SP. Parasitic DNA was isolated and subjected to sequencing of pfdhfr and pfdhps
Pfdhfr genes directly from purified PCR products.
Pfdhps Results: Genotyping of both the genes was successfully done in 113 isolates. In pfdhfr, 94.69% (107/113) isolates
P. falciparum showed mutations at codon 59 and 108. A double mutant genotype ANRNI was mostly prevalent (107/113,
India 94.69%), while wild-type genotype ANCSI was found only in 5.3% (6/113) isolates. In pfdhps, mutations were re-
corded at codon 436 and 437 in 65.49% (74/113) and 23.01% (26/113) isolates, respectively. In combined pfdhfr-
pfdhps genes, triple mutant ANRNI-FAKAA was most prevalent (45/113, 39.82%) followed by double mutant
ANRNI-SAKAA (37/113, 32.74%) and quadruple mutant ANRNI-FGKAA (24/113, 21.24%).
Conclusion: SP resistance hallmark mutations i.e., quadruple (AIRNI-SAEAA) or quintuple (AIRNI-SGEAA) geno-
type in pfdhfr and pfdhps was absent which indicates that SP components of used ACT is still effective in the study
area. It is also evident by the clinical response of AS + SP. Monitoring the efficacy of this combination (both by
therapeutic and molecular marker study) at a regular interval is highly suggested to record any development
of SP resistance in near future.
© 2017 Elsevier B.V. All rights reserved.

1. Introduction
Emergence and spread of resistance against different antimalarial
drugs particularly by Plasmodium falciparum, is one of the most impor-
tant obstacle to reach the goal of malaria elimination by 2030 globally,
as set by World Health Organization (WHO, 2016). Chloroquine
remained the drug of choice since it was recognised and established as
an effective and safe antimalarial agent in 1946. After a few decades, P.
falciparum developed resistance against it and was first reported from
Thai-Cambodian border in late 1950s (Harinasuta et al., 1965) and
from South America in early 1960s which gradually spread throughout
the world (Payne, 1987). Then sulphadoxine-pyrimethamine (SP) was
considered as a promising agent to treat P. falciparum (Harinasuta et
⁎ Corresponding author at: Calcutta School of Tropical Medicine, 108, C. R. Avenue,
Kolkata 700073, India.
E-mail address: maji_ardhendu@yahoo.com (A.K. Maji).
al., 1967; Laing et al., 1968) and showed better efficacy initially. SP
was introduced in southeast Asia, south America and in Africa in 1970′
s for the treatment of falciparum malaria (Black et al., 1981; Nurse,
1981). After a short while P. falciparum developed resistance against
this combination and get reported first from Thailand (Pinichpongse
et al., 1982). By 1990′s, SP resistance was reported in many endemic re-
gions of South America and East Africa (Cortese et al., 2002;
Wongsrichanalai et al., 2002).
In India, SP was used to treat known CQ resistant falciparum malaria
previously. At present, it is used as a partner drug of an artemisinin com-
bination therapy (ACT), a combination of artesunate plus sulphadoxine-
pyrimethamine (AS + SP) (Anvikar et al., 2014). The national drug pol-
icy on malaria of India introduced ACT (AS + SP) in 2005 in high en-
demic districts with known CQ resistance. Then the combination of
artesunate plus sulphadoxine-pyrimethamine (AS + SP) was recom-
mended as first line agent to treat all uncomplicated falciparum malaria
throughout the country, though it was not recommended for the first

http://dx.doi.org/10.1016/j.meegid.2017.05.013
1567-1348/© 2017 Elsevier B.V. All rights reserved.
156 M. Chatterjee et al. / Infection, Genetics and Evolution 53 (2017) 155–159
trimester pregnant woman with uncomplicated falciparum malaria and
CQ was recommended for treatment of non-falciparum malaria
(National Drug Policy on Malaria, 2010). Different studies showed a bet-
ter efficacy of this combination from India (Saha et al., 2013; Valecha et
al., 2009). Unfortunately, declined efficacy was reported from north-
eastern states (Mishra et al., 2014). Accordingly, National vector borne
diseases control program (NVBDCP) replaced AS + SP by AM + LU
only in north-eastern states (Arunachal Pradesh, Assam, Manipur, Me-
ghalaya, Mizoram, Nagaland and Tripura) of India in 2013 (National
Drug Policy on Malaria, 2013).
SP is a combination of sulphadoxine and pyrimethamine, that inhibit
two different biochemical reactions of folic acid biosynthesis of the par-
asite (Chulay et al., 1998). Sulphadoxine inhibits dihydropteroate syn-
thetase (PfDHPS), while pyrimethamine inhibits dihydrofolate
reductase (PfDHFR). Dihydrofolate reductase (DHFR) enzyme is pro-
duced by pfdhfr gene which is 1827 bp in size and located on chromo-
some 4. DHFR is responsible for conversion of dihydrofolate into
tetrahydrofolate in the folic acid biosynthesis pathways (Yuvaniyama
et al., 2003). Dihydropteroate synthetase (DHPS) encoded by pfdhps
gene which is located on chromosome 8 and 2417 bp in size.
Dihydropteridine pyrophosphate is converted to dihydropteroate with
the incorporation of p-ABA (p-Amino Benzoic Acid) by the action of
DHPS (Ferone et al., 1973). Molecular analysis of these two genes
showed that there are five important point mutations in each gene asso-
ciated with SP resistance. In pfdhfr, important SNPs are at codon 16, 51,
59, 108 and 164 (Nzila-Mounda et al., 1998; Peterson et al., 1988),
whereas in pfdhps they are at 436, 437, 540, 581 and 613 (Triglia and
Cowman, 1994; Plowe et al., 1997). A quadruple mutation with 51, 59,
108 of pfdhfr and 436/437 of pfdhps or a quintuple mutant with 51, 59,
108 of pfdhfr and 436/437 and 540 of pfdhps is considered as hallmark
of SP resistance (Kublin et al., 2002). Before introduction of ACT, qua-
druple mutations in pfdhfr-pfdhps genes ranging from 2 to 8% was re-
ported from different parts of the country (Pathak et al., 2014;
Mohapatra et al., 2014; Lumb et al., 2009; Saha et al., 2012; Ganguly et
al., 2013). Quintuple mutant (2 to 5%) was also reported from Car
Nicobar Island, Odhisa and West Bengal (Lumb et al., 2009; Saha et al.,
2012; Ganguly et al., 2013). Data on polymorphisms in pfdhfr and pfdhps
genes after ACT (AS + SP) introduction are very rare (Das et al., 2012).
The present study was carried out to detect the pattern of polymor-
phisms in pfdhfr and pfdhps genes among clinical isolates collected
after five years of ACT (AS + SP) implementation from urban Kolkata
India.
2. Materials and method
2.1. Study site and patients recruitment
The study was conducted at Malaria clinic attached with Calcutta
School of Tropical Medicine, Kolkata, India from December 2014 to
July 2016. In routine practice, febrile patients were attending the clinic
for diagnosis and treatment of malaria. Malaria parasites were detected
by pLDH and HRP-II based RDK and by examining thick and thin Giemsa
stained blood smear. Three-four ml EDTA blood samples were collected
from microscopically P. falciparum positive patients. The P. vivax positive
patients were treated with age dependent doses of CQ + PQ whereas P.
falciparum positive cases were treated with ACT (AS + SP) as per age
and body weight. The enrolled 125 P. falciparum positive cases were
treated with AS + SP under direct supervision of study team members
and they were advised to attend the clinic on day 0, 1, 2, 3, 7, 14, 21,
28, 35 and 42 for clinical and parasitological follow up.
2.2. DNA isolation
Genomic DNA of P. falciparum from whole blood was extracted using
QIAamp DNA blood Kit (Qiagen, Hilden, Germany), following the
manufacturer's instructions. Extracted DNA was stored at − 20 °C for
further study.
2.3. PCR and DNA sequencing
Pfdhfr: In the present study, 735 base pair region of pfdhfr gene con-
taining five important nucleotides was amplified by primary and nested
PCR using oligonucleotide primer pairs as described in Table 1
(Andriantsoanirina et al., 2009).
Pfdhps: A fragment of 758 base pair region of pfdhps gene was ampli-
fied by nested PCR using oligonucleotide primer pairs as described in
Table 1 (Andriantsoanirina et al., 2009).
The quality and concentration of PCR products were ascertained by
1.5% agarose gel electrophoresis following ethidium bromide stain.
PCR product was purified using Qiagen gel extraction kit and sequenc-
ing was outsourced from Chromous Biotech, Bangalore, both in forward
and reverse direction.
2.4. Analysis of sequence
The sequences were analysed using the software BioEdit Sequence
Alignment Editor version 7.0.9.0. The sequences of pfdhfr gene were
aligned with the reference sequence PFD0830w (Plasmo DB) and that
of pfdhps with reference sequence PF08_0095 (Plasmo DB) using online
multiple sequence alignment tool.
2.5. Ethics clearance
The study protocol was approved by the Institutional Scientific Advi-
sory Committee and Institutional Ethics Committee of the Calcutta
School of Tropical Medicine.
3. Results
A total of 13,394 patients were examined for malarial parasite dur-
ing the study period among them 2154 were positive for malaria infec-
tion, of them 1938 were positive for P. vivax, 216 for P. falciparum. Out of
216 P. falciparum positive cases 125 patients consented to participate
into the study. The demographic parameters of recruited patients are
given in Table 2. Though it was not a therapeutic efficacy study but all
recruited cases were followed-up upto 42 days. Out of 125 patients
111 were evaluated upto day 42 and 14 cases were loss to follow-up.
Among the follow-up completed cases 110 (99.1%) were classified as
treatment success and a single case of treatment failure (0.9%) was re-
corded on day 42. Loss to follow up was recorded 1 on day 3, 8 on day
7, and one each on day 14, 21, 28 and 35. The single case of withdrawn
was occurred on day 2.
3.1. Polymorphisms in pfdhfr and pfdhps genes
Out of 125 isolates, both pfdhfr and pfdhps genes were successfully
analysed in 113. In pfdhfr gene, mutations were observed at codon 59
(C59R) and 108 (S108N) in 107 isolates (107/113, 94.69%, 95% CI:
0.89–0.98) while no mutations were observed at codon 16, 51 and
164. The wild-type genotype of pfdhfr gene A16N51C59S108I164 was de-
tected in 6 (6/113, 5.3%, 95% CI: 0.02–0.11) and double mutant
A16N51R59N108I164 in 107 (107/113, 94.69%, 95% CI: 0.89–0.98) isolates
(Table 3).
In pfdhps gene, point mutation was recorded at codons 436 (S436F)
in 74 isolates (74/113, 65.49%, 95% CI: 0.56–0.75) and 437 (A437G) in 26
isolates (26/113, 23.01%, 95% CI: 0.16–0.32). The wild-type genotype of
pfdhps gene S436A437K540A581A613was detected in 37 (37/113, 32.74%,
95%CI: 0.24–0.42) isolates. Highest prevalent mutant form was single
mutant F436A437K540A581A613 in 50 (50/113, 44.25%, 95%CI: 0.35–0.53),
followed by double mutant F436G437K540A581A613 in 24 (24/113,
 M. Chatterjee et al. / Infection, Genetics and Evolution 53 (2017) 155–159 157

Table 1
Primers and PCR conditions for sequencing of pfdhfr and pfdhps gene.

Primer name Primer Sequence (5′-3′) Mg2+ Conc. PCR program Ref.
(mM)
Denaturation Annealing Elongation No. of cycles

Temp Time Temp Time Temp Time 1st 2nd

(°C) (min) (°C) (min) (°C) (min) PCR PCR

Pfdhfr_Pr_F CCAACATTTTCAAGATTGATACATAA 3 94 0:30 60 1:30 72 1:30 40 – Andriantsoanirina et al.

Pfdhfr_Pr_R ACATCGCTAACAGAAATAATTTGA (2009)
Pfdhfr_Ns_F GCGACGTTTTCGATATTTATG 2.5 94 0:30 60 1:30 72 1:30 – 40
Pfdhfr_Ns_R GATACTCATTTTCATTTATTTCTGGA
Pfdhps_Pr_F TTGTTGAACCTAAACGTGCTG 2.5 94 0:30 54 0:30 72 1:30 40 –
Pfdhps_Pr_R TTGATCCTTGTCTTTCCTCATGT
Pfdhps_Ns_F TTTGAAATGATAAATGAAGGTGCT 2.5 94 0:30 60 1:30 72 1:30 – 40
Pfdhps_Ns_R TCCAATTGTGTGATTTGTCCA

21.24%, 95% CI: 0.15–0.29) and single mutant in S436G437K540A581A613 2
cases (2/113, 1.77%, 95%CI: 0.005–0.06) respectively.
Regarding pfdhfr-pfdhps combined genotype, wild-type genotype
A16N51C59S108I164-S436A437K540A581A613 was not detected in any of the
studied isolates. The single mutant genotype A16N51C59S108I164-
S436G437K540A581A613 and A16N51C59S108I164-F436A437K540A581A613 was
detected in 0.89% (1/113, 95% CI: 0.002–0.05) and 4.42% (5/113,
95%CI: 0.02–0.09) isolates respectively. Double mutant
A16N51R59N108I164-S436A437K540A581A613 was present in 37 (37/113,
32.74%, 95% CI: 0.25–0.42) isolates. Among two different triple mutant
genotypes, A16N51R59N108I164-S436G437K540A581A613 was found in a sin-
gle isolate (1/113, 0.89%, 95% CI: 0.002–0.05) while another mutant
A16N51R59N108I164-F436A437K540A581A613 was detected in 45 (45/113,
39.82%, 95% CI: 0.31–0.49) cases. The quadruple mutant
A16N51R59N108I164-F436G437K580A581A613 was detected in 24 isolates
(24/113, 21.24%, 95% CI: 0.14–0.29) (Table 3).
4. Discussion
from this study. The study of polymorphisms in pfdhfr and pfdhps
genes highlights the status of SP resistance among the clinical isolates
treated with AS + SP. Previous studies indicated that presence of
point mutation at codon 108 in pfdhfr is primarily responsible for pyri-
methamine resistance that is gradually increased by addition of point
mutations at positions 16, 51, 59 and 164 (Nzila-Mounda et al., 1998;
Peterson et al., 1988). In the present study, a double mutant ANRNI ge-
notype in pfdhfr gene was highly prevalent (94.69%). Similar observa-
tion was also reported from different parts of the country before
introduction of ACT (Ahmed et al., 2004; Srivastava et al., 2013;
Mohapatra et al., 2014). We did not find any triple mutant genotype
in pfdhfr gene which was reported from car Nicobar, north eastern states
of the country (Lumb et al., 2009; Mishra et al., 2016) and also from
Jalpaiguri and Purulia districts of West Bengal (Saha et al., 2012;
Ganguly et al., 2013).
Table 3
Mutation profile of pfdhfr-pfdhps genes and their combined genotype.

Candidate genes Occurrence of mutations

At present SP is not used individually for treatment of falciparum
n % 95% CI
malaria in India. It is used as a partner drug with artesunate in the
form of AS + SP. It is very difficult to say about efficacy of SP alone pfdhfr (n = 113)
A16V 0 0 0–0.03
N51I 0 0 0–0.03
Table 2 C59R 107 94.69 0.89–0.98
Demographic parameters of the recruited patients. S108N 107 94.69 0.89–0.98
I164L 0 0 0–0.03
Characteristics Values
pfdhfr genotypes
Study period December 2014–July 2016 Wild Type
Total patients 125 A16N51C59S108I164 6 5.3 0.02–0.11
Treatment outcomes [n, (%)] Double mutant
Treatment success 110 (99.1) A16N51R59N108I164 107 94.69 0.89–0.98
Treatment failure 1 (0.9) pfdhps(n = 113)
Sex [no. (%)] S436F 74 65.49 0.56–0.74
Male 114 (91.2) A437G 26 23.01 0.16–0.32
Female 11 (8.8) K540E 0 0 0–0.03
Age group (yrs) [no, (%)] A581G 0 0 0–0.03
Adults 115 (92.0) A613S 0 0 0–0.03
5 to 15 10 (8.0) pfdhps Genotypes
Under 5 0 (0) Wild Type
Age (yrs) S436A437K540A581A613 37 32.74 0.24–0.42
Mean ± SD 35.0 ± 15.4 Single mutant
Range 5–70 F436A437K540A5813A613 50 44.25 0.35–0.53
95% CI 32.3–37.7 S436G437K540A581A613 2 1.77 0.005–0.06
Weight (kg), day 0 Double mutant
Mean ± SD 58.3 ± 13.5 F436G437K540A581A613 24 21.24 0.15–0.29
Range 15–90 pfdhfr-pfdhps genotype (n = 113)
95% CI 55.9–60.6 Single mutant
Temperature (°C), day 0 A16N51C59S108I164-S436G437K540A581A613 1 0.89 0.002–0.05
Mean ± SD 37.65 ± 1.04 A16N51C59S108I164-F436A437K540A581A613 5 4.42 0.02–0.09
Range 36–40 Double mutant
95% CI 37.4–37.8 A16N51R59N108I164-S436A437K540A581A613 37 32.74 0.25–0.42
Parasitemia (μl), day 0 Triple mutant
Mean ± SD 9851.2 ± 12,507 A16N51R59N108I164-S436G437K540A581A613 1 0.89 0.002–0.05
Range 2000–99,800 A16N51R59N108I164-F436A437K540A581A613 45 39.82 0.31–0.49
95% CI 7658.6–12,044.0 Quadruple mutant
Febrile patients: afebrile patients, day 0 57:68 A16N51R59N108I164-F436G437K540A581A613 24 21.24 0.14–0.29
158 M. Chatterjee et al. / Infection, Genetics and Evolution 53 (2017) 155–159
In pfdhps gene, SNPs at codon 436 and 437 were highly prevalent. In-
terestingly wild-type genotype was recorded in 32.74% isolates. The
SNPs at 436 and 437 play an important role in sulphadoxine resistance
that is further enhanced by additional mutations at codons 540, 581 and
613 (Triglia and Cowman, 1994; Plowe et al., 1997). But we did not find
any mutations in last three codons.
In combined pfdhfr-pfdhps genotype, quadruple mutant genotype
ANRNI-FGKAA, was recorded in 21.24% isolates. But no quadruple mu-
tant genotype with triple pfdhfr mutation (A16I51R59N108I164) along
with pfdhps mutation either at codon 437 or 540 and quintuple mutant
genotype with triple pfdhfr mutation (A16I51R59N108I164) along with
pfdhps mutation at codon 437 and 540 was detected in the present
study, which is considered as hallmark for SP resistance (Kublin et al.,
2002). In Purulia and Jalpaiguri districts of the same states, quintuple
pfdhfr-pfdhps mutant genotypes (AIRNI-SGEAA) was reported before
2010 (Saha et al., 2012; Ganguly et al., 2013). Both these districts were
declared as highly endemic for P. falciparum where AS + SP was imple-
mented since 2005. But in urban Kolkata SP was never been recom-
mended as first line agent either individually or in any combination
before 2010. These prolonged uses of SP in Jalpaiguri and Purulia dis-
tricts might be a cause behind the prevalence of quintuple mutation.
In the present study as most of the patients were classified as treatment
success following treatment with AS + SP indicates that the combina-
tion is still effective against prevailing parasite population of the study
area. This is also supported by the absence of any mutation in propeller
region of K-13 gene of the same isolates which is found to be associated
with artemisinin resistance (Chatterjee et al., 2015). The only treatment
failure case showed triple mutant ANRNI-SGKAA genotype that does
not indicate about SP resistance. As we did not study the efficacy of SP
alone and serum level drug concentration, it is difficult to explain
about this treatment failure case. The treatment failure case was an
adult male of 20 years of age with body weight 61 kg. On the day 42 fol-
low up axillary temperature was 37.7 °C with parasite count of 7400 per
μl of blood.
5. Conclusion
Absence of quadruple (AIRNI-SAEAA) or quintuple (AIRNI-SGEAA)
mutant genotype in pfdhfr and pfdhps genes, which have been consid-
ered as hallmark for SP resistance, indicates the SP components of
used ACT is still effective in the study area. It is also evident by the clin-
ical response of AS + SP among the study patients. Monitoring the effi-
cacy of this combination (both by therapeutic and molecular marker
study) at a regular interval is highly suggested to record any develop-
ment of SP resistance in near future.
Authors' contribution
AKM and SG designed the study; MC, SG, PS, SKG clinically exam-
ined, recruited and followed up the patients, collected the blood sam-
ples; SG, SKG provided the treatment, MC, SG, PS assessed laboratory
diagnostics, molecular studies. MC, PS, perform the data analysis and in-
terpretation. AKM, SG, PS, MC prepared the manuscript.
Financial supports
This work was financially supported by Department of Science and
Technology, Government of West Bengal.
Conflicts of interest
We have no conflicts of interest concerning the work reported in this
article.
Acknowledgement
We thank all the patients, who participated in this study.
References
Ahmed, A., et al., 2004. Plasmodium falciparum isolates in India exhibit a progressive in-
crease in mutations associated with sulphadoxine-pyrimethamine resistance.
Antimicrob. Agents Chemother. 48, 879–889.
Andriantsoanirina, V., et al., 2009. Plasmodium falciparum drug resistance in Madagascar:
facing the spread of unusual pfdhfr and pfmdr-1 genotypes and the decrease of
dihydroartemisinin susceptibility. Antimicrob. Agents Chemother. 53, 4558–4597.
Anvikar, A.R., et al., 2014. Antimalarial drug policy in India: past, present & future. Indian
J. Med. Res. 139, 205–215.
Black, F., et al., 1981. Fansidar resistant falciparum malaria acquired in South East Asia.
Trans. R. Soc. Trop. Med. Hyg. 75, 715–716.
Chatterjee, M., et al., 2015. No polymorphism in Plasmodium falciparum K13 propeller
gene in clinical isolates from Kolkata, India. J Pathog.:374354 http://dx.doi.org/10.
1155/2015/374354.
Chulay, J.D., et al., 1998. Synergistic antimalarial activity of pyrimethamine and
sulfadoxine against Plasmodium falciparum in vitro. Am.J.Trop. Med. Hyg. 33,
325–330.
Cortese, J.F., et al., 2002. Origin and dissemination of Plasmodium falciparum drug-resis-
tance mutations in South America. J. Infect. Dis. 186, 999–1006.
Das, S., et al., 2012. Novel quadruple mutations in dihydropteroate synthase genes of Plas-
modium falciparum in West Bengal, India. Trop. Med. Int. Health 17, 1329–1334.
Ferone, R., et al., 1973. The enzyme synthesis of dihydropteroate and dihydrofolate by
Plasmodium berghei. J. Protozool. 20, 459–463.
Ganguly, S., et al., 2013. High prevalence of asymptomatic malaria in a tribal population in
Eastern India. J. Clin. Microbiol. 51, 1439–1444.
Harinasuta, T., et al., 1965. Chloroquine-resistant falciparum malaria in Thailand. Lancet 2,
657–660.
Harinasuta, T., et al., 1967. Sulphormethoxine in chloroquine resistant falciparum malaria
in Thailand. Lancet 1, 1117–1119.
Kublin, J.G., et al., 2002. Molecular markers for failure of sulfadoxine-pyrimethamine and
chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. J. Infect. Dis.
185, 380–388.
Laing, A.B., et al., 1968. Hospital and field trials of sulformethoxine with pyrimethamine
against Malaysian strains of Plasmodium falciparum and P. vivax. Med. J. Malaya 23,
5–19.
Lumb, V., et al., 2009. Emergence of an unusual sulfadoxine-pyrimethamine resistance
pattern and a novel K540N mutation in dihydropteroate synthetase in Plasmodium
falciparum isolates obtained from Car Nicobar Island, India, after the 2004 Tsunami.
J. Infect. Dis. 199, 1064–1073.
Mishra, N., et al., 2014. Declining efficacy of artesunate plus sulphadoxine-pyrimethamine
in north eastern India. Malar. J. 13, 284.
Mishra, N., et al., 2016. Monitoring the efficacy of antimalarial medicines in India via sen-
tinel sites: outcomes and risk factors for treatment failure. J. Vector Borne Dis. 53,
168–178.
Mohapatra, P.K., et al., 2014. Molecular evidence of increased resistance to anti-folate
drugs in plasmodium falciparum in North-East India: a signal for potential failure of
artemisinin plus sulphadoxine-pyrimethamine combination therapy. PLoS One 9,
e105562.
National Drug Policy on Malaria, 2010. Directorate of National Vector Borne Disease Con-
trol Programme. http://nvbdcp.gov.in/doc/drug-policy-2010.pdf.
National Drug Policy on Malaria, 2013. Directorate of National Vector Borne Disease Con-
trol Programme. http://nvbdcp.gov.in/Doc/National-Drug-Policy-2013.
Nurse, G.T., 1981. Fansidar-resistant falciparum malaria in Papua 1 New Guinea. Lancet 1,
36–37.
Nzila-Mounda, A., et al., 1998. Kenyan Plasmodium falciparum field isolates: correla-
tion between pyrimethamine and chlorcycloguanil activity in vitro and point
mutations in the dihydrofolatereductase domain. Antimicrob. Agents
Chemother. 42, 164–169.
Pathak, A., et al., 2014. Characterization of drug resistance associated genetic polymor-
phisms among Plasmodium falciparum field isolates in Ujjain, Madhya Pradesh,
India. Malar. J. 13, 182.
Payne, D., 1987. Spread of chloroquine resistance in Plasmodium falciparum. Parasitol.
Today 3, 241–246.
Peterson, D.S., et al., 1988. Evidence that a point mutation in dihydrofolate reductase–
thymidylate synthase confers resistance to pyrimethamine in falciparum malaria.
Proc. Natl. Acad. Sci. U. S. A. 85, 9114–9118.
Pinichpongse, S., et al., 1982. An evaluation of five regimens for the outpatient therapy of
falciparum malaria in Thailand 1980–81. Bull. World Health Organ. 60, 907–912.
Plowe, C.V., et al., 1997. Mutations in plasmodium falciparum dihydrofolate reductase and
dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine
use and resistance. J. Infect. Dis. 176, 1590–1596.
Saha, P., et al., 2012. Comparative efficacy of Artemisinin Combination Therapies (ACTs)
in P. falciparum malaria and polymorphism of PfATPase6, Pfcrt, Pfdhfr and Pfdhps
genes in tea gardens of Jalpaiguri district, India. Antimicrob. Agents Chemother. 56,
2511–2517.
Saha, P., et al., 2013. Therapeutic efficacy of artemisinin combination therapies and prev-
alence of S769N mutation in PfATPase6 gene of Plasmodium falciparum in Kolkata,
India. Asian Pac. J. Trop. Med. 443–448.
Srivastava, P., et al., 2013. A clinical and molecular study of artesunate + sulphadoxine-
pyrimethamine in three districts of central and eastern India. Malar. J. 12, 247.
 M. Chatterjee et al. / Infection, Genetics and Evolution 53 (2017) 155–159 159

Triglia, T., Cowman, A.F., 1994. Primary structure and expression of the dihydropteroate World Health Organization, 2016. Global Technical Strategy for Malaria. http://apps.who.int/
synthetase gene of Plasmodium falciparum. Proc. Natl. Acad. Sci. U. S. A. 91, iris/bitstream/10665/176712/1/9789241564991_eng.pdf?ua=1&ua=1:pp. 2016–2030.
7149–7153. Yuvaniyama, J., et al., 2003. Insights into antifolate resistance from malarial DHFR-TS
Valecha, N., et al., 2009. Therapeutic efficacy of artemether-lumefantrine in uncomplicat- structures. Nat. Struct. Biol. 10, 357–365.
ed falciparum malaria in India. Malar. J. 8, 107.
Wongsrichanalai, C., et al., 2002. Epidemiology ofdrug-resistant malaria. Lancet Infect. Dis.
2, 209–218.