Sie sind auf Seite 1von 2

10/2/2015 Primer3Plus

Primer3Plus Primer3Manager Help

pick primers from a DNA sequence About Source Code

< Back

Pair 1:
  Left Primer 1:      Primer_F
Sequence: TTCATCGGCTGAGAAGGAGT
Start:   436 Length:   20 bp Tm:   60.0 °C GC:   50.0 % ANY:   6.0 SELF:   1.0
  Right Primer 1:      Primer_R
Sequence: GGAGGCGAATATTTGTTGGA
Start:   627 Length:   20 bp Tm:   59.9 °C GC:   45.0 % ANY:   6.0 SELF:   0.0
Product Size:   192 bp Pair Any: 4.0 Pair End: 1.0
Send to Primer3Manager   Reset Form
1   ATGCATCCAC  CAACACTTAT  CTTTAACTCA  ACCCTCCTCA  TTATTCTTTT
51   CCTCCTAACG  TACCCCCTCA  TCGTCTCCCT  CAATCCCAGC  CCTCTTAACA
101   AAAAATGAGC  GACCACCCAT  GTTAAAACCG  CAGTTCAAAC  GGCCTTCTAC
151   ATCAGCCTGC  TCCCCCTCGC  AATATTCTTT  GATCAAGGCA  TAGAAACCAT
201   CACCACCAAC  TGACACTGAA  TAAACATCGC  CACCTTCAAC  ATCAACGTCA
251   GCTTCAAATT  TGACCAATAC  TCAATTATTT  TTACACCCGT  CGCCCTCTAC
301   GTTACATGAT  CAATCCTAGA  ATTCGCTTCA  TGATACATAC  ACTCAGACCC
351   CAACATAAAC  CGATTCTTTA  AATACCTACT  CTTATTCTTA  ATCGCCATAA
401   TTACCCTAGT  CACAGCTAAC  AATATATTCC  AACTATTCAT  CGGCTGAGAA
451   GGAGTAGGCA  TTATGTCCTT  CCTGCTAATC  GGATGATGAT  ACGGACGTGC
501   AGACGCCAAC  ACTGCCGCCT  TACAAGCCGT  CATCTACAAC  CGAGTAGGAG
551   ACATTGGACT  AATCCTAAGC  ATGGCATGAT  TTGCAATAAA  CATAAACACT
601   TGAGAAATCC  AACAAATATT  CGCCTCCTCC

   Select all Primers

Pair 2:
  Left Primer 2:      Primer_1_F
Sequence: CGACCACCCATGTTAAAACC
Start:   110 Length:   20 bp Tm:   60.1 °C GC:   50.0 % ANY:   4.0 SELF:   2.0
  Right Primer 2:      Primer_1_R
Sequence: GGCGACGGGTGTAAAAATAA
Start:   294 Length:   20 bp Tm:   59.8 °C GC:   45.0 % ANY:   3.0 SELF:   1.0
Product Size:   185 bp Pair Any: 5.0 Pair End: 3.0

Send to Primer3Manager   Reset Form  

Pair 3:
  Left Primer 3:      Primer_2_F
Sequence: TCCTTCCTGCTAATCGGATG
Start:   466 Length:   20 bp Tm:   60.2 °C GC:   50.0 % ANY:   5.0 SELF:   3.0
  Right Primer 3:      Primer_2_R
Sequence: GGAGGCGAATATTTGTTGGA
Start:   627 Length:   20 bp Tm:   59.9 °C GC:   45.0 % ANY:   6.0 SELF:   0.0
Product Size:   162 bp Pair Any: 4.0 Pair End: 0.0

Send to Primer3Manager   Reset Form  

Pair 4:
http://www.bioinformatics.nl/cgi­bin/primer3plus/primer3plus.cgi 1/2
10/2/2015 Primer3Plus

  Left Primer 4:      Primer_3_F
Sequence: CGTCGCCCTCTACGTTACAT
Start:   288 Length:   20 bp Tm:   60.2 °C GC:   55.0 % ANY:   4.0 SELF:   3.0

  Right Primer 4:      Primer_3_R
Sequence: CATCCGATTAGCAGGAAGGA
Start:   485 Length:   20 bp Tm:   60.2 °C GC:   50.0 % ANY:   5.0 SELF:   0.0
Product Size:   198 bp Pair Any: 4.0 Pair End: 1.0

Send to Primer3Manager   Reset Form  

Pair 5:
  Left Primer 5:      Primer_4_F
Sequence: CGTCGCCCTCTACGTTACAT
Start:   288 Length:   20 bp Tm:   60.2 °C GC:   55.0 % ANY:   4.0 SELF:   3.0
  Right Primer 5:      Primer_4_R
Sequence: TCATCCGATTAGCAGGAAGG
Start:   486 Length:   20 bp Tm:   60.2 °C GC:   50.0 % ANY:   5.0 SELF:   1.0
Product Size:   199 bp Pair Any: 4.0 Pair End: 2.0

Send to Primer3Manager   Reset Form  

Statistics:
considered 4573, GC content failed 18, low tm 1846, high tm 1464, high end compl 4, long poly­x seq 19,high
Left Primer:
3' stability 90, ok 1132
considered 4596, GC content failed 20, low tm 1941, high tm 1379, high end compl 1, long poly­x seq 19,high
Right Primer:
3' stability 79, ok 1157
Primer Pair: considered 2369, unacceptable product size 2356, ok 13

More about Primer3Plus...

http://www.bioinformatics.nl/cgi­bin/primer3plus/primer3plus.cgi 2/2