Possible Migration Routes into South America Deduced

from Mitochondrial DNA Studies in Colombian

Amerindian Populations

GENOVEVA KEYEUX,1 CLEMENCIA RODAS,2 NANCY GELVEZ,3 AND DEE CARTER4

Abstract Mitochondrial DNA haplotype studies have been useful in un-

raveling the origins of Native Americans. Such studies are based on restric-
tion site and intergenic deletion/insertion polymorphisms, which define four
main haplotype groups common to Asian and American populations. Several
studies have characterized these lineages in North, Central, and South Amer-
ican Amerindian, as well as Na Dene and Aleutian populations. Siberian,
Central Asian, and Southeast Asian populations have also been analyzed, in
the hope of fully depicting the route(s) of migration between Asia and Amer-
ica. Colombia, a key route of migration between North and South America,
has until now not been studied. To resolve the current lack of information
about Colombian Amerindian populations, we have investigated the presence
of the founder haplogroups in 25 different ethnic groups from all over
the country. The present research is part of an interdisciplinary program, Ex-
pedición Humana, fostered by the Universidad Javeriana and Dr. J. E. Bernal
V. The results show the presence of the four founder A-D Amerindian lineag-
es, with varied distributions in the different populations, as well as the pres-
ence of other haplotypes in frequencies ranging from 3% to 26%. These in-
clude some unique or private polymorphisms, and also indicate the probable
presence of other Asian and a few non-Amerindian lineages. A spatial struc-
ture is apparent for haplogroups A and D, and to a lesser extent for haplogroup
C. While haplogroup A and D frequencies in Colombian populations from the
northwestern side of the Andes resemble those seen in Central American
Amerindians more than those seen in South American populations, their fre-
quencies on the southeastern side more closely resemble the bulk of South
American frequencies so far reported, raising the question as to whether they
reflect more than one migration route into South America. High frequencies of
the B lineage are also characteristic of some populations. Our observations
may be explained by historical events during the pre-Columbian dispersion of
the first settlers and, later, by disruptions caused by the European colonization.

1
Instituto de Genética, Universidad Nacional de Colombia, Ciudad Universitaria, Bogotá, Colombia.
2
Warwick University, Coventry, UK.
3
Instituto de Genética Humana, Facultad de Medicina, Universidad Javeriana, Bogotá, Colombia.
4
Microbiology Department, University of Sydney, NSW2006, Australia.

Human Biology, April 2002, v. 74, no. 2, pp. 211–233.

Copyright © 2001 Wayne State University Press, Detroit, Michigan 48201-1309

KEY WORDS: MITOCHONDRIAL DNA, HAPLOGROUPS, COLOMBIAN POPULATIONS,

AMERINDIANS, MIGRATIONS, SETTLEMENT
212 / keyeux et al.

Mitochondrial DNA (mtDNA) has been extensively studied in recent years in

population genetics investigations. The 16.5-kilobase-pair circular mtDNA
genome is maternally inherited and not subject to recombination during meiosis
(Giles et al. 1980), making mutations directly visible for phylogenetic studies.
Mutations in mtDNA accumulate at a rate 5 to10 times faster than that in nuclear
genes (Brown et al. 1979); many regions are polymorphic, and linked restriction
sites or short deletion/insertion polymorphisms have been characterized and
shown to be inherited as haplotypes and lineages in different populations (Wal-
lace et al. 1985; Torroni et al. 1992, 1993a, 1993b).
Several mtDNA variants have been found to be at the root of the differenti-
ation of human populations, since these arose early in the phylogenetic radiation
of the major ethnic groups. For instance, an A→G transition at nucleotide posi-
tion (np) 10398 distinguishes two major lineages in Caucasians, characterized by
the presence or absence of a DdeI site at np 10394. This polymorphism seems to
be very ancient, since it is also found in Asians and Africans (Ballinger et al.
1992; Torroni et al. 1993a, 1994c; Passarino et al. 1993). At position 10397, gain
of an AluI site is observed in Mongoloids, which has not been reported in
Africans or Europeans (Ballinger et al. 1992; Passarino et al. 1993; Torroni et al.
1994c; Chen et al. 1995). Therefore, this variant probably represents a more re-
cent mutation that arose in Asians and is also observed in Amerindians (Ballinger
et al. 1992; Bianchi et al. 1995). Africans are characterized by an HpaI site at np
3592, which is also found in populations having some degree of admixture with
sub-Saharan Africans (Chen et al. 1995). Finally, a few mutations define four dis-
tinct lineages in Amerindians: an HaeIII site gain at np 663, an AluI site loss at np
5176, a 9-base-pair (bp) deletion in region V, and a HincII site loss at np 13259
(Torroni et al. 1992, 1993a, 1993b).
Amerindian populations studied to date have been shown to cluster into
these four main haplogroups (A-D) (Schurr et al. 1990; Torroni et al. 1992, 1993a,
1993b, 1994b; Horai et al. 1993; Merriwether et al. 1994; Santos and Barrantes
1994; Bailliet et al. 1994; Santos et al. 1994; Bianchi et al. 1995; Merriwether and
Ferrell 1996; Lorenz and Smith 1996; Bonatto and Salzano 1997). Despite the
dramatic reduction in size of the Amerindian populations after the European con-
quest and colonization of the Americas, the mtDNA lineages found in present-day
Native American populations are thought to represent the ancestral lineages. An-
cient skeletal remains predating the arrival of Columbus have shown that the four
A-D Amerindian lineages accounted for most of the mtDNA diversity (Stone and
Stoneking 1993, 1998; Monsalve et al 1996; Parr et al. 1996). In these remains, as
well as in few extant populations, a fifth lineage, called X, was found at low fre-
quencies (Torroni et al. 1993a; Bailliet et al. 1994; Forster et al. 1996; Stone and
Stoneking 1998). These results suggest that the initial colonization of America
comprised no more than four main and one minor mtDNA haplogroups (Torroni
et al. 1993a; Stone and Stoneking 1993, 1998; Forster et al. 1996).
Colombia forms the northwestern corner of South America and is the first
territory after the constriction of Central America at the Panama isthmus, making
 Colombian Amerindian mtDNA and Migration Routes / 213

it a probable gateway to South America. According to currently accepted theories

(Turner 1983; Greenberg et al. 1986), paleoindians migrating towards the south
of the continent probably crossed the Darien forest that divides Colombia and
Panama to reach the Andes Mountains, the plains, and the Amazon Forest. Little
is known about this process, and about how much the present location of the dif-
ferent groups reflects their initial settlement of the country. However, it is likely
that they occupied their present-day territories when the Spanish conquest began
to threaten their lives and cultural integrity (Friedemann and Arocha 1982). De-
spite the well-documented extermination process that began with the arrival of
Columbus in 1492, Colombia is today one of the richest countries in cultural di-
versity; in a geographical area of 1,200,000km2, 72 languages (Ethnologue 2001)
representing around 80 ethnic groups are still spoken by some 800,000 Amerindi-
ans (Census 1993).
Extensive molecular studies have been undertaken in the last few years in
isolated Amerindian, African American, and Mestizo populations within Colom-
bia. These studies have concentrated on nuclear loci, and found an overall re-
stricted pattern of polymorphism in Amerindians, as opposed to a high diversity
in Afrocolombians (Trachtenberg et al. 1996a, 1996b; Keyeux and Bernal 1996;
Keyeux et al. in preparation; Jaramillo et al. 2001). We report here and in an ac-
companying paper (Rodas et al. 2002) an extensive study of mtDNA lineages in
25 Amerindian groups belonging to 12 different linguistic branches, as well as
five Afrocolombian and one Mestizo population from Colombia (Rodas 1997).
In the present study we analyzed characteristic restriction sites defining the
Amerindian haplogroups A, B, C, D, and X in 681 Amerindian individuals living
in the five main geographic areas of Colombia (the Atlantic and Pacific coasts, the
Andes region, the Amazon basin, and the Lowlands or Llanos Orientales). The
presence of a discontinuous cline in the distribution of the haplogroups in our
populations (present study), separated by the natural barrier of the Andes
cordillera, is interpreted as suggestive of different migration pathways into South
America. This finding, together with the distribution of haplotypes in the other
Amerindian groups so far studied all over the continent, possibly points to two
migrational waves into South America.

Materials and Methods

Amerindian Groups. The Tucano (some 2000 people) live on the border be-
tween Colombia and Brazil, but most of them are concentrated in the towns of
Mitu and San Jose del Guaviare. The Coreguaje (population 2000) live down-
stream of the Orteguaza River in the Caqueta Department. The Siona, today some
300 people, live at the border of the Putumayo River in three small towns where
other Indian groups have settled in recent years. As a result, they have a high de-
gree of admixture with the other groups, particularly Inganos. The languages of
the Tucano, Coreguaje, and Siona belong to the Tucano Oriental (T.) and Tucano
Occidental (C., S.) families.
214 / keyeux et al.

Figure 1. Map of Colombia showing the location of the sampled groups. The Andes Cordillera is
depicted as a gray, three-branched mountain system, with its prolongation into
Venezuela (Cordillera de Mérida). Map locations are: Chimila (1), Coreguaje (2), Curri-
paco (3), Embera (4), Guahibo (5), Guambiano (6), Guane (7), Guayabero (8), Huitoto
(9), Ijka (10), Ingano (11), Kogui (12), Murui-Muinane (13), Nukak (14), Paez (15),
Pasto (16), Piaroa (17), Siona (18), Tucano (19), Tule (20), Waunana (21), Wayuu (22),
Wiwa (23), Yuko (24), Zenu (25).

The Curripaco (population between 5000 and 6000) inhabit the Vaupes and
Guainia Departments, and belong to the Arawakan family on the Puinave linguis-
tic branch. The Wayuu, one of the largest groups in Colombia (population
128,000), also belong to the Arawakan family. They inhabit the Guajira Peninsu-
la, a desert in the north. Two other groups, the Guayabero-Cunimia (population
1000) distributed in 10 tribes along the Guaviare River, and the Guahibo-Sikuani
(population 20,000) occupying a large area in the eastern lowlands (Llanos Ori-
entales) up to the Orinoco River, both belong to the Arawakan linguistic group
(Guahiboan branch).
One of the most extended linguistic families is the Chibcha, which is spoken
by several groups in Central and South America. In Colombia, populations that be-
long to this linguistic family include the Chimila (population 900), who are re-
duced to the Oristunna region in the Magdalena Department (North), and the Wiwa
 Colombian Amerindian mtDNA and Migration Routes / 215

(also called Arsarios or Malayos) (population 4500), Kogui (population 6000), and
Arhuaco-Ijka (population 9400), who inhabit different regions of the Sierra Neva-
da de Santa Marta on the Caribbean coast. The Zenu (population 53,000) live in the
Córdoba and Sucre Departments of the North and the Guane-Butaregua (popula-
tion 2500) in the Santander Department, close to Venezuela. The Tule-Cuna (pop-
ulation 500), inhabit the Chocó Department on the Pacific Coast, and also Panama.
The Guambiano (population 18,000), also called Wampi or Guambia’s peo-
ple (previously classified in the Chibcha linguistic family), the Paez (population
90,000), and the Pasto (population 34,400), organized into 18 different tribes, live
in the Cauca Department, close to Ecuador, and also in many other regions in the
south since a strong earthquake devastated their lands. These groups belong to
the Barbacoan-Paezan linguistic family. The Ingano (population 4000), living in
the Sibundoy valley and the Putumayo River in the south, belong to the Quechua
family, which is dominant in Ecuador.
In Colombia, the Carib speakers include the Yuko-Yukpa (population
2500), established in the Perija Mountains close to Venezuela.
The Waunana (population 2200), scattered in nine separate communities
living in the south of the Chocó Department on the Pacific Coast, and the Embera
(population 42,000), inhabiting mainly the Chocó Department, but also Antioquia
and Risaralda, belong to the Chocoan linguistic family.
In the Amazon region, on the Caqueta River, two groups belong to the
Huitoto linguistic family: the Murui-Muinane (population 200) and the Huitoto
(population 6000), who also inhabit other regions further south in the Amazon.
The Nukak-Maku, one of the last groups of nomad hunter-gatherers who live in
small bands (exact number unknown) of 20 to 30 people, belong to the Maku-
Puinave linguistic branch. Finally, the Piaroa-Whothuha, a community where en-
dogamy is permitted, inhabit the Vichada Department and belong to the Salivan
family (bibliographical references for all the groups cited can be found in: Cul-
turas Indígenas de Colombia 1994; Castro 1996a; Castro 1996b; Chavez 1996;
Mamian-Guzman 1996; Morales 1996; Muriel 1996; Pachon 1996; Ulloa 1996;
Unidad Indígena 1997; Terrenos de la Gran Expedición Humana 1997; Ethno-
logue 2001). A map of Colombia showing the location of the different groups is
shown in Figure 1.

Molecular and Statistical Analyses. Blood samples from 681 unrelated indi-
viduals belonging to the 25 different Amerindian groups outlined above were col-
lected under the auspices of “Expedición Humana,” an interdisciplinary research
program fostered by the Javeriana University. All participants, as well as the com-
munities’ hierarchical leaders, gave their free consent. DNA was extracted from
peripheral blood leukocytes as previously described (Keyeux et al. 1990).
Typically, 100–200 ng of total DNA was amplified by polymerase chain re-
action (PCR) using the mitochondrial primers listed in Table 1. Reactions were
carried out according to the conditions previously described by Stone and Stone-
king (1993), with the following modifications: Buffer B (67 mM TrisCl, 6.7 mM
216 / keyeux et al.

Table 1. Markers, Primer Sequences, and Fragment Sizes of each of the Mutations Ana-
lyzed in the Present Study

PCR Fragment
Markers Primers 5′ → 3′ Sequence (bp) Sizes (bp)
9 bp L8215 ACAGTTTCATGCCCATCGTC 121 121 (–)
H8297 ATGCTAAGTTAGCTTTACAG 112 (+)
HincII-13259 L13232 GCCCTTACACAAAATGACATCAA 211 211 (–)
H13393 TCCTATTTTTCGAATATCTTGTTC 158+53 (+)
HaeIII-663 L611 ACCTCCTCAAAGCAATACACTG 176 176 (–)
H743 GTGCTTGATGCTTGTTCCTTTTG 101+75 (+)
AluI-5176 L5120 TAACTACTACCGCATTCCTA 149 149 (–)
H5230 AAAGCCGGTTAGCGGGGGCA 77+72 (+)
DdeI-10394 L10235 TATTACCTTCTTATTATTTG 334 123+221 (–)
H10569 CTAGGCATAGTAGGGAGGAT 123+38+173 (+)
AluI-10397 L10235 TATTACCTTCTTATTATTTG 334 334 (–)
H10569 CTAGGCATAGTAGGGAGGAT 164+170 (+)
HpaI-3592 Leber 5′ 3238 CCCAAGAACAGGGTTTGTTAAGATG 589 589 (–)
Leber 3′ 3779 ATAAGGGTGGAGAGGTTAAAGGAGC 381+208 (+)
DdeI-1715 A1715 CCAGAGTGTAGCTTAACAC 292 292 (–)
B1715 TTTGGCTCTCCTTGCAAAG 114+178 (+)

MgCl2, 16.6mM (NH4)2SO4, pH = 8.0), 50 pmol of each primer, 100 mM dNTPs,

2.5 U Taq polymerase (Perkin Elmer Corporation) in a final volume of 50 µL. Re-
actions were performed in a Perkin Elmer 480 thermal cycler programmed as fol-
lows: 5 min initial denaturation at 94°C followed by 40 cycles of 45 sec denatu-
ration at 94°C, 45 sec annealing at 50°C, 45 sec elongation at 72°C, with a 7 min
final extension at 72°C. These conditions were constant for the first four markers
defining haplotypes A-D listed in Table 1.
For the next three markers shown in Table 1, amplification conditions were
as follows: Buffer B, 50 pmol primers, 100 mM dNTPs, 2.5 U Taq polymerase in
a final volume of 50 µL. Reaction conditions were as above, with the following
modifications: 35 cycles, annealing at 52°C, 1 min (DdeI/AluI 10394/97), and
55°C, 45 sec (HpaI 3592) (Torroni et al. 1994c; Chen et al. 1995; Rötig, personal
communication).
Amplification conditions for the last marker in Table 1 were as follows:
Buffer B, 20 pmol primers, 100 mM dNTPs, 2.5U Taq polymerase in a final vol-
ume of 30 µL. Reaction conditions were: 5 min initial denaturation at 95°C; 35
cycles of 1 min denaturation at 95°C, 1 min annealing at 54°C, 1 min elongation
at 72°C; 7 min final elongation at 72°C (present study).
Digestion of 25 µL (30 µL for DdeI 1715 marker) of amplification product
was carried out overnight at 37°C using 6 U enzyme (10 U HpaI and DdeI) (Table
1). All restriction products were run on 3% (2% for DdeI 1715 marker) agarose
gels at 120 V. The region V 9-bp repeat was analyzed by electrophoresis through
a 6% polyacrylamide gel in a miniprotean II apparatus (BioRad) (1 hr at 150 V).
 Colombian Amerindian mtDNA and Migration Routes / 217

Gels were stained with ethidium bromide and photographed under UV light. New
mutation products were run on 6% polyacrylamide gels with appropriately sized
ladders in order to establish their length. Haplogroup designation is provided in
Table 2 (Torroni et al. 1992, 1993a, 1993b, 1994c, 1996; Chen et al. 1995; Merri-
wether and Ferrell 1996; Forster et al. 1996).
Diversity for each population was calculated using Tajima’s method (Tajima
1989), h = [1 – ∑ xi2]n/(n –1), where xi is the frequency of each haplogroup found
and n is the population size. We also applied a hierarchical genetic diversity analy-
sis (Nei 1972, 1987), assuming that the mitochondrial DNA molecule behaves as a
single locus with multiple alleles (the haplogroups). This allowed us to calculate
the degree of genetic differentiation between the subpopulations (GST) with respect
to the genetic diversity in the whole population, as GST = HT – HS/HT, where HT is
the genetic diversity in the whole population (in this case the entire Amerindian
population), and HS is the mean genetic diversity in the subpopulations.

Results
In all 25 different Colombian Amerindian populations studied, with the ex-
ception of the Yuko, two to four Amerindian haplogroups are present, but their fre-
quency distribution varies greatly between populations (from 2.4% to 88.6%)

Table 2. Characteristic Mutations Defining the Principal Mitochondrial DNA Hap-

logroups in Human Populations,a and Restriction Sites Present in the Original Cambridge
Reference Sequence (CRS)b

Mitochondrial DNA Markers

HaeIII AluI HincII Region V DdeI DdeI AluI HpaI
Haplogroups np663 np5176 np13259 repeat np1715 np10394 np10397 np3592
CRS – + + 2 + – – –
Amerindian
A + + + 2 + – – –
B – + + 1 + – – –
C – + – 2 + + +/– –
D – – + 2 + + +/– –
X – + + 2 – – – –
X6, X7 – + + 2 + + + –
Caucasian
H,T,U,V,W – + + 2 + – – –
I,J,K – + + 2 + (J,K) + – –
Asian
M – + + 2 + + + –
African
L – + + 2 + + – +
a. Torroni et al. 1992, 1993a, 1993b, 1994c, 1996; Chen et al. 1995; Merriwether and Ferrell 1996;
Forster et al. 1996.
b. Anderson et al. 1981.
218 / keyeux et al.

(Table 3). Based on the frequency of the principal lineage, three groups can be de-
fined: those populations with predominantly A haplotypes (Chimila, Curripaco,
Guayabero, Ijka-Arhuaco, Paez, Pasto, Guahibo-Sikuani, Siona, Tule-Cuna),
those with mostly B haplotypes (Guane-Butaregua, Embera, Waunana, Yuko-Yuk-
pa), and those with mainly C haplotypes (Coreguaje, Guambiano, Ingano, Kogui,
Murui-Muinane, Nukak, Tucano, Wayuu, Wiwa, Zenu). The D haplotype group is
absent from 14 populations and is found in five of our Amerindian groups at low
frequencies (2% to 9%). However, two groups, the Tucano and Huitoto, are excep-
tional in exhibiting high frequencies of this haplogroup (35% and 45%, respec-
tively). When overall haplogroup frequencies are calculated, Colombian
Amerindians show an even distribution of haplotype groups A (31.3%), B (30.5%),
and C (28.5%), and a low frequency of haplogroup D (6.6%) (Table 3).
Some populations have a high haplogroup B frequency, like the Guane-

Table 3. Mitochondrial DNA Haplogroup Frequencies in Colombian Amerindians

Amerindians N Haplo A Haplo B Haplo C Haplo D Haplo Ea Otherb

Chimila 35 0.886 0 0.028 0.057 0.029
Coreguaje 42 0.048 0.214 0.642 0.024 0.072
Curripaco 17 0.53 0.47 0 0 0
Embera (Cauca) 21 0.334 0.478 0.047 0.094 0 0.047
Guahibo-Sikuani 31 0.613 0.032 0.097 0 0.258
Guambiano 23 0.043 0.043 0.784 0.13 0
Guane-Butaregua 33 0.121 0.637 0 0.242 0
Guayabero 30 0.5 0.167 0.133 0 0.2
Huitoto 22 0.273 0.045 0.227 0.455 0
Ijka-Arhuaco 40 0.825 0 0.175 0 0
Ingano 21 0.38 0.095 0.525 0 0
Kogui 30 0.367 0 0.633 0 0
Murui-Muinane 19 0.106 0.21 0.368 0.263 0.053
Nukak 20 0 0.2 0.8 0 0
Paez 31 0.58 0.065 0.355 0 0
Pasto 9 0.667 0.333 0 0 0
Piaroa 18 0.277 0.169 0.277 0.277 0
Siona 12 0.75 0.167 0.083 0 0
Tucano 17 0 0.176 0.47 0.354 0
Tule-Cuna 30 0.5 0.267 0.2 0 0.033
Waunana 30 0 0.633 0.3 0.067 0
Wayuu 20 0.25 0.15 0.6 0 0
Wiwa 8 0.25 0 0.75 0 0
Yuco-Yukpa 88 0 1 0 0 0
Zenu 34 0.147 0.324 0.5 0.029 0
Overall frequency 681 0.313 0.305 0.285 0.066 0.029 0.001
(Number) (213) (208) (194) (45) (20) (1)
a. “Haplo E” refers to non-A-D lineages, based on the absence of one of the characteristic markers for
these founder lineages.
b. “Other” refers to mutations within a haplogroup.
 Colombian Amerindian mtDNA and Migration Routes / 219

Butaregua (63.7%), Waunana (63.3%), and Yuko. In this last group, the presence
of 100% haplotype B is confirmed by triplicating the average sample size: 88 un-
related individuals of a group of 416 Yuko families (Unidad Indígena 1997) are
tested and all found to have haplogroup B.
All the haplotypes that initially failed to match with any of the Amerindian
lineages are pooled under haplotype E (sometimes also called N), as defined by
other authors (Torroni et al. 1993a; Stone and Stoneking 1993, 1998; Bailliet et al.
1994; Santos et al. 1996), indicating the absence of mtDNA mutations characteriz-
ing each of the A-D haplogroups (see Table 2). These samples were subsequently
investigated by further amplification/restriction for the previously described Cau-
casian and African lineages: DdeI(–)/AluI(–) at np 10394/10397 for haplogroups
H, T, U, V, and W in Caucasians (Torroni et al. 1996); DdeI(+)/AluI(–) at the same
sites for the I, J, and K haplogroups in Caucasians or the L haplogroup in Africans
(Torroni et al. 1994c; Chen et al. 1995) and DdeI(+)/AluI(+) for haplogroup M
in Asians (Torroni et al. 1996); HpaI(+) at np 3592 for haplogroup L in Afri-
cans (Chen et al. 1995). We also analyzed the DdeI site loss at np 1715, which, to-
gether with DdeI(–)/AluI(–) at np 10394/10397, defines haplogroup X in Amer-
indians and Caucasians (Torroni et al. 1996; Forster et al. 1996; Brown et al. 1998)
(Table 2).
Haplotype E is found in six populations. In the two populations from the
eastern lowlands, Guayabero and Sikuani, six (20%) and eight (25.8%), respec-
tively, of the individuals tested do not match with any of the A-D founder lineages.
The other groups (Chimila, Coreguaje, Murui-Muinane, Tule-Cuna) have low fre-
quencies of this haplotype, and no particular spatial clustering. The three Coregua-
je, six Guayabero, one Murui-Muinane, and eight Sikuani individuals have the ad-
ditional DdeI(+)/AluI(+)10394/10397 and HpaI(–)3592 markers, indicating that
their haplotypes do not belong to any of the known Caucasian H, I, J, K, T, U, V, W,
or African L lineages, and might thus reflect different Asian haplogroups (Bal-
linger et al. 1992; Kolman et al. 1996) or reverse mutations from the original A-D
lineages. One Tule individual is further typed as DdeI(–)/AluI(–)10394/10397 and
HpaI(–)3592, characteristic of haplogroup H (T,U,V,W) in Caucasians, haplogroup
X in Amerindians, but also of some Asian haplotypes; and one Chimila individual
shows DdeI(+)/AluI(–) 10394/10397 and HpaI(+)3592 markers, which character-
ize African L haplogroups.
All these DNAs were checked for the DdeI site loss at np 1715 and found to
be negative, as expected a priori from the previous DdeI/AluI 10394/10397 typ-
ing (except for the Tule individual).
One individual from the Embera population shows a small deletion be-
tween primers L611 and H743 and no 663 HaeIII restriction site. In the absence
of further information on additional polymorphisms in the D-loop region charac-
teristic of haplogroup D to which he might belong (AluI 5176–, HincII 13259+,
9 bp 2 copies), this individual is not included in this group of haplotypes. The size
of the amplification product (55 bp) was determined by imaging densitometry us-
ing a molecular analyst software system (BioRad GS-700).
220 / keyeux et al.

Genetic diversity between the Amerindian groups, as inferred through the

methods of Tajima (1989) and Nei (1972, 1987), shows a high heterogeneity
(Table 4). The range is broad, from 0 in the Yuko with a single haplogroup, to
0.784855 and 0.778221 in the Piaroa and Murui-Muinane, respectively. Three
categories of diversity could be established, from 0 to 0.30, from 0.30 to 0.50, and
from 0.50 to 0.80. The Chimila, Ijka, and Yuko fall into the first category showing
the lowest diversity. The Guambiano, Kogui, Nukak, Pasto, Siona, and Wiwa be-
long to the second, with medium diversity values, and the remaining 16 popula-
tions have the highest degree of mtDNA diversity, and fall into the last category.

Discussion
We studied 681 individuals, belonging to 25 different Amerindian popula-
tions from Colombia, by amplifying four main polymorphic sites in each sample
in order to define the Amerindian A-D lineages that were previously described
(Schurr et al. 1990; Torroni et al. 1993a, 1993b). This is the highest number of

Table 4. Mitochondrial DNA Haplogroup Mean Diversity Index in Colombian Amer-

indian Populations

Colombian Amerindians Mean Diversity Index

Chimila 0.216310
Coreguaje 0.547000
Curripaco 0.529338
Embera 0.679041
Guahibo 0.565475
Guambiano 0.381325
Guane 0.537308
Guayabero 0.687333
Huitoto 0.696554
Ijka 0.296154
Ingano 0.599498
Kogui 0.480643
Murui-Muinane 0.778221
Nukak 0.336842
Paez 0.551128
Pasto 0.499750
Piaroa 0.784855
Siona 0.439333
Tucano 0.661733
Tule 0.659609
Waunana 0.584211
Wayuu 0.584211
Wiwa 0.428571
Yuco 0.000000
Zenu 0.641440
 Colombian Amerindian mtDNA and Migration Routes / 221

different groups so far studied in a relatively small area of the continent, justified
by the fact that Colombia represents the putative entrance gate for the predecessor
migrations of Paleoindians from North to South America.
Molecular studies undertaken during the last few years on isolated
Amerindian and African American populations from Colombia using nuclear loci
have consistently revealed a highly restricted pattern of polymorphism in the
HLA class II genes (DRB1, DQA1, DQB1, and DPB1), the switch regions from
both immunoglobulin alpha heavy chain genes (IGHA) and the APOE and APOB
genes in Amerindians, as opposed to a high diversity in African Colombians
(Keyeux 1993; Trachtenberg et al. 1996a; 1996b; Keyeux and Bernal 1996;
Jaramillo 1998; Jaramillo et al. 2001; Keyeux et al. in preparation). The present
results show that, in contrast to nuclear loci, the four mitochondrial DNA founder
lineages are more evenly distributed in these Amerindian populations, the excep-
tion being the Yuko. The genetic heterogeneity in Colombian Amerindians is very
high (HT = 0.725, HS = 0.507, and GST = 0.299; χ2 = 925.26, 100 degrees of free-
dom [df ], p < 0.0001), even compared to other Amerindian groups (Ward et al.
1991, 1996; Santos et al 1994; Batista et al. 1995; Kolman et al. 1995). From mi-
tochondrial DNA data, it seems as if most of the Colombian Amerindians had not
suffered bottleneck or founder effects and genetic drift, and, furthermore, might
have maintained their heterogeneity through gene flow from other groups. This
finding is in agreement with data from other populations, like the Cayapa from
Ecuador (Rickards et al. 1999) or the prehistoric Oneota from Illinois (Stone and
Stoneking 1998).
As a general trend, Colombian Chibcha-speaking groups show the lowest
diversity (from 0 to 0.50), whereas the Amazonian and eastern lowland groups
fall into the highest (0.50 to 0.80) diversity category, consistent with previous ob-
servations in other Central and South American populations (Santos et al. 1994;
Torroni et al. 1994b; Batista et al. 1995; Kolman et al. 1995; Santos et al. 1996;
Bonatto and Salzano 1997). There are some groups that do not fit this spatial and
linguistic clustering, which is also consistent with the complex history popula-
tions such as these have experienced, in part explaining the discordance between
the linguistic and genetic data observed in the present study.
The Yuco is the only group, so far, that exhibits a dramatic reduction in di-
versity, not only at the mtDNA level, but, most significantly, also at the nuclear
DNA level (APOE and ACE genes are monomorphic, and APOB shows only 4
out of 26 possible alleles) (Jaramillo 1998; Jaramillo-Correa et al. 2001), as if sin-
gle alleles had been fixed in the population due to a dramatic bottleneck effect
maintained by geographic isolation. The high number of Yuco individuals
screened, which was intentionally increased during the present investigation,
rules out a sample size artifact, as could be argued for the Kuna of Panama from
Rio Azucar Island or some Aymara from Chile, where single mitochondrial DNA
haplogroups have been found (Torroni et al. 1993a, 1994a). Consanguinity, docu-
mented by anthropological studies (Reichel-Dolmatoff 1960), might have exacer-
bated the initial event. This may be a rare documented example that we have in
222 / keyeux et al.

support of the hypothesis of a bottleneck effect on mtDNA variability during the

settlement of the American continent, as suggested by the Wallace group in the
early 1980s (1985).
Instead, several studies have shown that Native American haplogroups can
be further extended to as many as 13 founder haplotypes on the basis of the pres-
ence or absence of additional restriction sites at np 10394/10397 and 16517 (a re-
current transition at 16519, associated with different continental haplotypes
[Chen et al. 1995; Forster et al. 1996; Brown et al. 1998]), or the presence of com-
pound haplotypes (Torroni et al. 1992, 1993a, 1994b; Bailliet et al. 1994; Bianchi
et al. 1995; Merriwether and Ferrell 1996; Easton et al. 1996). D-loop sequencing
in Brazilian natives from the Amazon region and one Ecuadorian group have also
shown a wide range of haplotypes that coalesce in the four A-D groups common
to most Amerindians (Santos et al. 1996), and a previously undetected lineage
(Rickards et al. 1999). These data argue against a bottleneck during the early set-
tlement of the American continent, and for considerable genetic diversity among
the prehistoric immigrants (Santos et al. 1996; Forster et al. 1996; Bonatto and
Salzano 1997; Stone and Stoneking 1998).
Still, some individuals have failed to fall into one of these haplotype groups
(Ward et al. 1991; Torroni et al. 1993a; Stone and Stoneking 1993; Bailliet et al.
1994). D-loop sequence data and extended restriction fragment length polymor-
phism (RFLP) analyses have permitted the reassignment of a lineage to some of
these individuals, adding new arguments in favor of diversity among early settlers
(Merriwether and Ferrell 1996; Forster et al. 1996; Stone and Stoneking 1998).
Due to the limited restriction sites initially surveyed in our study, we adopt-
ed a transient designation (haplo E) for our “other” samples (Table 3). Two
groups, the Sikuani and Guayabero, show up to 26% of haplotype E. The high in-
cidence of this (group of) nonfounder haplotype(s) is rather unusual and might in-
dicate either admixture, reverse mutations eliminating one restriction site, or the
presence of other Amerindian (X, X6, or X7) or Asian lineages. Maternal admix-
ture with non-Amerindians (Europeans or Africans), which is not a common
practice even in contemporary Amerindian groups, is ruled out by extended hap-
lotype analyses of our samples using the 10394/10397 DdeI/AluI + 3592 HpaI
markers defining the main non-Amerindian haplogroups, as listed in Table 2.
Only one exception is found, a Chimila individual who is typed as haplogroup L,
probably resulting from admixture with the closest Afrocolombian neighbors
found throughout the north coast of Colombia (Departments of Sucre, Atlantico,
Bolivar, Magdalena, and Cesar) (Gelvez 1998). These results are in agreement
with those obtained in a comparative study of nuclear short tandem repeats
(STRs), mtDNA, and Y-chromosome markers in a set of Colombian Amerindian
groups, where the contribution of non-Amerindian markers has been shown to be
due essentially to men (Mesa et al. 2000).
The 10394/10397 DdeI+/AluI+ individuals (90% of all the non–A-D lineag-
es) can potentially reflect the presence of haplogroup M, which is the main Asian
haplogroup (Ballinger et al. 1992; Wallace 1995). Recent studies of Oneota re-
 Colombian Amerindian mtDNA and Migration Routes / 223

mains (Stone and Stoneking 1998) showed that another founder lineage, called X,
might in fact have entered the American continent, but seems to have been lost
subsequently in most extant populations due to founder effects or genetic drift
(Bandelt et al. 1995; Forster et al. 1996; Stone and Stoneking 1998). As we have
shown, all our non–A-D haplogroup samples are 1715 DdeI+, which is in keeping
with the studies by others, showing that the X lineage, if present, is indeed con-
fined to North American Amerindian groups (Brown et al. 1998; Malhi et al.
1999; O’Rourke et al. 2000).
Therefore, having ruled out the main African and European lineages, as
well as the X haplogroup and the X6/X7 lineages, which lack additional group-
specific mutation definition, our results point to other more probable explana-
tions. One might be the presence of Asian lineage(s) (Ballinger et al. 1992; Kol-
man et al. 1996) masked by the current amplification/restriction analyses
performed. Another might be haplotype shifting (Koehler et al. 1991; Bianchi et
al. 1995; Bendall et al. 1996; Parsons et al. 1997) due to point mutations arising
in the Amerindian but not the Asian ancestors. In the case of the Guayabero and
Guahibo-Sikuani, these should have arisen early in the diversification process of
these groups in South America, followed by an important population expansion,
in order to reach the high frequencies observed (Fay and Wu 1999).
The low frequencies (0% to 13%) of haplogroup D in 20 of our Amerindian
groups (Tables 3 and 5) are in striking contrast with the frequencies in the rest of
the South American Amerindian populations so far studied, where high inci-
dences (up to 67%) of this haplotype group and an overall frequency of 34.1%,
including Fueguinos and Patagonians, were found (Table 6) (Schurr et al. 1990;
Torroni et al. 1992, 1993a, 1994a; Merriwether et al. 1994; Merriwether and Fer-
rell 1996; Santos and Barrantes 1994; Santos et al. 1994; Bianchi et al. 1995;
Lalueza-Fox et al. 1997). Moreover, its overall frequency in Colombia resembles
the one found in Central or North American Amerindians (3.4% and 6.3%, re-
spectively) (Schurr et al. 1990; Torroni et al. 1992, 1993a, 1994a, 1994b; Stone
and Stoneking 1993; Santos and Barrantes, 1994; Santos et al. 1994; Merriwether
et al. 1994; Merriwether and Ferrell 1996; Lorenz and Smith 1996; O’Rourke et
al. 2000) (Table 6). Interestingly, most of the groups with low haplogroup D fre-
quencies inhabit northern and eastern Colombia, and the only populations with
higher incidences of this haplogroup are Amazonian groups belonging to vast
families of tribes scattered over the Amazon basin (Tucano, Huitoto, Murui-
Muinane, and Piaroa).
Contrasting with this, the distribution of haplogroup A is the opposite, since
at least nine groups of Colombian Amerindians show high frequencies of this lin-
eage (>0.50) (Tables 3 and 5). Again, these results contrast with the frequencies
observed in the rest of the South American groups, where this lineage is rare or
absent and has a mean frequency of 0.076 (Table 6) (Schurr et al. 1990; Torroni et
al. 1992, 1993a, 1994a; Merriwether et al. 1994; Merriwether and Ferrel 1996;
Bianchi et al. 1995; Lalueza-Fox 1996; Lalueza-Fox et al. 1997). On the contrary,
Central American Amerinds also show high incidences in 10 out of 13 popula-
224 / keyeux et al.

Table 5. Haplogroup Distribution in Colombian Amerindians according to the A/D Gradi-

ent (Cline) Observed (Present Paper)

Geographic
Amerindiansa Haplo A Haplo B Haplo C Haplo D Linguistic Family Region
Wayuu 0.25 0.15 0.6 0 Arawakan Caribbean Coast
Curripaco 0.53 0.47 0 0 Arawakan Amazon
Chimila 0.886 0 0.028 0.057 Chibcha Caribbean Coast
Ijka-Arhuaco 0.825 0 0.175 0 Chibcha Caribbean Coast
Kogui 0.367 0 0.633 0 Chibcha Caribbean Coast
Wiwa 0.25 0 0.75 0 Chibcha Caribbean Coast
Tule-Cuna 0.5 0.267 0.2 0 Chibcha Pacific Coast
Paez 0.58 0.065 0.355 0 Barbacoan/Paezan South Andes
Ingano 0.38 0.095 0.525 0 Quechua South Andes
Pasto 0.667 0.333 0 0 Barbacoan/Paezan South Andes
Embera (Cauca) 0.334 0.478 0.047 0.094 Chocoan Pacific Coast
Guahibo-Sikuani 0.613 0.032 0.097 0 Guahiboan/Arawakan Eastern Llanos
Guayabero 0.5 0.167 0.133 0 Guahiboan/Arawakan Eastern Llanos
Siona 0.75 0.167 0.083 0 Tucano Occidental Amazon
Guambiano 0.043 0.043 0.784 0.13 Barbacoan/Paezan South Andes
Zenu 0.147 0.324 0.5 0.029 Chibcha Caribbean Coast
Guane-Butaregua 0.121 0.637 0 0.242 Chibcha North Andes
Huitoto 0.273 0.045 0.227 0.455 Huitoto Amazon
Murui-Muinane 0.106 0.21 0.368 0.263 Huitoto Amazon
Piaroa 0.277 0.169 0.277 0.277 Salivan Amazon
Tucano 0 0.176 0.47 0.354 Tucano Oriental Amazon
Coreguaje 0.048 0.214 0.642 0.024 Tucano Occidental Amazon
Nukak 0 0.2 0.8 0 Maku-Puinave Amazon
Waunana 0 0.633 0.3 0.067 Chocoan Pacific Coast
Yuko-Yukpa 0 1 0 0 Carib North Andes
a. Colombian Amerindians are grouped according to their major mitochondrial affinities into Central
American–like (upper part) and South American–like (lower part), separated by a horizontal rule.

Table 6. Haplogroup Frequencies in Amerindian Populations across Americaa

Region N Haplo A Haplo B Haplo C Haplo D

North Americab 829 0.417 0.302 0.158 0.063
Central Americac 379 0.498 0.295 0.16 0.034
Colombiad 681 0.313 0.305 0.285 0.066
NW Colombiad 335 0.561 0.131 0.244 0.011
SE Colombiad 346 0.072 0.473 0.323 0.118
South Americae 736 0.076 0.347 0.222 0.341
a. Colombian data are split into the two geographic regions described in the text.
b. Torroni et al. 1993a; Stone and Stoneking 1993; Lorenz and Smith 1996.
c. Schurr et al. 1990; Torroni et al. 1993a; Merriwether et al. 1994; Santos and Barrantes 1994; San-
tos et al. 1994.
d. Present study.
e. South American data include Fuego-Patagonia populations. Torroni et al. 1993a; Merriwether et al.
1994; Bianchi et al. 1995; Lalueza-Fox et al. 1997.
 Colombian Amerindian mtDNA and Migration Routes / 225

0.6

0.5

0.4

0.3

0.2

0.1

0
No Ce Co So
rth nt lo ut
ra m hA
Am lA bi m
er m a er
ica er ica
ica

Figure 2. Haplogroup distribution in Amerindians from North, Central, and South America. Fre-
quencies and references are given in Table 6. Colombian Amerindians (present paper)
are grouped together (N = 681)

tions, and a mean frequency of 49.8% (Table 6) (Schurr et al. 1990; Torroni et al.
1992, 1993a; Merriwether et al. 1994; Santos and Barrantes 1994; Santos et al.
1994), suggesting that Colombian Amerindian groups are closer to Central or
most North American Amerindians (Stone and Stoneking 1993; Lorenz and
Smith 1996; O’Rourke et al. 2000) than to South American Amerindians.
A clinal distribution of these two haplogroups across the American conti-
nent, with A decreasing from north to south and D increasing in the same direc-
tion, had already been pointed out by several authors (Torroni et al. 1994a;
Lalueza-Fox 1996; Lalueza-Fox et al 1997; Lorenz and Smith 1996). In this dis-
tribution of both haplogroups, Colombian populations in general fit better with
the Central American Amerinds than with South Americans (Figure 2). However,
on a closer look, the Colombian populations showing high haplogroup A and low
or absent haplogroup D frequencies (AD) appear almost all to inhabit the regions
northwest of the eastern branch of the Andes (the inland, and the Pacific and
Caribbean coasts). Conversely, the few groups exhibiting low haplogroup A plus
high haplogroup D frequencies (AD) (Guane-Butaregua, Huitoto, Murui-
Muinane, Piaroa, and Tucano) and most of the other groups exhibiting low hap-
logroup A frequencies (Table 5) are located at the eastern boundary of the
Cordillera Oriental (eastern) branch of the Colombian Andes and in the Amazon
226 / keyeux et al.

basin (Figure 1, Table 5), sharing this vast region with a great number of other
South American groups so far studied (Torroni et al. 1993a; Bailliet et al. 1994;
Bianchi et al. 1995).
As Table 5 shows, the geographic grouping of genetically related popula-
tions around the Andes Cordillera also roughly aggregates the linguistic branches
spoken by the populations. Most of the AD populations are Chibcha-speaking
groups found on the western side of the Andes, whereas most of the AD (low A
and middle-to-high haplogroup D) groups are populations speaking Amazonian
languages, and are grouped on the eastern side.
Therefore, if one takes into account that the Colombian territory is actually
divided by a high-altitude mountain diagonal, the Cordillera Oriental (mean alti-
tude: 3000 m above sea-level, with high peaks, such as Cocuy at 5493 m above
sea level) running from the southwest to the northeast (into Venezuela under the
name of Cordillera de Mérida) (Figure 1), it appears from the present results that
the Colombian Amerindians might in the same way be broken up into two broad
groups separated by this diagonal: those geographically, linguistically, and genet-
ically close to the Central American groups, and those close to the South Ameri-
can groups (Tables 5 and 6, Figure 3). Moreover, three nuclear loci, APOE,
APOB, and ACE, analyzed in some of the same Colombian Amerindians, show a
similar spatial distribution into two clusters of populations, one on each side of
the Cordillera, with overlapping patterns of clustering of the nuclear and mito-
chondrial genes considered (Jaramillo 1998; Jaramillo et al. 2001).
The present results would then suggest that Amerindians might have differ-
entiated during evolution prior to tribalization into two main groups, those from
Central America and northwestern Colombia, and those from the region to the
east and south of South America (Figure 3). Few North American Amerindian
groups covering all the territory have been studied so far (Torroni et al. 1992,
1993a; Stone and Stoneking 1993, 1998; Lorenz and Smith 1996; O’Rourke et al.
2000), but a similar trend of AD haplotypes is observed (Lalueza-Fox 1996;
Lalueza-Fox et al. 1997; Lorenz and Smith 1996; O’Rourke et al. 2000) (Table 6,
Figure 3).
This general tendency of haplogroup A/D distribution in America could be
explained in terms of random genetic drift, where the loss of haplogroup A would
have been accompanied by a gain of haplogroup D as Paleoindians moved further
south in the process of settling America. This model would foresee a gradual cline
or at least a random distribution of the frequencies of these haplogroups. Howev-
er, instead of this, the present data show an abrupt change of frequencies which
overlaps the presence of a geographic barrier (Figures 1 and 3). Although the
model could still fit particular cases of fluctuations in isolated small groups, ran-
dom genetic drift assumes the absence of selective pressures over any one of the
four haplogroups, as well as small population sizes and early reproductive isola-
tion. Also, the fact that the frequency distribution of the other two haplogroups,
especially C, is quite stable in Amerindians over the whole of America, and
shows similar fluctuations in the populations within each subcontinental region
 Colombian Amerindian mtDNA and Migration Routes / 227

0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
No Ce N- S- So Pa
rth nt W E ut ta
ra Co Co hA go
Am lA l lo m ni
er m om m er a
ica er bi bi ica
ica a a

Figure 3. Regional haplogroup distribution in Colombian Amerindians. South American and

Fuego-Patagonian groups are shown separately (Lalueza-Fox et al. 1997), and Colom-
bian Amerindians are split into two groups, according to Tables 5 and 6.

(with B absent in the groups from both extremities of the continent, but also sta-
ble elsewhere), and the overall genetic diversity is higher than initially expected
in almost all the groups (Lalueza-Fox 1996; present study), argues against this
hypothesis. Instead, a second explanation to the discontinuous gradient of hap-
logroup frequencies, namely a more complex pattern of migrations from Asia
through the American territory, gains strength with the present results. In this
model, Colombia, the northwest corner of South America, would have been set-
tled by at least two waves of immigrants, one keeping close genetic and cultural
relationships with their relatives in Central America, and a second differentiating
into more heterogeneous groups, from the Amazon to the south of the continent.
Many of the native inhabitants of America have been driven out of their
original locations, both in prehistoric times (Meggers 1979; Friedemann and
Arocha 1982) and more recently, pushed by the European colonizers or Mestizo
landowners. However, even in pre-Hispanic times the Andes Mountains may well
have formed a natural barrier, both climatic and geographic, that kept populations
separated from one another. This presumption is supported by historical and ar-
chaeological records acknowledging that Central American and northern and
western Colombian Amerindian populations had extensive contact in the past and
established important cultural relationships (Reichel-Dolmatoff 1965). On the
228 / keyeux et al.

contrary, peoples from the West Indies, the Guayanas, and the Lowlands (Llanos)
were known to meet and trade in the markets along the Orinoco and its tributaries
until late in the Spanish colonial period (Friedemann and Arocha 1982; Morey
1977).

Conclusion
In conclusion, our studies have found a discontinuous gradient of mito-
chondrial haplogroups at the limit of a natural barrier, the Andes Cordillera. The
exact meaning of this finding is as yet unknown, but points to an evolutionary or
migrational pattern in the northern part of the continent that is distinct from that
in the southern. Since a clear picture of how South America was colonized by Pa-
leoindians migrating from North America has not yet emerged, our results raise a
new working hypothesis for the understanding of the peopling of this part of the
continent. There may have been two distinct migrational waves of ancestors that
expanded through South America by means of two different routes, one being a
coastal Pacific dispersion footpath, relating the Chibchas from Central America to
those from Colombia, and the other being a lowland-Amazonian trail relating the
majority of populations of the regions eastwards from the Andes Cordillera in
South America. Later transcordilleran contacts might well have also occurred oc-
casionally, concomitant in some cases with adoption of other cultures and lan-
guages. Such contact might thus explain the findings for a few groups, where geo-
graphic location, linguistic branch, and A/D haplogroup cluster belonging are not
completely concordant, a condition that is not uncommon in Amerindians
(Rickards et al. 1999). Analyses of genetic distance of the four A-D haplogroups
(Rodas 1997; Ruiz-García et al., in preparation) show that the Guahibo,
Guayabero, Curripaco, and Siona cluster together on the dendrograms with other
northwestern populations, whereas the Zenú form a cluster with populations like
the Coreguaje, Nukak, and Guambiano, thus overlapping the present analysis and
interpretation, and probably indicating that the present-day homeland and cultur-
al traits of these groups might be of more recent acquisition.
Wallace’s group had suggested a two-wave model for the settling move-
ment from Asia to America, and other groups had postulated different scenarios,
based on their results from mtDNA and nuclear gene analyses (Szathmary 1993;
Merriwether et al. 1994; Bonatto and Salzano 1997; Stone and Stoneking 1998).
Missing data on Colombian Amerindians has not helped in solving this contro-
versial point. Therefore, the present results should be of significance in helping to
answer this question (which has also raised debates among linguists [Nettle 1999]
and archaeologists [for review, see Crawford 1998; Dillehay 2000]), in that the
northwest corner of South America (present Colombian territory) should be re-
garded as more than one entrance gate to the hemisphere. Whether this reflects
two different groups of founder populations is also a matter for further analysis,
in which recent archaeological and anthropological evidence should be taken into
account (Roosevelt et al. 1996; Dillehay 1997, 2000; Daniel Lévine, personal
communication).
 Colombian Amerindian mtDNA and Migration Routes / 229

Acknowledgments The authors are greatly indebted to Drs. Mark Stoneking and
Thomas White, who supported this study by providing the primers and donating the Taq
polymerase. Dr. Agnes Rötig is also kindly acknowledged for providing the Leber primers.
The present study was carried out at the Unidad de Genética Molecular of the Instituto de
Genética Humana and presented by Clemencia Rodas for her M.Sc. degree (1997) at the
Javeriana University. We thank Dr. Jaime Bernal V. for comments on a previous version of
this manuscript and Dr. Manuel Ruiz-García for statistical analysis. We are also very grate-
ful to the peoples of Colombia who voluntarily contributed to these insights into human
history, and to the late Professor Nina S. de Friedemann for her helpful and critical anthro-
pological discussions and contributions. We are greatly indebted to Professor Daniel
Lévine, former head of the Americas’ Department at the Musée de l’Homme in Paris, for
his comments on our results and input of recent archaeological evidence to the peopling of
America, and to Drs. Thomas White and Michael Crawford for reading and commenting
on the present manuscript. The reviewers of a previous version, whose remarks signifi-
cantly improved the present paper, are kindly acknowledged.

Received 11 July 2001; revision received 28 November 2001.

Literature Cited

Anderson, S., A.T. Bankier, B.G. Barrell et al. 1981. Sequence and organization of the human mito-
chondrial genome. Nature 290:457–465.
Bailliet, G., F. Rothhammer, F.R. Carnese et al. 1994. Founder mitochondrial haplotypes in Amerindi-
an populations. Am. J. Hum. Genet. 54:27–33.
Ballinger, S.W., T.G. Schurr, A. Torroni et al. 1992. Southeast Asian mitochondrial DNA analysis re-
veals genetic continuity of ancient Mongoloid migrations. Genetics 130:139–152.
Bandelt, H.J., P. Forster, B.S. Sykes et al. 1995. Mitochondrial portraits of human populations using
median networks. Genetics 141:743–753.
Batista, O., C.J. Kolman, and E. Bermingham. 1995. Mitochondrial DNA diversity in the Kuna
Amerinds of Panama. Hum. Mol. Genet. 4:921–929.
Bendall, K.E., V.A. Macaulay, J.R. Baker et al. 1996. Heteroplasmic point mutations in the human
mtDNA control region. Am. J. Hum. Genet. 59:1276–1287.
Bianchi, N., G. Baillet, and C. Bravi. 1995. Peopling of the Americas as inferred through the analysis
of mtDNA. Braz. J. Genet. 18:661–668.
Bonatto, S., and F.M. Salzano. 1997. A single and early migration for the peopling of the Americas
supported by mitochondrial DNA sequence data. Proc. Natl. Acad. Sci. USA 94:1866–1871.
Brown, E.M., M. George, and A.C. Wilson. 1979. Rapid evolution of animal mitochondrial DNA.
Proc. Natl. Acad. Sci. USA 76:1967–1971.
Brown, M.D, S.H. Hosseini, A. Torroni et al. 1998. Mitochondrial DNA haplogroup X: An ancient
link between Europe/Western Asia and North America? Am. J. Hum. Genet. 63:1852–1861.
Castro, L.M. 1996a. Curripacos. In Geografía Humana de Colombia, Tomo III, Vol. 1. Instituto
Colombiano de Cultura Hispánica.
Castro, L.M. 1996b. Piaroa-Whothuha. In Geografía Humana de Colombia, Tomo III, Vol. 1. Institu-
to Colombiano de Cultura Hispánica.
Census 1993. Departamento Administrativo Nacional de Estadística DANE. http://www.dane.gov.
co/Informacion_Estadistica/Estadisticas/Poblacion/Censos_Demograficos/etnico1.xls
Chaves, A. 1996. Grupo Indígena Waunana. In Geografía Humana de Colombia, Tomo IX. Instituto
Colombiano de Cultura Hispánica.
230 / keyeux et al.

Chen, Y.S., A. Torroni, L. Excoffier et al. 1995. Analysis of mitochondrial variation in African popu-
lations reveals the most ancient of all human continent-specific haplogroups. Am. J. Hum.
Genet. 57:133–149.
Crawford, M. 1998. The Origins of Native Americans: Evidence from Anthropological Genetics.
Cambridge, U.K.: Cambridge University Press.
Culturas Indígenas de Colombia. Texto Educativo 1994. Asociación Instituto Linguístico de Verano,
Bogotá, Colombia: Editorial Buena Semilla.
Dillehay, T.D. 1997. Monte Verde: A Late Pleistocene Settlement in Chile. Vol. 2: The Archeological
Context. Washington D.C.: Smithsonian Institution Press.
Dillehay, T.D. 2000. The Settlement of the Americas. A New Prehistory. New York, N.Y.: Basic Books.
Easton, R.D., D.A. Merriwether, D.E. Crews et al. 1996. Mitochondrial DNA variation in the Yano-
mami: Evidence for additional new world founding lineages. Am. J. Hum. Genet. 59:213–225.
Ethnologue. 2001. Languages of the World. 14th ed. Electronic version. http://www.ethnologue.com/
show_country.asp?name=Colombia
Fay, J.C., and C.-I. Wu. 1999. A human population bottleneck can account for the discordance be-
tween patterns of mitochondrial versus nuclear DNA variation. Mol. Biol. Evol. 16:1003–
1005.
Forster, P., R. Harding, A. Torroni et al. 1996. Origin and evolution of Native American mtDNA vari-
ation: A reappraisal. Am. J. Hum. Genet. 59:935–945.
Friedemann, N.S., and J. Arocha. 1982. Del Jaguar y la Anaconda. In Herederos del Jaguar y la Ana-
conda. Bogotá, Colombia: Carlos Valencia Editores, 23–78.
Gelvez, N. 1998. Identificación de la rata de mutación en el DNA mitocondrial a través del estudio de
regiones polimórficas en familias multigeneracionales. B.Sc. dissertation, Instituto de Genéti-
ca Humana, Universidad Javeriana, Bogotá, Colombia.
Giles, R.E., H. Blanc, H.M. Cann et al. 1980. Maternal inheritance of human mitochondrial DNA.
Proc. Natl. Acad. Sci. USA 77:6715–6719.
Greenberg, J.H., C.G. Turner II, and S.L. Zegura. 1986. The settlement of the Americas: A comparison
of linguistic, dental and genetic evidence. Curr. Anthropol. 27:477–497.
Horai, S., R. Kondo, Y. Nakagawa-Hattori et al. 1993. Peopling of the Americas, founded by four ma-
jor lineages of mitochondrial DNA. Mol. Biol. Evol. 10:23–47.
Jaramillo, J.P. 1998. Estudio poblacional de los genes APOE, APOB y ACE en comunidades negras e
indígenas de Colombia. B.Sc. dissertation, Instituto de Genética Humana, Universidad Javeri-
ana and Universidad de los Andes, Bogotá, Colombia.
Jaramillo-Correa, J.P., G. Keyeux, M. Ruiz-García et al. 2001. Population study of the genes APOE,
APOB 3′ (VNTR) and ACE in some Black and Amerindian communities from Colombia.
Hum. Hered. 52:14–33.
Keyeux, G. 1993. Poblaciones negras de Colombia: Una primera aproximación a su estructura molec-
ular. America Negra 5:21–33.
Keyeux, G., and J.E. Bernal. 1996. New allele variants of the immunoglobulin switch (Sα) regions.
Hum. Genet. 97:695–696.
Keyeux, G., M.P. Lefranc, A. Chevailler et al. 1990. Molecular analysis of the IGHA and MHC class
III region genes in one family with IgA and C4 deficiencies. Exp. Clin. Immunogenet. 7:170–
180.
Koehler, C., G.L. Lindberg, D. Brown et al. 1991. Replacement of bovine mitochondrial DNA by a se-
quence variant within one generation. Genetics 129:247–255.
Kolman, C.J., E. Bermingham, R. Cooke Ward et al. 1995. Reduced mtDNA diversity in the Ngobe
Amerinds of Panama. Genetics 140:275–283.
Kolman, C.J., N. Sambuughin, and E. Bermingham. 1996. Mitochondrial DNA analysis of Mongolian
populations and implications for the origin of New World founders. Genetics 142:1321–1334.
Lalueza-Fox, C. 1996. Mitochondrial DNA haplogroups in four tribes from Tierra del Fuego-Patago-
nia: Inferences about the peopling of the Americas. Hum. Biol. 6:855–871.
Lalueza-Fox, C., A. Perez, E. Prats et al. 1997. Lack of founding Amerindian mitochondrial DNA lin-
eages in extinct Aborigines from Tierra del Fuego-Patagonia. Hum. Mol. Genet. 1:41–46.
 Colombian Amerindian mtDNA and Migration Routes / 231

Lorenz, J.G., and D.G. Smith. 1996. Distribution of four founding mtDNA haplogroups among native
North Americans. Am. J. Phys. Anthropol. 101:307–323.
Malhi, R.S., B.A. Schultz, J.A. Eshleman et al. 1999. Latitudinal trends among native North American
groups: Examination of mitochondrial DNA diversity. Am. J. Hum. Genet. 65 (Supplement):
A389.
Mamián-Guzmán, D. 1996. Los Pastos. In Geografía Humana de Colombia, Tomo IV, Vol. 1. Institu-
to Colombiano de Cultura Hispánica.
Meggers, B. 1979. Climatic oscillation as a factor in the prehistory of Amazonia. American Antiquity
44:252–266.
Merriwether, D.A., and R.E. Ferrell. 1996. The four founding lineage hypothesis for the New World:
A critical reevaluation. Mol. Phylogen. Evol. 5:241–246.
Merriwether, D.A., F. Rothhammer, and R.E. Ferrell. 1994. Genetic variation in the New World: An-
cient teeth, bone, and tissue as sources of DNA. Experientia 50:592–601.
Mesa, N.R., M.C. Mondragón, I.D. Soto et al. 2000. Autosomal, mtDNA, and Y-chromosome diversi-
ty in Amerinds: Pre- and post-Columbian patterns of gene flow in South America. Am. J. Hum.
Genet. 67:1277–1286.
Monsalve, M.V., F. Cárdenas, F. Guhl et al. 1996. Phylogenetic analysis of mtDNA lineages in South
American mummies. Ann. Hum. Genet. 60:293–303.
Morales, J. 1996. Los Indios Cuna. In Geografía Humana de Colombia, Tomo IX. Instituto Colom-
biano de Cultura Hispánica.
Morey, N. 1977. The effects of the Carib slaving in the Llanos of Colombia and Venezuela. Annual
Meeting of the American Society of Ethnohistory, Chicago, IL.
Muriel, A. 1996. Grupo Indígena Guayabero-Cunimia. In Geografía Humana de Colombia, Tomo III.
Vol. 1. Instituto Colombiano de Cultura Hispánica.
Nei, M. 1972. Genetic distance between populations. Amer. Nature 106:283–292.
Nei, M. 1987. Molecular Evolutionary Genetics. New York, NY: Columbia University Press.
Nettle, D. 1999. Linguistic diversity of the Americas can be reconciled with a recent colonization.
Proc. Natl. Acad. Sci. USA 96:3325–3329.
O’Rourke, D.H., M.G. Hayes, S.W. Carlyle. 2000. Spatial and temporal stability of mtDNA hap-
logroup frequencies in native North America. Hum. Biol. 72:15–34.
Pachón, X. 1996. Los Nasa o la gente Paez. In Geografía Humana de Colombia, Tomo IV. Vol. 2. In-
stituto Colombiano de Cultura Hispánica.
Parr, R.L., S.W. Carlyle, and D.H. O’Rourke. 1996. Ancient DNA analysis of Fremont Amerindians of
the Great Salt Lake Wetlands. Am. J. Phys. Anthropol. 99:507–518.
Parsons, T., D. Muniec, K. Sullivan et al. 1997. A high observed substitution rate in the human mito-
chondrial DNA control region. Nature Genetics 15:363–368.
Passarino, G., O. Semino, G. Modiano et al. 1993. COII/tRNA Lys intergenic 9-bp deletion and other
mtDNA markers clearly reveal that the Tharus (Southern Nepal) have oriental affinities. Am. J.
Hum. Genet. 53:609–618.
Reichel-Dolmatoff, G. 1960. Contribuciones al conocimiento de las tribus de la region del Perija. Re-
vista Colombiana de Antropologia 9:161–193.
Reichel-Dolmatoff, G. 1965. Colombia: Ancient Peoples and Places. London, UK: Thames and Hud-
son.
Rickards, O., C. Martinez-Labarga, J.K. Lum et al. 1999. Mitochondrial DNA history of the Cayapa
Amerinds of Ecuador: Detection of additional founding lineages for the Native American pop-
ulation. Am. J. Hum. Genet. 65:519–530.
Rodas, M.C. 1997. Análisis genético molecular de los haplogrupos fundadores del DNA mitocondrial
en América, en poblaciones colombianas. M.Sc. dissertation, Instituto de Genética Humana,
Universidad Javeriana, Bogotá, Colombia.
Rodas, M.C., G. Keyeux, and N. Gelvez. 2002. Amerindian admixture in Afrocolombian and Mestizo
populations as inferred from mitochondrial DNA haplogroup studies. Hum. Biol. (submitted).
Roosevelt, A.C., M. Lima da Costa, C. Lopes Machado et al. 1996. Paleoindian cave dwellers in the
Amazon: The peopling of the Americas. Science 272:373–384.
232 / keyeux et al.

Santos, M., and R. Barrantes. 1994. D-loop mtDNA deletion as a unique marker of Chibchan Amer-
indians. Am. J. Hum. Genet. 55:413–414.
Santos, M., R.H. Ward, and R. Barrantes. 1994. Mitochondrial DNA variation in the Chibcha
Amerindian Huetar from Costa Rica. Hum. Biol. 66:963–977.
Santos, S.E.B., A. Ribeiro-Dos-Santos, and D. Meyer. 1996. Multiple founder haplotypes of mito-
chondrial DNA in Amerindians revealed by RFLP and sequencing. Ann. Hum. Genet. 60:305–
319.
Schurr, T.G., S.W. Ballinger, Y.Y. Gan et al. 1990. Amerindian mitochondrial DNAs have rare Asian
mutations at high frequencies, suggesting they derived from four primary maternal lineages.
Am. J. Hum. Genet. 46:613–623.
Stone, A.C., and M. Stoneking. 1993. Ancient DNA from a pre-Columbian Amerindian population.
Am. J. Phys. Anthropol. 92:463–471.
Stone, A., and M. Stoneking. 1998. Mitochondrial DNA analysis of a prehistoric Oneota population:
Implications for the peopling of the New World. Am. J. Hum. Genet. 62:1153–1170.
Szathmary, E. 1993. Mitochondrial DNA and the peopling of the Americas. Am. J. Hum. Genet.
53:793–799.
Tajima, F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymor-
phism. Genetics 123:585–595.
Terrenos de la Gran Expedición Humana. 1997. Aspectos demográficos de las poblaciones indígenas,
negras y aisladas visitadas por la Gran Expedición Humana, No. 6. J. Bernal V., ed. Universi-
dad Javeriana.
Torroni, A., T.G. Schurr, C.C. Yang et al. 1992. Native American mitochondrial DNA analysis indi-
cates that the Amerind and the Nadene populations were founded by two independent migra-
tions. Genetics 130:153–162.
Torroni, A., T.G. Schurr, M.F. Cabell et al. 1993a. Asian affinities and continental radiation of the four
founding Native American mtDNAs. Am. J. Hum. Genet. 54:563–590.
Torroni, A., R.I. Sukernik, T.G. Schurr et al. 1993b. Mitochondrial DNA variation of aboriginal Si-
berians reveals distinct genetic affinities with Native Americans. Am. J. Hum. Genet. 53:591–
608.
Torroni, A., Y.S. Chen, O. Semino et al. 1994a. Mitochondrial DNA and Y-chromosome polymor-
phisms in four Native American populations from southern Mexico. Am. J. Hum. Genet.
54:303–318.
Torroni, A., J.V. Neel, R. Barrantes et al. 1994b. A mitochondrial DNA “clock” for the Amerinds and
its implication for timing their entry into North America. Proc. Natl. Acad. Sci. USA 91:1158–
1162.
Torroni, A., M.T. Lott, M.F. Cabell et al. 1994c. Mitochondrial DNA and the origin of Caucasians:
Identification of ancient Caucasian-specific haplogroups, one of which is prone to a recurrent
somatic duplication in the D-loop region. Am. J. Hum. Genet. 55:760–776.
Torroni, A., K. Huoponen, P. Francalacci et al. 1996. Classification of European mtDNAs from an
analysis of three European populations. Genetics 144:1835–1850.
Trachtenberg, E.A., G. Keyeux, J.E. Bernal et al. 1996a. Analysis of HLA class II (DRB1-DQA1-
DQB2-DPB1) alleles and DR-DQ haplotypes in nine Amerindian tribes from Colombia. Re-
sults of Expedición Humana. Part I. Tissue Antigens 48:174–181.
Trachtenberg, E.A., G. Keyeux, J.E. Bernal et al. 1996b. Analysis of HLA class II alleles in three Af-
rican American populations from Colombia using PCR/SSOP: Identification of a novel
DQB1*0.2 (*0203) allele. Results of Expedición Humana. Part II. Tissue Antigens 48:192–
198.
Turner, C. 1983. The Dental Search for Native American Origins, Out of Asia. Canberra, Australia:
Australian National University, 31–78.
Ulloa, E. 1996. Grupo Indígena Los Emberá. In Geografía Humana de Colombia, Tomo IX. Instituto
Colombiano de Cultura Hispánica.
Unidad Indígena. 1997. Periódico. Edición 114: Abril.
 Colombian Amerindian mtDNA and Migration Routes / 233

Wallace, D.C. 1995. Mitochondrial DNA variation in human evolution, degenerative disease, and ag-
ing. Am. J. Hum. Genet. 57:201–223.
Wallace, D.C., K. Garrison, and W.C. Knowler. 1985. Dramatic founder effects in Amerindian mito-
chondrial DNAs. Am. J. Phys. Anthropol. 68:149–155.
Ward, R.H., B.L. Frazier, K. Dew-Jager et al. 1991. Extensive mitochondrial diversity within a single
Amerindian tribe. Proc. Natl. Acad. Sci. USA 88:8720–8724.
Ward, R.H., F.M. Salzano, S.L. Bonatio et al. 1996. Mitochondrial DNA polymorphisms in three
Brazilian Indian tribes. Am. J. Hum. Biol. 8:317–32.