Manuscript Details

Manuscript number MOLMET_2019_543

Title Wolfram syndrome 1 gene regulates pathways maintaining beta cell health and
survival

Article type Short Communication

Abstract
Wolfram Syndrome 1 (WFS1) protein is an endoplasmic reticulum (ER) factor whose deficiency results in juvenile-
onset diabetes secondary to cellular dysfunction and apoptosis. The mechanisms guiding beta-cell outcomes
secondary to WFS1 function, however, remain unclear. Here, we show that WFS1 preserves normal beta-cell
physiology by promoting insulin biosynthesis and negatively regulating ER stress. Depletion of Wfs1 in vivo and in vitro
causes functional defects in glucose-stimulated insulin secretion and insulin content, triggering Chop-mediated
apoptotic pathways. Genetic proof of concept studies coupled with RNA-seq reveal that increasing WFS1 confers a
functional and a survival advantage to beta-cells under ER stress by increasing insulin gene expression and
downregulating the Chop-Trib3 axis, thereby activating Akt pathways. Remarkably, WFS1 and INS levels are reduced
in type 2 diabetic (T2DM) islets, suggesting that WFS1 may contribute to T2DM beta-cell pathology. Taken together,
this work reveals essential pathways regulated by WFS1 to control beta-cell survival and function primarily through
preservation of ER homeostasis.

Keywords Wolfram syndrome; beta cells; endoplasmic reticulum

Taxonomy Genetics, Molecular Biology

Corresponding Author Fumihiko Urano

Corresponding Author's Washington University School of Medicine

Institution

Order of Authors Damien Abreu, John Revilla, Rie Asada, Zeno Lavagnino, Kelly Kries, David
Piston, Fumihiko Urano

Suggested reviewers Laura Alonso, Mariana Igoillo Esteve, Abdelfattah El Ouaamari, Ernesto Bernal-
Mizrachi, Siri Atma Greeley, Emily Sims

Submission Files Included in this PDF

File Name [File Type]
Cover_MolecularMetabolism_0626_2019.pdf [Cover Letter]

Highlights_0626_2019.pdf [Highlights]

Abreu_MolecularMetabolism_0626_2019.pdf [Manuscript File]

Conflict of Interest_0626_2019.pdf [Conflict of Interest]

To view all the submission files, including those not included in the PDF, click on the manuscript title on your EVISE
Homepage, then click 'Download zip file'.
John T. Milliken Department of Medicine
Division of Endocrinology, Metabolism, and Lipid Research

Fumihiko Urano, M.D., Ph.D.
Samuel E. Schechter Professor of Medicine

June 26, 2019

Professor. Dr. Stephan Herzig

Editor-in-Chief
Molecular Metabolism

Dear Dr. Herzig,

Please consider the enclosed manuscript entitled “Wolfram syndrome 1 gene regulates
pathways maintaining beta cell health and survival” by Damien Abreu, John M. P. Revilla,
Rie Asada, Zeno Lavagnino, Kelly Kries, David W. Piston, and Fumihiko Urano for
publication in Molecular Metabolism as a Report. The authors declare no competing financial
interests. I certify that all coauthors have seen and agree with the contents of the manuscript
and that the submission is not under review at any other publication.

The endoplasmic reticulum (ER) is best known for its central role in protein folding and
calcium homeostasis. Unsurprisingly, mounting evidence shows that ER dysfunction plays a
critical role in pancreatic beta cell dysfunction and beta cell death in diabetes. The functional
characterization of key molecules promoting beta cell health and survival at the ER is therefore
a promising avenue for identification of novel therapeutic targets for diabetes. Here we
evaluate WFS1, an ER transmembrane protein whose functional defect is associated a genetic
neurodegenerative form of juvenile-onset diabetes termed Wolfram syndrome, in beta cells.
We show that WFS1 lies at the crossroads of ER stress induction and ER stress attenuation,
with the ultimate task of maintaining ER homeostasis, thereby preserving mature beta cell
function/identity and enhancing beta cell survival. Using mouse models of Wolfram syndrome
coupled to cell models of WFS1 loss-of-function and gain-of-function, we identify key
downstream targets of WFS1 action. We further extend our findings to human primary islets
to show that WFS1 is a critical molecule regulating beta cell health and survival in islets,
particularly under stress. Taken together, our data suggest that WFS1 may be an attractive
therapeutic target for improving beta cell health under diabetic disease processes.

Experts in the field who would be appropriate reviewers include: Dr. Laura Alonso at UMass
Medical School (laura.alonso@umassmed.edu), Dr. Ernesto Bernal-Mizrachi at University of
Miami Miller School of Medicine (Ebernalm@med.miami.edu), Dr. Siri Greeley at
University of Chicago (sgreeley@peds.bsd.uchicago.edu), Dr. Mariana Igoillo-Esteve at
Université libre de Bruxelles (migoillo@ulb.ac.be), Emily Sims at Indiana University School
Washington University School of Medicine at Washington University Medical Center, Campus Box 8127,
660 South Euclid Avenue, St. Louis, Missouri 63110-1093, Phone: (314) 362-8683 (Office), (314) 562-2898 (Clinic),
(314) 362-8684 (Lab), Fax: (314) 362-8770
urano@dom.wustl.edu, urano@wustl.edu
of Medicine (eksims@iu.edu) and Dr. Abdelfattah El Ouaamari at Rutgers Robert Wood
Johnson Medical School (abdelfattah.elouaamari@rutgers.edu). I would appreciate if you
could exclude Dr. Anath Shalev at UAB, Dr. Randal Kaufman (Sanford Burnham Prebys),
and Peter Arvan (University of Michigan) as potential reviewers.

We believe that our work will be of considerable interest to scientists in multiple disciplines
including beta cell biology, ER stress, and diabetes, and is thus appropriate for publication in
Molecular Metabolism. Please let me know if you have any questions or need additional
information. I look forward to hearing from you soon.

Sincerely yours,

Fumihiko Urano, MD, PhD

Samuel E. Schechter Professor of Medicine
Professor of Medicine and Pathology and Immunology
Director, Wolfram Syndrome International Registry and Clinical Study
Director, Metabolic Tissue Function Core of Diabetes Research Center
Site Director, Rare and Atypical Diabetes Network (NIH U54)
Division of Endocrinology, Metabolism, & Lipid Research
Washington University School of Medicine
https://wolframsyndrome.dom.wustl.edu/

Washington University School of Medicine at Washington University Medical Center, Campus Box 8127,
660 South Euclid Avenue, St. Louis, Missouri 63110-1093, Phone: (314) 362-8683 (Office), (314) 562-2898 (Clinic),
(314) 362-8684 (Lab), Fax: (314) 362-8770
urano@dom.wustl.edu, urano@wustl.edu
Highlights

• Overexpression of WFS1 protects b cells from ER stress-mediated cell death.

• WFS1 downregulates the Chop-Trib3 pathway, thereby activates Akt pathways.

• WFS1 increases insulin gene expression.

• WFS1 and INS levels are reduced in type 2 diabetic islets.

• Taken together, this work reveals essential pathways regulated by WFS1 to control β-cell

survival and function primarily through preservation of ER homeostasis.

Abreu, D et al.

Wolfram syndrome 1 gene regulates pathways maintaining beta cell health and survival

Damien Abreu1, 2, John M. P. Revilla1, Rie Asada1, 5, Zeno Lavagnino3, 6, Kelly Kries1, David W.
Piston3, and Fumihiko Urano1, 4 ¶

1
Department of Medicine, Division of Endocrinology, Metabolism, and Lipid Research,
Washington University School of Medicine, St. Louis, MO 63110, USA
2
Medical Scientist Training Program, Washington University School of Medicine, St. Louis, MO
63110, U.S.A.
3
Department of Cell Biology and Physiology, Washington University School of Medicine, St.
Louis, MO 63110, USA;
4
Department of Pathology and Immunology, Washington University School of Medicine, St.
Louis, MO 63110, USA.
5
Department of Biochemistry, Institute of Biomedical & Health Science, Hiroshima University,
Hiroshima 734-8553, Japan
6
Experimental Imaging Center DIBIT, IRCCS Ospedale San Raffaele, 20132, Milan, Italy

¶
Corresponding author:
Fumihiko Urano, M.D., Ph.D.
Department of Medicine,
Washington University School of Medicine
Email: urano@wustl.edu

The authors declare no competing financial interests.

1
Abreu, D et al.

SUMMARY

Wolfram Syndrome 1 (WFS1) protein is an endoplasmic reticulum (ER) factor whose deficiency

results in juvenile-onset diabetes secondary to cellular dysfunction and apoptosis. The mechanisms

guiding b-cell outcomes secondary to WFS1 function, however, remain unclear. Here, we show

that WFS1 preserves normal b-cell physiology by promoting insulin biosynthesis and negatively

regulating ER stress. Depletion of Wfs1 in vivo and in vitro causes functional defects in glucose-

stimulated insulin secretion and insulin content, triggering Chop-mediated apoptotic pathways.

Genetic proof of concept studies coupled with RNA-seq reveal that increasing WFS1 confers a

functional and a survival advantage to b-cells under ER stress by increasing insulin gene

expression and downregulating the Chop-Trib3 axis, thereby activating Akt pathways.

Remarkably, WFS1 and INS levels are reduced in type 2 diabetic (T2DM) islets, suggesting that

WFS1 may contribute to T2DM b-cell pathology. Taken together, this work reveals essential

pathways regulated by WFS1 to control β-cell survival and function primarily through preservation

of ER homeostasis.

2
Abreu, D et al.

INTRODUCTION

Diabetes mellitus (DM) encompasses a set of metabolic disorders of glucose homeostasis

characterized by a deficiency in insulin production or secretion. While the etiology of this

deficiency varies by disorder, it inevitably involves pancreatic β-cell dysfunction that usually

culminates in cell death (Cnop et al., 2005; Donath et al., 2005). Accumulating evidence

underscores endoplasmic reticulum (ER) dysfunction as a key factor in diabetic pathophysiology,

particularly in type-2 DM (T2DM), due to the importance of ER homeostasis to insulin production

and secretion (Back and Kaufman, 2012; Harding and Ron, 2002). Still, there remains a gap in our

understanding of the key molecules that mediate ER homeostasis and the mechanisms by which

they preserve b-cell health.

The Wolfram syndrome 1 (WFS1) gene was identified as the major causative locus for Wolfram

syndrome, a rare neurodegenerative disorder characterized by juvenile-onset diabetes mellitus,

optic nerve atrophy, diabetes insipidus, and deafness (Inoue et al., 1998; Urano, 2016). WFS1

encodes an ER transmembrane protein in which common variants are associated with T2DM

susceptibility and over one hundred recessive mutations are linked to the genetic form of diabetes

associated with Wolfram syndrome (Inoue et al., 1998; Sandhu et al., 2007). A recent study also

identified a mutation in WFS1 causative for autosomal dominant diabetes, further implicating

WFS1 in DM pathology (Bonnycastle et al., 2013). Various reports suggest that WFS1 may play

a pivotal role in maintaining ER health through modulation of ER stress and calcium homeostasis

(Fonseca et al., 2005; Fonseca et al., 2010; Lu et al., 2014). Evidently, WFS1 is a vital component

of normal b-cell physiology that when altered causes systemic disruption. Yet, we still do not fully

understand the mechanisms or targets of WFS1 action in b-cells, particularly the downstream

effectors that mediate WFS1’s pro-survival effects.

3
Abreu, D et al.

Here we describe loss-of-function and gain-of-function cell and mouse models of WFS1 that have

enabled us to elucidate molecular pathways regulated by WFS1 in pancreatic b cells. Our results

reveal essential pathways regulated by WFS1 which control β cell survival and function.

Activation of such pathways has therapeutic implications for Wolfram syndrome and, more

broadly, diabetes.

4
Abreu, D et al.

RESULTS

WFS1 is critical maintenance of b-cell mass and b-cell function

Diabetes is a cardinal phenotype of Wolfram syndrome that has been recapitulated in C57BL/6J

mice on a delayed time scale relative to human disease (Ishihara et al., 2004; Riggs et al., 2005).

Recent reports of 129S6 whole body Wfs1 knockout (Wfs1 KO) mice suggest that this strain may

more faithfully model human disease phenotypes (Luuk et al., 2008). To characterize the

progression of diabetic pathology in 129S6 Wfs1 KO mice, we performed a detailed analysis of

glucose tolerance in this model between 4.5- and 16-weeks of age. Wfs1 KO mice developed a

progressive glucose tolerance impairment between 4.5- and 6.5-weeks old that persisted through

16-weeks of age (Figure 1, A-C). During this period, insulin tolerance was not impaired. Instead,

insulin secretion was blunted in Wfs1 KO mice at both 6.5- and 16-weeks of age (Figure 1D). To

determine whether this secretory defect was associated with pancreatic insulin deficiency, we

assessed total pancreatic insulin content in Wfs1 KO mice and littermate controls. At 6.5-weeks

old, the age of onset of glucose intolerance, Wfs1 KO mice had considerably less total pancreatic

insulin content than wildtype (WT) mice (6.23±1.18 µg insulin/ml/mg wet pancreas in Wfs1 KO

compared to 20.53± 1.34 µg insulin/ml/mg wet pancreas in WT) (Figure 1E). A similar disparity

in total pancreatic insulin content was apparent at 16-weeks of age (11.36±1.15 µg insulin/ml/mg

wet pancreas in Wfs1 KO compared to 35.99±4.69 µg insulin/ml/mg wet pancreas in WT). To

further interrogate these insulin deficits in Wfs1 KO mice, we examined pancreatic tissue of 6.5-

and 16-week old mice. WT islets retained their characteristic core insulin staining surrounded by

peripheral glucagon staining at both ages. Wfs1 KO islets, in contrast, displayed a disrupted islet

architecture with central glucagon staining from the onset of glucose intolerance (Figure 1F). This

observation prompted us to quantify the ratio of a-cell area to b-cell area in WT versus KO islets.

5
Abreu, D et al.

As suspected, this ratio was 2-fold higher in KO islets than WT islets at both 6.5- and 16-weeks

of age (Figure 1G). Moreover, the β-cell mass of Wfs1 KO mice at 6.5-weeks of age (0.53±0.07

mg) was considerably lower than that of WT littermate controls (0.96±0.13 mg), as determined by

blinded morphometric analysis (Figure 1H). This difference in β-cell mass between Wfs1 KO

(0.27±0.08mg) and WT mice (0.87±0.28mg) persisted through 16-weeks of age, with Wfs1 KO

mice exhibiting a more precipitous drop in b-cell mass with time. Collectively, these findings

suggest that WFS1 plays a critical role in the maintenance of b-cell mass and b-cell function,

particularly in the context of insulin production and secretion. These data also suggest a potential

role for WFS1 in preserving proper islet composition.

WFS1 promotes b-cell viability and function through suppression of pro-apoptotic pathways

and upregulation of insulin biosynthesis

Given the degree of b-cell dysfunction caused by WFS1 depletion in humans and mice, we

hypothesized that overexpressing WFS1 in b-cells could confer b-cells with a functional and/or

survival benefit, particularly under stress. To test this hypothesis, we established a tet-inducible

system that could express Flag-tagged WFS1 at levels 4-fold higher than endogenous Wfs1 in

INS1 832/13 cells. To agnostically interrogate the gene networks affected by WFS1 in the context

of ER stress, we performed RNA sequencing on INS1 cells overexpressing WFS1 under

tunicamycin or thapsigargin conditions. First, a list of genes differentially expressed between

control and Wfs1-overexpressing cells was generated for each stress condition. These lists were

then compared against each other to identify genes differentially expressed across both stressors

in the context of WFS1 overexpression (Figure 2A). Consistent with our hypothesis, pathways

associated with the negative regulation of apoptosis and the positive regulation of hormone,

6
Abreu, D et al.

peptide and insulin secretion were among the top 25 biological processes most affected by WFS1

overexpression under ER stress (Figure 2, B and C). These results support our in vivo data

suggesting a critical role for WFS1 in preserving b-cell function and survival. Our model was

further reinforced by the presence of Ins1, Ins2 and Nkx6.1 within the list of genes upregulated

under both tunicamycin and thapsigargin-mediated ER stress (Supplementary Table S1). This

subset of genes was particularly prominent to us because of their importance in defining b-cell

maturity. Interestingly, validation by quantitative PCR revealed that Ins1 and Ins2 were

significantly upregulated by WFS1 overexpression in both the presence and absence of ER stress

(Figure 2, D and E). Correspondingly, Nkx2.2, Nkx6.1 and Pdx1 were differentially expressed

under thapsigargin stress in a similar pattern to rat insulin gene expression under WFS1

overexpression (Figure 2, F-H and Supplementary Table 3). These data, coupled to the disrupted

islet architecture and b-cell dysfunction observed in Wfs1 KO mice, suggest a role for WFS1 in

maintaining b-cell function through the preservation of insulin biosynthesis and the positive

regulation of b-cell maturity factors, particularly under ER stress.

WFS1 negatively regulates the Chop-Trib3 axis to promote Akt activation

To parse out the pro-apoptotic pathways suppressed by WFS1 overxpression across tunicamycin

and thapsigargin-mediated ER stress, we examined the genes comprising the GO term for cellular

response to DNA damage stimulus in our RNA seq study. Remarkably, Chop was reduced in

WFS1-overexpressing cells across both ER stress conditions (Supplementary Table 1). Since Chop

is an ER stress inducible molecule downstream of Atf6 and published reports suggest that WFS1

modulates Atf6 degradation, we hypothesized that upregulating WFS1 would downregulate

apoptosis through the suppression of Chop-mediated cell death pathways (Fonseca et al., 2010).

To test this hypothesis, we challenged WFS1-overexpressing and control INS1 cells with

7
Abreu, D et al.

tunicamycin and thapsigargin. Under no stress, WFS1 overexpression alone reduced caspase 3/7

activity by 20% (Figure 3A). Under tunicamycin challenge, WFS1 overexpressing cells exhibited

24% less caspase 3/7 activity than WT cells. Although not statistically significant, WFS1

overexpression also reduced caspase 3/7 activity under thapsigargin-mediated ER stress by 14%.

To determine if WFS1’s protective effect on INS1 cells stemmed in part from targeted

downregulation of Chop, we monitored Chop expression under ER stress. Chop was

downregulated at the transcriptional and the translational level under no treatment and under

tunicamycin-mediated stress (Figure 3, B and D), the two conditions in which WFS1

overexpression reduced apoptosis, as corroborated by caspase 3 cleavage (Figure 3, D and F). To

further assess the effects of WFS1 overexpression on this Chop-mediated pro-apoptotic axis, we

measured expression of Trib3, a pro-apoptotic downstream effector of Chop. As anticipated, Trib3

was significantly downregulated in conditions where Chop was reduced by WFS1 overxpression

(Figure 3C). To determine if WFS1 modulates this pathway under more physiological forms of

ER stress, we examined caspase 3/7 activity and Chop-Trib3 expression under high glucose

(25mM glucose) conditions. As with chemical ER stress, WFS1 overexpression decreased caspase

3/7 activity by 34% under high glucose (Figure 3G). This decrease in pro-apoptotic caspase

activity again corresponded with reduced Chop and Trib3 expression, further supporting a role for

WFS1 in the negative regulation of these molecules (Figure 3, H – L).

Prompted by the anti-apoptotic effects of WFS1 upregulation in b-cells, we explored the role of

WFS1 on b-cell survival pathways. Our data indicate that WFS1 mitigates apoptosis through the

negative regulation of the Chop-Trib3 axis. Since Trib3 is a well-documented negative regulator

of Akt activation, we hypothesized that overexpressing WFS1 in INS1 cells would enhance Akt

phosphorylation (Du et al., 2003). Indeed, Akt phosphorylation increased upon WFS1

8
Abreu, D et al.

overexpression in INS1 cells (Figure 3, M and N), suggesting that WFS1 not only suppresses b-

cell death, but also enhances b-cell survival through Akt activation.

To corroborate our model of WFS1’s role in b-cell viability and function, we evaluated a tet-

inducible Wfs1 knockdown loss-of-function model in INS1 832/13 cells. To determine if this in

vitro system modeled our in vivo observations, we assessed glucose stimulated insulin secretion in

Wfs1-depleted and control cells. Consistent with our Wfs1 KO animal data, Wfs1 knockdown cells

secreted less insulin than control cells (Figure S1A). Insulin content was also reduced in Wfs1-

depleted cells (Figure S1B). Since insulin secretion is triggered by an increase in intracellular

calcium and WFS1 has been implicated in maintaining calcium homeostasis, we assessed the effect

of Wfs1 depletion on glucose-stimulated calcium mobilization (Hara et al., 2014; Ishihara et al.,

2004; Lu et al., 2014; Takei et al., 2006). More specifically, we monitored changes in cytoplasmic

calcium upon exposure to increasing glucose concentrations. Control cells exhibited a step-wise

increase in cytoplasmic calcium in response to rising glucose concentrations. Wfs1-depleted cells

exhibited no response to the same glucose stimuli (Figure S1C). Given the importance of calcium

balance to b-cell function and viability, we also examined the effects of Wfs1 knockdown on ER

stress-mediated cell death. Interestingly, knockdown of Wfs1 alone increased caspase 3/7 activity

5-fold in INS1 cells (Figure S1D). When challenged with tunicamycin and thapsigargin, Wfs1

knockdown cells exhibited 3-fold and 2-fold higher levels of caspase 3/7 activity, respectively,

compared to WT cells under the same conditions. As we hypothesized, both Chop and cleaved

caspase 3 were increased in Wfs1-depleted cells, suggesting a role for Wfs1 in the negative

regulation of Chop-mediated apoptosis (Figure S1, E–G). To assess this pathway in a more

physiologic context, we examined caspase 3/7 activity and Chop expression in Wfs1-knockdown

and control cells under high glucose. As observed under chemical ER stress, high glucose elicited

9
Abreu, D et al.

an increase in caspase 3/7 activity in Wfs1-depleted cells relative to WT cells (Figure S1H).

Moreover, Wfs1 knockdown increased Chop and cleaved caspase 3 expression under high glucose

(Figure S1, I – K). To evaluate the effect of Wfs1-depletion and subsequent Chop induction on

Akt activation, we measured Akt phosphorylation relative to total Akt expression in Wfs1

knockdown cells. In keeping with our hypothesis, Akt phosphorylation was reduced by 30% in

Wfs1 knockdown cells (Figure S1, L and M). Taken together, these data support a model wherein

Chop acts a key mediator of b-cell death in the context of Wfs1 deficiency by simultaneously

suppressing Akt activation and promoting pro-apoptotic pathways. These data thus corroborate the

survival benefits observed with the upregulation of WFS1.

WFS1 and insulin are reduced in T2DM islets

Wfs1 is a critical gene for maintaining b-cell health as evidenced by our loss-of-function and gain-

of-function models. In mice, Wfs1-depletion alters islet architecture and elicits profound insulin

loss in association with b-cell dysfunction. This raised the possibility that Wfs1 might play a role

in more complex metabolic disorders like T2DM. To evaluate the potential contribution of WFS1

to T2DM pathology in islets, we assessed WFS1 expression in T2DM human donor islets relative

to normoglycemic donor islets. Interestingly, islets from T2DM donors had significantly lower

levels of WFS1 and insulin gene expression than islets from normoglycemic donors (Figure 4, A

and B). Conversely, T2DM donor islets had slightly elevated TXNIP levels and a more robust

increase in IL-1b expression than normoglycemic islets (Figure 4, C and D). In the context of our

in vivo and in vitro WFS1 loss of function data, these results from humans islets suggest that WFS1

downregulation may contribute to the b-cell dysfunction and b-cell death associated with T2DM

pathology (Back and Kaufman, 2012; Butler et al., 2003; Evans-Molina et al., 2013; Henquin et

al., 2017).

10
Abreu, D et al.

DISCUSSION

In this study, we demonstrate a role for WFS1 in preserving β-cell function and viability in

physiologic and pathophysiologic states through the positive regulation of insulin biosynthesis and

the negative regulation of ER stress-inducible pro-apoptotic molecules. We identify new targets

of WFS1 action downstream of ATF6 through the negative regulation of the CHOP-TRIB3 axis,

thereby establishing a link between WFS1 and AKT activation. Further, we propose a role for

WFS1 in islets as a molecular determinant of proper b-cell function through the preservation of

islet composition and key b-cell maturity factors.

Consistent with previous reports of diabetic pathology in C57BL/6J Wfs1 KO mice, we observed

a progressive decline in glucose tolerance with concurrent b-cell loss and pancreatic insulin

insufficiency in 129S6 Wfs1 KO mice. Unexpectedly, however, our data showed that Wfs1 KO in

the 129S6 strain led to an earlier onset of diabetic pathology (at 6.5-weeks) than previously

reported in whole body (at 17-weeks) and conditional (at 12-weeks) C57BL/6J KO models, or

even in previous reports of this Wfs1 KO model (Ishihara et al., 2004; Ivask et al., 2016; Noormets

et al., 2011; Riggs et al., 2005). This suggests a potential role for genetic background in mediating

disease severity in the context of WFS1 depletion that may resonate with the clinical variability

observed in patients (Chaussenot et al., 2011; Cryns et al., 2003; de Heredia et al., 2013). Notably,

our study narrows the window of pathological progression in 129S6 Wfs1 KO mice to the 2-week

period preceding 6.5-weeks of age, providing a discrete window for future studies to evaluate the

events precipitating b-cell decline.

11
Abreu, D et al.

The aberrant islet architecture we observed at 6.5-weeks in 129S6 Wfs1 KO mice parallels

published C57BL/6J data from 36-week old whole body Wfs1 KO mice and 24-week old b-cell-

specific Wfs1 KO mice, as well as 24-week old mixed strain [(129S6xB6)xB6]F2 whole body

Wfs1 KO mice (Ishihara et al., 2004; Riggs et al., 2005). Counter to the hyperglycemia reported in

C57BL/6J Wfs1 KO models at those ages, however, 129S6 Wfs1 KO mice are normoglycemic at

6.5-weeks old. This suggests a potential role for WFS1 in maintaining proper islet composition

independent of the b-cell loss expected from chronic hyperglycemia. Perhaps WFS1 loss-of-

function not only increases b-cell death, but also affects b-cell maturity by causing downregulation

of key b-cell identity markers, leading to the anomalous a-cell/b-cell ratios we observed in Wfs1

KO islets. Further studies aimed at ascertaining WFS1’s role in maintaining b-cell maturity are

warranted.

While insulin production is critical for maintaining glucose homeostasis, insulin biosynthesis is

also a major source of b-cell ER stress (Fonseca et al., 2011; Scheuner and Kaufman, 2008). It is

likely for this reason that insulin gene expression is strongly downregulated under ER stress

(Lipson et al., 2006; Seo et al., 2008). Our data supports this phenomenon, as genetic depletion of

Wfs1 not only reduced insulin content in b-cells, but also induced b-cell death, especially under

chemical or glucotoxic ER stress. However, our data also showed that WFS1 overexpression

increased insulin gene expression, even under different forms of ER stress. Taken together, these

data posit a model where WFS1 hosts dual and opposing roles in mitigating ER stress while also

promoting insulin synthesis. This may, in part, be due to WFS1’s role in the negative regulation

of key unfolded protein response (UPR) factors such as ATF6, which when overactive dampen

insulin expression (Fonseca et al., 2010; Seo et al., 2008). Still, WFS1 likely has an independent

12
Abreu, D et al.

role in promoting insulin biosynthesis under homeostatic conditions given the apparent increase

in insulin gene expression under conditions devoid of ER stress. This independent pathway may

well depend on WFS1’s positive regulation of b-cell maturity factors, such as Pdx1, Nkx2.2 and

Nkx6.1, which also promote insulin production (Cissell et al., 2003; Gutierrez et al., 2017; Le Lay

and Stein, 2006; Schaffer et al., 2013). Indeed, this may also help explain the consistent disruption

in islet architecture observed across Wfs1 KO mouse models that requires further address in the

literature.

Recent reports have described the complex relationship between ER stress, glucose homeostasis

and b-cell mass (Porat et al., 2011; Sharma et al., 2015; Song et al., 2008; Szabat et al., 2016).

One study proposed that a mild ER load promotes an adaptive response via UPR signaling,

primarily through ATF6, that results in b-cell proliferation (Sharma et al., 2015). Another study

proposed that decreasing insulin production decreases ER stress, thus promoting b-cell

proliferation through AKT activation (Szabat et al., 2016). In our model, WFS1 relieves ER stress

and also burdens the ER with increased insulin bioynthesis. We therefore propose a model where

WFS1 acts as fulcrum in b-cells between the dichotomous reality of insulin production and ER

stress management to maintain a crucial cell population for organismal glucose homeostasis.

Under physiologic conditions, WFS1 promotes insulin biosynthesis to meet glucose demand, but

also modulates pro-apoptotic branches of the ER stress response to sustain an adaptive outcome

through AKT activation. Under pathologic conditions, as in the case of WFS1 mutation or

depletion, the absence of WFS1 leads to unregulated ER stress that culminates in b-cell death at

least in part due to repression of AKT survival pathways. In this manner, WFS1 may lie at the

intersection of the observations made by aforementioned reports, by serving as a molecular arbiter

13
Abreu, D et al.

of b-cell survival that negotiates the outcome of increasing insulin demand in the face of UPR

signaling.

ER stress is a potent contributor to b-cell pathology in T2DM, while Wolfram syndrome is

arguably a prototype of ER stress disease (Eizirik and Cnop, 2010; Laybutt et al., 2007; Marchetti

et al., 2007; Urano, 2014). Moreover, T2DM is associated with b-cell death and dysfunction

similar to our models of WFS1-depletion (Papa, 2012). Accordingly, we questioned whether WFS1

played a role in the complex milieu of T2DM pathology. Intriguingly, we found WFS1 and insulin

gene expression decreased in T2DM donor islets. These findings are consistent with our in vivo

and in vitro knockout and knockdown studies of WFS1, suggesting that perhaps the

downregulation of WFS1 may be contributing to the b-cell pathology of T2DM. Considering

reports of WFS1 variants that confer risk of T2DM, it is possible that these variants affect WFS1

mRNA or protein stability (Sandhu et al., 2007; Stitzel et al., 2010). In light of our findings

regarding the effects of WFS1 expression on b-cell viability and function, further studies should

examine the effects of T2DM-associated WFS1 variants on the pathways highlighted by our

studies.

This study provides novel insights into the cellular function of WFS1 in b-cells through the

identification of key downstream effectors under physiologic and pathologic states. Our findings

demonstrate the importance of WFS1 as a negative regulator of ER stress, but, more importantly,

highlight a previously unreported role for WFS1 in promoting insulin biosynthesis and b-cell

health through downregulation of the CHOP-TRIB3 axis and activation of AKT survival

pathways. The striking effect of Wfs1-depletion on islet composition coupled to the upregulation

14
Abreu, D et al.

of key markers of b-cell maturity by WFS1 overexpression suggests a role for WFS1 in maintaining

b-cell mass through an intricate balance of insulin production and ER stress management. Given

the positive effects of WFS1 upregulation on overall b-cell health, particularly in the context of

metabolic stress, our findings provide motivation for novel therapeutic strategies targeting WFS1

for stabilization or upregulation as a treatment for diabetic disorders.

15
Abreu, D et al.

Acknowledgments

We thank the Genome Technology Access Center in the Department of Genetics at Washington

University School of Medicine for help with genomic analysis. The Center is partially supported

by NCI Cancer Center Support Grant P30CA91842 to the Siteman Cancer Center and

by ICTS/CTSA Grant UL1TR000448 from the National Center for Research Resources (NCRR),

a component of the National Institutes of Health (NIH), and NIH Roadmap for Medical Research.

This publication is solely the responsibility of the authors and does not necessarily represent the

official view of NCRR or NIH. The authors would like to acknowledge Cris Brown, Akari

Takesato, and Lucas Peng for their technical assistance.

Author contributions

D.A. directed the conception and design of the study, the data analysis and interpretation, the

collection and assembly of data, and the writing of the manuscript. J.M.P.R., R.A., K.K., Z.L.,

and D.W.P. contributed to data collection and analysis. F.U. directed funding acquisition, study

conception and design, directed the writing of the manuscript and gave final approval of the

manuscript. D.A. and F.U. wrote the manuscript. F.U. is the guarantor of this work and, as such,

had full access to all the data in the study and takes responsibility for the integrity of the data and

the accuracy of the data analysis.

Declaration of Interests

No potential conflicts of interest relevant to this article were reported.

Funding

16
Abreu, D et al.

This work was partly supported by the grants from the National Institutes of Health/NIDDK

(DK112921, DK020579) and National Institutes of Health/NCATS (TR002065) and philanthropic

supports from the Unravel Wolfram Syndrome Funds, the Silberman Funds, the Stowe Funds, the

Ellie White Foundation for Rare Genetic Disorders, the Eye Hope Foundation, and the Snow

Foundation to F. Urano. D. Abreu was supported by the NIH training grant (F30DK111070).

17
Abreu, D et al.

REFERENCES
Back, S.H., and Kaufman, R.J. (2012). Endoplasmic reticulum stress and type 2 diabetes. Annual
review of biochemistry 81, 767-793.

Bonnycastle, L.L., Chines, P.S., Hara, T., Huyghe, J.R., Swift, A.J., Heikinheimo, P.,
Mahadevan, J., Peltonen, S., Huopio, H., Nuutila, P., et al. (2013). Autosomal dominant diabetes
arising from a Wolfram syndrome 1 mutation. Diabetes 62, 3943-3950.

Butler, A.E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R.A., and Butler, P.C. (2003). Beta-
cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-
110.

Chaussenot, A., Bannwarth, S., Rouzier, C., Vialettes, B., Mkadem, S.A., Chabrol, B., Cano, A.,
Labauge, P., and Paquis-Flucklinger, V. (2011). Neurologic features and genotype-phenotype
correlation in Wolfram syndrome. Annals of neurology 69, 501-508.

Cissell, M.A., Zhao, L., Sussel, L., Henderson, E., and Stein, R. (2003). Transcription factor
occupancy of the insulin gene in vivo. Evidence for direct regulation by Nkx2.2. The Journal of
biological chemistry 278, 751-756.

Clark, A.L., Kanekura, K., Lavagnino, Z., Spears, L.D., Abreu, D., Mahadevan, J., Yagi, T.,
Semenkovich, C.F., Piston, D.W., and Urano, F. (2017). Targeting Cellular Calcium
Homeostasis to Prevent Cytokine-Mediated Beta Cell Death. Scientific reports 7, 5611.

Cnop, M., Welsh, N., Jonas, J.C., Jorns, A., Lenzen, S., and Eizirik, D.L. (2005). Mechanisms of
pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities.
Diabetes 54 Suppl 2, S97-107.

Cryns, K., Sivakumaran, T.A., Van den Ouweland, J.M., Pennings, R.J., Cremers, C.W.,
Flothmann, K., Young, T.L., Smith, R.J., Lesperance, M.M., and Van Camp, G. (2003).
Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing
impairment, diabetes mellitus, and psychiatric disease. Human mutation 22, 275-287.

de Heredia, M.L., Cleries, R., and Nunes, V. (2013). Genotypic classification of patients with
Wolfram syndrome: insights into the natural history of the disease and correlation with
phenotype. Genetics in medicine : official journal of the American College of Medical Genetics
15, 497-506.

Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson,
M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics
(Oxford, England) 29, 15-21.

Donath, M.Y., Ehses, J.A., Maedler, K., Schumann, D.M., Ellingsgaard, H., Eppler, E., and
Reinecke, M. (2005). Mechanisms of beta-cell death in type 2 diabetes. Diabetes 54 Suppl 2,
S108-113.

Du, K., Herzig, S., Kulkarni, R.N., and Montminy, M. (2003). TRB3: a tribbles homolog that
inhibits Akt/PKB activation by insulin in liver. Science (New York, NY) 300, 1574-1577.

18
Abreu, D et al.

Eizirik, D.L., and Cnop, M. (2010). ER stress in pancreatic beta cells: the thin red line between
adaptation and failure. Science signaling 3, pe7.

Evans-Molina, C., Hatanaka, M., and Mirmira, R.G. (2013). Lost in translation: endoplasmic
reticulum stress and the decline of beta-cell health in diabetes mellitus. Diabetes, obesity &
metabolism 15 Suppl 3, 159-169.

Fonseca, S.G., Fukuma, M., Lipson, K.L., Nguyen, L.X., Allen, J.R., Oka, Y., and Urano, F.
(2005). WFS1 is a novel component of the unfolded protein response and maintains homeostasis
of the endoplasmic reticulum in pancreatic beta-cells. The Journal of biological chemistry 280,
39609-39615.

Fonseca, S.G., Gromada, J., and Urano, F. (2011). Endoplasmic reticulum stress and pancreatic
beta-cell death. Trends in endocrinology and metabolism: TEM 22, 266-274.

Fonseca, S.G., Ishigaki, S., Oslowski, C.M., Lu, S., Lipson, K.L., Ghosh, R., Hayashi, E.,
Ishihara, H., Oka, Y., Permutt, M.A., et al. (2010). Wolfram syndrome 1 gene negatively
regulates ER stress signaling in rodent and human cells. The Journal of clinical investigation
120, 744-755.

Gutierrez, G.D., Bender, A.S., Cirulli, V., Mastracci, T.L., Kelly, S.M., Tsirigos, A., Kaestner,
K.H., and Sussel, L. (2017). Pancreatic beta cell identity requires continual repression of non-
beta cell programs. The Journal of clinical investigation 127, 244-259.

Hara, T., Mahadevan, J., Kanekura, K., Hara, M., Lu, S., and Urano, F. (2014). Calcium efflux
from the endoplasmic reticulum leads to beta-cell death. Endocrinology 155, 758-768.

Harding, H.P., and Ron, D. (2002). Endoplasmic reticulum stress and the development of
diabetes: a review. Diabetes 51 Suppl 3, S455-461.

Henquin, J.C., Ibrahim, M.M., and Rahier, J. (2017). Insulin, glucagon and somatostatin stores in
the pancreas of subjects with type-2 diabetes and their lean and obese non-diabetic controls.
Scientific reports 7, 11015.

Hohmeier, H.E., Mulder, H., Chen, G., Henkel-Rieger, R., Prentki, M., and Newgard, C.B.
(2000). Isolation of INS-1-derived cell lines with robust ATP-sensitive K+ channel-dependent
and -independent glucose-stimulated insulin secretion. Diabetes 49, 424-430.

Inoue, H., Tanizawa, Y., Wasson, J., Behn, P., Kalidas, K., Bernal-Mizrachi, E., Mueckler, M.,
Marshall, H., Donis-Keller, H., Crock, P., et al. (1998). A gene encoding a transmembrane
protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome).
Nature genetics 20, 143-148.

Ishihara, H., Takeda, S., Tamura, A., Takahashi, R., Yamaguchi, S., Takei, D., Yamada, T.,
Inoue, H., Soga, H., Katagiri, H., et al. (2004). Disruption of the WFS1 gene in mice causes
progressive beta-cell loss and impaired stimulus-secretion coupling in insulin secretion. Human
molecular genetics 13, 1159-1170.

19
Abreu, D et al.

Ivask, M., Hugill, A., and Koks, S. (2016). RNA-sequencing of WFS1-deficient pancreatic islets.
Physiological reports 4.

Laybutt, D.R., Preston, A.M., Akerfeldt, M.C., Kench, J.G., Busch, A.K., Biankin, A.V., and
Biden, T.J. (2007). Endoplasmic reticulum stress contributes to beta cell apoptosis in type 2
diabetes. Diabetologia 50, 752-763.

Le Lay, J., and Stein, R. (2006). Involvement of PDX-1 in activation of human insulin gene
transcription. The Journal of endocrinology 188, 287-294.

Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program
for assigning sequence reads to genomic features. Bioinformatics (Oxford, England) 30, 923-
930.

Lipson, K.L., Fonseca, S.G., Ishigaki, S., Nguyen, L.X., Foss, E., Bortell, R., Rossini, A.A., and
Urano, F. (2006). Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic
reticulum-resident protein kinase IRE1. Cell metabolism 4, 245-254.

Liu, R., Holik, A.Z., Su, S., Jansz, N., Chen, K., Leong, H.S., Blewitt, M.E., Asselin-Labat,
M.L., Smyth, G.K., and Ritchie, M.E. (2015). Why weight? Modelling sample and observational
level variability improves power in RNA-seq analyses. Nucleic acids research 43, e97.

Lu, S., Kanekura, K., Hara, T., Mahadevan, J., Spears, L.D., Oslowski, C.M., Martinez, R.,
Yamazaki-Inoue, M., Toyoda, M., Neilson, A., et al. (2014). A calcium-dependent protease as a
potential therapeutic target for Wolfram syndrome. Proceedings of the National Academy of
Sciences of the United States of America 111, E5292-5301.

Luo, W., Friedman, M.S., Shedden, K., Hankenson, K.D., and Woolf, P.J. (2009). GAGE:
generally applicable gene set enrichment for pathway analysis. BMC bioinformatics 10, 161.

Luuk, H., Koks, S., Plaas, M., Hannibal, J., Rehfeld, J.F., and Vasar, E. (2008). Distribution of
Wfs1 protein in the central nervous system of the mouse and its relation to clinical symptoms of
the Wolfram syndrome. The Journal of comparative neurology 509, 642-660.

Marchetti, P., Bugliani, M., Lupi, R., Marselli, L., Masini, M., Boggi, U., Filipponi, F., Weir,
G.C., Eizirik, D.L., and Cnop, M. (2007). The endoplasmic reticulum in pancreatic beta cells of
type 2 diabetes patients. Diabetologia 50, 2486-2494.

Noormets, K., Koks, S., Muldmaa, M., Mauring, L., Vasar, E., and Tillmann, V. (2011). Sex
differences in the development of diabetes in mice with deleted wolframin (Wfs1) gene.
Experimental and clinical endocrinology & diabetes : official journal, German Society of
Endocrinology [and] German Diabetes Association 119, 271-275.

Papa, F.R. (2012). Endoplasmic reticulum stress, pancreatic beta-cell degeneration, and diabetes.
Cold Spring Harbor perspectives in medicine 2, a007666.

Patro, R., Duggal, G., Love, M.I., Irizarry, R.A., and Kingsford, C. (2017). Salmon provides fast
and bias-aware quantification of transcript expression. Nature methods 14, 417-419.

20
Abreu, D et al.

Porat, S., Weinberg-Corem, N., Tornovsky-Babaey, S., Schyr-Ben-Haroush, R., Hija, A.,
Stolovich-Rain, M., Dadon, D., Granot, Z., Ben-Hur, V., White, P., et al. (2011). Control of
pancreatic beta cell regeneration by glucose metabolism. Cell metabolism 13, 440-449.

Riggs, A.C., Bernal-Mizrachi, E., Ohsugi, M., Wasson, J., Fatrai, S., Welling, C., Murray, J.,
Schmidt, R.E., Herrera, P.L., and Permutt, M.A. (2005). Mice conditionally lacking the Wolfram
gene in pancreatic islet beta cells exhibit diabetes as a result of enhanced endoplasmic reticulum
stress and apoptosis. Diabetologia 48, 2313-2321.

Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K. (2015). limma
powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic
acids research 43, e47.

Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics (Oxford,
England) 26, 139-140.

Sandhu, M.S., Weedon, M.N., Fawcett, K.A., Wasson, J., Debenham, S.L., Daly, A., Lango, H.,
Frayling, T.M., Neumann, R.J., Sherva, R., et al. (2007). Common variants in WFS1 confer risk
of type 2 diabetes. Nature genetics 39, 951-953.

Schaffer, A.E., Taylor, B.L., Benthuysen, J.R., Liu, J., Thorel, F., Yuan, W., Jiao, Y., Kaestner,
K.H., Herrera, P.L., Magnuson, M.A., et al. (2013). Nkx6.1 controls a gene regulatory network
required for establishing and maintaining pancreatic Beta cell identity. PLoS genetics 9,
e1003274.

Scheuner, D., and Kaufman, R.J. (2008). The unfolded protein response: a pathway that links
insulin demand with beta-cell failure and diabetes. Endocrine reviews 29, 317-333.

Seo, H.Y., Kim, Y.D., Lee, K.M., Min, A.K., Kim, M.K., Kim, H.S., Won, K.C., Park, J.Y., Lee,
K.U., Choi, H.S., et al. (2008). Endoplasmic reticulum stress-induced activation of activating
transcription factor 6 decreases insulin gene expression via up-regulation of orphan nuclear
receptor small heterodimer partner. Endocrinology 149, 3832-3841.

Sharma, R.B., O'Donnell, A.C., Stamateris, R.E., Ha, B., McCloskey, K.M., Reynolds, P.R.,
Arvan, P., and Alonso, L.C. (2015). Insulin demand regulates beta cell number via the unfolded
protein response. The Journal of clinical investigation 125, 3831-3846.

Song, B., Scheuner, D., Ron, D., Pennathur, S., and Kaufman, R.J. (2008). Chop deletion reduces
oxidative stress, improves beta cell function, and promotes cell survival in multiple mouse
models of diabetes. The Journal of clinical investigation 118, 3378-3389.

Stitzel, M.L., Sethupathy, P., Pearson, D.S., Chines, P.S., Song, L., Erdos, M.R., Welch, R.,
Parker, S.C., Boyle, A.P., Scott, L.J., et al. (2010). Global epigenomic analysis of primary
human pancreatic islets provides insights into type 2 diabetes susceptibility loci. Cell metabolism
12, 443-455.

21
Abreu, D et al.

Szabat, M., Page, M.M., Panzhinskiy, E., Skovso, S., Mojibian, M., Fernandez-Tajes, J., Bruin,
J.E., Bround, M.J., Lee, J.T., Xu, E.E., et al. (2016). Reduced Insulin Production Relieves
Endoplasmic Reticulum Stress and Induces beta Cell Proliferation. Cell metabolism 23, 179-193.

Takei, D., Ishihara, H., Yamaguchi, S., Yamada, T., Tamura, A., Katagiri, H., Maruyama, Y.,
and Oka, Y. (2006). WFS1 protein modulates the free Ca(2+) concentration in the endoplasmic
reticulum. FEBS letters 580, 5635-5640.

Urano, F. (2014). Wolfram syndrome iPS cells: the first human cell model of endoplasmic
reticulum disease. Diabetes 63, 844-846.

Urano, F. (2016). Wolfram Syndrome: Diagnosis, Management, and Treatment. Current diabetes
reports 16, 6.

Wang, L., Wang, S., and Li, W. (2012). RSeQC: quality control of RNA-seq experiments.
Bioinformatics (Oxford, England) 28, 2184-2185.

Wang, Z., York, N.W., Nichols, C.G., and Remedi, M.S. (2014). Pancreatic beta cell
dedifferentiation in diabetes and redifferentiation following insulin therapy. Cell metabolism 19,
872-882.

22
Abreu, D et al.

STAR METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
polyclonal rabbit anti-Wfs1 Proteintech Cat# 11558-1-AP, RRID:AB_2216046
monoclonal rabbit anti-DYKDDDDK tag Cell Signaling Cat# 14793, RRID:AB_2572291
monoclonal mouse anti-Chop Cell Signaling Cat# 2895, RRID:AB_2089254
monoclonal rabbit anti-cleaved caspase 3 Cell Signaling Cat# 9661, RRID:AB_2341188
rabbit anti-Akt Cell Signaling Cat# 9272, RRID:AB_329827
rabbit anti-phospho-Akt (Ser473) Cell Signaling Cat# 9271, RRID:AB_329825
monoclonal rabbit anti-Tubulin Cell Signaling Cat# 2128, RRID:AB_823664
Virus Strains
pLenti1-GFP Fonseca et al., N/A
2010
pLenti1-WT-WFS1 Fonseca et al., N/A
2010
Biological Samples
Human Donor Islets Prodo N/A
Laboratories
Chemicals, Peptides, and Recombinant Proteins
Tunicamycin Sigma Cat #: T7765
Thapsigargin Sigma Cat #: T9033
Critical Commercial Assays
Caspase-Glo® 3/7 Assay System Promega Cat #: G8090
Thermo Fisher
Fluo4-AM Cat #: F14201
Scientific
High-Capacity cDNA Reverse Transcription Thermo Fisher Cat #: 4368814
Kit Scientific
Thermo Fisher
Powerup TM SYBR TM Green Cat #25742
Scientific
Experimental Models: Cell Lines
Fonseca et al.,
INS1_Tet-WFS1 N/A
2010
Fonseca et al.,
INS1_Tet-shWfs1 N/A
2010
Hohmeier, et al.,
INS1 832/13 N/A
2010
Oligonucleotides
Integrated DNA
Hs_WFS1_qPCR_F AAGGGGATTTCCATGTCTCC
Technologies
Integrated DNA
Hs_WFS1_qPCR_R CCTGGTGTTAGAGACGCAGC
Technologies
Integrated DNA
Hs_B-actin_qPCR_F CACCAACTGGGACGACAT
Technologies
Integrated DNA
Hs_B-actin_qPCR_R ACAGCCTGGATAGCAACG
Technologies
Integrated DNA
Hs_TXNIP_qPCR_F CAGCCAACAGGTGAGAATGA
Technologies

23
Abreu, D et al.

Integrated DNA
Hs_TXNIP_qPCR_R TTGAAGGATGTTCCCAGAGG
Technologies
Integrated DNA
Hs_IL-1beta_qPCR_F CTCGCCAGTGAAATGATGGCT
Technologies
Integrated DNA
Hs_IL-1beta_qPCR_R GTCGGAGATTCGTAGCTGGAT
Technologies
Integrated DNA
Rn_Wfs1_qPCR_F CATCACCAAGGACATCGTCCT
Technologies
Integrated DNA
Rn_Wfs1_qPCR_R AGCACGTCCTTGAACTCGCT
Technologies
Integrated DNA
Rn_Chop_qPCR_F AGAGTGGTCAGTGCGCAGC
Technologies
Integrated DNA
Rn_Chop_qPCR_R CTCATTCTCCTGCTCCTTCTCC
Technologies
Integrated DNA
Rn_Trib3_qPCR_F TCATCTTGCGCGACCTCA
Technologies
Integrated DNA
Rn_Trib3_qPCR_R GTCCAGTCATCACACAGGCATC
Technologies
Integrated DNA
Rn_Ins1_qPCR_F GTCCTCTGGGAGCCCAAG
Technologies
Integrated DNA
Rn_Ins1_qPCR_R ACAGAGCCTCCACCAGG
Technologies
Integrated DNA
Rn_Ins2_qPCR_F ATCCTCTGGGAGCCCCGC
Technologies
Integrated DNA
Rn_Ins2_qPCR_R AGAGAGCTTCCACCAAG
Technologies
Integrated DNA
Rn_Pdx1_qPCR_F GAACCGGAGGAGAATAAGAGG
Technologies
Integrated DNA
Rn_Pdx1_qPCR_R AGTCAAGTTGAGCATCACTGC
Technologies
Integrated DNA
Rn_Nkx2.2_qPCR_F ATACTCCCTGCACGGACTG
Technologies
Integrated DNA
Rn_Nkx2.2_qPCR_R CCTTGTCATTGTCCGGTGAC
Technologies
Integrated DNA
Rn_Nkx6.1_qPCR_F CAGGTCAAGGTCTGGTTCCA
Technologies
Integrated DNA
Rn_Nkx6.1_qPCR_R TCAGTCTCCGAGTCCTGCT
Technologies
Software and Algorithms
ImageJ Schneider et al., https://imagej.nih.gov/ij/
2012
PRISM 8 GraphPad https://www.graphpad.com/scientific-
Software software/prism/
STAR version 2.0.4b Dobin et al., N/A
2013
Subread:featureCount version 1.4.5 Liao et al., 2014 N/A
Sailfish version 0.6.13 Patro et al., N/A
2017
RSeQC version 2.3 Wang et al., N/A
2012
R/Bioconductor package EdgeR Robinson et al., N/A
2010
R/Bioconductor package Limma Ritchie et al., N/A
2015
voomWithQualityWeights Liu et al., 2015 N/A

24
Abreu, D et al.

R/Bioconductor package GAGE Luo et al., 2009 N/A

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be

fulfilled by the Lead Contact, Fumihiko Urano (urano@wustl.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Reagents

Tunicamycin and thapsigargin were obtained from Sigma and used at the specified concentrations

indicated in figure legends. b-mercaptoethanol for cell culture media was obtained from Sigma.

Human islets

De-identified normal and type-2 diabetic donor human islets were obtained from Prodo

Laboratories. Informed consent was obtained from all subjects. Experiments were approved by

Washington University’s Human Research Protection Office and conducted in accordance with

the National Institutes of Health guidelines. All human islets used in this study were cultured in

CMRL medium supplemented with FBS and penicillin/streptomycin to recover overnight prior to

experiments. Further information regarding islet donors can be found in Supplementary Table S4.

Mice, in vivo physiology and pancreatic insulin content

129S6 whole body Wfs1-knockout mice were a kind gift from Dr. Sulev Kõks (Luuk et al., 2008).

All animal experiments were performed according to procedures approved by the Institutional

Animal Care and Use Committee at the Washington University School of Medicine. In vivo

glucose tolerance tests and insulin tolerance tests were performed according to the standard

procedures of the NIH-sponsored National Mouse Metabolic Phenotyping Centers

25
Abreu, D et al.

(http://www.mmpc.org). Blood glucose was measured by glucometer (Arkray). Total pancreatic

insulin was extracted from minced pancreata in ice-cold acid ethanol incubated at −20°C for 72h.

Pancreatic and serum insulin content was measured by rat/mouse insulin ELISA kit (EMD

Millipore).

b-cell morphometry

Pancreata from WT and Wfs1 KO mice were weighed, then fixed in zinc-formaldehyde and

paraffin-embedded for sectioning. Morphometric analysis of pancreata from these mice was

preformed as previously reported (Wang et al., 2014). Cross-sectional areas calculated using

ImageJ. The β cell mass for each specimen was quantified by multiplying the fraction of the cross-

sectional area of pancreatic tissue positive for insulin staining by the pancreatic weight. All

staining and subsequent morphometric analyses were conducted by an operator blinded to the

genotypes of the specimens.

Cell lines and insulin secretion assays

Tet-inducible INS1 832/13 cell lines were cultured using published media formulations with

tetracycline-free fetal bovine serum (Clontech) (Hohmeier et al., 2000). To generate β-cells with

tet-inducible knockdown of endogenous Wfs1, INS-1 832/13 pTetR Tet-On were transduced with

lentivirus expressing shRNA directed against rat Wfs1. To generate β-cells with tet-inducible

overexpression of WFS1, INS-1 832/13 pTetR Tet-On were transduced with lentivirus expressing

FLAG-tagged human WFS1. For knockdown and overexpression experiments, cells were cultured

in 2 µg/ml doxycycline for 48 hours prior to any experimental manipulation. For rescue

experiments, cells were transfected per manufacter’s instructions using the 4D-Nucleofector

26
Abreu, D et al.

system (Lonza) or transduced with lentivirus expressing WT WFS1. Glucose-stimulated insulin

secretion assays were performed as previously described (Clark et al., 2017).

RNA Sequencing and Analysis

Samples were prepared according to library kit manufacturer’s protocol, indexed, pooled, and

sequenced on an Illumina HiSeq. Basecalls and demultiplexing were performed with Illumina’s

bcl2fastq software and a custom python demultiplexing program with a maximum of one mismatch

in the indexing read. RNA-seq reads were aligned to the Ensembl release 76 top-level assembly

with STAR version 2.0.4b (Dobin et al., 2013). Gene counts were derived from the number of

uniquely aligned unambiguous reads by Subread:featureCount version 1.4.5 (Liao et al., 2014).

Isoform expression of known Ensembl transcripts were estimated with Sailfish version 0.6.13

(Patro et al., 2017). Sequencing performance was assessed for total number of aligned reads, total

number of uniquely aligned reads, and features detected. The ribosomal fraction, known junction

saturation, and read distribution over known gene models were quantified with RSeQC version 2.3

(Wang et al., 2012).

All gene counts were imported into the R/Bioconductor package EdgeR and TMM normalization

size factors were calculated to adjust for samples for differences in library size (Robinson et al.,

2010). Ribosomal genes and genes not expressed in the smallest group size minus one sample

greater than one count-per-million were excluded from further analysis. The TMM size factors

and matrix of counts were imported into the R/Bioconductor package Limma (Ritchie et al., 2015).

Weighted likelihoods based on the observed mean-variance relationship of every gene and sample

were calculated for all samples with the voomWithQualityWeights (Liu et al., 2015). The

performance of all genes was assessed with plots of residual standard deviation of every gene to

27
Abreu, D et al.

their average log-count with a robustly fitted trend line of the residuals. Differential expression

analysis was performed to analyze for differences between conditions and results were filtered for

only those genes with Benjamini-Hochberg false-discovery rate adjusted p-values less than or

equal to 0.05.

For each contrast extracted with Limma, global perturbations in known Gene Ontology (GO) terms

were detected using R/Bioconductor package GAGE to test for changes in expression of the

reported log 2 fold-changes reported by Limma in each term versus the background log 2 fold-

changes of all genes found outside the respective term (Luo et al., 2009). Differentially expressed

genes in thapsigargin and tunicamycin stress conditions are listed in Supplementary Tables 3 and

4.

Intracellular cytosolic calcium

Confocal microscopy was performed on a Zeiss LSM 880 using a C-Apochromat 40x Water NA

1.2 objective lens. The cell permeable calcium sensor Fluo-4 AM (Invitrogen) was added to cells

at a concentration of 4 µM in 1 ml of RPMI for 15–20 minutes. Cells were washed to remove

excess Fluo-4AM prior to imaging. Experiments were performed in 37 °C KRBH with increasing

glucose doses (0mM, 2.8mM and 16.7mM). The incubator stage provided the physiological

conditions of 37 °C and 5% CO2. Images were acquired as a time series of 2 minutes for each

condition before and after the addition of increasing glucose doses. Because Fluo-4 AM is a single-

wavelength calcium sensor, the data shown are related to the variation of fluorescence intensity of

the stimulated cells (ΔF) relative to the basal condition (F0). The signal from at least 20 cells was

averaged for each condition to avoid differences due to different Fluo-4 concentrations in the cells.

Photostability experiments were performed prior to each imaging session to confirm best

28
Abreu, D et al.

acquisition conditions with minimal photobleaching. All data analysis and image processing were

carried out with ImageJ.

Real-time polymerase chain reaction

Total RNA was isolated using RNeasy Kits (Qiagen) and cDNA libraries were generated using

high-capacity cDNA reverse transcription kits (Applied Biosystem). Relative amounts of each

transcript were calculated by the ∆∆Ct method and normalized to either 18S rRNA expression for

INS1 cells or to human b-actin for human islets. Quantitative PCR was performed with Applied

Biosystems ViiA7 using SYBR green dye. Primers used for qPCR are listed in Key Resources

Table.

Immunoblot analysis

Cells were lysed in Mammalian Protein Extraction Reagent (Thermo Scientific) with 1X Protease

Complete (Sigma) and 1X PhosSTOP (Sigma) protein lysates were immunoblotted with antibodies

listed in Key Resources Table. Images were digitally captured using a Bio-Rad ChemiDoc MP and

analyzed with ImageJ.

Measurement of apoptosis

Caspase 3/7 activity was monitored using the Caspase-Glo® 3/7 Assay kit (Promega) and

luminescence was measured using an Infinite M1000 plate reader (Tecan). Data was analyzed

relative to untreated control cells.

Statistical analysis

29
Abreu, D et al.

Statistical significance was calculated by two-tailed unpaired Student’s T-test, with a p-value less

than 0.05 considered significant. All values are shown as means ± SEM.

30
Abreu, D et al.

FIGURE LEGENDS

Figure 1. Glucose tolerance and b-cell morphometry in whole body WFS1 –/– 129S6 mice.

Intraperitoneal glucose tolerance test of: (A) WFS1 KO (n=12) and WT control (n=6) mice at 4.5

weeks old, (B) WFS1 KO (n=21) and WT control (n = 19) mice at 6.5-weeks old and (C) WFS1

KO (n=7) and WT control (n=7) mice at 16-weeks old (*p<0.05, **p< 0.01). (D) Insulin levels 30

min after injection of glucose (2g/kg) in 6.5-week old and 16-week old mice (n=4 WFS1 KO mice

at each age and n = 4 WT mice at each age, *p<0.05). (E) Total pancreatic insulin content in 6.5-

week old and 16-week-old mice (n = 4 WFS1 KO mice at each age and n = 4 WT mice at each

age, *p<0.05, **p< 0.01) (F) Immunofluorescence of islets from control and WFS1 KO mice at

6.5 and 16-weeks of age. (G) Beta cell mass in WT and WFS1 KO mice at 6.5 and 16-weeks of

age mice (n = 3 WFS1 KO mice at each age and n = 3 WT mice at each age). Black bars represent

data from WT mice and red bars indicate data from Wfs1 KO mice. (H) Quantification of alpha

cell area to beta cell area in WT and WFS1 KO mice at 6.5 and 16-weeks of age mice (n=3 Wfs1

KO mice and n = 3 WT mice at each age, *p<0.05). Data are represented as mean ± SEM from at

least three mice per experiment. Statistical significance was determined by unpaired t-test.

Figure 2. WFS1 positively regulates insulin biosynthesis and b-cell maturity markers. (A)

Experimental strategy for identifying gene networks affected by WFS1 overexpression in INS1

cells via RNA sequencing. INS-1 832/13 with inducible pTetR Tet On (TO) WFS1 overexpression

were treated with DMSO or doxycycline for 48 hours, followed by 16 hours of 5µg/ml tunicamycin

or 10nM thapsigargin. Venn diagram represents number of genes with q-value ≤ 0.05 in each stress

condition. (B) Top 25 biological processes affected by WFS1 overexpression under tunicamycin-

mediated ER stress. Yellow bars indicate biological processes affected only by tunicamycin-

mediated stress. Green bars indicate biological processes affected by both tunicamycin- and

31
Abreu, D et al.

thapsigargin-mediated stress. (C) Top 25 biological processes affected by WFS1 overexpression

under thapsigargin-mediated ER stress. Blue bars indicate biological processes affected only by

thapsigargin-mediated stress. Green bars indicate biological processes affected by both

tunicamycin- and thapsigargin-mediated stress. (D-E) Relative expression of Ins1 and Ins2 by

quantitative PCR in cells treated as indicated in (A) (n=4 for all conditions, **p< 0.01). (F-H)

Relative expression of Nkx2.2, Nkx6.1 and Pdx1 by quantitative PCR in cells treated as indicated

in (A) (n=4 for all conditions, *p<0.05, **p< 0.01). Data are represented as mean ± SEM from at

least four independent experiments or three independent mice. Statistical significance was

determined by unpaired t-test.

Figure 3. WFS1 overexpression suppresses ER stress-mediated cell death. (A) INS-1 832/13

with inducible pTetR Tet On (TO) Flag-tagged WFS1 overexpression were treated with DMSO or

doxycycline for 48 hours, followed by 16 hours of no treatment (UT) or chemical ER stress by

specified doses of tunicamycin (TM) or thapsigargin (TG) before measurement of caspase 3/7

activity (n=8 for all conditions, **p< 0.01). (B-C) Relative expression of Chop and Trib3 by

quantitative PCR in cells treated as (a) (n=4 for all conditions, *p<0.05, **p< 0.01). (D)

Immunoblot analysis of Chop and cleaved caspase 3 expression in cells treated as (A). (E-F)

Quantification of Chop and cCasp3 protein expression relative to untreated control cells—UT

DMSO (n=8 for all conditions, *p<0.05). (G) INS-1 832/13 with inducible pTetR TO Flag-tagged

WFS1 overexpression were treated with DMSO or doxycycline for 48 hours in 11mM glucose or

25mM glucose media prior to measurement of caspase 3/7 activity (n=4 for all conditions, *p<

0.05). (H-I) Relative expression of Chop and Trib3 by quantitative PCR in cells treated as (G)

(n=4 for all conditions, **p< 0.01). (J) Immunoblot analysis of Chop and cleaved caspase 3

expression in cells treated as (G). (K-L) Quantification of Chop and cCasp3 protein expression

32
Abreu, D et al.

relative to untreated control cells—11mM glucose DMSO (n=8 for Chop quantification, n=9 for

cCasp3 quantification, **p< 0.01). (M) Immunoblot analysis of Wfs1, pAkt and total Akt

expression in WT INS1 832/13 cells transduced with GFP or WFS1 lentivirus (n=3). (N)

Quantification of pAkt/Akt in WFS1 overexpression (WFS1) cells relative to WT control (GFP)

cells (n=3, *p<0.05). White bars represent data from control cells and blue bars indicate data from

WFS1 overexpression cells. Data are represented as mean ± SEM from at least four independent

experiments. Statistical significance was determined by unpaired t-test.

Figure 4. WFS1 expression is decreased in type-2 diabetic human donor islets. Relative

expression of (A) WFS1, (B) INS, (C) TXNIP and (D) IL-1b by quantitative PCR in normal

(n=10) and type-2 diabetic (T2DM) (n=5) donor islets (*p<0.05). (e) Proposed model of Wfs1

role in b-cell viability and function. Data are represented as mean ± SEM from at least five

individual donors. Statistical significance was determined by unpaired t-test.

Graphical Abstract. Model of WFS1 action in pancreatic b-cells. WFS1 promotes insulin

production and negatively regulates ER stress. Insulin production induces ER stress, which in turn

negatively regulates insulin production. ER stress also induces WFS1, which negatively regulates

CHOP-mediated pro-apoptotic pathways leading to caspase 3 cleavage and TRIB3 induction.

TRIB3 negatively regulates b-cell survival pathways by inhibiting AKT activation. In the absence

or mutation of WFS1, ER stress inhibits insulin production and leads to b-cell apoptosis through

CHOP-mediated pathways and suppression of AKT survival pathway.

33
Abreu, D et al.

Figure 1
A B C
4.5 week 6.5 week 16 week
500 KO 500 KO
500 KO
Blood glucose (mg/dL)

Blood glucose (mg/dL)

WT WT **

Blood glucose (mg/dL)

400 400 WT
400 **
** ** **
** **
300 * 300 300
**
200 200 200

100 100 100

0 0 0
0 30 60 90 120 0 30 60 90 120 0 30 60 90 120
Time (min) Time (min) Time (min)

D E 50
4 WT
WT *
KO
Plasma Insulin (ng/mL)

( g/ml/mg pancreas)
KO 40
* p=0.06

Insulin content
3
30
2 **
20
1
10

0 0
0 min

0 min

0 min

0 min

WT KO WT KO
30 min

30 min

30 min

30 min

6.5-week 16-week
6.5 wk old 16 wk old

WT
F 6.5-weeks 16-weeks G
1.0 WT
WT WT
KO
*
-cell area/ -cell area

0.8
*
0.6

0.4

0.2

KO 0.0
WT KO WT KO

KO KO 6.5-wk 16-wk

H
2.0 WT
KO
-cell mass (mg)

1.5
p=0.10
*
1.0

Gcg Ins DAPI 0.5

0.0
WT KO WT KO
6.5-wk KO 16-wk

34
Abreu, D et al.

Figure 2
A
RNA seq
TM stress TG stress
WFS1
TM stress Control vs OE

47 35 65

WFS1
TG stress Control vs OE

B C
Top 25 Biological Processes affected by Tunicamycin stress under WFS1 OE Top 25 Biological Processes affected by Thapsigargin stress under WFS1 OE

Hormone transport Homophilic cell adhesion via plasma membr adhesion molecules
Positive regulation of hormone secretion Positive regulation of hormone secretion
Hormone secretion Respiratory electron transport chain
Positive regulation of insulin secretion Regulation of DNA-templated transcription in response to stress
Apoptotic signaling pathway Positive regulation of insulin secretion
Peptide transport Regulation of peptide secretion
DNA conformation change Electron transport chain
Peptide hormone secretion Response to glucose
Hormone metabolic process Regulation of secretion by cell
Peptide secretion Regulation of peptide hormone secretion
Protein-DNA complex assembly Neuron fate commitment

GO TERM
GO TERM

Amide transport Insulin secretion

Protein-DNA complex subunit organization ATP synthesis coupled electron transport
Insulin secretion Regulation of insulin secretion
Cellular response to DNA damage stimulus Glucose homeostasis
Regulation of insulin secretion Carbohydrate homeostasis
DNA packaging Peptide secretion
Regulation of hormone secretion Cellular response to DNA damage stimulus
Nucleosome assembly Peptide hormone secretion
Chromatin assembly or disassembly Regulation of hormone secretion
Chromatin assembly Endocrine system development
Nucleosome organization Response to radiation
Regulation of hormone levels Cell-cell adhesion via plasma-membrane adhesion molecules
Homophilic cell adhesion via plasma membr adhesion molecules Neuron fate specification
Cell-cell adhesion via plasma-membrane adhesion molecules Regulation of hormone levels

-4 -2 0 2 4 6 -4 -2 0 2 4
Mean log(Fold change) Mean log(Fold change)

D E F
Ins1 Ins2 Nkx2.2
Fold expression rel to UT DMSO (au)
Fold expression rel to UT DMSO (au)

2.5
Fold expression rel to UT DMSO (au)

3 5 DMSO DMSO
DMSO
Dox Dox Dox
4 2.0
2 ** 1.5 p=0.05
3
**
**
** 2 ** 1.0
1
1 0.5

0 0 0.0
UT 5 g/mL TM 10nM TG UT 5 g/mL TM 10nM TG UT 5 g/mL TM 10nM TG
Treatment Treatment Treatment

G H
Nkx6.1 Pdx1
Fold expression rel to UT DMSO (au)

2.0
Fold expression rel to UT DMSO (au)

DMSO 2.0 DMSO

Dox Dox
1.5 1.5
**
1.0 1.0
*

0.5 0.5

0.0 0.0
UT 5 g/mL TM 10nM TG UT 5 g/mL TM 10nM TG
Treatment Treatment

35
Abreu, D et al.

Figure 3
A Casp3/7 Activity B C
Chop
Trib3
fold luminescence rel to UT DMSO (au)

Fold expression rel to UT DMSO (au)

Fold expression rel to UT DMSO (au)
5 4 DMSO 15
DMSO DMSO
Dox Dox Dox
4 3
** 10
3
2
2 **
** ** 5
*
1
1
**
0 0 0
UT 5 g/mL TM 10nM TG UT 5 g/mL TM 10nM TG UT 5 g/mL TM 10nM TG
Treatment Treatment Treatment

D E Chop F cCasp3
UT 5µg/ml TM 10nM TG

Fold intensity rel to UT DMSO (au)

Fold intensity rel to UT DMSO (au)
15 p = 0.16 10 DMSO
– + – + – + DMSO p = 0.06
Dox Dox
Dox
8
Flag p = 0.08
10 p = 0.08
6
Chop
4
5
cCasp3
2 *
*
Tubulin 0 0
UT 5 g/ml TM 10nM TG UT 5 g/ml TM 10nM TG
Treatment Treatment

G H I
Casp3/7 Activity Chop Trib3
fold luminescence rel to UT DMSO (au)

2 1.5 1.5
fold expression rel to 11mM DM (au)

fold expression rel to 11mM DM (au)

DMSO DMSO DMSO
Dox Dox Dox
* ** ** **
1.0 ** 1.0
*
1

0.5 0.5

0 0.0 0.0
11mM 25mM 11mM 25mM 11mM 25mM
Glucose Concentration Glucose Concentration Glucose concentration (48hr)

J [Glucose] 11mM 25mM K Chop

L
cCasp3
Fold intensity rel to UT DMSO (au)

Fold intensity rel to UT DMSO (au)

Dox – + – + 2.0 ** 3
DMSO DMSO **
Flag Dox Dox
1.5
2
Chop **
1.0
**
1
cCasp3 0.5

0.0 0
Tubulin 11mM 25mM 11mM 25mM
Treatment Glucose (mM)

M N
GFP WFS1 1.5
p=0.07
fold pAkt/Akt rel to GFP

pAkt
1.0

Akt
0.5

0.0
GFP WFS1

36
Abreu, D et al.

Figure 4
A B
WFS1 INS
4 6
p=0.07
Expression (rel to actin)

Expression (rel to actin)

3
*
4

2
1

0 0
Normal T2DM Normal T2DM
C TXNIP
D IL-1β f
1.5 6
p=0.34 p=0.16

Expression (rel to actin)

Expression (rel to actin)

1.0 4

0.5 2

0.0 0
Normal T2DM Normal T2DM

MODEL
WFS1 role in ß-cell viability and function

37
Abreu, D et al.

38
Abreu, D. et al.

Supplementary Table S1. Genes differentially expressed under both TM- and TG-induced ER stress in WFS1 overexpression
cells and control cells.
TM stress (WFS1 OE relative to Control) TG stress (WFS1 OE relative to Control)
Gene ID Gene Name logFC linearFC P.Value adj.P.Val logFC linearFC P.Value adj.P.Val
Wolframin ER
transmembrane 0.946 1.926 1.24E-07 0.0007 1.107 2.153 5.78E-08 0.0004
Wfs1 glycoprotein
Fn1 Fibronectin 1 0.982 1.975 8.75E-08 0.0007 1.133 2.192 2.81E-08 0.0004
Interleukin 1
0.862 1.818 1.56E-07 0.0007 0.720 1.647 1.62E-06 0.0050
Il1r1 receptor type 1
Stearoyl-Coenzyme
0.661 1.581 2.70E-07 0.0008 0.356 1.280 2.97E-04 0.0468
Scd2 A desaturase 2
Glutathione S-
-0.730 -1.658 6.76E-07 0.0017 -0.461 -1.376 1.82E-04 0.0386
Gstp1 transferase pi 1
Roundabout
0.776 1.712 1.32E-06 0.0028 0.657 1.577 1.74E-05 0.0146
Robo2 guidance receptor 2
Ins1 Insulin 1 1.074 2.105 2.57E-06 0.0038 0.899 1.865 4.34E-05 0.0202
Ins2 Insulin 2 1.393 2.627 2.71E-06 0.0038 1.253 2.383 2.01E-05 0.0156
AY172581.10 -1.816 -3.521 2.74E-06 0.0038 -1.443 -2.718 9.47E-05 0.0264
ATP binding
cassette subfamily 0.680 1.603 5.93E-06 0.0068 0.530 1.444 1.23E-04 0.0314
Abca1 A member 1
AY172581.22 -1.603 -3.039 9.60E-06 0.0081 -1.461 -2.753 6.93E-05 0.0228
Carnitine
palmitoyltransferase -0.539 -1.453 1.35E-05 0.0093 -0.514 -1.428 6.26E-05 0.0228
Cpt1a 1A
Mitochondrially
encoded 0.585 1.500 1.36E-05 0.0093 0.680 1.602 8.74E-06 0.0127
Mt-cyb cytochrome b
ATP binding
cassette subfamily 0.482 1.396 2.52E-05 0.0127 0.592 1.507 9.79E-06 0.0127
Abcg1 G member 1

39
Abreu, D. et al.

Solute carrier
-0.564 -1.478 2.37E-05 0.0127 -0.606 -1.522 2.82E-05 0.0171
Slc16a1 family 16 member 1
Cell division cycle
0.505 1.419 3.42E-05 0.0153 0.546 1.460 3.33E-05 0.0171
Cdc20 20
DNA-damage
inducible transcript
3/ C/EBP -0.598 -1.514 3.99E-05 0.0170 -0.534 -1.448 2.86E-04 0.0467
homologous
Ddit3/Chop protein
Monoamine oxidase
0.615 1.531 4.07E-05 0.0170 0.581 1.496 1.64E-04 0.0362
Maob B
Synaptotagmin-like
0.739 1.669 5.35E-05 0.0182 0.790 1.729 7.30E-05 0.0229
Sytl4 4
Mitochondrially
encoded NADH 4L 0.409 1.328 5.12E-05 0.0182 0.749 1.681 3.29E-07 0.0014
Mt-nd4l dehydrogenase
Islet amyloid
0.519 1.433 6.29E-05 0.0208 0.509 1.423 1.85E-04 0.0386
Iapp polypeptide
Adaptor-related
protein complex 1, 0.495 1.409 7.70E-05 0.0242 0.480 1.394 2.33E-04 0.0442
Ap1s2 sigma 2 subunit
Nectin cell adhesion
0.480 1.395 9.08E-05 0.0252 0.538 1.452 6.56E-05 0.0228
Nectin3 molecule 3
Cdh6 Cadherin 6 1.267 2.406 8.59E-05 0.0252 1.658 3.155 1.03E-05 0.0127
Mitochondrially
encoded NADH 0.428 1.345 1.17E-04 0.0293 0.683 1.605 3.68E-06 0.0066
Mt-nd5 dehydrogenase 5
Alpha-1-B
0.798 1.739 1.39E-04 0.0316 0.804 1.746 2.85E-04 0.0467
A1bg glycoprotein
Notch1 Notch 1 0.574 1.489 1.43E-04 0.0316 0.679 1.601 5.86E-05 0.0228

40
Abreu, D. et al.

Mitochondrially
encoded NADH 0.380 1.302 1.47E-04 0.0319 0.649 1.568 2.41E-06 0.0050
Mt-nd6 dehydrogenase 6
Inhibitor of DNA
binding 4, HLH 0.624 1.541 2.61E-04 0.0408 0.877 1.836 1.32E-05 0.0127
Id4 protein
Nkx6-1 NK6 homeobox 1 0.502 1.416 2.70E-04 0.0408 0.521 1.435 2.81E-04 0.0467
Free fatty acid
0.529 1.443 2.79E-04 0.0408 0.732 1.661 3.30E-05 0.0171
Ffar1 receptor 1
Mitochondrially
encoded ATP 0.352 1.276 2.82E-04 0.0408 0.518 1.432 2.19E-05 0.0156
Mt-atp8 synthase 8
RASD family,
-0.585 -1.500 3.32E-04 0.0434 -0.820 -1.765 2.40E-05 0.0159
Rasd2 member 2
Mitochondrially
encoded NADH 0.376 1.298 3.30E-04 0.0434 0.601 1.517 1.20E-05 0.0127
Mt-nd4 dehydrogenase 4
G protein subunit
0.413 1.331 3.82E-04 0.0470 0.601 1.517 3.25E-05 0.0171
Gnal alpha L

Supplementary Table S1. Genes differentially expressed under both TM- and TG-induced ER stress in WFS1 overexpression

cells and control cells. Results for each stress condition were filtered for only those genes with Benjamini-Hochberg false-discovery

rate adjusted p-values less than or equal to 0.05 (q-value ≤0.05).

41
Abreu, D. et al.

Supplementary Table S2. Genes differentially expressed under TG-induced ER stress in WFS1 overexpression cells and control
cells.
TM stress (WFS1 OE relative to Control)
Gene name Description logFC linearFC P.Value adj.P.Val
Wfs1 Wolframin ER transmembrane glycoprotein 0.946 1.926 1.24E-07 0.0007
Fn1 Fibronectin 1 0.982 1.975 8.75E-08 0.0007
Il1r1 Interleukin 1 receptor type 1 0.862 1.818 1.56E-07 0.0007
Scd2 Stearoyl-Coenzyme A desaturase 2 0.661 1.581 2.70E-07 0.0008
Gstp1 Glutathione S-transferase pi 1 -0.730 -1.658 6.76E-07 0.0017
Robo2 Roundabout guidance receptor 2 0.776 1.712 1.32E-06 0.0028
Ins1 Insulin 1 1.074 2.105 2.57E-06 0.0038
Ins2 Insulin 2 1.393 2.627 2.71E-06 0.0038
AY172581.10 -1.816 -3.521 2.74E-06 0.0038
Slc6a6 Solute carrier family 6 member 6 0.538 1.452 3.31E-06 0.0041
Abca1 ATP binding cassette subfamily A member 1 0.680 1.603 5.93E-06 0.0068
Car8 Carbonic anhydrase 8 1.388 2.617 7.29E-06 0.0076
Phldb2 Pleckstrin homology-like domain, family B, member 2 0.702 1.627 1.03E-05 0.0081
Trib3 Tribbles pseudokinase 3 -0.889 -1.852 9.13E-06 0.0081
Gdf15 Growth differentiation factor 15 -0.621 -1.538 9.65E-06 0.0081
AY172581.22 -1.603 -3.039 9.60E-06 0.0081
Cpt1a Carnitine palmitoyltransferase 1A -0.539 -1.453 1.35E-05 0.0093
Fat1 FAT atypical cadherin 1 0.516 1.430 1.41E-05 0.0093
Mt-cyb Mitochondrially encoded cytochrome b 0.585 1.500 1.36E-05 0.0093
Unc5b Unc-5 netrin receptor B -0.508 -1.422 1.71E-05 0.0107
Abcg1 ATP binding cassette subfamily G member 1 0.482 1.396 2.52E-05 0.0127
Lhx3 LIM homeobox 3 1.475 2.780 2.42E-05 0.0127
Slc16a1 Solute carrier family 16 member 1 -0.564 -1.478 2.37E-05 0.0127
AY172581.7 -2.306 -4.945 2.43E-05 0.0127

42
Abreu, D. et al.

Tmem215 Transmembrane protein 215 0.905 1.873 2.73E-05 0.0132

Synpo2 Synaptopodin 2 0.413 1.332 2.84E-05 0.0132
Cdc20 Cell division cycle 20 0.505 1.419 3.42E-05 0.0153
DNA-damage inducible transcript 3/ C/EBP
-1.514 3.99E-05 0.0170
Ddit3/Chop homologous protein -0.598
Maob Monoamine oxidase B 0.615 1.531 4.07E-05 0.0170
Cox6a2 Cytochrome c oxidase subunit 6A2 -1.097 -2.139 4.39E-05 0.0178
Osgin1 Oxidative stress induced growth inhibitor 1 -1.453 -2.737 4.59E-05 0.0180
Gcg Glucagon 1.107 2.153 4.77E-05 0.0181
Sytl4 Synaptotagmin-like 4 0.739 1.669 5.35E-05 0.0182
Mt-nd4l Mitochondrially encoded NADH 4L dehydrogenase 0.409 1.328 5.12E-05 0.0182
AY172581.18 -1.262 -2.399 5.22E-05 0.0182
Iapp Islet amyloid polypeptide 0.519 1.433 6.29E-05 0.0208
Dnah8 Dynein, axonemal, heavy chain 8 0.613 1.529 7.16E-05 0.0230
Ap1s2 Adaptor-related protein complex 1, sigma 2 subunit 0.495 1.409 7.70E-05 0.0242
Akap12 A-kinase anchoring protein 12 0.379 1.300 8.05E-05 0.0247
Nectin3 Nectin cell adhesion molecule 3 0.480 1.395 9.08E-05 0.0252
F3 Coagulation factor III, tissue factor 0.969 1.957 8.77E-05 0.0252
Cdh6 Cadherin 6 1.267 2.406 8.59E-05 0.0252
ChaC glutathione-specific gamma-
-1.983 8.88E-05 0.0252
Chac1 glutamylcyclotransferase 1 -0.988
Rhbdf1 Rhomboid 5 homolog 1 -0.867 -1.823 9.24E-05 0.0252
Homocysteine inducible ER protein with ubiquitin like
-1.300 1.02E-04 0.0273
Herpud1 domain 1 -0.378
Phlda3 Pleckstrin homology-like domain, family A, member 3 -0.583 -1.498 1.08E-04 0.0282
Myo3a Myosin IIIA 0.658 1.578 1.16E-04 0.0293
Jund JunD proto-oncogene, AP-1 transcription factor subunit -0.474 -1.389 1.19E-04 0.0293
Mt-nd5 Mitochondrially encoded NADH dehydrogenase 5 0.428 1.345 1.17E-04 0.0293
A1bg Alpha-1-B glycoprotein 0.798 1.739 1.39E-04 0.0316

43
Abreu, D. et al.

Chrm4 Cholinergic receptor, muscarinic 4 -0.577 -1.491 1.33E-04 0.0316

Notch1 Notch 1 0.574 1.489 1.43E-04 0.0316
Ifi27l2b Interferon, alpha-inducible protein 27 like 2B -0.536 -1.450 1.43E-04 0.0316
Stk32a Serine/threonine kinase 32A -0.726 -1.654 1.43E-04 0.0316
Mt-nd6 Mitochondrially encoded NADH dehydrogenase 6 0.380 1.302 1.47E-04 0.0319
Tnik TRAF2 and NCK interacting kinase 0.433 1.350 1.55E-04 0.0326
Ppp1r1b Protein phosphatase 1, regulatory (inhibitor) subunit 1B -0.662 -1.582 1.56E-04 0.0326
Slc2a2 solute carrier family 2 member 2 1.018 2.026 1.65E-04 0.0333
Gpr158 G protein-coupled receptor 158 0.535 1.449 1.64E-04 0.0333
Cyp4x1 Cytochrome P450, family 4, subfamily x, polypeptide 1 1.457 2.745 1.72E-04 0.0342
Creb3l1 cAMP responsive element binding protein 3-like 1 -0.460 -1.376 1.77E-04 0.0347
Myc Myelocytomatosis oncogene -0.599 -1.514 2.05E-04 0.0349
Csdc2 Cold shock domain containing C2 -0.527 -1.441 1.88E-04 0.0349
A3galt2 Alpha 1,3-galactosyltransferase 2 0.474 1.389 2.05E-04 0.0349
Kirrel3 Kin of IRRE like 3 (Drosophila) 0.517 1.431 1.99E-04 0.0349
Hpgd Hydroxyprostaglandin dehydrogenase 15 (NAD) 1.451 2.733 1.98E-04 0.0349
Entpd2 Ectonucleoside triphosphate diphosphohydrolase 2 -0.514 -1.428 1.98E-04 0.0349
Plppr5 Phospholipid phosphatase related 5 0.675 1.597 1.96E-04 0.0349
Atf4 Activating transcription factor 4 -0.339 -1.265 2.06E-04 0.0349
Arhgef2 Rho/Rac guanine nucleotide exchange factor 2 -0.594 -1.509 1.84E-04 0.0349
Akr1c12 Aldo-keto reductase family 1, member C12 -0.936 -1.913 2.06E-04 0.0349
Slc30a8 Solute carrier family 30 member 8 0.465 1.380 2.19E-04 0.0367
Sema3d Semaphorin 3D 0.673 1.595 2.38E-04 0.0393
Acaa2 Acetyl-CoA acyltransferase 2 -0.538 -1.452 2.41E-04 0.0394
LOC102552640 REST corepressor 2-like -0.417 -1.335 2.49E-04 0.0400
LOC102552640 REST corepressor 2-like -0.417 -1.335 2.49E-04 0.0400
Unc5c Unc-5 netrin receptor C 0.510 1.424 2.56E-04 0.0407
Pcsk2 Proprotein convertase subtilisin/kexin type 2 0.418 1.336 2.64E-04 0.0408

44
Abreu, D. et al.

Slc7a11 Solute carrier family 7 member 11 -1.066 -2.093 2.66E-04 0.0408

Id4 Inhibitor of DNA binding 4, HLH protein 0.624 1.541 2.61E-04 0.0408
Nkx6-1 NK6 homeobox 1 0.502 1.416 2.70E-04 0.0408
Igsf1 Immunoglobulin superfamily, member 1 0.671 1.592 2.76E-04 0.0408
Scg2 Secretogranin II 0.482 1.397 2.83E-04 0.0408
Ffar1 Free fatty acid receptor 1 0.529 1.443 2.79E-04 0.0408
Mt-atp8 Mitochondrially encoded ATP synthase 8 0.352 1.276 2.82E-04 0.0408
Cdkn1a Cyclin-dependent kinase inhibitor 1A -0.946 -1.926 2.97E-04 0.0410
Galnt14 Polypeptide N-acetylgalactosaminyltransferase 14 0.484 1.399 2.90E-04 0.0410
Gch1 GTP cyclohydrolase 1 -0.693 -1.617 2.91E-04 0.0410
Limch1 LIM and calponin homology domains 1 0.373 1.295 3.10E-04 0.0424
Nipal3 NIPA-like domain containing 3 0.398 1.318 3.18E-04 0.0429
Rasd2 RASD family, member 2 -0.585 -1.500 3.32E-04 0.0434
Mt-nd4 Mitochondrially encoded NADH dehydrogenase 4 0.376 1.298 3.30E-04 0.0434
Adarb2 Adenosine deaminase, RNA-specific, B2 0.398 1.317 3.32E-04 0.0434
Ntrk3 Neurotrophic receptor tyrosine kinase 3 0.378 1.299 3.52E-04 0.0451
Sesn2 Sestrin 2 -0.420 -1.338 3.52E-04 0.0451
Lpl Lipoprotein lipase -0.347 -1.272 3.63E-04 0.0456
Slc16a14 Solute carrier family 16, member 14 0.555 1.469 3.60E-04 0.0456
Ptprz1 Protein tyrosine phosphatase, receptor type Z1 0.333 1.260 3.75E-04 0.0466
Gnal G protein subunit alpha L 0.413 1.331 3.82E-04 0.0470

Supplementary Table S2. Genes differentially expressed under TG-induced ER stress in WFS1 overexpression cells and control

cells. Results were filtered for only those genes with Benjamini-Hochberg false-discovery rate adjusted p-values less than or equal to

0.05 (q-value ≤0.05).

45
Abreu, D. et al.

Supplementary Table S3. Genes differentially expressed under TM-induced ER stress in WFS1 overexpression cells and control
cells.
TG stress (WFS1 OE relative to Control)
Gene ID Gene Name logFC linearFC P.Value adj.P.Val
Fn1 Fibronectin 1 1.13 2.19 2.81E-08 0.0004
Wfs1 Wolframin ER transmembrane glycoprotein 1.11 2.15 5.78E-08 0.0004
Mt-nd4l Mitochondrially encoded NADH 4L dehydrogenase 0.75 1.68 3.29E-07 0.0014
Il1r1 Interleukin 1 receptor type 1 0.72 1.65 1.62E-06 0.0050
Pdx1 Pancreatic and duodenal homeobox 1 0.84 1.79 2.00E-06 0.0050
Mt-nd6 Mitochondrially encoded NADH dehydrogenase 6 0.65 1.57 2.41E-06 0.0050
Mt-nd5 Mitochondrially encoded NADH dehydrogenase 5 0.68 1.61 3.68E-06 0.0066
Abcg1 ATP binding cassette subfamily G member 1 0.59 1.51 9.79E-06 0.0127
Cdh6 Cadherin 6 1.66 3.15 1.03E-05 0.0127
Id4 Inhibitor of DNA binding 4, HLH protein 0.88 1.84 1.32E-05 0.0127
Mt-nd4 Mitochondrially encoded NADH dehydrogenase 4 0.60 1.52 1.20E-05 0.0127
Mt-cyb Mitochondrially encoded cytochrome b 0.68 1.60 8.74E-06 0.0127
H1fx H1 histone family, member X 0.58 1.49 1.57E-05 0.0140
Robo2 Roundabout guidance receptor 2 0.66 1.58 1.74E-05 0.0146
Ins2 Insulin 2 1.25 2.38 2.01E-05 0.0156
Mt-atp8 Mitochondrially encoded ATP synthase 8 0.52 1.43 2.19E-05 0.0156
Rasd2 RASD family, member 2 -0.82 -1.77 2.40E-05 0.0159
Kif21b Kinesin family member 21B -0.76 -1.69 3.3E-05 0.0171
Gnal G protein subunit alpha L 0.60 1.52 3.25E-05 0.0171
Tenm4 Teneurin transmembrane protein 4 -0.74 -1.67 3.41E-05 0.0171
Slc16a1 Solute carrier family 16 member 1 -0.61 -1.52 2.82E-05 0.0171
Ffar1 Free fatty acid receptor 1 0.73 1.66 3.3E-05 0.0171
Cdc20 Cell division cycle 20 0.55 1.46 3.33E-05 0.0171
Ins1 Insulin 1 0.90 1.86 4.34E-05 0.0202

46
Abreu, D. et al.

Nectin3 Nectin cell adhesion molecule 3 0.54 1.45 6.56E-05 0.0228

Csrp2 Cysteine and glycine-rich protein 2 0.74 1.67 6.99E-05 0.0228
Ngfr Nerve growth factor receptor 1.09 2.13 5.19E-05 0.0228
Pcsk1 Proprotein convertase subtilisin/kexin type 1 0.84 1.79 6.52E-05 0.0228
Pcdh7 Protocadherin 7 1.42 2.67 7.09E-05 0.0228
Cpt1a Carnitine palmitoyltransferase 1A -0.51 -1.43 6.26E-05 0.0228
Notch1 Notch 1 0.68 1.60 5.86E-05 0.0228
Fat4 FAT atypical cadherin 4 2.22 4.65 5.36E-05 0.0228
Spock3 SPARC/osteonectin, cwcv and kazal like domains proteoglycan 3 0.84 1.78 5.70E-05 0.0228
Mt-nd2 Mitochondrially encoded NADH dehydrogenase 2 0.56 1.47 6.75E-05 0.0228
AY172581.22 -1.46 -2.75 6.93E-05 0.0228
Gnas GNAS complex locus 0.57 1.49 5.77E-05 0.0228
Sytl4 Synaptotagmin-like 4 0.79 1.73 7.30E-05 0.0229
Nnat Neuronatin 0.83 1.77 7.77E-05 0.0238
Wnt4 Wingless-type MMTV integration site family, member 4 0.82 1.77 8.06E-05 0.0241
Adra2a Adrenoceptor alpha 2A 0.78 1.72 8.72E-05 0.0255
Mafb MAF bZIP transcription factor B 0.85 1.80 9.43E-05 0.0264
AY172581.10 -1.44 -2.72 9.47E-05 0.0264
Camk2n1 Calcium/calmodulin-dependent protein kinase II inhibitor 1 0.57 1.49 1.01E-04 0.0272
Pycard PYD and CARD domain containing 1.57 2.97 0.000102 0.0272
Tenm2 Teneurin transmembrane protein 2 0.69 1.61 1.04E-04 0.0273
Abca1 ATP binding cassette subfamily A member 1 0.53 1.44 0.000123 0.0314
Mafa MAF bZIP transcription factor A 0.80 1.74 1.29E-04 0.0320
Nkx2-2 NK2 homeobox 2 0.76 1.69 0.00013 0.0320
Plet1 Placenta expressed transcript 1 3.08 8.46 1.32E-04 0.0320
Tmem178a Transmembrane protein 178A 0.83 1.78 0.000145 0.0345
Pttg1 Pituitary tumor-transforming 1 0.53 1.45 1.59E-04 0.0356
Ube2ql1 Ubiquitin-conjugating enzyme E2Q family-like 1 0.52 1.44 0.000155 0.0356

47
Abreu, D. et al.

Maob Monoamine oxidase B 0.58 1.50 1.64E-04 0.0362

Ppp1r15a Protein phosphatase 1, regulatory subunit 15A -0.68 -1.60 0.000174 0.0377
Iapp 0.51 1.42 1.85E-04 0.0386
Gstp1 Glutathione S-transferase pi 1 -0.46 -1.38 0.000182 0.0386
Aurka Aurora kinase A 0.61 1.53 1.98E-04 0.0407
Rph3a Rabphilin 3A 1.40 2.63 0.000207 0.0412
Plk1 Polo-like kinase 1 0.48 1.39 2.06E-04 0.0412
Mt-nd3 Mitochondrially encoded NADH dehydrogenase 3 0.58 1.50 0.000216 0.0424
Ap1s2 Adaptor-related protein complex 1, sigma 2 subunit 0.48 1.39 2.33E-04 0.0442
Tll1 Tolloid-like 1 0.50 1.42 0.000244 0.0456
Etv4 Ets variant 4 -1.23 -2.35 2.49E-04 0.0460
Igfbp7 Insulin-like growth factor binding protein 7 0.75 1.68 0.000271 0.0467
Nkx6-1 NK6 homeobox 1 0.52 1.44 2.81E-04 0.0467
A1bg Alpha-1-B glycoprotein 0.80 1.75 0.000285 0.0467
Ddit3/Chop DNA-damage inducible transcript 3/ C/EBP homologous protein -0.53 -1.45 2.86E-04 0.0467
Clvs1 Clavesin 1 0.57 1.48 0.000268 0.0467
Plppr1 Phospholipid phosphatase related 1 0.58 1.49 2.81E-04 0.0467
Cdkn3 Cyclin-dependent kinase inhibitor 3 0.55 1.46 0.000279 0.0467
St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 0.43 1.35 2.87E-04 0.0467
Arhgef39 Rho guanine nucleotide exchange factor 39 0.60 1.52 0.000267 0.0467
Rai2 Retinoic acid induced 2 0.61 1.53 3.00E-04 0.0468
Epha1 Eph receptor A1 0.63 1.55 0.0003 0.0468
Rnf185 Ring finger protein 185 -0.51 -1.42 3.02E-04 0.0468
Scd2 Stearoyl-Coenzyme A desaturase 2 0.36 1.28 0.000297 0.0468
Slitrk6 SLIT and NTRK-like family, member 6 1.17 2.25 3.08E-04 0.0471
Hopx HOP homeobox 0.64 1.56 0.000328 0.0491

48
Abreu, D. et al.

Supplementary Table S3. Genes differentially expressed under TM-induced ER stress in WFS1 overexpression cells and control

cells. Results were filtered for only those genes with Benjamini-Hochberg false-discovery rate adjusted p-values less than or equal to

0.05 (q-value ≤0.05).

49
Abreu, D. et al.

Supplementary Table S4. Human islet donors.

Donor ID Age (yrs) Sex A1C (%) COD

Normal-1 33 Female 4.9 Anoxic event
Normal-2 28 Male 4.2 Head trauma
Normal-3 48 Female 5.3 Stroke
Normal-4 45 Male 5.1 Anoxic event
Normal-5 46 Male 5.4 Anoxic event
Normal-6 30 Female 4.4 Stroke
Normal-7 52 Female 4.8 Stroke
Normal-8 50 Male 5.4 Head trauma
Normal-9 62 Female 5.0 Stroke
Normal-10 35 Male 5.4 Anoxic event
T2D-1 63 Male 7.3 CVH
T2D-2 59 Female 6.7 Anoxic event
T2D-3 40 Male 7.4 Stroke
T2D-4 45 Male 6.5 Stroke
T2D-5 55 Male 8.5 Head trauma

Supplementary Table S4. Human islet donors. Detailed information obtained from Prodo

regarding patient age, sex, hemoglobin A1C (A1C) and cause of death.

50
Abreu, D. et al.

Supplemental Figure S1. WFS1 knockdown promotes b-cell dysfunction, ER stress and b-
cell death.
Suppl. Figure S1.
A B C
0.4 2.0 3 *
Insulin release (% of content)

DMSO DMSO
*

Insulin content (ng/mL)

Dox Dox *
0.3 1.5 **
2

F/F0
0.2 1.0

1
0.1 0.5

0.0 0.0 0
2.8mM 16.7mM DMSO Dox 0mM 2.8mM 16.7mM
[Glucose] Treatment Glucose Treatment
D Casp3/7 Activity E F
UT 5µg/ml TM 10nM TG
Fold luminenescence rel to DMSO UT (au)

Chop

Fold intensity rel to UT DMSO (au)

10 DMSO *
* Dox: – + – + – + 30 DMSO
Dox Dox
8 <
* Wfs1 #
* 20
6
Chop
4 *
10 *
cCasp3
2

0 Tubulin 0
UT 5 g/ml TM 10nM TG UT 5 g/ml TM 10nM TG
Treatment Treatment

G H Casp3/7 Activity
I
[Glucose] 11mM 25mM
cCasp3
Fold intensity rel to UT DMSO (au)

Fold luminenescence rel to 11mM DM (au)

15 8 DMSO
DMSO Dox – + – +
Dox Dox
** <
p = 0.07 6
** Wfs1 #
10
** 4
Chop
5
2
cCasp3
0 0
UT 5 g/ml TM 10nM TG 11mM 25mM
Tubulin
Treatment Glucose Treatment

J K L
Chop cCasp3
Dox: – +
Fold intensity rel to UT DMSO (au)

Fold intensity rel to UT DMSO (au)

6 DMSO DMSO *
Dox 6 Dox
Wfs1 <
** **
4 #
**
4
pAkt
2
2

Akt
0 0
11mM 25mM 11mM 25mM
Treatment Treatment
M
1.5
fold pAkt/Akt rel to DMSO

**
1.0

0.5

0.0
DMSO Dox

51
Abreu, D. et al.

Supplemental Figure S1. WFS1 knockdown promotes b-cell dysfunction, ER stress and b-

cell death. (A) INS-1 832/13 with inducible pTetR Tet-On (TO) shWfs1 were treated with DMSO

or doxycycline for 48 hours, then subjected to glucose stimulated insulin secretion by sequential

exposure to 2.8mM glucose then 16.7mM glucose (n=4, *p< 0.05). (B) Insulin content was

measured from the cells used in (a) (n=4, **p< 0.01). (C) INS-1 832/13 with inducible pTetR TO

shWfs1 were treated with DMSO or doxycycline for 48 hours, then loaded with Fluo-4 AM and

imaged over 2 minutes in 0mM glucose KRBH, 2.8mM glucose KRBH and 16.7mM glucose

KRBH. The change in fluorescence intensity at each glucose condition was averaged over 2

minutes of image acquisition and is expressed relative to baseline fluorescence to account for

uneven concentration of dye loading in each cell. ΔF/F0 was averaged over 20 cells per glucose

concentration (n=3, *p<0.05). (D) INS-1 832/13 with inducible pTetR TO shWfs1 were treated

with DMSO or doxycycline for 48 hours, followed by 16 hours of no treatment (UT) or chemical

ER stress by specified doses of tunicamycin (TM) or thapsigargin (TG) before measurement of

caspase 3/7 activity (n=8 for all conditions, **p< 0.01). (E) Immunoblot analysis of Wfs1, Chop

and cleaved caspase 3 expression in cells treated as (d). (F-G) Quantification of Chop and cCasp3

protein expression relative to untreated control cells—UT DMSO (n=9 for all conditions, *p<0.05,

**p<0.01). (H) INS-1 832/13 with inducible pTetR TO shWfs1 were treated with DMSO or

doxycycline for 48 hours in 11mM glucose or 25mM glucose media prior to measurement of

caspase 3/7 activity (n=5 for all conditions, *p< 0.05). (I) Immunoblot analysis of Wfs1, Chop and

cleaved caspase 3 expression in cells treated as (h). (J-K) Quantification of Chop and cCasp3

protein expression relative to untreated control cells—UT DMSO (n=11 for all conditions,

*p<0.05, **p<0.01). (L) Immunoblot analysis of Wfs1, Ser743 Akt phosphorylation (pAkt) and

total Akt expression in INS-1 832/13 with inducible pTetR Tet On (TO) shWfs1 treated for 48

52
Abreu, D. et al.

hours with DMSO or doxycycline. (M) Quantification of pAkt/Akt in Wfs1 knockdown (Dox)

cells relative to control (DMSO) cells (n=7, **p<0.01). White bars represent data from control

cells and red bars indicate data from Wfs1 knockdown cells. For immunoblots, < indicates WFS1

band, # indicates a background band. Data are represented as mean ± SEM from at least four

independent experiments. Statistical significance was determined by unpaired t-tests.

53
Declarations of interest: none