G R S

Journal Name
1
Manuscript No.
6 1
B Dispatch: 9.10.09
Author Received:
Journal: GRS CE: Blackwell
No. of pages: 10 PE: Nithya

Japanese Society of Grassland Science ISSN1744-6961

1 ORIGINAL ARTICLE
2
3 Utilizing single primers as molecular markers in Poa spp.
4
Bryan Kindiger1 and Terry R. Conley2
5
6 1 USDA-ARS, Grazinglands Research Laboratory, El Reno, Oklahoma, USA
7 2 Department of Biology, Oklahoma City University, Oklahoma City, Oklahoma, USA
8
9
10
11
Keywords Abstract
12
Inverted repeat; microsatellites; palindrome;
13 polymerase chain reaction; Poa spp. An approach is described whereby single simple sequence repeat (SSR) primers are
14 utilized at high annealing temperature to identify and evaluate the presence of pal-
15 Correspondence indrome or quasi-palindrome regions in polyploid genomes to provide locus spe-
16 Bryan Kindiger, USDA-ARS, Grazinglands
cific genotyping for polyploid grass species. The procedure has been effective in
17 Research Laboratory, 7207 West Cheyenne
Street, El Reno, OK 73036, USA.
identifying markers that coexpress in Poa arachnifera and interspecific Poa hybrids.
18 DNA sequence analysis of the polymerase chain reaction (PCR) amplification
Email: bryan.kindiger@ars.usda.gov
19 products identified an array of homologous loci within and among evaluated indi-
20 Received 26 February 2009; accepted 9 June viduals. From this study, 157 single primers were identified to provide information
21 2009. and identify polymorphisms across P. arachnifera. Similar to random amplified
22 polymorphic DNA, arbitrarily primed PCR or low-stringency single primer PCR
23 doi: 10.1111/j.1744-697X.2009.00161.x
methods, this approach requires no prior genome information, utilizes agarose gels
24 and can be visualized with ethidium bromide. Preliminary evaluations of addi-
25 tional Poa spp., Bromus inermis, Dactylis glomerata, Thinopyrum ponticum, Lolium
26 perenne and Agrostis spp. suggest wide utility of this approach toward genotyping
27 polyploid grasses.
28
29 for an additional 30–35 cycles. The utilization of RAPD-PCR
Introduction
30 at high annealing temperature (50–54C) has also been
31 Plant genomes maintain a vast array of chromosomal shown to generate high-quality genomic DNA profiles from
32 arrangements ranging from miniature inverted repeat tan- phylogenetically different groups of organisms using the
33 dem elements and short interspersed elements (Casa et al. same set of single RAPD-PCR primers (Atienzar et al. 2000).
34 2000; Ohtsubo et al. 2004) to larger genome rearrangements LSSP-PCR is another approach whereby a purified DNA
35 containing inverted repeats which are known to be often gen- fragment is subjected to PCR using a single-specific primer
36 erated by class II transposable elements (TE) (Charrier et al. where the amplified sequence is subjected to under low-strin-
37 1999) or spontaneously generated by illegitimate recombina- gency conditions to produce a range of amplicons of differ-
38 tion and translocation (Carver & Stubbs 1997; Koszul et al. ent length (Pena et al. 1994). The amplification products and
39 2004). The polymerase chain reaction (PCR) methods of banding patterns generated by these techniques are unique to
40 random amplified polymorphic DNA (RAPD-PCR) (Weis- an individual, and of possible value for identity testing or
41 ing et al. 1995), arbitrary primed PCR (AP-PCR) (Welsh & genotyping. Because each of these methods are based on arbi-
42 McClelland 1990) and low-stringency single primer PCR trary amplification under low-stringency conditions, various
43 (LSSP-PCR) (Pena et al. 1994) are each biased single primer genomic regions can be amplified simultaneously in a single
44 PCR procedures that use geometric amplification of a repeti- PCR amplification (Welsh & McClelland 1990).
45 tive genome region. The successful generation of an amplifi- When considering the utilization of single primers, and
46 cation product occurs only where template-to-primer appropriate modification of PCR conditions, the RAPD-
47 matches are imperfect and the 3¢-end of the annealed primers PCR, AP-PCR and LSSP-PCR methods could also be con-
48 of no more than 3 kb apart, face one another on opposite sidered as approaches for scanning a genome for small base
49 strands (Weising et al. 1995). A traditional RAPD-PCR pair inverted repeat or quasi-inverted repeats and amplify-
50 methodology utilizes a single annealing temperature (37C); ing the particular intervening DNA sequence. Such sites are
51 while in AP-PCR, during the first five PCR cycles use a low- widespread in both the animal and plant genomes, and
52 stringency annealing temperature of 37C, that is then is when associated to transposable elements, are implicated as
53 increased to 55C. The AP-PCR is then allowed to proceed a component of plant genome rearrangement and evolution

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10 1
 Utilizing single primers for PCR
1 (Federoff 2000; Lisch et al. 2001; Bennetzen 2002). Prior
2 studies have suggested that TE may facilitate the rapid
3 restructuring of genomes following polyploidization and
4 that polyploidy can allow extensive gene modification by
5 transposons, generation of genome duplication through
6 erroneous DNA replication (Lagercrantz 1998) and because
7 polyploid genomes possess multiple gene copies, they can be
8 buffered from the potentially deleterious consequences of
9 transposition and genome duplication (Matzke & Matzke
10 1 1998; Soltis & Soltis 2000). As a consequence, allopolyploid
11 genomes may possess an abundance of inverted repeat sites.
12 Poa is a polyploid complex within the Poaceae whose
13 study is complicated by the possibility of segregation for
14 three or more alleles at a locus. To address genome analysis
15 in polyploid plant species, researchers have focused their
16 efforts on the development of single dose markers (SDM)
17 (Ming et al. 2001). RAPD, AP-PCR and low-stringency sin-
18 gle-specific primer PCR (LSSP-SSR) are unique single pri-
19 mer techniques that during a successful PCR amplification
20 process, can be used to randomly scan a genome for small
21 inverted repeats or quasi-inverted repeats that are comple-
22 mentary to the primers.
23 As an extension of these approaches, the use of higher
24 annealing temperatures and longer primers could generate
25 PCR amplification products that are highly specific for these
26 inverted or quasi-inverted repeat regions. A huge resource
27 of potentially useful oligos are available from public SSR pri-
28 mer databases and most have been generated by appropriate
29 primer generation protocols (e.g. primer3, NCBI). By utiliz-
30 ing a rapid and efficient selection approach, a large number
31 of single primers with a high level of informativeness could
32 be used for the identification of inverted or quasi-inverted
33 repeats and the detection and measurement of variability in
34 a polyploid grass species.
35 In this study, SSR primers are used in the same manner as
36 RAPD-PCR with the exceptions that: (i) the primers are
37 longer than RAPD oligos; (ii) annealing temperatures are
38 higher; and (iii) only amplification products exhibiting one
39 or a few bands are utilized. Primers generating multiple and
40 complex PCR amplification profiles were discarded. As such,
41 only oligos having a high affinity for a complementary DNA
42 region are considered useful. The evaluations successfully
43 identified several primers at high stringency conditions that
44 were associated to potential inverted or quasi-inverted
45 repeat regions in the Poa genome. For simplicity, this
46 approach is assigned the acronym PAL-PCR for palindrome
47 PCR. The approach discovers and exploits the occurrence
48 of PAL that flank genomic regions of approximately
49 150–3.0 kb to generate specific and informative genotypes
50 for polyploid grasses. The subsequent selection of low- or
51 single-dose amplification products rapidly generates an
52 abundance of useful PCR-based markers for genotyping and
53 genetic analysis in Poa.
2 Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10
B. Kindiger and T. R. Conley
Materials and methods
Representatives of the genus Poa and some of its interspe-
cific hybrids were selected for the study because the genus:
(i) is genetically complex; (ii) represents over 300 species;
(iii) maintains a vast array of ploidy levels; (iv) is found in
numerous ecological niches; and (v) possess two reproduc-
tive forms (sexual and apomictic) (Huff 1992). The founda-
tion species for this study is Poa arachnifera Torrey (Texas
bluegrass) a dioecious, complex allopolyploid with a sexual
mode of reproduction. A series of P. arachnifera · Poa prat-
ensis L., P. arachnifera · Poa secunda J. Presl and P. arach-
nifera · P. ligularis Nees ex Steudel interspecific hybrids
were also included in the study to determine expression of
the PCR amplification products and measure the potential
of PAL-PCR to identify genotypic differences. All the Poa
spp. germplasm resources used in the study are part of a
working germplasm collection maintained at the USDA-
ARS, Grazinglands Research Laboratory, El Reno, OK, USA.
The Arabidopsis thaliana (L.) Heynh. ecotype Columbia was
provided by Oklahoma City University and the Oryza sativa
L. c.v. Melrose (PI595211) was obtained through the USDA
Western Regional Plant Introduction Station, Pullman, WA,
USA.
The species from which the SSR primers evaluated in this
study were selected at random, with the common denomi-
nator being that they were generated by a variety of labora-
tories to identify various types of microsatellite repeats
(Green et al. 2000; Kang et al. 2001; Taylor et al. 2001; Song
et al. 2002; Ramakrishnan 2003; Tsuruta et al. 2005). The
226 evaluated primers ranged 18–34 nucleotides (nt) in
length and represented a wide range of microsatellite loci
with various repetitions of di-, tri- and tetra-nucleotide
motifs found in various cool- and warm-season grass species
(Table 1). Microsatellite information regarding the specific
method for microsatellite identification and primer design
can be found by referencing the citations in Table 1.
The species from which 63 non-SSR primers were
obtained were selected entirely at random and were gener-
ated by various research units to amplify genomic regions
having consequence for marker-to-trait associations in Triti-
cum aestivum L., Hordeum vulgare L. and Lolium perenne L.
genetic programs (Table 1). The non-SSR primers, not
including RAPD primers, ranged 10–29 nt in length and
represent an array of various types: (i) sequence character-
ized amplified repeat (SCAR) markers that were generated
from randomly generated RAPD products (Hernandez et al.
1999); (ii) SCAR markers generated from RAPD markers
having an association to a particular gene locus (Wang et al.
2002); (iii) amplified fragment length polymorphism
(AFLP) markers converted to sequence-specific PCR mark-
ers (Shan et al. 1999); and (iv) sequence tagged site (STS)
markers converted from restriction fragment length poly-
ª 2009 The Authors
 B. Kindiger and T. R. Conley Utilizing single primers for PCR

1 Table 1 Primer sources, identification, the genus from which the original primers were generated, number utilized, number that were informative
2 and percent informative
3
Primer Number Number Percent
4
source Designation Genus ⁄ species attempted informative informative Source reference
5
6 SSR URP Oryza sativa 12 5 41.7 Kang et al. 2001
7 BAR Triticum aestivum 36 5 13.9 Song et al. 2002
8 LM, LP, M, PR Lolium perenne ⁄ multiflorum 80 35 43.8 Kindiger 2006
9 ZjAg, M Zoysia japonica 56 29 51.8 Tsuruta et al. 2005
Bt Bromus tectorum 24 18 75 Ramakrishnan 2003
10
As Anisantha sterilis 18 9 50 Green et al. 2000
11
Total 226 101 44.7
12 Non-SSR MWG (RFLP) Triticum aestivum 8 1 6.7 Sayed-Tabatabaei et al. 1998;
13 Wang et al. 2002
14 XJ (AFLP) Triticum aesticum 6 0 0 Shan et al. 1999
15 IAS (SCAR) Triticum aestivum 22 2 9 Hernandez et al. 1999
16 LPASP (STS) Lolium perenne 27 2 7.4 Taylor et al. 2001
ISSR Various sources 100 7 7 University of British Columbia,
17
UBC Primer Set 9, Zietkiewics et al. 1994
18
RAPD Not applicable 280 44 15.7 University of British Columbia,
19 UBC Primer Sets 1–8; Operon
20 Primer Kits A thru D
21 Total 443 56 12.6
22
23 Sequences for the primers can be found by referencing the appropriate source of each primer.
24
25 morphism (RFLP) clones (Sayed-Tabatabaei et al. 1998). A grammed on a MWG Primus-96 thermal cycler (MWG,
26 total of 280 RAPD primers were obtained from both the High Point, NC, USA) following the protocol: 1 cycle at
27 University of British Columbia UBC1-200 and Operon 94C for 3 min followed by 30 cycles of 45 s at 94C, 45 s at
28 Technologies OP Kits A, B, C and D. Sequences of the 55C annealing temperature, and 45 s at 72C with a final
29 RAPD primers can be found by contacting the University of extension step of 72C of 4 min. PCR reactions were held at
30 British Columbia Nucleic Acid-Protein Service Unit or 4C. No attempt was made to optimize the annealing tem-
31 Operon Technologies. The inter-simple sequence repeat perature associated with any particular primer. A initial
32 (ISSR) primers utilized in the study were obtained as Primer standard annealing temperature of 50C was utilized to
33 Set #9 from the University of British Columbia Nucleic screen all non-RAPD primers. When amplification products
34 Acid-Protein Service Unit (UBC800-900) and represent a appeared robust, annealing temperature was increased to
35 compiled set of publically available ISSR sequences that have 55C to verify the primers disposition to amplify under
36 had previous success in detecting polymorphisms in other higher annealing temperatures. Amplifications at annealing
37 species (Zietkiewics et al. 1994). Sequences of the ISSR temperatures higher than 55C were not performed. All
38 oligos can be found by contacting the University of British RAPD primers evaluated in this study followed the above
39 Columbia Nucleic Acid-Protein Service Unit. Variability for methods with the exception that the annealing temperature
40 each locus amplified by each marker were measured using was 37C. Due to the polyploid nature of P. arachnifera, it
41 a the polymorphic index content (PIC) determinations was anticipated that more than one or two amplification
42 were calculated following the procedure of Anderson et al. products could be generated from a particular genomic
43 (1993) and are provided in Table 2. Nulls were not included region. In addition, we were also aware that varying levels of
44 in the calculation. mispriming could generate multiple amplification products
45 The Master Pure Plant Leaf DNA Purification Kit (Epi- that would not be specific to a particular genome region. As
46 centre Technologies, Madison, WI, USA) was used for all such, we used the following criteria to identify amplification
47 DNA extractions following the manufacturer’s protocol. products, genotypes and single primers that would be
48 Template DNA (5 ng) was amplified by PCR in a total considered useful and informative. Following electrophore-
49 volume of 25 uL utilizing Ready Mix Taq (Sigma-Aldrich, sis and gel analysis, only gels exhibiting five or fewer distin-
50 St Louis, MO, USA) and following the manufacture’s guishable bands per lane were considered to exhibit specific
51 instructions. The level of polymorphism for the 671 single primer-to-template complementation during the PCR reac-
52 primers were determined by genotyping eight to 10 tion. Each band exhibited in a particular lane, when using
53 P. arachnifera individuals. The PCR conditions were pro- P. arachnifera as the initial evaluating material, were consid-

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10 3
 Utilizing single primers for PCR B. Kindiger and T. R. Conley

1 Table 2 Single primers and their sequences that successfully identified polymorphisms during their evaluation across several Poa arachnifera indi-
2 viduals
3
Primer Number of Approximate
4
designation Genus ⁄ species Type Primer sequence seg. bands size PIC
5
6 AS115F Anisantha sterilis SSR GTTGCTGCTGCCAGGCTGA 1 500 0.75
7 AS133R Anisantha sterilis SSR TGATAGAAGTAATACGAGGCG 1 1200 0.63
8 AS147R Anisantha sterilis SSR ACTGTGGTGATCGTAACCCGTG 3 750, 450, 300 0.72, 0.63, 0.54
9 AS152F Anisantha sterilis SSR AAGGTTCAAAGTGTAAGGACG 1 1100 0.65
AS152R Anisantha sterilis SSR AGGAGAAGAAGAACGAGAGAA 1 450 0.50
10
AS184F Anisantha sterilis SSR CGGAATGTTGTCAGAATAGTT 1 475 0.67
11
AS184R Anisantha sterilis SSR ACGAACCGTGGAACTTGTTAC 2 500, 510 0.78, 0.45
12 AS211R Anisantha sterilis SSR TCCAAGGACCCACCGATCTC 2 750, 500 0.84. 0.45
13 AS211F Anisantha sterilis SSR TTCTATGTAATCATGGCTTGC 1 675 0.56
14 BT01F Bromus tectorum SSR GGCAAACTCTCATATCACACACCCA 2 490, 300 0.73, 0.63
15 BT01R Bromus tectorum SSR CTCACCTTTGTCTCCTTCCCCTCAC 1 1000 0.67
16 BT03F Bromus tectorum SSR GCATGTCCACCTCCATGGCCACGCC 1 750 0.73
BT03R Bromus tectorum SSR CTGTCTTCCTCCCTCCCTCACTTGTGTTCC 1 650 0.32
17
BT04F Bromus tectorum SSR ACAGAGCTACCTATCTATGTGCAA 2 700, 490 0.41. 0.73
18
BT04R Bromus tectorum SSR GGTATGTTACCATGTTGCTTCC 2 650, 550 0.63, 0.55
19 BT05R Bromus tectorum SSR CGGTGGACGACGGGAAAGCGGAGCA 2 700, 350 0.71, 0.63
20 BT11F Bromus tectorum SSR CAGAGACTCGAGGCATGAGACCATC 2 450, 400 0.45, 0.84
21 BT12R Bromus tectorum SSR GAAAAGAAAATGAAACACCTTGC 1 700 0.56
22 BT12F Bromus tectorum SSR ATATTGTGGTGGCCAGTGC 3 400-500 0.78, 0.63, 0.54
23 BT20F Bromus tectorum SSR AAGATACAAGTCTTAGCCCCAAGGG 1 700 0.70
BT20R Bromus tectorum SSR TTCCTCCCCCTTGGCAGCCGTCTTG 3 750, 700, 300 0.77, 0.65, 0.73
24
BT23F Bromus tectorum SSR GACCACATGAGTTGGTGTGC 3 900, 700, 500, 480 0.84, 0.45, 0.54, 0.73
25
BT23R Bromus tectorum SSR AAAAGGTTTTGATTCTCCACGA 1 900 0.25
26 BT26F Bromus tectorum SSR ATCCGTCCCTCTTTCTTTGCGCTGC 1 175 0.54
27 BT26R Bromus tectorum SSR GGAGGAAGAAGAATGACCGAGAGAG 2 500, 450 0.74, 0.54
28 BT33F Bromus tectorum SSR CTGCTATATCATGAGGCCATTGGGA 2 1200, 900 0.77, 0.84
29 BT33R Bromus tectorum SSR AGTTTGTACAGCAGCCTGAGGCATG 3 800, 450, 300 0.77, 0.88, 0.73
30 UBC825 ISSR Kit #9 ISSR ACACACACACACACACT 3 750, 525, 350 0.56, 0.73, 0.84
UBC840 ISSR Kit #9 ISSR GAGAGAGAGAGAGAGAYT 1 1000 0.88
31
UBC873 ISSR Kit #9 ISSR GACAGACAGACAGACA 3 850, 750, 590 0.55, 0.34, 0.20
32
UBC890 ISSR Kit #9 ISSR VHVGTGTGTGTGTGTGT 2 475, 290 0.78, 0.84
33 UBC834 ISSR Kit #9 ISSR AGAGAGAGAGAGAGAGYT 1 450 0.73
34 UBC880 ISSR Kit #9 ISSR GGAGAGGAGAGGAGA 1 600 0.73
35 UBC881 ISSR Kit #9 ISSR GGGTGGGGTGGGGTG 1 750 0.73
36 LM1-1B R Lolium multiflorum SSR GCTTTGCCGGTTATGGCTCC 1 500 0.73
37 LM1-11A F Lolium multiflorum SSR CGTGTTCTGCTCGGATCCTG 3 750, 500, 300 0.73, 0.73, 0.84
LM2-1B F Lolium multiflorum SSR CTTTATTGCACTTTACTTGCCTTGC 1 500 0.54
38
LM2-1B R Lolium multiflorum SSR CGATGTTCCACGTCAGGTGG 1 350 0.45
39
LM12-10F F Lolium multiflorum SSR AATTCAACCATGCAAGGAGG 2 1200, 500 0.54, 0.73
40 LM12-10F R Lolium multiflorum SSR GCGGCATTAGCVAAVAAGC 1 1100 0.78
41 LM2-1B R Lolium multiflorum SSR CGATGTTCCACGTCAGGTGG 1 1000 0.78
42 LM3-11B F Lolium multiflorum SSR GGCAAGTGCAAATCCATTGC 2 1100, 1000 0.78, 0.78
43 LM3-11B R Lolium multiflorum SSR CCAAAGTGGGCTTCCCAAGA 1 800 0.54
44 LM3-1F R Lolium multiflorum SSR GTTCGGCACACCAACTCACG 3 800, 625, 400 0.73, 0.78, 0.45
LM3-4C F Lolium multiflorum SSR CTTCTATGGTTGACCTGCTGCG 2 750, 600 0.84, 0.54
45
LM3-4C R Lolium multiflorum SSR TAAGGGCATGAGTGCGGTCA 1 225 0.78
46
LM3-4E F Lolium multiflorum SSR CTCAAAATGAGCCCGCCTTG 2 800, 400 0.54, 0.56
47 LM3-4F F Lolium multiflorum SSR CAGATGGGCAGTTGCCACTG 2 510, 200 0.78, 0.84
48 LM4-10C R Lolium multiflorum SSR CAGTCGGAGTGCTGATGATCG 1 425 0.78
49 LPSSRH01A02F Lolium perenne SSR AAAGACCGCATACGAAGT 2 1000, 600 0.54, 0.78
50 LPSSRH01A02R Lolium perenne SSR AACCAAAGCCTCAAGACA 2 750, 720 0.54, 0.78
51 LPSSRH01A07F Lolium perenne SSR TGGAGGGCTCGTGGAGAAGT 3 600, 480, 300 0.45, 0.81, 0.81
LPSSRH01A07R Lolium perenne SSR CGGTTCCCACGCCTTGC 1 700 0.73
52
53

ª 2009 The Authors

4 Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10
 B. Kindiger and T. R. Conley Utilizing single primers for PCR

1 Table 2 (continued )
2
3 Primer Number of Approximate
designation Genus ⁄ species Type Primer sequence seg. bands size PIC
4
5 LPSSRH01A10F Lolium perenne SSR GAGGCACCGGCCATGGAG 1 250 0.84
6 LPSSRH01A10R Lolium perenne SSR AGGACGAGCCACTCACTTG 3 1100, 500, 250 0.73, 0.73
7 LPSSRH01D09 F Lolium perenne SSR CAAGTGCCACCATAGATACAA 1 750 0.73
8 LPSSRH01E10 F Lolium perenne SSR CGCAGCTTAATTTAGTC 1 500 0.78
9 LPSSRK01A03 R Lolium perenne SSR CGGGCATGGTGAGAAGGA 1 1100 0.78
LPSSRK01A03 F Lolium perenne SSR GGACGAACTGCCGACACA 1 650 0.54
10
M16B R Lolium perenne SSR AGCCGAGGCTCAGCTCGA 1 650 0.73
11
M12-52 R Lolium perenne SSR TAGAGGCACCCGCGCCCT 2 700, 400 0.78
12 M2-148 R Lolium perenne SSR GAGGCTCGATCTTCACGGA 2 1100, 600 0.73
13 M144 F Lolium perenne SSR CAGAAGGAGGTCGTCGA 1 800 0.81
14 M3B02F Lolium perenne SSR GAAAGCAATATTTGTACGAGG 3 490, 510, 550 0.54
15 M4213 F Lolium perenne SSR CACCTCCCGCTGCATGGCATGT 2 750, 325 0.78, 0.78
16 M15185 R Lolium perenne SSR TACCAGCACAGGCAGGTTC 3 1200, 800, 500 0.78, 0.73
PRE R Lolium perenne SSR GTTAGGTTCGTCTGCAT 1 1200 0.78
17
PR10 F Lolium perenne SSR CTTCTAATCCCTCGCCT 1 650 0.81
18
PR8 R Lolium perenne SSR GCCGTCGCACCCCTG 1 800 0.73
19 LPASP-F F Lolium perenne STS GGCGTGGACCCGAACCTG 1 500 0.54
20 LPASP-F R Lolium perenne STS TGGGTACCTCACTCCCAGATGCCGACCTC 1 500 0.73
21 URP1 F Oryza sativa SSR ATCCAAGGTCCGAGACAACC 2 500 750 0.73
22 URP6 R Oryza sativa SSR GGCAAGCTGGTGGGAGGTAC 1 450 0.78
23 URP2 F Oryza sativa SSR GTGTGCGATCAGTTGCTGGG 1 450 0.81
URP25 F Oryza sativa SSR GATGTGTTCTTGGAGCCTGT 1 500 0.81
24
URP30 F Oryza sativa SSR GGACAAGAAGAGGATGTGGA 1 300 0.81
25
MWG807 F Triticum aestivum RFLP TACTGGGTGTTCGGTGTGGC 5 several calc. not performed
26 IASPHCR5 R Triticum aestivum SCAR CCGCAACAATATCATGTGACG 1 350 0.54
27 IASPHC6-4 F Triticum aestivum SCAR AAAGGGGTCCAAACATATTACTTTTACTA 1 450 0.78
28 BARC004 F Triticum aestivum SSR GCGTGTTTGTGTCTGCGTTCTA 1 300 0.84
29 BARC004 R Triticum aestivum SSR CACCACACATGCCACCTTCTTT 2 600, 450 0.45, 0.45
30 BARC008 F Triticum aestivum SSR GCGGGAATCATGCATAGGAAACAGAAAA 2 800, 500 0.73; 0.78
BARC010A F Triticum aestivum SSR CGACAGAGTGATCACCCAAATATAACAT 2 500, 280 0.54, 0.15
31
BARC010A R Triticum aestivum SSR CGGTCTAATTGTCAATGTA 3 1000, 500, 300 0.78, 0.73
32
IASPHC1-1.2 F Triticum aestivum SSR CCTTCGCATGAGATCGGCAAACT 1 400 0.84
33 IASPHC1-1.2 R Triticum aestivum SSR AACTACTGGCAGAGGAGGTACGCAACT 1 300 0.73
34 ZjAG101F Zoysia japonica SSR GGCCTCAATCTGCAATTCA 2 1400, 700 0.78
35 ZjAG101R Zoysia japonica SSR AGTCTTTTGGTCGGCAAGTATA 1 750 0.63
36 ZjAG116F Zoysia japonica SSR AGGAGGTGGCGAATCACA 2 1000, 490 0.78, 0.78
37
Polymorphic content index determinations (PIC) are provided in order for each amplification product.
38
39
40 ered useful. Each band was considered to represent variable ethylene diamine tetra acetate (TBE) utilizing a 4.0% Amer-
41 homologous loci because mapping data and progeny analy- sco-SFR agarose gel with a run time of approximately 1.5 h.
42 sis were not performed to test for allelism. Gels exhibiting The Amresco-SFR agarose is a high-quality agarose that has
43 six or more amplification products per lane (on average) proven effective in discriminating and detecting micro-
44 were not maintained or considered informative because they satellite variation in genetic studies of maize and Poa (Davis
45 may have resulted from mispriming events or amplified et al. 1999; Kindiger 2006). As a consequence, the utilization
46 more than one inverted region in the P. arachnifera genome. of a high-quality agarose to investigate potential genetic
47 As such, analysis of a complicated or complex PCR amplifi- marker variability in this study is appropriate. Gels were
48 cation profile would diminish the intent of rapid genotyping stained with EtBr and examined with a ultraviolet illumina-
49 and band scoring. Typically, primers that generated the few- tor and data were collected and stored on a ‘‘Speedlight’’ gel
50 est number of PCR amplification products were considered documentation system (Lighthouse Research, Encinitas, CA,
51 to be the most suitable and informative. USA). PCR fragments were characterized according to size
52 Following the PCR reaction, 10 lL of the reaction mixture by the inclusion of a 100-bp Promega molecular weight
53 was resolved by horizontal electrophoresis in 1· Tris-borate- marker (cat. no. G316A; Madison, WI, USA).

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10 5
 Utilizing single primers for PCR
1 Oligonucleotide sequences were generated by Sigma-
2 Aldrich-Genosys or the University of British Columbia.
3 Amplification products selected for sequencing were selected
4 at random and were cloned utilizing the pCR2.1 vector of
5 the Original TA cloning kit (Invitrogen, Carlsbad, CA,
6 USA). All inserts were sequenced by Northwoods DNA (Sol-
7 way, MN, USA) through a single pass sequencing approach
8 on an ABI3000 DNA sequenced by Northwoods DNA. For
9 the study, 25 randomly selected amplification products were
10 chosen for sequencing. Sequence comparisons were per-
11 formed utilizing the clustalw multiple sequence alignment
12 server (Thompson et al. 1994). When primers were
13 designed, the primer3 software package available at NCBI
14 was utilized (Rozen & Skaletsky 2000).
15 Three steps were performed to confirm that the single pri-
16 mer PCR products were not artifacts or products of poten-
17 tially complex PCR events. First, a twofold increase in the
18 template concentration was performed in the initial PCR
19 reactions with no modification in PCR amplification prod-
20 ucts (Welsh et al. 1995; Atienzar et al. 2000). If the PCR
21 amplification products had varied among individuals and
22 PCR reactions, this would have indicated the single-primer
23 approach would not have been repeatable. This evaluation
24 was performed with 10 primers identified to provide clear
25 amplification products and no variation was observed.
26 Second, because completely sequenced nuclear and chlo-
27 roplast genome information is available in Arabidopsis thia-
28 liana and O. sativa, single primer PCR products were
29 generated in A. thialiana and O. sativa, cloned, sequenced
30 and submitted to a BLAST search and compared utilizing
31 clustalw software. For both Arabidopsis and Oryza, the
32 PCR amplification products corresponded well to known
33 chromosome locations of the Arabidopsis and Oryza
34 genomes (data not shown).
35 In a third level of PCR product confirmation, the three
36 different amplification products generated from an analysis
37 of P. arachnifera were cloned and a pair of nested primers
38 were designed. The nested PCR protocol utilized the identi-
39 cal PCR conditions as the earlier PCR amplification meth-
40 odology. In these instances, the nested primer pair produced
41 a slightly smaller PCR product with a sequence that was
42 complementary to the original single primer sequence (data
43 not shown). The results of these studies confirm that the
44 PCR amplification products or PAL-PCR represent true
45 amplified genome regions and not PCR artifacts.
46
47
Results
48
49 For the overall study, a total of 669 single primers were eval-
50 uated against P. arachnifera. Table 1 summarizes the species
51 origin of the original SSR primer sequences and the type of
52 approach utilized to generate the primer (e.g. SSR, RAPD,
53 SCAR, RFLP, STS). Table 2 lists the identity and primer
6 Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10
B. Kindiger and T. R. Conley
sequence which provided informative band segregation in
P. arachnifera.
Utilizing single primers generated from microsatellite
repeat sites, 101 informative markers were identified, result-
ing in a success level of 44.7 (Table 1). The non-SSR derived
primers provided 56 informative markers with an accumula-
tive success rate of 13.3%. Of the 280 RAPD primers evalu-
ated, 44 were identified to be informative providing a success
level of 15.7%. From 100 evaluated ISSR primers, seven were
identified to be useful. Overall, microsatellite-derived prim-
ers exceeded the combined ability of ISSR and non-SSR
primers to identify polymorphic loci in P. arachnifera.
The success of microsatellite-generated primers varied
among species and ranged from a high of 75% to a low of
13.9% (Table 1). An evaluation of the published methods
that identified the original species microsatellite regions and
developed the particular SSR primers did not suggest a ten-
dency for a particular type of repetitive motif or primer gen-
eration approach to predispose an individual primer to be
informative in PAL-PCR. In addition, the single primer
amplification products were observed to be reproducible
and preliminary evaluations suggest they can be useful in
multiplex reactions. Amplification conditions appeared to
be efficient; however, as with traditional two primer PCR
approaches, the efficiency of amplification reaction can be
adjusted with respect to the length and base pair composi-
tion of the primer pairs (Shagin et al. 1999). It is likely, sim-
ilar tweaking of the described procedures will result in
similar results.
The primers providing informative and clear amplifica-
tion products were observed to be useful in genotyping and
identifying differences across P. arachnifera and various Poa
species and several Poa interspecific hybrids (Figures 1–3).
The PCR amplification products exhibited both dominant
and co-dominant expression and allowed efficient and rapid
scoring.
Overall, the type and form of the PCR amplification
product varied with the particular locus amplified or primer
utilized. In some instances, sequence comparisons of bands
exhibiting similar size, generated from various Poa spp.,
indicated orthologous regions among Poa species. In other
instances, bands were unique to a particular Poa spp. In sev-
eral instances, variable homologous loci were observed when
utilizing a single primer associated to a newly identified PAL
region. As an example, primer M3B02F was able to identify
at least three variable homologous loci variations per
individual (Figure 1, lanes 2 and 4). Sequence comparisons
of the cloned PCR products indicated the bands represented
similar amplification products or presumed variable homo-
logous loci. A clustalw sequence comparison of cloned
and sequenced PCR amplification products utilizing primer
M3B02F across several P. arachnifera individuals are shown
in Figure 2. Size differences were associated to sequence
ª 2009 The Authors
 B. Kindiger and T. R. Conley Utilizing single primers for PCR

1
2
3
4
5
6
7
8
9
10
L1 L2 L3 L4 L5 L6 L7 L8 L9
11
12 Figure 1 L2–9 illustrate amplicons from eight Poa arachnifera individ-
13 uals using primer M3BO2F. L1, Promega 100-bp molecular weight
14 marker. The 100–400-bp marker bands are shown. Differences in
15 band migration are due to sequence deletions ⁄ insertions ⁄ substitutions
16 in the polymerase chain reaction products. Cloned and sequenced
amplicons are identified as CL# and their sequence information is pro-
17
vided in Figure 2.
18
19 length with regard to presence ⁄ absence of duplicate ⁄ deleted
20 regions. Bands exhibiting lower molecular weights were
21 missing similar or different regions in the sequence flanked
22 by the primer. In the provided example for M3BO2F, the
23 major sequences differences were found in a 90–110 bp
24 region of the PCR amplification product. The observed
25 sequence variation is suggested to be caused by prior DNA
26 duplication ⁄ deletion events generated by the presence of an
27 ancient hairpin or cruciform forming structure which
28 accompanies the inverted repeat or quasi-inverted repeat
29 sequence. Research has shown that inverted repeats or palin-
30 dromes can generate hairpin or cruciform forming
31 sequences that allows the DNA to fold back on itself which
32 can result in frameship mutations by bringing the DNA slip-
33 page sites into close proximity leading to deletions as well as
34 insertion mutations (De & Ripley 1984; Glickman & Ripley
35 1984; Schroth & Ho 1995; Okawara et al. 2003). Palin-
36 dromes as small as 10–17 bp are known to generate these
37 type of secondary structures (Kato et al. 1998, 2003) and
38 atypical pairing events leading to duplications, deletions and
39 genome rearrangements can stabilize the hairpin structures
40 over time and the effects of this stabilization can be observed
41 as sequence variation at the locus (Sinden et al. 1991; Pujol
42 et al. 1999). We hypothesize that these palindrome regions Figure 2 A partial sequence alignment of seven cloned M3B02F poly-
43 are of ancient origin, and based on the small size of the merase chain reaction amplification products generated from various
44 internal sequence flanked by the palindrome, the majority of Poa arachnifera individuals (Figure 1). Sequence similarity is high
45 the observed variable homologous loci variability are stable across all amplification products with differences due to small or large
46 and characteristic of that specific individual or genome. deletions or additions of sequence. The sequence differences observed
among the clones are presumed to identify variable homologous loci
47 BLAST searches of some cloned PCR products identified
within or among particular individuals.
48 that the PCR product had sequence similarity to previously
49 known and sequenced TE transposition events. In the case
50 of primer LM4-10C(R), a BLAST sequence search resulted many monocot grass species (Wolfgang et al. 1991; Chopra
51 in a 84.2% match to a region of Transposase_21, transposase et al. 1999). Additional sequence followed by BLAST
52 family of tnp2 (acc. no. pfam02992.11), a class of En-Spm searches resulted in identifying additional TE events as well
53 family of TE which represent a conserved domain among as sequence of unknown function and derivation.

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10 7
 Utilizing single primers for PCR B. Kindiger and T. R. Conley

1
Discussion
2
3 Similar to RAPD-PCR, AP-PCR and LSSP-PCR, PAL-PCR
4 also amplifies DNA sequence with a single oligo primer in
5 which the 3¢-end of the annealed primers face one
6 another on opposite strands and are no more than 3 kb
7 L1 L2 L3 L4 L5 L6 L7 L8 L9 L9 L10 L11 L12 L13 apart (Weising et al. 1995). Success in generating PCR
8 Figure 3 Single-primer amplification products generated by primer
amplification products at high annealing temperature sug-
9 BT33F across several Poa species, hybrids or Poa cultivars. L1, P. arachnif- gests that the primer annealing sites could be inverted
10 era female; L2, P. arachnifera male; L3, P. arachnifera · P. pratensis F1 or quasi-inverted repeats. However, because RAPD-PCR,
11 hybrid; L4, P. arachnifera · P. secunda F1 hybrid; L5, P. secunda; L6, P. AP-PCR and LSSP-PCR utilize low annealing temperatures
12 pratensis (KB3, local ecotype); L7, P. pratensis cv. Baron; L8, P. pratensis (37C) many mispriming events are known to occur. When
13 cv. Bartheia; L9, P. pratensis cv. Barrister; L10, P. arida; L11, P. labillardi- utilizing longer oligos at higher annealing temperatures
eri; L12, P. ligularis; L13, Promega molecular weight marker (top line and
14 (55C) the products generated by PAL-PCR would be more
lower line indicate approximate 750 and 250 bp weights).
15 specific to the annealing site and result in fewer mispriming
16 A comparison of SSR primer utilization to non-SSR events. As a result, PAL-PCR can more successfully identify
17 derived primers suggests that SSR primer sequence has the the presence of inverted repeat or quasi-inverted repeat sites
18 capacity to identify polymorphisms or small palindromes within a genome.
19 more regularly than non-SSR primer sequence. In both Preliminary applications of single primer PCR to Bromus
20 instances, the selection of the primer sequence was random inermis, Dactylis glomerata, Thinopyrum ponticum (B. Kindi-
21 and the inability of non-SSR primer sequences to generate 2 ger, unpublished data), Lolium perenne (M. Fujimori, per-
22 an equivalent frequency of polymorphic or informative 3 sonal communication) and Argostis spp. (T. Takamizo,
23 amplification products was unanticipated. Overall, regard- 4 personal communication) suggest that PAL-PCR will be
24 less of which species provided the non-SSR primers, their equally effective in generating dominant and co-dominant
25 ability to generate informative PCR products in P. arachnif- PCR-based markers associated with inverted repeat regions
26 era was lower than SSR-associated primers. The success in in other polyploid species. As with RAPD-PCR, AP-PCR
27 utilizing SSR primers to identify palindrome regions in a and LSSP-PCR, different patterns are obtained with PAL-
28 polyploid grass genome may not be coincidental. Prelimin- PCR that identify differences in sequence that can be utilized
29 ary research regarding flanking regions of microsatellite sites to genotype individuals or be used as markers in a marker-
30 suggest these regions may contain specialized sequence assisted selection program. Though the application of PAL-
31 (Temnykh et al. 2001; Mogg et al. 2002). However, these PCR can be effective in diploid species (Zea mays L., Arabid-
32 studies are preliminary and before conclusions can be devel- opsis, Oryza) possessing palindrome regions (B. Kindiger,
33 oped, additional investigation is required at the genomic 5 unpublished data), its greater value may reside with its use
34 and sequence level in organisms with smaller genomes. The in polyploid species. Though unconfirmed, the authors
35 tendency of SSR primers to provide more informative mark- anticipate that the palindrome sites within Poa ssp. are ran-
36 ers than non-SSR derived primers is clear from this study; domly dispersed throughout the genome like TE transposi-
37 however, it is not possible to provide a complete interpreta- tion events (Ellis et al. 1998; Federoff 2000).
38 tion of the results. SSR primers generated from species that
39 are true forage grasses (Bromus, Zoysia, Lolium), with the
Conclusion
40 possible exception of Oryza, appear to identify polymor-
41 phisms in P. arachnifera at a higher frequency than those A PCR approach that uses a single primer was developed
42 obtained from Triticum. Because the Oryza genome contains that takes advantage of potential inverted or quasi-inverted
43 much segmental genome duplication, and as a species is repeat regions presumably occurring in complex polyploid
44 considered a genomic model for many grass genomes, likely grass species. This approach, called PAL-PCR, reflects the
45 including forage grasses, this result may not be surprising formation of PCR products obtained through the use of a
46 (Wang et al. 2000; Chandler & Wessler 2001; Eckardt 2001; single long oligo having a high affinity for a complementary
47 Feuillet & Keller 2002). However, additional studies are nec- DNA region at high stringency PCR conditions. Single
48 essary to determine if the selection of single SSR primers for primers obtained from primer pairs developed for SSR and
49 PAL-PCR from forage grasses is superior to those selected non-SSR regions of O. sativa, T. aestivum, Lolium spp.,
50 from non-forage grass resources. Overall, considering the Z. japonica, Bromus tectorum and Bromus sterilis were evalu-
51 species from which the SSR primer sequences were derived ated in P. arachnifera, at high stringency PCR conditions
52 for PAL-PCR and the evolutionary distance of those species and suggested that the single primer PCR approach could be
53 from P. arachnifera, the primers performed remarkably well. effective in providing informative genotypic information.

ª 2009 The Authors

8 Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10
 B. Kindiger and T. R. Conley Utilizing single primers for PCR

1 Overall, single primers developed from SSR sites in Casa AM, Brouwer C, Nagel A, Wang L, Zhang Q, Kresovich
2 O. sativa, T. aestivum, Lolium ssp., Z. japonica, B. tectorum S, Wessler SR (2000) The MITE family heartbreaker (Hbr):
3 and B. sterilis were observed to generate reproducible and molecular markers in maize. Proc Natl Acad Sci USA 97:
4 informative PCR amplification products more frequently 10083–10089.
5 and reliably than non-SSR markers (AFLP, ISSR, STS, Chandler VL, Wessler S (2001) Grasses. A collective model sys-
6 RAPD) generated from the same species. SSR primers devel- tem. Plant Physiol 125: 1155–1156.
7 oped for microsatellite regions in B. tectorum, B. sterilis and Charrier B, Foucher F, Kondorsi E, d’Aubenton-Carafa Y,
8 Z. japoinca were found to more frequently identify discrete Thermes C, Kondorsi A, Rater P (1999) Bigfoot: a new
family of MITE elements characterized from the Medicago
9 differences in P. arachnifera than similar SSR primers
7 genus. Plant J 18: 431–341.
10 obtained from O. sativa, T. aestivum and Lolium ssp.
Chopra S, Brendel V, Zhang J, Axtell JD, Peterson T (1999)
11 Palindrome PCR was identified to be capable of generat-
Molecular characterization of a mutable pigmentation pheno-
12 ing reproducible genotypic information not only in
type and isolation of the first active transposable element from
13 P. arachnifera but also a wide range of Poa ssp. Sequence
Sorghum bicolor. Proc Natl Acad Sci USA 96: 15330–15335.
14 information obtained from cloned PCR amplification prod- Davis GL, McMullen MD, Baysdorfer C et al. (1999) A maize
15 ucts indicate the generation of multiple bands represents the map standard with sequenced core markers, grass genome
16 presence of homologous loci within the evaluated individ- reference points and 932 expressed sequence tagged sites
17 ual. Molecular size differences across these homologous loci (ESTs) in a 1736-locus map. Genetics 152: 1137–1172.
18 suggested the presence of hot-spot regions that are prone to De BJ, Ripley LS (1984) Demonstration of the production of
19 sequence loss or gain. In some instances, cloned PCR prod- frameshit and base-substitution mutations by quasipalindro-
20 ucts identified sequence similarity to previously identified mic DNA sequences. Proc Natl Acad Sci USA 81: 5528–5531.
21 transposabale element transposition events. Similar to Eckardt NA (2001) Everything in its place: conservation of
22 RAPD-PCR, AP-PCR and LSSP-PCR, this approach should gene order among distantly related plant species. Plant Cell
23 be useful across a wide range of species where the number of 13: 723–725.
24 available markers is small or are difficult or expensive to Ellis THN, Poyser SJ, Knox MR, Vershinin AV, Amrose MJ
25 generate. PAL-PCR appears to have its greatest application (1998) Polymorphism of insertion sites of Ty1-copia class
26 in genotyping and marker-assisted selection studies. In the retrotranspons and its use for linkage and diversity analysis
27 absence of mapping data and characterization of a markers in pea. Mol Gen Genomics 260: 9–19.
28 particular dominant or co-dominant inheritance nature, it Federoff N (2000) Transposons and genome evolution in
29 is suggested that PAL markers should be scored in a similar plants. Proc Natl Acad Sci USA 97: 7002–7007.
30 fashion as RAPD-PCR markers. Feuillet C, Keller B (2002) Comparative genomics in the grass
31 family: molecular characterization of grass genome structure
and evolution. Ann Bot 89: 3–10.
32
Acknowledgments Glickman BW, Ripley LS (1984) Structural intermediates of
33
deletion mutagenesis: a role for palindromic DNA. Proc Natl
34 The authors wish to thank Dr Masahiro Fujimori and Dr
Acad Sci USA 81: 512–516.
35 Tadashi Takamizo, National Institute for Livestock and
Green JM, Edwards KJ, Usher SL, Barker JHA, Marshall EJP,
36 Grassland Science, Japan, for generously providing the
Froud-Williams RJ, Karp A (2000) Microsatellites for barren
37 L. multiflorum SSR primers and confirming application of brome (Anisantha sterilis). Mol Ecol 9: 2195.
38 the technique in Argostis spp., respectively. Hernandez P, Martin A, Dorado G (1999) Development of
39 SCARs by direct sequencing of RAPD products: a practical
40 tool for the introgression and markers-assisted selection of
References
41 wheat. Mol Breed 5: 245–253.
42 Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrels Huff DR (1992) Apomixis in Poa. In: Proceedings of the
43 ME (1993) Optimizing parental selection for genetic linkage Apomixis Workshop, USDA-ARS Publ. ARS-104. February
44 maps. Genome 36: 181–186. 11–13, Atlanta, GA, 20–25.
45 Atienzar F, Evenden A, Jha A, Savva D, Depledge M (2000) Kang H-W, Park D-S, Go S-J, Eun M-Y (2001) Fingerprinting
46 Optimized RAPD analysis generates high quality genomic of diverse genomes using PCR with universal rice primers
47 DNA profiles at high annealing temperature. BioTechniques generated from repetitive sequence of Korean weedy rice.
48 28: 52–54. Mol Cells 13: 281–287.
49 Bennetzen JL (2002) Transposable element contributions to Kato M, Matsunga K, Shimizu N (1998) A novel unusual
6 plant gene and genome evolution. Plant Mol Biol 42: 251–169. DNA structure formed in an inverted repeat sequence.
50
Carver EA, Stubbs L (1997) Zooming in on the human-mouse Biochem Biophys Res Commun 246: 532–534.
51
comparative map: genome conservation re-examined on a Kato M, Hokabe S, Itakura S, Minoshima S, Lyubchenko YL,
52
high-resolution scale. Genome Res 7: 1123–1137. Gurkov TD, Okawara H, Nagayama K, Shimizu N (2003)
53

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10 9
 Utilizing single primers for PCR B. Kindiger and T. R. Conley

1 Interarm interaction of DNA cruciform forming at a short Shagin DA, Lukyanov KA, Vagner LL, Matz MV (1999) Regu-
2 inverted repeat sequence. Biophys J 85: 402. lation of average length of complex PCR product. Nucleic
3 Kindiger B (2006) Cross-species amplification of Lolium Acids Res 27: e23.
4 microsatellites in Poa ssp. Grassl Sci 52: 105–115. Shan X, Ablake TK, Talbert LE (1999) Conversion of AFLP
5 Koszul R, Caburet S, Dujon B, Fischer G (2004) Eukaryotic markers to sequence-specific PCR markers in barley and
6 genome evolution through the spontaneous duplication of wheat. Theor Appl Genet 98: 1072–1078.
7 large chromosomal segments. EMBO J 23: 234–243. Sinden RR, Zheng G, Brankamp RG, Allen KN (1991) On the
8 Lagercrantz U (1998) Comparative mapping between Arabid- deletion of inverted repeated DNA in Escherihia coli: Effects
opsis thaliana and Brassica nigra indicates that Brassica of length, thermal stability, and cruciform formation in vivo.
9
genomes have evolved through extensive genome replication Genetics 120: 991–1005.
10
accompanied by chromosome fusions and frequent Soltis PS, Soltis DE (2000) The role of genetic and genomic
11
rearrangements. Crop Sci 150: 1217–1228. attributes in the success of polyploids. Proc Natl Acad Sci
12
Lisch DR, Freeling M, Langham RJ, Choy MY (2001) Mutator USA 97: 7051–7057.
13
transposase is widespread in the grasses. Plant Phys 125: Song QJ, Fickus EW, Cregan PB (2002) Characterization of trinu-
14 1293–1303. cleotide SSR motifs in wheat. Theor Appl Genet 104: 286–293.
15 Matzke MA, Matzke AJM (1998) Epigenetic silencing of plant Taylor C, Madsen K, Borg S, Moller MG, Boelt B, Holm PB
16 transgenes as a consequence of diverse cellular defense (2001) The development of sequence-tagges sites (STSs) in
17 responses. Cell Mol Life Sci 54: 94–103. Lolium perenne L.: the application of primer sets derived
18 Mogg R, Batley J, Hanley S, Edwards DO, Sullivan H, Edwards from other genera. Theor Appl Genet 103: 648–658.
19 KJ (2002) Characterisation of the flanking regions of Zea Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour
20 mays microsatellites reveals a large number of useful S, McCouch S (2001) Computational and experimental anal-
21 sequence polymorphisms. Theor Appl Genet 105: 532–543. ysis of microsatellite in rice (Oryza sativa L.): frequency,
22 Ming R, Sin-Chieh L, Moore PH, Irvine JE, Patterson AH length variation transposon associations, and genetic marker
23 (2001) QTL analysis in a complex autopolyploid: genetic con- potential. Genome Res 11: 1141–1152.
24 trol of sugar content in sugarcane. Genome Res 11: 1075–2084. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW:
25 Ohtsubo H, Cheng C, Ohsawa I, Tsuchimoto S, Ohtsubo E improving the sensitivity of progressive multiple sequence
26 (2004) Rice retroposon p-SINE1 and origin of cultivated alignment through sequence weighting, positions-specific
27 rice. Breed Sci 54: 1–11. gap penalties and weight matrix choice. Nucleic Acids Res
28 Okawara H, Nagayama K, Shimizu N (2003) Interarm inter- 22: 4673–4680.
29 action of DNA cruciform forming at a short inverted repeat Tsuruta S, Ebina M, Hashiguchi M, Matsuo T, Akashi R,
30 sequence. Biophys J 85: 402–408. Yamamoto T, Kobayashi M, Takahara M, Nakagawa H (2005)
31 Pena SDJ, Barreto G, Vago AR, DeMarco L, Reinach FC, Development and characterization of simple sequence repeat
Neto ED, Simpson AJG (1994) Sequence-specific gene signa- (SSR) markers in Zoysia japonica. Grassl Sci 51: 249–257.
32
tures can be obtained by PCR with single specific primers at Wang O, Liu KD, Zhang QF (2000) Segmental duplications are
33
low stringency. Proc Natl Acad Sci USA 91: 1946–1949. common in the rice genome. Acta Bot Sin 42: 1150–1155.
34
Pujol C, Joly S, Nolan B, Srikantha T, Soll DR (1999) Micro- Wang X, Lai J, Liu G, Chen F (2002) Development of a SCAR
35
evolutionary changes in Candida albicans identified by the marker for the Ph1 locus in common wheat and its applica-
36
complex Ca3 fingerprinting probe involve insertions and tion. Crop Sci 42: 1365–1368.
37 deletions of the full-length repetitive sequence RPS at Weising K, Nybom H, Wolff K, Wieland M (1995) IV.
38 specific genomic sites. Microbiology 145: 2635–2646. PCR-based DNA fingerprinting. In: DNA Fingerprinting
39 Ramakrishnan AP (2003) Microsatellite markers for Bromus 8 in Plants and Fungi. CRC Press, Boca Raton, FL, 112–139.
40 tectorum (cheatgrass) (PhD Thesis). Bringham Young Welsh J, McClelland M (1990) Fingerprinting genomes
41 University, Provo, UT ap226@email.byu.edu. using PCR and arbitrary primers. Nucleic Acids Res 18: 7213.
42 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for Welsh JD, Ralph D, McClelland M (1995) DNA and RNA
43 general users and for biologist programmers. In: Bioinfor- fingerprinting using arbitrary primed PCR. In: PCR
44 matics Methods and Protocols: Methods in Molecular Biology Strategies (eds Innis MA, Gelfand DH, Sninsky JJ), Academic
45 (eds Krawetz S, Misener S), Humana Press, Totowa, NJ, Press, San Diego, CA, 249–276.
46 365–386. Wolfgang KFN, Piotrowiak R, Saedler H, Sommer H (1991)
47 Sayed-Tabatabaei BE, Komatsuda T, Takaiwa F, Graner A The transposable element Tam1 from Antirrhinum majus
48 (1998) DNA sequence and primer designing for RFLP clones shows structural homology to the maize transposon En ⁄ Spm
49 evenly distributed in the barley genome. Barley Genet Newsl and has no sequence specificity of insertion. Mol Gen Genet
50 28: 15–18. 228: 201–208.
51 Schroth GP, Ho PS (1995) Occurrence of potential cruciform Zietkiewics E, Rafalski A, Labuda D (1994) Genome fingerprint-
52 and H-DNA forming sequences in genomic DNA. Nucleic ing by simple sequence repeat (SSR)-anchored polymerase
53 Acids Res 23: 1977–1983. chain reaction amplification. Genomics 20: 176–183.

ª 2009 The Authors

10 Journal compilation ª 2009 Blackwell Publishing Ltd, Grassland Science, 55, 1–10
 Author Query Form
Journal: GRS

Article: 161
Dear Author,
During the copy-editing of your paper, the following queries arose. Please respond to these by marking up
your proofs with the necessary changes/additions. Please write your answers on the query sheet if there is
insufficient space on the page proofs. Please write clearly and follow the conventions shown on the attached
corrections sheet. If returning the proof by fax do not write too close to the paper’s edge. Please remember
that illegible mark-ups may delay publication.

Many thanks for your assistance.

See correction for Figure 2 below, its margins are out of line.

Query Query Remarks

reference
1 AUTHOR: Soltis and Soltis 1999 has been changed to Soltis and Soltis 2000 so 2000 is correct
that this citation matches the Reference List. Please confirm that this is correct.
2 AUTHOR: B. Kindiger, unpublished data: Please provide year. 2006
3 AUTHOR: M. Fujimori, personal communication: Please provide year. 2006
4 AUTHOR: T. Takamizo, personal communication: Please provide year. 2006
5 AUTHOR: B. Kindiger, unpublished data: Please provide year 2008
6 AUTHOR: Please check the page range 251–169. 251-269.
7 AUTHOR: Please check the page range 431–341. 431-441.
8 AUTHOR: Please provide the editors names for Weising et al. 1995. see eds below
Eds. K. Weising, H. Nybom, K. Wolff, W. Meyer

Figure 2: sequence data margins are out of line, need adjusting.

 MARKED PROOF
Please correct and return this set
Please use the proof correction marks shown below for all alterations and corrections. If you
wish to return your proof by fax you should ensure that all amendments are written clearly
in dark ink and are made well within the page margins.

Instruction to printer Textual mark Marginal mark

Leave unchanged under matter to remain
Insert in text the matter New matter followed by
indicated in the margin or
Delete through single character, rule or underline
or or
through all characters to be deleted
Substitute character or
through letter or new character or
substitute part of one or
more word(s) through characters new characters
Change to italics under matter to be changed
Change to capitals under matter to be changed
Change to small capitals under matter to be changed
Change to bold type under matter to be changed
Change to bold italic under matter to be changed
Change to lower case Encircle matter to be changed
Change italic to upright type (As above)
Change bold to non-bold type (As above)
or
Insert ‘superior’ character through character or
under character
where required
e.g. or
Insert ‘inferior’ character (As above) over character
e.g.
Insert full stop (As above)
Insert comma (As above)
or and/or
Insert single quotation marks (As above)
or

or and/or
Insert double quotation marks (As above)
or
Insert hyphen (As above)
Start new paragraph
No new paragraph
Transpose
Close up linking characters

Insert or substitute space through character or

between characters or words where required

Reduce space between between characters or

characters or words words affected