Journal of Affective Disorders 207 (2017) 300–304

Contents lists available at ScienceDirect

Journal of Affective Disorders

journal homepage: www.elsevier.com/locate/jad

Research paper

Prevotella and Klebsiella proportions in fecal microbial communities are

potential characteristic parameters for patients with major depressive
crossmark
disorder
Ping Lina,1, Bingyu Dingb,c,1, Chunyan Fengd, Shuwei Yinb, Ting Zhangb, Xin Qib, Huiying Lvb,
⁎
Xiaokui Guoc, Ke Dongc, Yongzhang Zhuc,1, Qingtian Lib, ,1
a
Department of Medical Laboratory, Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine, Shanghai 200030, China
b
Department of Laboratory Medicine, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China
c
Department of Immunology and Microbiology, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China
d
Department of internal medicine, Zhejiang Medical College, Hangzhou 310053, China

A R T I C L E I N F O A BS T RAC T

Keywords: Background: The diagnosis of major depression disorder (MDD) and other mental disorders were depended on
Prevotella some subjective survey scales. There are confirmed relationship between the gut flora and the mental states of
Klebsiella MDD patients.
Fecal microbial communities Methods: The V3–V4 region of the 16S rRNA gene was extracted from the fecal microbial communities in MDD
Major depressive disorder
patients, PCR amplified and sequenced on the Illumina Miseq platform.
Results: More phylum Firmicutes, less Bacteroidetes, and more genus Prevotella, Klebsiella, Streptococcus and
Clostridium XI were found in MDD patients. The changes of the proportion of Prevotella and Klebsiella were
consistent with Hamilton depression rating scale.
Limitations: The conclusion was limited by small sample sizes and potential uncontrollable influence factors on
fecal microbiota.
Discussion: Prevotella and Klebsiella proportion in fecal microbial communities should be concerned in the
diagnosis and therapeutic monitoring of MDD in future.

1. Instruction depressive illness (Dash et al., 2015).

Major depressive disorder is one of the major and common
psychiatric disorders with high rates of self-harm and suicide attempts.
The real causes and pathogenesis of major depressive disorder are not
well understood (Hegerl et al., 2013). A diverse contribution of genetic,
neurochemical and environmental factors are involved in the onset and
progression of depression (Wang et al., 2015). The bidirectional
interactions between the central nervous system, the enteric nervous
system, and the gastrointestinal tract have illustrated the influences on
the emotional behavior, stress and pain modulation systems and brain
neurotransmitter systems in several rodent animal experiments
(Carabotti et al., 2015; Mayer et al., 2015). That means the composi-
tion and changes of gut flora can influence and interference mental
states of major depressive disorder patients, even the diet and other
factors can influence gut microbiota composition and may influence
There are about 1014 microorganisms cover on human intestine and
more than 80% of them are uncultivated. To analyze the gut bacterial
diversity, many culture-independent methods, such as clone library,
real-time quantitative polymerase chain reaction (qPCR), and denatur-
ing gradient gel electrophoresis, have been applied and investigated in
these years where the majority of the gut bacteria are not culturable
(Chen et al., 2011).
High-throughput sequencing can detect hundreds of thousands to
millions of DNA molecules in one time and it is a cost-effective means
of comprehensive analysis of the intestinal microbial community. The
reading length is shorter than previous sequencing technique. In these
new sequencing techniques, 454 pyrosequencing on 16S rRNA genes
has expanded with low-cost, high-throughput sequencing instruments.
Now pre-existing 454 pyrosequencing workflows can transfer to
Illumina MiSeq sequencing by changing the sequencing adapters of

⁎
Correspondence to: Department of Laboratory Medicine, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, B06, Building 1, 280 South Chongqing Road, Shanghai
200025, China.
E-mail address: qingtianli@gmail.com (Q. Li).
1
Ping Lin and Bingyu Ding share first authorship, Yongzhang Zhu and Qingtian Li share last authorship.

http://dx.doi.org/10.1016/j.jad.2016.09.051
Received 7 April 2016; Received in revised form 27 September 2016; Accepted 30 September 2016
Available online 01 October 2016
0165-0327/ © 2016 Elsevier B.V. All rights reserved.
P. Lin et al.
the primers (Nelson et al., 2014). In this study, the V3-V4 hyper-
variable regions of the 16SrRNA gene were detected with Illumina
MiSeq sequencers to identify the gut bacterial diversity in patients with
Major depressive disorder (Kang et al., 2013).
Hamilton depression rating scale (HAM-D) was used to evaluate
the mental states of MDD patients. There are 17 quantitative para-
meters in this well accepted evaluation criteria. Naseribafroue's and
Jiang's studies (Jiang et al., 2015; Naseribafrouei et al., 2014)
illustrated the relationship between MDD and fecal flora. Here we
reported the dynamic observation of the fecal flora composition and the
correlation between the specific bacterial compositions and the HAM-D
scores.
2. Methods
2.1. Ethics statement
The institutional Review Board (IRB) at Shanghai Mental Health
Center, Shanghai Jiao Tong University School of Medicine approved
the study. Patients who expressed interest in joining this study were
introduced the details and signed the written consent forms.
2.2. Subject recruitment and study procedure
Sixty MDD patients were recruited in this study, and another 60
people were selected as control. The basic enrollment criteria of the
patient recruitment are: (1) age 20–85 years; (2) no usage of any type
of antibiotic, antifungal medications or any probiotics and probiotics
related drink within the last month; (3) MDD Group: the patients with
depression were assessed with the major depressive disorder criteria in
the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-
TR) and 17-items HAM-D scales ≥23; (4) Control Group: in good
mental and physical health: no stomach/gut problems such as chronic
diarrhea, constipation, gas, heartburn, bloating, etc. Unrelated to an
individual with MDD. All MDD subjects in this study received a single
escitalopram treatment as 10 mg once per day. Patients with change of
dose during the study period will be excluded from the study.
In this study there are three visits occurred on day 1, day 15 and
day 29. In each visit, besides the vital signs and other regular physical
and biochemical tests, a revised HAM-D assessment was used to
evaluate the mental states of each patients and fecal samples was
selected at the same day. This revised 15-items HAM-D assessment
was based on the original 17-items HAM-D Rating Scale removed two
potential gut associated “parameters somatic symptoms - gastrointest-
inal” and “loss of weight”. To evaluate the correlation between the
revised HAM-D scores and the fecal bacterial composition, we selected
the patients those revised HAM-D scores continuously reducing in the
3 visits and sent their specimen for gene sequencing. After that, the
bacteria with most significant differences in the 3 visits will selected to
be verified with genus specific real-time PCR.
2.3. Sample collections and DNA extraction
Fecal samples (200 mg) were immediately frozen on collection and
stored at −70 °C before analysis. Single fecal sample was selected from
each subject in each visit. One aliquot was added to a 2.8 mL ASL lysis
buffer from the Tiagen DNA Stool Mini Kit (Tiagen Biotech, Beijing,
China). Subsequent steps of DNA extraction followed the Tiagen kit
protocol for Stool DNA extraction. The quantity and quality of DNA
were assessed by measuring absorbance at 260 and 280 nm using a
NanoDrop ND-2000 spectrophotometer (NanoDrop Technology,
Rockland, DE). Before we sent genomic DNA samples to the sequen-
cing facility for MiSeq sequencing, we confirmed PCR amplification
with universal bacterial primers, and ran agarose gel (1%, w/v)
electrophoresis to confirm the efficiency of PCR amplification visually
(Kang et al., 2013).
301
Journal of Affective Disorders 207 (2017) 300–304
2.4. 16S rRNA Gene sequencing and analysis
The V3–V4 region of the 16S rRNA gene was PCR amplified with
primer 343F (TACGGRAGGCAGCAG) and 798R
(AGGGTATCTAATCCT) (Nossa et al., 2010). The resulting amplicons
were purified, quantified, and barcoded with custom primers and
sequenced on the Illumina Miseq platform (paired end, 2×300)
according to manufacturer's protocols by Shanghai Yuanxu
Biotechnology Co. Ltd. Sequences were analyzed with the mothur
software package (v.1.30) (Kozich et al., 2013; Schloss et al., 2009).
Briefly, matched paired-end reads were assembled using ‘make.contigs’
command in mothur package, and any sequences with an ambiguous
base were removed. Sequences were aligned to a reference database
(Silva v.119, provided in mothur), and sequences aligned to incorrect
region were culled. After the end trimming of the sequences (Schloss,
2013), the unique sequences were further denoised using a precluster-
ing algorithm (Schloss et al., 2011) and their frequency in each sample
was calculated. Chimeras in the sequences were removed by use of
UCHIME (Edgar et al., 2011) and the resulting sequences were then
classified using the Bayesian classifier (Wang et al., 2007). Finally,
sequences were clustered into operational taxonomic units (OTUs) at a
3% dissimilarity level. Each OTU was assigned a taxonomic classifica-
tion at all levels from phylum to genus using the reference Silva
database. Species richness and diversity indices were estimated by
calculating ACE and Chao, as well as the Shannon and Simpson
diversity indices using mothur (Schloss et al., 2009). Data tables were
constructed using several custom R scripts and the vegan package.
Principal coordinates analysis (PCoA) was applied to the distance
matrices for visualization and was plotted against each other to
summarize the microbial community compositional differences be-
tween samples.
2.5. Verification of the clinical significance of bacterial constitution of
MDD by genus specific real-time PCR
The original fecal samples from late excluded MDD patients were
selected to verify the clinical significance of these genera by real-time
PCR. The corresponding genus specific primers were referred from
previous studies (Anbazhagan et al., 2011; Matsuki et al., 2002; Picard
et al., 2004; Song et al., 2004): CACRGTAAACGATGGATGCC
and GGTCGGGTTGCAGACC, ACGCTACTTGAGGAGGA and
GAGCCGTAGCCTTTCACT, GTACAGTTGCTTCAGGACGTATC and
ACGTTCGATTTCATCACGTTG, CATCTCGATCTGCTGGCCAA and
GCGCGGATCCAGCGATTGGA were used for genus Prevotella,
Clostridium cluster XI, Streptococcus and Klebsiella, respectively.
2.6. Statistical analysis
The statistical software SPSS17.0 was used in this study. The
significance of differences between the means of bacterial composition
in fecal samples was analyzed by the double-sided Student's t-test and
Wilcoxon's Sign Rank Test for phylum level and genus level compari-
tions respectively. A P value < 0.01 was considered significant.
3. Results
3.1. Subject characteristics
Ten MDD patients performed the study procedure completely, that
means total 30 patients’ stool specimen were collected for metage-
nomic sequencing in this study. Another 10 control stool samples were
randomly selected from the 60 subjects. The common characteristics of
10 MDD patients and control subjects were shown in Table 1.
P. Lin et al. Journal of Affective Disorders 207 (2017) 300–304

Table 1 Table 3
Characteristics of MDD patients and control people. Most significant different genera between MDD patients and health control.

parameter MDD (n=10) Control (n=10) Genus Visit 1 (%, Visit 2 (%, Visit 3 (%, Control (%,
Median (QR)) Median (QR)) Median (QR)) Median (QR))
Gender (F/M) 4/6 4/6
Age (years; means ± SD) 36.2 ± 10.1 38.1 ± 2.9 Prevotella 2.07(3.29)* 3.27(6.3)* 2.90(4.57) 0.01(0.01)
BMI (means ± SD) 23.8 ± 1.9 24.2 ± 2.0 Klebsiella 0.55(1.65)* 0.20(0.4) 0.09(0.31) 0.01(0.01)
Education years (means ± SD) 15.3 ± 2.6 13.8 ± 2.4 Streptococcus 0.97(1.12)* 1.08(1.89)* 0.45(0.73) 0.05(0.04)
Smoking/No smoking 4/6 3/7 Clostridium XI 0.07(0.1) 0.07(0.16) 0.06(0.3)* 0.02(0.02)

*
P < 0.01 difference from the level in Control group, n=10; Median (Quartile range).

Table 2
Major bacterial organism in MDD patients and control persons’ faeces in phylum level. groups, suggesting that the three treatments have little effect on
different visits.
Phylum Visit 1 Visit 2 Visit 3 Control (%)
The percentage of phylum Candidatus saccharibacteria, Nitrospirae
(%) (%) (%)
and Verrucomicrobia were less than 0.01% of total bacterial organisms.
Actinobacteria 0.53 ± 0.45 ± 0.74 ± 0.10 ± 0.06 For the other 6 phyla, more phylum Firmicutes were detected in MDD
0.69 0.50 1.08 patients than those in control subjects, and there were more
Bacteroidetes 45.30 ± 44.19 ± 45.22 ± 61.96 ± 4.03 Bacteroidetes bacteria were found in control subjects than those in
13.21* 9.95* 13.08*
Candidatus Saccharibacteria < 0.01 < 0.01 < 0.01 < 0.01
MDD patients. No significant differences were found between the 3
Firmicutes 45.95 ± 48.77 ± 47.06 ± 33.21 ± 3.14 visits of the MDD patients.
15.01* 14.63* 9.90* About 220 genera of bacteria were identified in this study. The
Fusobacteria 1.23 ± 1.85 ± 0.36 ± 0.00 ± 0.01 genera with most significant differences between MDD group and
3.38 5.48 1.02
control group and the genera with same change trends as revised
Nitrospirae < 0.01 < 0.01 < 0.01 < 0.01
Proteobacteria 6.36 ± 4.70 ± 8.58 ± 4.73 ± 1.04 HAM-D scores were shown in Table 3. Our results illustrated the
3.90 2.72 9.21 significant differences in four genera Prevotella, Klebsiella,
Unclassified 0.03 ± 0.03 ± 0.04 ± 0.04 ± 0.03 Streptococcus and Clostridium XI between the 3 patient groups and
0.03 0.04 0.07 the control group. We found the correlation between the reducing
Verrucomicrobia < 0.01 < 0.01 < 0.01 < 0.01
trends of the proportion of Klebsiella and the revised HAM-D scores
*
P < 0.01 difference from the level in Control group, n=10; mean ± SD. from visit 1 to visit 3. There is no difference between those 3 visits in
the other 3 bacterial genera.
3.2. Major bacterial organism in subjects of MDD and control groups
3.3. Verification of the clinical significance of bacterial constitution of
All MDD patients received the regular treatment in this study. The MDD
major bacterial organism in subjects of MDD (3 visits) and control
groups were calculated in phylum level (Table 2). In PCoA analysis, the Genus specific primers for these four genera were used to verify the
treated groups (visit 1–3) were separated from the control group (see proportion of these bacteria in all 60 MDD patients in quantitative real-
Fig. 1). However, no difference was observed between the treated time PCR reactions. More Prevotella and Klebsiella were detected in

Fig. 1. A PCoA of weighted UniFrac distances for the samples. Each symbol is colored and represents a single sample, and the distance between points represents how compositionally
different the samples are from one another. The points are colored by health state, showing a clear difference in the microbial community composition between diseased (blue, orange, or
purple) and healthy (green). Principal coordinates analysis (PCoA) are plotted against each other to summarize the microbial community compositional differences between samples.
(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

302
P. Lin et al.
MDD patients than those in control group. There was no difference
between the MDD patients and the control people in the proportion of
the Streptococcus and Clostridium XI (data not shown).
4. Discussion
Intestinal microbiota constitutes a symbiotic ecosystem that keeps
homeostatic balance inside the human body. However, this equilibrium
can be disrupted by pathological conditions interfering with intestinal
physiology (Kang et al., 2013). There are complicated correlation
between the components of gut flora and several diseases, includes
infectious diseases and non infectious disease. However, the pattern of
gut flora is affected by many factors such as the diet, race, geography,
local climate. In this study, we used the subject selection strategies
including diet control to avoid those interference factors.
Here we detected the bacterial proportion of bacteria and the
revised HAM-D scores in 3 visits in MDD patients. The purpose of
HAM-D revision is to avoid the influence on the depression - gut
microbiota relationship assessment from those gut microbiota closely
related parameters in standard 17-items HAM-D Scale. For the phylum
level, we found that more firmicutes bacteria in MDD patients than
those in control subjects, and there were more bacteroidetes bacteria in
control subjects than those in MDD patients. Firmicutes and bacter-
oidetes are the two major bacterial phyla in fecal microbial flora. They
may play an important role in the stability of the composition and the
function of human intestine. Many studies illustrated the relation
between these two bacterial phyla and the pathogenesis of several
diseases. Higher proportions of the phyla Firmicutes and Bacteroidetes
were found in the obese population in Africa (Abdallah Ismail et al.,
2011). However, the Firmicutes/Bacteroidetes ratio is different in
infants, adults and elderly, that means there are strong interaction
between the gut flora and many health factors, such as human
immunology, nutrition and pathological processes (Che et al., 2009;
Mariat et al., 2009). These variations severely restricted the signifi-
cance and application value of the proportion of different bacterial
phyla as novel biomarkers in MDD patients clinical diagnosis.
The bacterial communities were analyzed in this study in genera
level. Significant differences were detected in the proportions of four
genera. They were Prevotella, Klebsiella, Streptococcus, and
Clostridium XI. Liu's study (Liu et al. 2015) pointed that significantly
lower abundances of prevotella were related to the young autism
patients. The opposite is there were higher prevotella in obesity, coeliac
disease patients or responded-MDD (Gerritsen et al., 2011; Jiang et al.,
2015). Klebsiella is a classical respiratory pathogen, however, as an
Gram negative bacterium, the Klebsiella translocation with immune
responses to the LPS may play a role in MDD pathophysiology (Maes
et al., 2008, 2012). Prior streptococcal infection was also associated
with some neuropsychiatric disorders, such as MDD (Leslie et al.,
2008). For Clostridium XI, there is a clear correlation between
depression and Clostridium difficile infection (Rogers et al., 2013).
All these differences in genera levels means the increased bacterial
translocation may play a role in the pathophysiology of depression. In
the verification tests with quantitative real-time PCR, Prevotella and
Klebsiella were identified as influence factors in MDD disease. The
changes in the proportion of specific genera in fecal samples should be
deserved more attention in future's diagnosis and surveillance of MDD.
Gut flora can affect people's emotions and play an important role in
many diseases and the responses to device and medical treatment (Cho
and Blaser, 2012). On behalf of the colon microbial communities, fecal
flora can be collected and studied easily. Although the fecal microbial
flora can be changed by a lot of physiological and environmental factors
(Cryan and Dinan, 2012), a series combinations in the levels of phylum
and genus might be novel valuable indicators in the diagnosis and
surveillance of MDD and other mental disorders.
303
Journal of Affective Disorders 207 (2017) 300–304
5. Conclusions
The proportion changes of prevotella and klebsiella in fecal flora
could be useful parameters for the laboratory diagnosis and treatment
evaluation in MDD patients.
References
Abdallah Ismail, N., Ragab, S.H., Abd Elbaky, A., Shoeib, A.R., Alhosary, Y., Fekry, D.,
2011. Frequency of Firmicutes and Bacteroidetes in gut microbiota in obese and
normal weight Egyptian children and adults. Arch. Med. Sci. 7, 501–507.
Anbazhagan, D., Mui, W.S., Mansor, M., Yan, G.O., Yusof, M.Y., Sekaran, S.D., 2011.
Development of conventional and real-time multiplex PCR assays for the detection of
nosocomial pathogens. Braz. J. Microbiol.: Publ. Braz. Soc. Microbiol. 42, 448–458.
Carabotti, M., Scirocco, A., Maselli, M.A., Severi, C., 2015. The gut-brain axis:
interactions between enteric microbiota, central and enteric nervous systems. Ann.
Gastroenterol.: Q. Publ. Hell. Soc. Gastroenterol. 28, 203–209.
Che, C., Pang, X., Hua, X., Zhang, B., Shen, J., Zhu, J., Wei, H., Sun, L., Chen, P., Cui, L.,
Zhao, L., Yang, Q., 2009. Effects of human fecal flora on intestinal morphology and
mucosal immunity in human flora-associated piglet. Scand. J. Immunol. 69,
223–233.
Chen, Y., Yang, F., Lu, H., Wang, B., Chen, Y., Lei, D., Wang, Y., Zhu, B., Li, L., 2011.
Characterization of fecal microbial communities in patients with liver cirrhosis.
Hepatology 54, 562–572.
Cho, I., Blaser, M.J., 2012. The human microbiome: at the interface of health and
disease. Nat. Rev. Genet. 13, 260–270.
Cryan, J.F., Dinan, T.G., 2012. Mind-altering microorganisms: the impact of the gut
microbiota on brain and behaviour. Nat. Rev. Neurosci. 13, 701–712.
Dash, S., Clarke, G., Berk, M., Jacka, F.N., 2015. The gut microbiome and diet in
psychiatry: focus on depression. Curr. Opin. Psychiatry 28, 1–6.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves
sensitivity and speed of chimera detection. Bioinformatics 27, 2194–2200.
Gerritsen, J., Smidt, H., Rijkers, G.T., de Vos, W.M., 2011. Intestinal microbiota in
human health and disease: the impact of probiotics. Genes Nutr. 6, 209–240.
Hegerl, U., Rummel-Kluge, C., Varnik, A., Arensman, E., Koburger, N., 2013. Alliances
against depression - A community based approach to target depression and to
prevent suicidal behaviour. Neurosci. Biobehav. Rev. 37, 2404–2409.
Jiang, H., Ling, Z., Zhang, Y., Mao, H., Ma, Z., Yin, Y., Wang, W., Tang, W., Tan, Z., Shi,
J., Li, L., Ruan, B., 2015. Altered fecal microbiota composition in patients with major
depressive disorder. Brain Behav. Immun. 48, 186–194.
Kang, D.W., Park, J.G., Ilhan, Z.E., Wallstrom, G., Labaer, J., Adams, J.B., Krajmalnik-
Brown, R., 2013. Reduced incidence of Prevotella and other fermenters in intestinal
microflora of autistic children. PLoS One 8, e68322.
Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K., Schloss, P.D., 2013.
Development of a dual-index sequencing strategy and curation pipeline for analyzing
amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ.
Microbiol. 79, 5112–5120.
Leslie, D.L., Kozma, L., Martin, A., Landeros, A., Katsovich, L., King, R.A., Leckman, J.F.,
2008. Neuropsychiatric disorders associated with streptococcal infection: a case-
control study among privately insured children. J. Am. Acad. Child Adolesc.
Psychiatry 47, 1166–1172.
Liu, X., Cao, S., Zhang, X., 2015. Modulation of gut microbiota-brain axis by probiotics,
prebiotics, and diet. J. Agric. Food Chem. 63, 7885–7895.
Maes, M., Kubera, M., Leunis, J.C., 2008. The gut-brain barrier in major depression:
intestinal mucosal dysfunction with an increased translocation of LPS from gram
negative enterobacteria (leaky gut) plays a role in the inflammatory pathophysiology
of depression. Neuro Endocrinol. Lett. 29, 117–124.
Maes, M., Kubera, M., Leunis, J.C., Berk, M., 2012. Increased IgA and IgM responses
against gut commensals in chronic depression: further evidence for increased
bacterial translocation or leaky gut. J. Affect. Disord. 141, 55–62.
Mariat, D., Firmesse, O., Levenez, F., Guimaraes, V., Sokol, H., Dore, J., Corthier, G.,
Furet, J.P., 2009. The firmicutes/bacteroidetes ratio of the human microbiota
changes with age. BMC Microbiol. 9, 123.
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K.,
Oyaizu, H., Tanaka, R., 2002. Development of 16S rRNA-gene-targeted group-
specific primers for the detection and identification of predominant bacteria in
human feces. Appl. Environ. Microbiol. 68, 5445–5451.
Mayer, E.A., Tillisch, K., Gupta, A., 2015. Gut/brain axis and the microbiota. J. Clin.
Investig. 125, 926–938.
Naseribafrouei, A., Hestad, K., Avershina, E., Sekelja, M., Linlokken, A., Wilson, R., Rudi,
K., 2014. Correlation between the human fecal microbiota and depression.
Neurogastroenterol. Motil.: Off. J. Eur. Gastrointest. Motil. Soc. 26, 1155–1162.
Nelson, M.C., Morrison, H.G., Benjamino, J., Grim, S.L., Graf, J., 2014. Analysis,
optimization and verification of Illumina-generated 16S rRNA gene amplicon
surveys. PLoS One 9, e94249.
Nossa, C.W., Oberdorf, W.E., Yang, L., Aas, J.A., Paster, B.J., Desantis, T.Z., Brodie, E.L.,
Malamud, D., Poles, M.A., Pei, Z., 2010. Design of 16S rRNA gene primers for 454
pyrosequencing of the human foregut microbiome. World J. Gastroenterol. 16,
4135–4144.
Picard, F.J., Ke, D., Boudreau, D.K., Boissinot, M., Huletsky, A., Richard, D., Ouellette,
M., Roy, P.H., Bergeron, M.G., 2004. Use of tuf sequences for genus-specific PCR
detection and phylogenetic analysis of 28 streptococcal species. J. Clin. Microbiol.
42, 3686–3695.
P. Lin et al.
Rogers, M.A., Greene, M.T., Young, V.B., Saint, S., Langa, K.M., Kao, J.Y., Aronoff, D.M.,
2013. Depression, antidepressant medications, and risk of Clostridium difficile
infection. BMC Med. 11, 121.
Schloss, P.D., 2013. Secondary structure improves OTU assignments of 16S rRNA gene
sequences. ISME J. 7, 457–460.
Schloss, P.D., Gevers, D., Westcott, S.L., 2011. Reducing the effects of PCR amplification
and sequencing artifacts on 16S rRNA-based studies. PLoS One 6, e27310.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,
Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B.,
Thallinger, G.G., Van Horn, D.J., Weber, C.F., 2009. Introducing mothur: open-
304
Journal of Affective Disorders 207 (2017) 300–304
source, platform-independent, community-supported software for describing and
comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541.
Song, Y., Liu, C., Finegold, S.M., 2004. Real-time PCR quantitation of clostridia in feces
of autistic children. Appl. Environ. Microbiol. 70, 6459–6465.
Wang, H., Quirion, R., Little, P.J., Cheng, Y., Feng, Z.P., Sun, H.S., Xu, J., Zheng, W.,
2015. Forkhead box o transcription factors as possible mediators in the development
of major depression. Neuropharmacology.
Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naive Bayesian classifier for rapid
assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ.
Microbiol. 73, 5261–5267.