Sie sind auf Seite 1von 10

Antonie van Leeuwenhoek https://doi.org/10.1007/s10482-019-01243-1 (0123456789().,-volV)( 0123456789().,-volV)

(0123456789().,-volV) ( 01234567 89().,-volV) ORIGINAL PAPER Transcription factor CgAzf1 regulates melanin

ORIGINAL PAPER

ORIGINAL PAPER

Transcription factor CgAzf1 regulates melanin production, conidial development and infection in Colletotrichum gloeosporioides

Xiaoyu Li . Zhijian Ke . Xinjun Yu . Zhiqiang Liu

Li . Zhijian Ke . Xinjun Yu . Zhiqiang Liu . Chenghui Zhang Received: 30 October

. Chenghui Zhang

Received: 30 October 2018 / Accepted: 28 January 2019 Springer Nature Switzerland AG 2019

Abstract Rubber anthracnose caused by Col- letotrichum gloeosporioides leads to huge economic loss in the natural rubber industry every year. Conidia of C. gloeosporioides are a major infection source but little is known about molecular mechanisms underly- ing conidial development and infection. In this study, the C. gloeosporioide C 2 H 2 zinc-finger protein tran- scription factor gene CgAzf1 is shown to be involved in melanin production, conidial development and infection. Deletion of CgAzf1 resulted in decreased melanin production and hydrophilicity of aerial mycelium was increased. The mutants also showed reduced conidiation, low germination rate, and the formation of appressorium lagged too. Virulence assays showed that the CgAzf1 deletion strain could not infect intact rubber tree leaves and had an attenuated virulence on the wounded leaves. Quanti- tative RT-PCR showed that CgAzf1 regulates expres- sion of genes involved in the MAPK, cAMP-PKA and melanin biosynthesis pathways.

X. Li Z. Ke Z. Liu ( &) C. Zhang

Key Laboratory of Green Prevention and Control of Tropical Plant Diseases and Pests (Hainan University), Ministry of Education, Haikou 570228, China e-mail: liuzhiqiang80@126.com

X. Yu

Key Laboratory of Bioorganic Synthesis of Zhejiang Province, College of Biotechnology and Bioengineering, Zhejiang University of Technology, Hangzhou 310014, China

Zhejiang University of Technology, Hangzhou 310014, China Keywords Colletotrichum gloeosporioides Rubber

Keywords Colletotrichum gloeosporioides Rubber anthracnose Transcription factor Conidium Pathogenicity

Introduction

Rubber tree ( Hevea brasiliensis) is a tropical eco- nomic crop and is the primary source of natural rubber. Compared to synthetic rubber, natural rubber (NR) has better performance. Rubber anthracnose caused by Colletotrichum gloeosporioides (Penz.) Penz. and Sacc. is the main factor threatening the NR industry. The pathogen overwinters in diseased branches in the form of mycelium, producing conidia as primary infection source under suitable condition. During the infection, conidia attach to leaf surfaces and germi- nate, ultimately forming an appressorium. The appres- sorium produces a penetration peg and invades the leaf epidermis, resulting in the formation of infection hyphae (Prusky and Lichter 2008 ; Gomes et al. 2009 ). As a result, rubber tree leaves will become necrotic, deformative and deciduous, resulting in the reduction of rubber production (Jean et al. 2005 ). So far, little is known about conidia formation and the infection process displayed by C. gloeosporioides. In the present study, we identify transcription factor CgAzf1 from C. gloeosporioides that is involved in melanin production, conidial development and infection.

123

Antonie van Leeuwenhoek

Materials and methods

Strains and culture conditions

In this study, C. gloeosporioides strain WT (Liu et al. 2018 ) was used. Vegetative growth of strain WT and its related mutants were assessed according to Liu et al. (2018 ). Infiltration of 10 lL distilled water added on top of cultures cultured on PDA medium at 28 C for 10 days was used to assess hydrophilicity of the aerial mycelium.

Cloning and characterization of CgAzf1

Isolation of RNA and cDNA synthesis were done according to Liu et al. ( 2018 ). The ORF of CgAzf1 was amplified from the cDNA using primers CgAzf1F and CgAzf1R (Table 1 ). SMART was used to analysis the protein domains of CgAzf1 (Liu et al. 2018 ). The CgAzf1’s orthologues from different fungi were identified by bidirectional blast using GenBank. Mega 6.0 (Tamura et al. 2013 ) was used to construct the phylogenetic tree of CgAzf1 with the neighbour- joining method.

Gene knockout and complementation

Isolation of genomic DNA was done according to Talbot et al. ( 1993 ). The gene replacement vector was constructed as described (Li et al. 2017 ) with modified primers of CgAzf1upF/CgAzf1upR and CgAzf1- downF/CgAzf1downR (Table 1 ). The recombinant plasmid was digested by Eco R I and transformed into the strain WT’s protoplasts. The transformation was done according to Shelp et al. ( 1999 ), while screening of the transformants was performed as described (Li et al. 2017 ) with modified primers of CgAzf1F/ CgAzf1R, CgAzf1UU/PI and PI1/CgAzf1DD (Table 1 ). For complementation, a DNA fragment ( * 3.4 kb) was amplified with primers CgAzf1hbF/ CgAzf1hbR and inserted into vector pUC18-HPT containing a hygromycin phosphotransferase (HPT ) gene. Transformation and identification of transfor- mants were done according to Li et al. ( 2017 ).

123

Conidiation, germination and appressorium formation

Conidia were harvested according to Liu et al. ( 2018 ), and their concentration were determined with a hemocytometer. For assessment of conidial germina- tion and appressoria formation, a droplet (20 lL) of conidial suspension (1 9 10 4 cfu/mL) was placed on a glass slide, incubated at 24 C, and assessed after 6 and 20 h, respectively.

Virulence assays

Intact, detached rubber tree leaves were selected for virulence assays, and a sterilized pin was used for wounding. Conidia in 20 lL sterilized distilled water (1 9 10 5 cfu/mL) were placed on wounded and unwounded rubber tree leaves. Leaves were incubated at 28 C and 90% relative humidity in chambers and analysed daily for the sizes of disease spots.

Quantitative RT-PCR

Genes CgHog1 (Gene_ID: CGGC5_9113), CgPbs2 (KT387309), CgCdc42 (CGGC5_8415), CgSte20 (CGGC5_14654), CgSte12 (CGGC5_12223), CgPKAC (CGGC5_9407), CgAcy (CGGC5_142), CgCmr1 (CGGC5_1601), Cg4HNR (CGGC5_9) and CgSCD (KX198009) were selected for quantitative RT-PCR (qRT-PCR). The b-tubulin (CGGC5_5866) served as the control. The qRT-PCR was performed using QIAGEN Rotor-Gene Q (German). PCR ampli- fication was performed with 1 l L of cDNA template in a 10 l L reaction mixture containing 5 l L of the SYBR Premix (TakaRa) and 0.5 l L of each primer (Table 1 ). PCR was carried out using the following cycling program: 15 min at 95 C, followed by 40 cycles of 95 C for 10 s, 58 C for 20 s, and 72 C for 30 s. The samples were subjected to melting curve analysis with efficiencies close to 100% for all primers pairs. The relative expressions were determined using the method of 2 - DD Ct (Livak and Schmittgen 2001 ).

Antonie van Leeuwenhoek

Table 1 Primers and sequences

Primer name

Sequence

Use in this study

CgAzf1upF

CGGAATTCACGCCTTTAGAAAGTCCCTC

Upstream sequence

CgAzf1upR

GGGGTACCTTTGCTGGTTGAGGTGATGG

CgAzf1F

ATGGCCCTCACGGAATCACCAG

The ORF of CgAzf1

CgAzf1R

TCAGTACATCGCGTGGGTGGAT

CgAzf1downF

GCTCTAGAACGGAAATGATTCAACAAGG

Downstream sequence

CgAzf1downR CCGAATTCAGTGCGGGAGTGTTGTGTCG

CgAzf1UU

TCAACACCGTCATCGCCATCAC

Validation of mutant

PI

CTTCAGGGTTTTCCCAGTCACG

PI1

GTATGTTGTGTGGAATTGTGAGCGG

Validation of mutant

CgAzf1DD

CACCACCATCACCAACGCTTCCAAC

CgAzf1hbF

CCGAATTCGAACTCGACTGTCGTCGTCTGT

Complementary sequence

CgAzf1hbR

GCTCTAGATGTCTAATAACTCCCGTGATGC

CgHog1F

CTCACCAACCAGAATGTCGCC

qPCR for CgHog1

CgHog1R

CTGGAGGTGAGTAGCCTGTGC

CgPbs2F

GAGGTATCGTCAACCATCTTC

qPCR for CgPbs2

CgPbs2R

GGCTTCTTCACCCTCTTCGGC

CgCdc42F

CGTCTGCTTCAGCGTCACATC

qPCR for CgCdc42

CgCdc42R

CTCCCAAGTCCTTCGCCATCC

CgSte20F

CCTCACCACAACGGAAACCAG

qPCR for CgSte20

CgSte20R

CAGGACCCAGACTCAGCAAGC

CgSte12F

GCATCCGAACGCAGAAGAAGC

qPCR for CgSte12

CgSte12R

GCTGGGCGTTGAAGGAAGAAG

CgPKACF

GTTTCGCCAAGAGAGTGCCAG

qPCR for CgPKAC

CgPKACR

CCCTTGAGGATGTTTTCGTAG

CgAcyF

CCCTGCTGCTATGAATAAACC

qPCR for CgAcy

CgAcyR

GCGTCATCGTCTGAACCGTGC

CgCmr1F

GCGTCAACTCTGCTTGTCCTC

qPCR for CgCmr1

CgCmr1R

ATCAACCACTTGTCGCCACTC

Cg4HNRF

GTCGTGGTGCCAAGGTCATCG

qPCR for Cg4HNR

Cg4HNRR

CTCACGAGCGACGAAGAACTG

CgSCDF

GTCCCCTGCTGGCAACATCAC

qPCR for CgSCD

CgSCDR

GTGCCGCCGATGAAGTGCTGC

Results

Characterization of CgAzf1

CgAzf1 (Gene_ID: KY581593) is predicted to encode a 491-amino acids (aa) protein. Protein domain analysis showed that CgAzf1 contains four adjacent C 2 H 2 zinc-finger domains from position 240 to 353 (Fig. 1 a, b). Bidirectional blast reveals that CgAzf1 homologues are ubiquitous in fungi and all of them have four adjacent C 2 H 2 zinc-finger domains. CgAzf1 shares 34, 19.7 and 13% overall identity with

Verticillium dahliae VdLs.17 zinc finger protein (XP_009658472.1), Magnaporthe oryzae Cos1 (XP_003714460.1) and Saccharomyces cerevisiae Azf1 (NP_014756.3), respectively.

Targeted deletion of CgAzf1

The gene knockout vector was introduced in proto- plasts of strain WT and screened by PCR (Fig. 2 a–c). 168 transformants were screened and it was found that transformant 4 and 70 could amplify the specific amplicon with the primers CgAzf1UU/PI, PI1/

123

Antonie van Leeuwenhoek

A

Antonie van Leeuwenhoek A B 100 CgAzf1 58 100 99 45 100 57 99 93 Colletotrichum

B

100
100

CgAzf1

58 100 99 45 100 57 99 93
58
100
99
45
100
57
99
93

Colletotrichum gloeosporioides Nara gc5 (XP_007276848.1) Colletotrichum higginsianum IMI 349063 (XP_018160470.1) Colletotrichum orbiculare MAFF 240422 (ENH78718.1)

Verticillium dahliae VdLs.17 (XP_009658472.1)

Fusarium oxysporum Fo47 (EWZ45422.1)

Trichoderma harzianum (KKP06506.1)

Beauveria bassiana ARSEF 2860 (XP_008598185.1)

Metarhizium anisopliae (KFG78752.1) Neurospora crassa OR74A (XP_961139.2)

Saccharomyces cerevisiae S288C (NP_014756.3)

Magnaporthe oryzae 70-15 (XP_003719876.1)

(NP_014756.3) Magnaporthe oryzae 70-15 (XP_003719876.1) 0.1 Fig. 1 Protein domains and phylogenetic analysis of

0.1

Fig. 1 Protein domains and phylogenetic analysis of CgAzf1.

a Protein domain analysis of CgAzf1, and CgAzf1 contains four

adjacent C 2 H 2 zinc-finger domains (aa 240-353). b Phylogenetic

analysis of CgAzf1, the phylogenetic tree was constructed by using MEGA 6.0 with homologous sequences of CgAzf1 from various fungi

A BC Band II Band I Band III
A
BC
Band II
Band I
Band III

Fig. 2 CgAzf1 gene knockout and complementation. a PCR

amplification results using the primers CgAzf1F/CgAzf1R.

b PCR amplification results using the primers CgAzf1UU/PI. c PCR amplification results using the primers of PI1/ CgAzf1DD. M: DL2000 DNA marker; 1: Wild type; 2:

123

D CgAzf1- 4 ; 3: D CgAzf1- 70; 4: D CgAzf1- C ; Band I: PCR amplification fragment using the primers CgAzf1F/CgAzf1R; Band II: PCR amplification fragment using the primers CgAzf1UU/PI; Band III: PCR amplification fragment using the primers PI1/CgAzf1DD

Antonie van Leeuwenhoek

CgAzf1DD and no amplicon using CgAzf1F/ CgAzf1R, confirming deletion of CgAzf1. These two transformants were named DCgAzf1- 4 and DCgAzf1- 70 , respectively. The former strain was complemented with the wild-type copy of the gene validated using PCR. The complemented strain named DCgAzf1- C.

CgAzf1 regulates melanin production and surface hydrophobicity

No significant differences were found in growth rate between the CgAzf1 deletion strains and the wild type on PDA, CM, CZAPEK and MM media. On PDA medium, the CgAzf1 deletion mutants produced less melanin than the wild type (Fig. 3 a). On the other three media, the wild type produced little melanin, and there was no obvious difference between the CgAzf1 deletion mutants and the wild type. Moreover, deletion of the gene CgAzf1 had also changed the surface hydrophobicity. After culturing on PDA medium for

10 days, the aerial mycelia of the CgAzf1 mutants were easy to be infiltrated by distilled water, which was not the case in the wild type (Fig. 3 b). The complemented strain did not show any of the above- described phenotypic defects. Cumulatively, this sug- gests CgAzf1 is involved in regulating melanin production and surface hydrophobicity of C. gloeosporioides .

CgAzf1 is involved in conidiation, germination and appressorium formation

CgAzf1 deletion strains produced significantly less conidia when compared to the wild type, and the conidia production of the complemented strain was similar to that of the wild type (Fig. 4 a). Germination was also reduced by 30% in the CgAzf1 deletion strains mutants (Fig. 4 b), while it was restored in the complemented strain. In addition, appressorium for- mation was delayed in the CgAzf1 mutants. After 6 h

A WT

ΔCgAzf1-4

ΔCgAzf1-70

ΔCgAzf1-C

Front

Back

6 h A WT ΔCgAzf1-4 ΔCgAzf 1-70 ΔCgAzf1-C Front Back B WT ΔCgAzf1-4 Fig. 3 Melanin

B

6 h A WT ΔCgAzf1-4 ΔCgAzf 1-70 ΔCgAzf1-C Front Back B WT ΔCgAzf1-4 Fig. 3 Melanin

WT

ΔCgAzf1-4

Fig. 3 Melanin production and surface hydrophobicity. a Com- parison of the melanin production, the strains of WT, D CgAzf1- 4 , D CgAzf1- 70 and D CgAzf1- C were cultured on PDA medium at 28 C for 10 days. b Comparison of the surface

ΔCgAzf1-70

ΔCgAzf1-C

hydrophobicity, the strains were inoculated on PDA medium, cultured at 28 C for 10 days, and then distilled water was added into aerial mycelium

123

Antonie van Leeuwenhoek

A B 6 4.9 100 5 3.6 80 4 60 3 40 2 20 1
A
B
6
4.9
100
5
3.6
80
4
60
3
40
2
20
1
0.25
0.15
0
0
WT
ΔCgAzf1-4 ΔCgAzf1-70 ΔCgAzf1-C
Conidiation
10 6
Conidial germination
%

C

120 6h 95.8 96.1 94.3 100 92.7 20h 80 60 40 12.9 20 11.2 0
120
6h
95.8 96.1
94.3
100
92.7
20h
80
60
40
12.9
20
11.2
0
0
0
WT
ΔCgAzf1-4
ΔCgAzf1-70
ΔCgAzf1-C
Appressorium formation
%
92.7 91.1 65.4 61.5 WT ΔCgAzf1-4 ΔCgAzf1-70 ΔCgAzf1-C
92.7
91.1
65.4
61.5
WT
ΔCgAzf1-4 ΔCgAzf1-70 ΔCgAzf1-C

Fig. 4 Statistical analyses of conidial production, germination and appressorium formation. a Conidial productions. b Conidial germination rates. c Appressorium formation rates

germination, DCgAzf1- 4 and DCgAzf1- 70 had not formed appressoria (Fig. 5 ), while 95.8% and 92.7% of the germlings of strain WT and the complemented strain had formed these infection structures. After 20 h germination, the CgAzf1 deletion strains had formed appressoria but their numbers were significantly lower when compared to the wild type and the comple- mented strain (Fig. 4 c). These results show that CgAzf1 plays important roles in conidiation, germi- nation and appressorium formation of C. gloeosporioides .

CgAzf1 is required for virulence

Conidial suspensions of strains WT, DCgAzf1- 4 , DCgAzf1- 70 and DCgAzf1 -C were placed onto unwounded and wounded rubber tree leaves. Small disease spots had formed on the unwounded leaves

123

inoculated with strain WT 5 days after inoculation, but no lesions were found in the case of the CgAzf1 deletion strains (Fig. 6 ). Symptoms were severe when WT had been inoculated on wounded leaves, while DCgAzf1- 4 and DCgAzf1 -70 had formed smaller disease spots than the strain WT. The complemented strain DCgAzf1- C could recover virulence of the deletion strain. The results demonstrate CgAzf1 is required for virulence in C. gloeosporioides .

Quantitative RT-PCR analysis

To further understand the regulatory mechanisms, expression of 10 genes was analyzed using qRT-PCR. The wild type and CgAzf1 deletion strain were cultured on PDA medium at 28 C for 5d, and total RNA was isolated for qRT-PCR. The result showed that the expressions of most genes were

Antonie van Leeuwenhoek

WT

ΔCgAzf1-4

ΔCgAzf1-70

ΔCgAzf1-C

0h

6h

20h

WT ΔCgAzf1-4 ΔCgAzf1-70 ΔCgAzf1-C 0h 6h 20h Fig. 5 Conidial germination and appressorium formation of

Fig. 5 Conidial germination and appressorium formation of the wild type, the CgAzf1 mutants and the complemented strain (bar = 10 lm)

downregulated, including the genes of CgHog1 , CgPbs2 , CgCdc42 and CgSte12 involved in the mitogen-activated protein kinase (MAPK) pathway, the genes of CgPKAC and CgAcy (adenylate cyclase) involved in the cAMP-PKA pathway, and the genes of CgCmr1 , Cg4HNR , CgSCD involved in the melanin biosynthesis pathway (Fig. 7 ). In contrast, the gene of CgSte20 also involved in the MAPK pathway was upregulated obviously (Fig. 7 ).

In this study, we showed that transcription factor CgAzf1 of C. gloeosporioides is involved in melanin production, conidiation, germination, appressorium formation and infection. Homologues of CgAzf1 are widely present in the fungal kingdom. Of these homologues, Azf1 of S. cerevisiae and Cos1 of M. oryzae have been functionally characterized (Slattery

Discussion

123

Antonie van Leeuwenhoek

No wound

inoculation

Wound

inoculation

WT

ΔCgAzf1-4

ΔCgAzf1-70

ΔCgAzf1-C

Wound inoculation WT ΔCgAzf1-4 ΔCgAzf1-70 ΔCgAzf1-C Fig. 6 Virulence assays on the rubber tree leaves. The

Fig. 6 Virulence assays on the rubber tree leaves. The rubber tree leaves were inoculated with 20 lL of conidial suspension (1 9 10 5 cfu/mL) of the wild type, the CgAzf1 mutants and the

complemented strain through unwounded and wounded ways, and the symptoms were shown at 5 days after inoculation

2 WT ΔCgAzf1-4 1.5 1 0.5 0 CgHog1 CgPbs2 CgCdc42 CgSte20 CgSte12 CgPKAC CgAcy CgCmr1
2
WT
ΔCgAzf1-4
1.5
1
0.5
0
CgHog1
CgPbs2 CgCdc42 CgSte20 CgSte12 CgPKAC
CgAcy
CgCmr1 Cg4HNR CgSCD
Relative expression

Fig. 7 Quantitative RT-PCR analyses of ten genes from the strain WT and DCgAzf1 - 4. The selected genes include CgHog1 (Gene_ID: CGGC5_9113), CgPbs2 (KT387309), CgCdc42 (CGGC5_8415), CgSte20 (CGGC5_14654), CgSte12

et al. 2006 ; Zhou et al. 2009 ). The 914-aa zinc finger protein Azf1 activates carbon and energy metabolism genes when glucose is present. However, when this

123

(CGGC5_12223), CgPKAC (CGGC5_9407), CgAcy (CGGC5_142), CgCmr1 (CGGC5_1601), Cg4HNR (CGGC5_9) and CgSCD (KX198009)

carbon source is depleted, it promotes cell wall integrity (Slattery et al. 2006 ). Unlike Azf1, CgAzf1 and COS1 are not involved in vegetative growth.

Antonie van Leeuwenhoek

Deletion of the latter two encoding genes does reduce melanin production (Zhou et al. 2009 ). RNA-Seq indicates that Cos1 might downregulate the genes encoding 4HNR (MGG_02252.6) and Cmr1 (Mgg_07215.6), which play important roles in regu- lating melanin biosynthesis (Tsuji et al. 2000 ; Bhadauria et al. 2010 ; Li et al. 2013 ). Similar to Cos1, CgAzf1 can downregulate the expressions of CgCmr1 (homologous gene of Mgg_07215.6), Cg4HNR (homologous gene of MGG_02252.6) and CgSCD , which may result in the decrease of melanin. In summary, CgAzf1 is proposed to impact melanin production by regulating genes involved in the melanin biosynthesis pathway. Deletion of CgAzf1 results in the increasing of hydrophilicity of the aerial mycelia, and we speculate that some changes may occur in the cell wall of aerial mycelia in the CgAzf1 deletion mutant. First, it is reported that hydrophobins play an important role in hyphal hydrophobicity and cell wall composition, and CgAzf1 may affect hydrophilic and hydrophobic performance by affecting the expression of hyphal hydrophobins (Wo¨ sten 2001 ). Second, CgAzf1 down- regulates the expression of CgCdc42 , which may result in varying chitin distribution and changed cell wall integrity. This is based on the finding that deletion of CgCdc42 influences cell wall integrity and chitin distribution (Wang et al. 2018 ). Expressions of CgPbs2 and CgHog1 involved in the high osmolarity glycerol mitogen-activated protein kinase (HOG- MAPK) pathway were shown to be both downregu- lated by CgAzf1. Yet, deletion of CgAzf1 had no impact on the osmotic pressure response of C. gloeosporioides . We have also tested the effects of NaCl and sorbitol on the mutants’ growth, and there were no significantly difference between the wild type and CgAzf1 deletion strain (data not shown). Similar to CgAzf1, Cos1 also has no effect on the osmotic pressure response in M. oryzae (Zhou et al. 2009 ). In M. oryzae, deletion of COS1 results in the developmental failure of conidiophores (Zhou et al. 2009 ). The CgAzf1 deletion mutants do show reduced conidiation and low germination rate. Therefore, Cos1 may function in the initial steps of conidiation, while CgAzf1 may function in later stages of this develop- mental process. The formation of appressoria was also delayed in the CgAzf1 deletion mutant. It is reported

that the cAMP-PKA pathway plays a role in appres- sorium formation, and the cAMP levels also influence it (Xu et al. 1997 ; Adachi and Hamer 1998 ). CgAzf1 downregulates expression of CgPKAC , and the CgPKAC mutant has a delayed appressorium forma- tion (Priyatno et al. 2012 ), which is consistent with the phenotype of the CgAzf1 mutant. Moreover, CgAzf1 also downregulates expression of CgAcy , which may change the levels of cAMP, as such influencing formation of appressoria. In summary, these results indicate that CgAzf1 plays a critical role in conidia development by regulating several important genes in the cAMP-PKA pathway. The CgAzf1 deletion mutants could not infect intact rubber tree leaves, and had a reduced virulence on wounded leaves. Decreased germination and appres- sorium formation may lead to the weak virulence phenotype in the CgAzf1 deletion mutants. Moreover, melanin plays an important role in maintaining appressorium turgor and formation of the penetration peg. Reduced melanin will thus affect the penetration ability of appressorium. Change in surface hydropho- bicity may also influence the attachment of appresso- ria resulting in weak virulence (Wo¨ sten et al. 1994 ; Wo¨ sten 2001 ). It was reported that CgPKAC and CgCdc42 could positively regulate the pathogenicity of C. gloeosporioides (Priyatno et al. 2012 ; Wang et al. 2018 ), and Hog1 or Pbs2 and their homologous proteins were also closely related to the pathogenicity of M. oryzae and Fusarium oxysporum (Zheng et al. 2009 ; Pareek and Rajam 2017 ). According to the qRT- PCR, expression of CgHog1 , CgPbs2 , CgPKAC and CgCdc42 were downregulated in the CgAzf1 deletion mutant, which might impact virulence of C. gloeospo- rioides . In conclusion, CgAzf1 is an important tran- scription regulator which is required for melanin production, conidial development and infection in C. gloeosporioides . Further studies will reveal its regu- latory network, illuminating the related regulatory mechanism.

Acknowledgements This research was supported by the National Natural Science Foundation of China (Grant Nos. 31860480 and 31560045).

Conflict of interest The authors declare that they have no conflict of interest.

123

Antonie van Leeuwenhoek

References

Adachi K, Hamer JE (1998) Divergent cAMP signaling path- ways regulate growth and pathogenensis in the rice blast fungus Magnaporthe grisea. Plant Cell 10:1361–1373 Bhadauria V, Wang LX, Peng YL (2010) Proteomic changes associated with deletion of the Magnaporthe oryzae coni- dial morphology-regulating gene COM1. Biol Direct 5:61 Gomes S, Prieto P, Martins-Lopes P, Carvalho T, Martin A, Guedes-Pinto H (2009) Development of Colletotrichum acutatum on tolerant and susceptible Olea europaea L. cultivars: a microscopic analysis. Mycopathologia

168:203–211

Jean G, Edith NO, Fabrice P (2005) Some epidemiological

investigations on Colletotrichum leaf disease on rubber tree. Crop Prot 24:65–77

Li

X, Han X, Liu Z, He C (2013) The function and properties of the transcriptional regulator COS1 in Magnaporthe oryzae . Fungal Biol 117:239–249

Li

X, Wu Y, Liu Z, Zhang C (2017) The function and tran-

scriptome analysis of a bZIP transcription factor CgAP1 in Colletotrichum gloeosporioides . Microbiol Res 197:39–48 Liu Z, Wu M, Ke Z, Liu W, Li X (2018) Functional analysis of a regulator of G-protein signaling CgRGS1 in the rubber tree anthracnose fungus Colletotrichum gloeosporioides . Arch Microbiol 200:391–400 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 - DD CT method. Methods 25:402–408 Pareek M, Rajam MV (2017) RNAi-mediated silencing of MAP kinase signalling genes ( Fmk1, Hog1, and Pbs2 ) in Fusarium oxysporum reduces pathogenesis on tomato plants. Fungal Biol 121:775–784 Priyatno TP, Abu Bakar FD, Kamaruddin N, Mahadi NM, Abdul Murad AM (2012) Inactivation of the catalytic subunit of cAMP-dependent protein kinase A causes delayed appressorium formation and reduced pathogenic- ity of Colletotrichum gloeosporioides . Sci World J

2012:545784

Prusky D, Lichter A (2008) Mechanisms modulating fungal attack in post-harvest pathogen interactions and their control. Eur J Plant Pathol 121:281–289 Shelp BJ, Bown AW, McLean MD (1999) Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci

4:446–452

123

Slattery MG, Liko D, Heideman W (2006) The function and properties of the Azf1 transcriptional regulator change with growth conditions in Saccharomyces cerevisiae . Eukaryot Cell 5:313–320 Talbot NJ, Ebbole DJ, Hamer JE (1993) Identification and characterization of MPGI, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell

5:1575–1590

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729 Tsuji G, Kenmochi Y, Takano Y, Sweigard J, Farrall L, Furu- sawa I, Horino O, Kubo Y (2000) Novel fungal transcrip- tional activators, Cmr1p of Colletotrichum lagenarium and Pig1p of Magnaporthe grisea , contain Cys 2 His 2 zinc finger and Zn(II) 2 Cys 6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Mol Microbiol

38:940–954

Wang X, Xu X, Liang Y, Wang Y, Tian C (2018) A Cdc42 homolog in Colletotrichum gloeosporioides regulates morphological development and is required for ROS-me- diated plant infection. Curr Genet 64:1153–1169 Wo¨ sten HA (2001) Hydrophobins: multipurpose proteins. Annu Rev Microbiol 55:625–646 Wo¨ sten HA, Schuren FH, Wessels JG (1994) Interfacial self- assembly of a hydrophobin into an amphipathic protein membrane mediates fungal attachment to hydrophobic surfaces. EMBO J 13:5848–5854 Xu JR, Urban M, Sweigard JA, Hamer JE (1997) The CPKA gene of Magnaporthe grisea is essential for appressorial penetration. Mol Plant Microbe Interact 10:187–194 Zheng W, Zhao Z, Chen J, Liu W, Ke H, Zhou J, Lu G, Darvill AG, Albersheim P, Wu S, Wang Z (2009) A Cdc42 ortholog is required for penetration and virulence of Magnaporthe grisea. Fungal Genet Biol 46:450–460 Zhou ZZ, Li GH, Lin CH, He CZ (2009) Conidiophore Stalk- less1 encodes a putative zinc-finger protein involved in the early stage of conidiation and mycelial infection in Mag- naporthe oryzae . Mol Plant Microbe Interact 22:402–410

Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.