Placenta 36 (2015) 731e737

Contents lists available at ScienceDirect

Placenta
journal homepage: www.elsevier.com/locate/placenta

Placenta expresses anti-Müllerian hormone and its receptor:

Sex-related difference in fetal membranes
R. Novembri a, L. Funghi a, C. Voltolini a, G. Belmonte b, S. Vannuccini a, M. Torricelli a,
F. Petraglia a, *
a
Obstetrics and Gynecology, Department of Molecular and Developmental Medicine, University of Siena, Siena, Italy
b
Department of Biomedical Sciences, Applied Biology, University of Siena, Siena, Italy

a r t i c l e i n f o a b s t r a c t

Article history: Introduction: Anti-Müllerian hormone (AMH) is a member of the transforming growth factor-b super-
Accepted 21 April 2015 family, playing a role in sexual differentiation and recruitment. Since a correlation exists between AMH
serum levels in cord blood and fetal sex, the present study aimed to identify mRNA and protein
Keywords: expression of AMH and AMHRII in placenta and fetal membranes according to fetal sex.
AMH Methods: Placenta and fetal membranes samples (n ¼ 40) were collected from women with singleton
AMHRII
uncomplicated pregnancies at term. Identification of AMH protein in placenta and fetal membranes was
Trophoblast
carried out by immunohistochemistry and AMH and AMHRII protein localization by immunofluores-
Fetal membranes
cence, while mRNA expression was assessed by quantitative real-time PCR.
Result: AMH and AMHRII mRNAs were expressed by placenta and fetal membranes at term, without any
significant difference between males and females. Placental immunostaining showed a syncytial local-
ization of AMH without sex-related differences; while fetal membranes immunostaining was signifi-
cantly more intense in male than in female fetuses (p < 0,01). Immunofluorescence showed an intense
co-localization of AMH and AMHRII in placenta and fetal membranes.
Discussion: The present study for the first time demonstrated that human placenta and fetal membranes
expresses and co-localizes AMH and AMHRII. Although no sex-related difference was found for the
mRNA expression both in placenta and fetal membranes, a most intense staining for AMH in male fetal
membranes supports AMH as a gender specific hormone.
© 2015 Elsevier Ltd. All rights reserved.

1. Introduction adrenal axis is also influenced by fetal sex suggesting it may

Sex specific differences in fetal growth and pregnancy outcome
have been reported [1e4]. During last years the concept that gene,
protein and steroid pathways of fetal-placental unit are sex spe-
cifically different has become evident [5e7]. Indeed placental
mRNA expression of cytokines such as tumor necrosis factor (TNF-
a), interleukin (IL-1b, IL-6, IL-8) and the response to inflammatory/
infective stimuli is different according to fetal sex; all cytokines
were increased in female placentae of pregnancies complicated by
maternal asthma, differently, this condition was not observed in
male placentae [8,9]. Activation of fetal hypothalamic-pituitary-
* Corresponding author. Obstetrics and Gynecology, Department of Molecular
and Developmental Medicine, University of Siena, Policlinico “Le Scotte” Viale
Bracci, 53100 Siena, Italy. Tel.: þ39 0577 233 453; fax: þ39 0577 233 454.
E-mail address: felice.petraglia@unisi.it (F. Petraglia).
determine the timing of parturition and of fetal organ maturation
[4].
Anti-Müllerian Hormone (AMH) is a homodimeric disulphide-
linked glycoprotein with a molecular weight of 140 kDa [10]
belonging to the transforming growth factor-b (TGF-b) superfam-
ily synthesized by the gonads of both sexes, but highly secreted
only in male fetuses [11]. AMH influences embryonic sex differen-
tiation: in male embryo Sertoli cells of testis produces AMH causing
the loss of Müllerian duct [12] whether, in the absence of AMH, the
embryo develops into a female allowing the Müllerian duct to
differentiate into the upper vagina, uterus and oviduct [13]. As a
member of the TGF family of growth factors AMH acts through a
serineethreonine kinase receptor complex consisting of ligand-
specific type II receptors (AMHRII) than, upon binding ligand, re-
cruits and phosphorylates more general type I receptors also
known as activin receptor-like protein kinases (ALKs); activation of

http://dx.doi.org/10.1016/j.placenta.2015.04.009
0143-4004/© 2015 Elsevier Ltd. All rights reserved.
732 R. Novembri et al. / Placenta 36 (2015) 731e737

the type I receptor results in phosphorylation of the downstream
Smad proteins [14,15]. In adult women AMH is expressed by ovary
and modulates both initial and cyclic recruitment of ovarian folli-
cles [16]. Recent study indicated serum levels of AMH as a marker
for ovarian aging [17] and circulating AMH measurement may
provide useful information in women with ovarian dysfunction
[18,19]. Moreover, AMH is produced by endometrium of
reproductive-age women [20] and higher expression of AMH and
AMHRII are shown in endometriotic lesions [21].
Up to now few studies examined changes in maternal circula-
tion and a possible role of AMH through pregnancy, showing a
similar AMH concentrations between first-trimester pregnant and
non-pregnant women [22,23] and a decline of maternal serum
AMH levels during pregnancy [24,25]. Some recent studies have
shown a correlation between maternal AMH circulating levels and
pregnancy outcome such as preeclampsia [26e29]. Among TGF-
beta family members also Activin A circulating levels are related
to adverse pregnancy outcome such as preeclampsia and preterm

Fig. 1. Immunohistochemical analysis of AMH in female and male placenta tissue. Panels AeC and DeF shown AMH immunostaining in placenta tissues in female and male fetuses
respectively (Original magnification A, B, D, and E: 100; C and F 400); (<) cytotrophoblast cells, ([) syncytiotrophoblast, (*) endothelial cells. H: negative control; G: repre-
sentative graph of semi-quantitation of staining intensity determined using ImageJ, (Jensen EC Anat Rec (Hoboken). 2013 Mar; 296(3):378e81).
 R. Novembri et al. / Placenta 36 (2015) 731e737 733

delivery [30,31] and is assessed that placenta and fetal membranes
are the main sources of circulating activin A [32e34]; thus a role of
placenta and fetal membranes in regulation of AMH can be hy-
pothesized. Moreover a fetal sex relation was proposed because
AMH cord blood serum levels in pregnancy carrying male fetuses
were higher than in female fetuses [23,35].
Since no evidence exists on AMH expression and localization in
gestational tissues and evaluating both, the role of TGF-beta family
in pregnancy and the role of these tissues on regulation of these
peptides, the aim of the present study was to evaluate AMH and
AMHRII expression in term placenta and fetal membranes from
healthy pregnant women according to the fetal sex. mRNA
expression of both AMH and its receptor was evaluated with qRT-
PCR, while immunohistochemistry was performed in order to
evaluate AMH localization and double immunofluorescence to
assess a possible co-localization of AMH and AMHRII.
2. Material and methods
2.1. Tissues collection
Specimens of placenta and fetal membranes were collected from healthy women
with singleton pregnancies (n ¼ 40) (28e37 years old) who delivered and received
perinatal care at the tertiary care hospital of Siena (Italy). Written informed consent
was obtained from each pregnant woman and the permission of the Local Human
Investigation Committee was granted for the study. The study population included
women with uncomplicated, term gestation (>37 weeks of gestations) delivering a
healthy infant by elective cesarean section. The study group was divided into two
groups based on fetal sex: male (n ¼ 18) and female (n ¼ 22) (no statistically signif-
icant difference between the two groups in terms of birthweight). Tissues were
collected after delivery and divided in two parts: the former was submerged in a RNA
stabilization reagent (RNA later, Quiagen, Milan, Italy) and frozen at 80  C until
assay, and the latter was paraffin embedded for histochemical analysis.
2.2. RNA extraction and cDNA preparation
Total RNA was extracted from frozen tissue sample as follow. Samples were
disrupted and homogenized following manufacturer's instructions. Briefly tissues

Fig. 2. Immunohistochemical analysis of AMH in female and male fetal membranes. Panel A represent a descriptive image of fetal membranes structure; panel B, D and C, E are
representative images of AMH immunostaining in fetal membranes of female and male fetuses respectively (Original magnification B C and D: 100; E 200): (Y) epithelial layer,
(C) compact layer, (A) fibroblast layer and (-) reticular. G: negative control; F: representative graph of semi-quantitation of staining intensity determined using ImageJ, (Jensen
EC Anat Rec (Hoboken). 2013 Mar; 296(3):378e81). (**p < 0.01).
734 R. Novembri et al. / Placenta 36 (2015) 731e737
were cut into small pieces with a sterile razor blade, frozen in liquid nitrogen and
grinded in a mortar under liquid nitrogen. Then liquid nitrogen and ground tissue
were transferred to appropriately size sterile tube, allowing the liquid nitrogen to
evaporate and then 175 ml of RNA Lysis Buffer every 60 mg of tissue were imme-
diately added. Total RNA was extracted with SV Total RNA Isolation System (Prom-
ega, USA), according to the instruction of the manufacturer. RNA was quantified by
UV absorption (OD260), and the RNA integrity was checked prior to downstream
analysis with the FlashGel® System (Lonza Group, Ltd, Switzerland) to verify total
RNA quality. In order to generate cDNA, 200 ng of total RNA were reverse transcribed
using the ImProm-II Reverse Transcriptase (Promega, USA).
2.3. Real time polymerase chain reaction
Changes in mRNA expression of AMH and AMHRII were analyzed by quantitative
real time polymerase chain reaction (qRT-PCR). Quantification of mRNA expression
relative to housekeeping Hypoxanthine-guanine phosphoribosyltransferase (HPRT)
was measured in triplicate in 20 ml reactions using SYBR® Select Master Mix for CFX
(Applied Biosistem) according to manufacturer's protocol, on CFX Connect 96 (Bio-
Rad Laboratories, Waltham, MA) with appropriate 30 nM forward and reverse
primers. Gene-specific primers used for PCR were chosen according to the published
sequences of human AMH (Genbank accession no. NM_000479.3), AMHRII (Gen-
bank accession no. NM_002192.2) and HPRT (Genbank accession no. NM_000194.2).
AMH forward primer was 50 eTCCGAGAAGACTTGGACTGGe30 , the reverse primer
was 50 -TCCTCCAGGTGTAGGACCACe30 , and the expected size of the amplified frag-
ment was 296 bp; the AMHRII forward primer was 50 eGAGATCATCACG
TTTGCCGAGe30 , the reverse primer was 50 -GAAGAGCCAGACTTCTGCACGe30 , and
the expected size of the amplified fragment was 258 bp; HPRT forward primer was
50 -CGTGATTAGTGATGATGAACCAGe30 and reverse primers was 50 -CGTGATTAGT
GATGATGAACCAGe30 and the expected size of the amplified fragment was 129 bp.
All PCR primers for this real-time assays were designed using Primer-BLAST
software, giving special attention to primer length, annealing temperature, base
composition and 30 -end stability; all primers span exoneexon junctions or are
located on different exons. Real-time PCR protocol consisted of a hot start at 95  C for
2 min, followed by 45 cycles of a two steps protocol: 95  C for 15 s and 60  C for 30 s,
with fluorescence detection at the end of each extension step. Melting curve
confirmed the specificity of the amplified products and the absence of primer dimer
formation. Standard curves were performed to confirm efficient amplification of
each gene before analysis of all samples.
2.4. Immunohistochemistry and double immunofluorescence
Paraffin embedded tissue sections of a thickness of 4 microns were deparaffi-
nized in xylene and rehydrated in graded ethanol solutions (100%, 95%, 80% and
Fig. 3. Immunofluorescence localization of AMH and AMHRII in male placenta. Original magnification AeC: 200; DeF 600. Green: AMHRII, red: AMH, yellow: merge blue: DAPI
(40, 6-diamidino-2-phenylindole). G and H negative controls, I: DAPI.
70%), 5 min each. The sections were subsequently rinsed twice with dH2O for 5 min
each. Then, antigen retrieval was obtained by incubation with 10 mM sodium citrate
buffer (pH 6.0) at a sub-boiling temperature for 20 min and cooling for 10 min.
For immunohistochemistry, the slides were washed three times with
phosphate-buffered saline (PBS), and endogenous peroxidase was blocked with 3%
H2O2 in absolute methanol for 30 min at RT. Sections were then washed in PBS three
times for 5 min. After blocking with PBS containing 5% BSA for 60 min, the sections
were incubated overnight at 4  C with following antibodies: goat anti-human AMH/
MIS (AF 1737, R&D System) rabbit anti-AMHRII (AP7111c; Abgent). Next, the slides
were incubated with EnVisionþ System-HRP (DAKO, Glostrup, Denmark) for 45 min
at RT. Finally, the reaction products were stained with diaminobenzidine (DAB),
counterstained with Mayer's hematoxylin, and mounted with Eukitt mounting
medium after drying. IHC has been performed used 6 male and 6 female placental
tissues and 6 male and 6 female fetal membranes tissues. From each sample 6
sections have been stained and from each slide 4 areas have been captured at
different magnification (100, 200 and 400) and analyzed using ImageJ [36] for
semi-quantitation of staining intensity.
For double immunofluorescence, the slides were washed three times with
phosphate-buffered saline (PBS) and incubated with secondary antibody fluoro-
chrome conjugate (goat anti-rabbit Alexa Fluor 488, donkey anti-goat Alexa Fluor
568) for 1 h at RT in the dark. The nuclei were counterstained by incubating the
sections for 10 min with 40 , 6-diamidino-2-phenylindole (DAPI). Slides were washed
with PBS, mounted with Antifade. Negative controls were generated by omitting the
primary antibody. Images were acquired and analyzed with a microscope Leica AF
CTR6500HS (Microsystems). IF has been performed used 6 male placental tissues
and 6 male fetal membranes. From each sample 6 randomly sections have been
stained and from each slide 4 areas have been captured at two different magnifi-
cations (200 and 600).
2.5. Statistical analysis
All data were assessed for normality of distribution using Cochran Test, using
computer software (Prism 4; Graphpad Software, CA, USA). Normally distributed
data were assessed using Student's t-test. Data are expressed as mean and standard
deviation (SD). Statistical significance was assumed for P < 0.05.
3. Results
AMH and AMHRII mRNA expression was detected by qRT-PCR in
placenta and fetal membranes examined without showing any
significant difference between male and female neonates (AMH:
 R. Novembri et al. / Placenta 36 (2015) 731e737
male placenta 12.25 ± 0.26, female placenta 11.10 ± 0.63; male fetal
membranes 17.22 ± 0.22, female fetal membranes 17.14 ± 0.23.
AMHRII: male placenta 6.39 ± 0.68, female placenta 5.36 ± 0.86;
male fetal membranes 5.86 ± 0.24, female fetal membranes
5.11 ± 0.59 data not shown).
For AMH protein localization immunohistochemistry was per-
formed and ImageJ, an open source image processing program
designed for scientific multidimensional images [36], has been
used in order to have semi-quantitation of IHC analysis and to
compare different staining intensity between male and female sex.
AMH immunostaining in placental tissue of female and male fe-
tuses trophoblast resulted positive in cytotrophoblast cells and in
the syncytiotrophoblast layer, additionally some positive staining
was found in endothelial cell of female placenta (Fig. 1). When data
were analyzed examining the intensity of staining no significant
difference was found between the two sexes (Fig. 1). Fetal mem-
branes of both female and male fetuses showed a more intense
AMH immunostaining than placenta; amniotic epithelial cells and
fibroblast layer in chorion were positively stained (Fig. 2). When
analyzed for the intensity of staining, AMH male fetuses showed a
significant higher staining than female fetuses (Fig. 2).
AMH/AMHRII double immunofluorescence staining was per-
formed in order to localize AMHRII and to evaluate a possible co-
localization with its agonist AMH; AMH and AMHRII resulted co-
expressed in all tissues examined. Fig. 3 showed a double
Fig. 4. Immunofluorescence localization of AMH and AMHRII male fetal membranes. Original magnification AeC: 200; DeF 600. Green: AMHRII, red: AMH, yellow: merge, blue:
DAPI (40, 6-diamidino-2-phenylindole). G and H negative controls, I: DAPI.
735
immunofluorescence staining in placenta tissues: syncytiotropho-
blast is positive for both AMH and AMHRII while the stroma results
negative, at high magnification it is visible a cytoplasmic localiza-
tion of AMH and AMHRII; the merge image shows a co-localization
of AMH and its receptor and a localization of AMHRII in cell
membrane. In fetal membranes (Fig. 4) both magnification pictures
display that AMH and AMHRII are mainly located in amniotic
epithelial cells; the high magnification images indicate a cyto-
plasmic localization of AMH and its receptor. The merge co-localize
AMH and AMHRII and show the localization of AMHRII in cell
membrane.
4. Discussion
The present study shows for the first time that AMH and type II
receptor are expressed and localized in placenta and fetal mem-
branes at term. Although no sex-related difference was found for
mRNA expression both in placenta and fetal membranes, AMH
protein localization in fetal membranes of male fetuses resulted
significantly higher than in female fetuses.
Previous studies conducted on TGF-beta family peptides and
pregnancy suggested a possible involvement of inhibin A and
activin A in the pathogenesis of gestational diseases and it has been
demonstrated that placenta and fetal membranes are sources of
these peptides throughout pregnancy [30e33,37e39]. It was well
736 R. Novembri et al. / Placenta 36 (2015) 731e737
established that maternal circulating AMH levels decrease
throughout pregnancy, then after birth AMH rises quickly; in
particular, a decline in AMH in maternal serum during gestation
starting from 20 weeks was reported. The biological significance of
this decreased AMH maternal serum levels was correlated with the
blockade of maternal ovarian function during gestation [22,25,40].
Indeed during pregnancy ovarian function is inactivated due to
hormonal feedback and no follicles develop, contributing to explain
the lack of difference in maternal AMH levels between women
carrying male or female fetuses [22]. A recent study showed a
relationship between very low maternal AMH levels (1.5 pmol/L) in
early pregnancy and the increased risk to develop pregnancy hy-
pertension later, while no other adverse pregnancy outcomes were
identified [27]; moreover, maternal AMH levels are lower in pre-
eclamptic women than healthy controls [29]. On the basis of
maternal level changes, it has been hypothesized that placenta does
not represent a source of maternal AMH during pregnancy [22,35].
With the present study we show that both term placenta and fetal
membranes of healthy women express AMH and AMHRII mRNA
suggesting a role of these gestational tissues in regulation of this
hormone and its receptor. Moreover in amniotic membranes and in
chorionic layer AMH immunostaining signal resulted much intense
in male than in female fetuses. This finding is in agreement with the
high AMH cord blood serum in male fetuses [23,35]; cord blood
serum AMH levels in second trimester male fetuses range between
64 and 92 ng/ml, whereas it is almost undetectable in female fe-
tuses. AMH is in fact considered an age and gender specific hor-
mone from infancy to adulthood and may be used as an early
marker for testicular function [41e43].
The different results in terms of staining between placenta and
fetal membranes indicates that male-related fetal AMH production
is provided by the membrane production, and supports previous
evidences on sex-related differences in hormonal production and
inflammatory pathways in the feto-placental unit [8]. The co-
localization of AMH and AMHRII and the localization of AMHRII
in cell membrane of both placenta and fetal membranes suggest
that the possible biological action of AMH is probably within the
tissues (paracrine or autocrine), and may be different between
trophoblast and fetal membranes modulating, as TGF-beta family
member, cell proliferation and apoptosis in a different entity. This
functional hypothesis needs further studies in order to be
elucidated.
In conclusion, the present study firstly showed that AMH and
AMHRII are expressed and co-localized in placenta and fetal
membranes, probably exerting specific biological role; the most
intense staining in male fetal membranes supports AMH as a
gender specific hormone.
Conflict of interest
None declared.
References
[1] Vatten LJ, Skjaerven R. Offspring sex and pregnancy outcome by length of
gestation. Early Hum Dev 2004;76(1):47e54.
[2] Engel PJ, Smith R, Brinsmead MW, Bowe SJ, Clifton VL. Male sex and pre-
existing diabetes are independent risk factors for stillbirth. Aust N Z J Obstet
Gynaecol 2008;48(4):375e83.
[3] Stevenson DK, Verter J, Fanaroff AA, Oh W, Ehrenkranz RA, Shankaran S, et al.
Sex differences in outcomes of very low birthweight infants: the newborn
male disadvantage. Arch Dis Child Fetal Neonatal Ed 2000;83(3):F182e5.
[4] Challis J, Newnham J, Petraglia F, Yeganegi M, Bocking A. Fetal sex and pre-
term birth. Placenta 2013;34(2):95e9.
[5] Osei-Kumah A, Smith R, Jurisica I, Caniggia I, Clifton VL. Sex-specific differ-
ences in placental global gene expression in pregnancies complicated by
asthma. Placenta 2011;32(8):570e8.
[6] Yeganegi M, Leung CG, Martins A, Kim SO, Reid G, Challis JR, et al. Lactobacillus
rhamnosus GR-1 stimulates colony-stimulating factor 3 (granulocyte) (CSF3)
output in placental trophoblast cells in a fetal sex-dependent manner. Biol
Reprod 2011;84(1):18e25.
[7] Saif Z, Hodyl NA, Hobbs E, Tuck AR, Butler MS, Osei-Kumah A, et al. The human
placenta expresses multiple glucocorticoid receptor isoforms that are altered
by fetal sex, growth restriction and maternal asthma. Placenta 2014;35(4):
260e8.
[8] Clifton VL. Review: sex and the human placenta: mediating differential stra-
tegies of fetal growth and survival. Placenta 2010;(Suppl. 31):S33e9.
[9] Scott NM, Hodyl NA, Murphy VE, Osei-Kumah A, Wyper H, Hodgson DM, et al.
Placental cytokine expression covaries with maternal asthma severity and
fetal sex. J Immunol 2009;182(3):1411e20.
[10] Hirobe S, He WW, Gustafson ML, MacLaughlin DT, Donahoe PK. Mullerian
inhibiting substance gene expression in the cycling rat ovary correlates with
recruited or graafian follicle selection. Biol Reprod 1994;50(6):1238e43.
[11] di Clemente N, Josso N, Gouedard L, Belville C. Components of the anti-
Mullerian hormone signaling pathway in gonads. Mol Cell Endocrinol
2003;211(1e2):9e14.
[12] Xavier F, Allard S. Anti-Mullerian hormone, beta-catenin and Mullerian duct
regression. Mol Cell Endocrinol 2003;211(1e2):115e21.
[13] Broer SL, Broekmans FJ, Laven JS, Fauser BC. Anti-Mullerian hormone: ovarian
reserve testing and its potential clinical implications. Hum Reprod Update
2014;20(5):688e701.
[14] Visser JA. AMH signaling: from receptor to target gene. Mol Cell Endocrinol
2003;211(1e2):65e73.
[15] Visser JA, Themmen AP. Anti-Mullerian hormone and folliculogenesis. Mol
Cell Endocrinol 2005;234(1e2):81e6.
[16] Weenen C, Laven JS, Von Bergh AR, Cranfield M, Groome NP, Visser JA, et al.
Anti-Mullerian hormone expression pattern in the human ovary: potential
implications for initial and cyclic follicle recruitment. Mol Hum Reprod
2004;10(2):77e83.
[17] de Vet A, Laven JS, de Jong FH, Themmen AP, Fauser BC. Antimullerian hor-
mone serum levels: a putative marker for ovarian aging. Fertil Steril
2002;77(2):357e62.
[18] Koninger A, Koch L, Edimiris P, Enekwe A, Nagarajah J, Kasimir-Bauer S, et al.
Anti-Mullerian Hormone: an indicator for the severity of polycystic ovarian
syndrome. Arch Gynecol Obstet 2014;290(5):1023e30.
[19] Knauff EA, Eijkemans MJ, Lambalk CB, ten Kate-Booij MJ, Hoek A,
Beerendonk CC, et al. Anti-Mullerian hormone, inhibin B, and antral follicle
count in young women with ovarian failure. J Clin Endocrinol Metab
2009;94(3):786e92.
[20] Wang J, Dicken C, Lustbader JW, Tortoriello DV. Evidence for a Mullerian-
inhibiting substance autocrine/paracrine system in adult human endome-
trium. Fertil Steril 2009;91(4):1195e203.
[21] Carrarelli P, Rocha AL, Belmonte G, Zupi E, Abrao MS, Arcuri F, et al. Increased
expression of antimullerian hormone and its receptor in endometriosis. Fertil
Steril 2014;101(5):1353e8.
[22] La Marca A, Giulini S, Orvieto R, De Leo V, Volpe A. Anti-Mullerian hormone
concentrations in maternal serum during pregnancy. Hum Reprod
2005;20(6):1569e72.
[23] Lutterodt M, Byskov AG, Skouby SO, Tabor A, Yding Andersen C. Anti-Mulle-
rian hormone in pregnant women in relation to other hormones, fetal sex and
in circulation of second trimester fetuses. Reprod Biomed Online 2009;18(5):
694e9.
[24] Koninger A, Kauth A, Schmidt B, Schmidt M, Yerlikaya G, Kasimir-Bauer S,
et al. Anti-Mullerian-hormone levels during pregnancy and postpartum.
Reprod Biol Endocrinol 2013;11:60.
[25] Nelson SM, Stewart F, Fleming R, Freeman DJ. Longitudinal assessment of
antimullerian hormone during pregnancy-relationship with maternal
adiposity, insulin, and adiponectin. Fertil Steril 2010;93(4):1356e8.
[26] Szafarowska M, Molinska-Glura M, Jerzak MM. Anti-Mullerian hormone
concentration as a biomarker of pregnancy success or failure. Neuro Endo-
crinol Lett 2014;35(4):322e6.
[27] Shand AW, Whitton K, Pasfield A, Nassar N, McShane M, Han X, et al. Evalu-
ation of anti-Mullerian hormone in the first trimester as a predictor for hy-
pertensive disorders of pregnancy and other adverse pregnancy outcomes.
Aust N Z J Obstet Gynaecol 2014;54(3):244e9.
[28] Yarde F, Maas AH, Franx A, Eijkemans MJ, Drost JT, van Rijn BB, et al. Serum
AMH levels in women with a history of preeclampsia suggest a role for
vascular factors in ovarian aging. J Clin Endocrinol Metab 2014;99(2):579e86.
[29] Tokmak A, Guney G, Aksoy RT, Guzel AI, Topcu HO, Kececioglu T, et al. May
maternal anti mullerian hormone levels predict adverse maternal and peri-
natal outcomes in preeclampsia? J Matern Fetal Neonatal Med 2014:1e18.
[30] Manuelpillai U, Schneider-Kolsky M, Dole A, Wallace EM. Activin A and activin
receptors in gestational tissue from preeclamptic pregnancies. J Endocrinol
2001;171(1):57e64.
[31] Farina A, Lambert-Messerlian GM, Canick JA, Banzola I, Carletti A, Concu M,
et al. Total activin A in maternal blood as a marker of preterm delivery in low-
risk asymptomatic patients. Prenat Diagn 2006;26(3):277e81.
[32] Rabinovici J, Goldsmith PC, Librach CL, Jaffe RB. Localization and regulation of
the activin-A dimer in human placental cells. J Clin Endocrinol Metab
1992;75(2):571e6.
[33] Petraglia F, Di Blasio AM, Florio P, Gallo R, Genazzani AR, Woodruff TK, et al.
High levels of fetal membrane activin beta A and activin receptor IIB mRNAs
 R. Novembri et al. / Placenta 36 (2015) 731e737
and augmented concentration of amniotic fluid activin A in women in term or
preterm labor. J Endocrinol 1997;154(1):95e101.
[34] Keelan JA, Zhou RL, Mitchell MD. Activin A exerts both pro- and anti-
inflammatory effects on human term gestational tissues. Placenta
2000;21(1):38e43.
[35] Kuijper EA, Ket JC, Caanen MR, Lambalk CB. Reproductive hormone concen-
trations in pregnancy and neonates: a systematic review. Reprod Biomed
Online 2013;27(1):33e63.
[36] Jensen EC. Quantitative analysis of histological staining and fluorescence using
ImageJ. Anat Rec (Hoboken) 2013;296(3):378e81.
[37] Florio P, Luisi S, Ciarmela P, Severi FM, Bocchi C, Petraglia F. Inhibins and
activins in pregnancy. Mol Cell Endocrinol 2004;225(1e2):93e100.
[38] Torricelli M, Voltolini C, Novembri R, Bocchi C, Di Tommaso M, Severi FM,
et al. Activin A and its regulatory molecules in placenta and fetal mem-
branes of women with preterm premature rupture of the membranes
associated with acute chorioamnionitis. Am J Reprod Immunol 2012;68(5):
392e9.
737
[39] Florio P, Cobellis L, Luisi S, Ciarmela P, Severi FM, Bocchi C, et al. Changes in
inhibins and activin secretion in healthy and pathological pregnancies. Mol
Cell Endocrinol 2001;180(1e2):123e30.
[40] Li HW, Hui PW, Tang MH, Lau ET, Yeung WS, Ho PC, et al. Maternal serum
anti-Mullerian hormone level is not superior to chronological age in pre-
dicting Down syndrome pregnancies. Prenat Diagn 2010;30(4):320e4.
[41] Bergada I, Milani C, Bedecarras P, Andreone L, Ropelato MG, Gottlieb S, et al.
Time course of the serum gonadotropin surge, inhibins, and anti-Mullerian
hormone in normal newborn males during the first month of life. J Clin
Endocrinol Metab 2006;91(10):4092e8.
[42] Lee MM, Donahoe PK, Hasegawa T, Silverman B, Crist GB, Best S, et al.
Mullerian inhibiting substance in humans: normal levels from infancy to
adulthood. J Clin Endocrinol Metab 1996;81(2):571e6.
[43] Pierik FH, Deddens JA, Burdorf A, de Muinck Keizer-Schrama SM, Jong FH,
Weber RF. The hypothalamus-pituitary-testis axis in boys during the first six
months of life: a comparison of cryptorchidism and hypospadias cases with
controls. Int J Androl 2009;32(5):453e61.