Sie sind auf Seite 1von 108
Developmental and Pathological Roles of BMP/Follistatin-like 1 in the Lung PhD thesis to obtain the

Developmental and Pathological Roles of BMP/Follistatin-like 1 in the Lung

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the Rector Magnificus Prof. E. Sterken and in accordance with the decision by the College of Deans.

This thesis will be defended in public on

Friday 6 October 2017 at 12.45 hours

by

Navessa Padma Tania

born on 12 April 1986 in Bandung, Indonesia

Supervisors Prof. R. Gosens Prof. M. Schmidt

Co-supervisor Dr. H. Maarsingh

Assessment Committee Prof. G. Folkerts Prof. C. Bingle Prof. F.A.E. Kruyt

Prof. G. Folkerts Prof. C. Bingle Prof. F.A.E. Kruyt De rol van BMP/Follistatin-like 1 in de

De rol van BMP/Follistatin-like 1 in de ontwikkeling en de pathologie van de long

Proefschrift

ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen op gezag van de rector magnificus prof. dr. E. Sterken en volgensbesluit van het College voor Promoties.

De openbare verdediging zal plaatsvinden op

vrijdag 6 oktober 2017 om 12.45 uur

door

Navessa Padma Tania

geboren op 12 april 1986 te Bandung, Indonesië

Paranymphs:

Christel Seegers Thea van den Bosch

The research described in this thesis was carried out at the Department of Molecular Pharmacology (Groningen Research Institute of Pharmacy, University of Groningen, The Netherlands) according to the requirements of the Graduate School of Science (Faculty of Science and Engineering, University of Groningen, The Netherlands).

The research was financially supported by the Lung Foundation Netherlands (grant 3.2.12.083).

Printing of this thesis was financially supported by the University Library of the University of Groningen, the Graduate School of Science, and the Lung Foundation Netherlands.

Cover story: COPD lung vs. developing lung– Putri Astri Wulandari Printing: Ipskamp Printing B.V., Enschede, the Netherlands

ISBN (printed version): 978-94-034-0016-7 ISBN (electronic version): 978-94-034-0015-0

Copyright © 2017 by Navessa Padma Tania. All rights reserved. No parts of this thesis may be reproduced or transmitted in any form or by any means without the prior permission from the author.

Science knows no country, because knowledge belongs to humanity, and is the torch which illuminates the world – Louis Pasteur

DEVELOPMENTAL AND PATHOLOGICAL ROLES OF BMP/FOLLISTATIN-LIKE 1 IN THE LUNG

Chapter 1.

General Introduction.

Chapter 2.

Endothelial follistatin-like-1 regulates the postnatal development of the pulmonary vasculature by modulating BMP/Smad signaling.

Pulm Circ. 2017; 7(1):219-231

Chapter 3.

The effect of cigarette smoking on pulmonary Follistatin-like 1 expres- sion: potential implication in chronic obstructive pulmonary disease

Chapter 4.

Activin-A: active in inflammation in COPD.

EurRespir J. 2014; 43: 954–955

Chapter 5.

Pro-inflammatory roles of Follistatin-like 1 in coordinating epitheli- al-mesenchymal communication in inflammatory cytokine release in the lung

Submitted

Chapter 6.

Regulation of pulmonary inflammation by mesenchymal cells.

Pulm.Pharmacol.Ther. 2014; 1-10

Chapter 7.

Variant club cell differentiation is driven by bone morphogenetic pro- tein 4 in adult human airway epithelium: Implications for goblet cell metaplasia and basal cell hyperplasia in COPD.

Chapter 8.

General discussion and summary.

Chapter 9.

Dutch summary/Nederlandse samenvatting

Chapter 10. Indonesian summary/Rangkuman dalam bahasa Indonesia

Acknowledgement

Biography and list of publications

1

CHAPTER 1

1

GENERAL

INTRODUCTION

Preface

The primary aim of this thesis is to explore the functional roles of an endogenous bone morphogenetic protein (BMP) antagonist, Follistatin-like 1 (Fstl1), in lung development and in the pathological processes of chronic obstructive pulmonary disease (COPD). BMP signaling plays active roles in lung development as evident in embryonic and perinatal lethality and lung developmental defect of BMP-deficient mice. 1 It is now apparent that BMP signaling also plays crucial regulatory roles in adult lung homeostasis by modulating inflammation and repair in the lung. 2,3 However, the involvement of BMP signaling has not been previously explored in the pathophysiology of COPD. We hypothesized that the imbalance between BMP and its antagonist Fstl1 contributes to dysregulation of early postnatal lung development, airway inflammation, and adult airway epithelial cell differentiation similar to that observed in COPD. This thesis sheds light on Fstl1 as a novel mediator of airway epithelial-driven inflammation in the lung and potentially of goblet cell metaplasia and the loss of club cells in COPD epithelium. Therefore, targeting Fstl1 is worth pursuing for the treatment of airway inflammation and epithelial remodeling in COPD.The first part of this chapter provides an overview of COPD pathophysiology, including chronic airway inflammation, airway epithelial remodeling, vascular remodeling, and currently available treatment. The second part of this chapter covers the current understanding of BMP pathway in lung development and chronic respiratory diseases. The third part of this chapter focuses on the latest discoveries on developmental and pathological roles of Fstl1. Finally, the scope of this thesis and the specific aims of our studies are described in the last part of this chapter.

1. Chronic Obstructive Pulmonary Disease (COPD)

The Global Initiative for Chronic Obstructive Lung Diseases (GOLD) guidelines stated COPD as “a common preventable and treatable disease, characterized by persistent airflow limitation that is usually progressive and associated with an enhanced chronic inflammatory response in the airways and the lung to noxious particles or gases. Exacerbations and comorbidities contribute to the overall severity in individual patients’’. 4 According to the World Health Organization, COPD will be the third major cause of death worldwide by 2020, surpassing stroke. 5 Cigarette smoking accounts for 85-90% of COPD cases and is the best-known etiological factor for the development of COPD. However, 10-15% of COPD patients are never smokers and only about 15-20% of smokers manifest COPD, 6 suggesting a role for environmental factors and susceptibility-associated (epi)genetic make-up. This has led to the concept that impaired inflammatory responses to cigarettes smoke- induced injury manifest to COPD in susceptible persons. 7 Accumulating evidence from genome-wide (epi)genetic association studies discovered several loci that are strongly associated with COPD susceptibility. 812 The major loci that associated with COPD susceptibility include HHIP (hedgehog interacting protein) and FAM13A (family with sequence similarity 13 member A) on chromosome 4 as well as CHRNA3/5 (cholinergic nicotinic acetylcholine receptor) on chromosome 15. 8,9,13,14 The common

4

symptoms of COPD include breathlessness, chronic and progressive dyspnea, chronic cough, and excessive sputum production. 4 The episodes of acute worsening of COPD symptoms, the-so-called exacerbations, aggravate primarily in patients with severe disease, and approximately 78% is linked with respiratory infections. 4 The molecular and cellular mechanisms underlying the symptoms and pathobiology of COPD are not completely understood. The current understanding from histopathology and current available treatment of COPD is summarized below.

1

1.1. The pathology of COPD

The pathology of COPD displays highly heterogeneous phenotypes involving abnormal airway wall architectures, peribronchial fibrosis, destruction of alveolar septa (emphysema), and altered airway epithelial composition, including goblet cell

metaplasia and loss of club cells. 15,16 Major remodeling throughout the respiratory tracts (including proximal, distal and peripheral airways, lung parenchyma and pulmonary vasculature) and changes in the cellular differentiation profile of the airway epithelium collectively manifest in a progressive decline of lung function. 17 The staging of COPD that reflects disease severity is typically determined by spirometry. 4

A new hypothesis addresses the potential involvement of developmental pathways

in COPD based on accumulating data from genome-wide association studies and microarray profiling, indicating dysregulation of developmental factors originally known for their roles in embryonic development. 18 BMP signaling is pivotal during lung development, nevertheless, it has been largely unexplored in adult lung as well as the pathogenesis of COPD. BMP signaling is found decreased in the lung of pulmonary fibrosis patients and following bleomycin injury in mice. 19,20 Accordingly, accumulating evidence indicates a marked increase of the endogenous BMP antagonist Fstl1 in the lung of patients suffer from respiratory diseases. 2125 This thus raises the possibility that an imbalance between BMP and its endogenous antagonists may lead to airway inflammation and airway epithelial remodeling in COPD.

1.2. Persistent inflammation of the airways in COPD

Chronic airway inflammation is the primary pathophysiological feature of COPD and

is believed to be the major contributor of structural changes in COPD airways. 17 The

number of neutrophils and macrophages is positively correlated with COPD severity. 26 Airway inflammation in COPD is associated with infiltration of various innate and adaptive immune cells with prolonged retention time in the respiratory tracts, primarily in peripheral airways (bronchioles), lung parenchyma, and pulmonary arteries. 27,28 Previously, infiltrating leukocytes were considered to be the key player of airway inflammation and the major factor in COPD development. However, latest discoveries show that the structural cells, such as bronchial epithelial cells, lung fibroblasts, and airway smooth muscle cells also express and secrete molecules that regulates innate airway inflammation and defense mechanisms. 2931

5

As a part of the normal repair mechanism to injury, airway epithelium of healthy individuals mediate the activation of innate immune responses via pattern recognition receptors (PRRs) to release “danger signals” which subsequently activate Toll-like receptor (TLRs). 32 Activation of TLR receptor promotes release of cytokines to recruit inflammatory cells to the site of injured epithelium in the lung. Resolution of inflammation is responsible for switching “off” the inflammatory response when the toxic insults are successfully cleared out. However, chronic exposure to inhaled toxic compounds, such as cigarette smoke, activates airway epithelial cells to secrete a myriad of pro-inflammatory cytokines and chemokines, including interleukin-6 (IL- 6), CXC-chemokine ligand 1 (CXCL1), CXCL8, CC-chemokine ligand 2 (CCL2), C-X-C- Motif ligand 8, IL-1β, tumor necrosis factor (TNF)-α and granulocyte macrophage colony-stimulating factor (GM-CSF). 3335 Airway inflammation in COPD is associated with persistent and exaggerated innate and adaptive inflammatory responses involving recruitment of CD8 + T-helper-1 (Th1) cells, neutrophils, monocytes, and lymphocytes. Inflammatory mediators released by bronchial epithelial cells following cigarette smoke-induced injury have a paracrine effect on neighboring mesenchymal cells, such as lung fibroblasts and airway smooth muscle cells. 30,36 Several studies have shown that these mesenchymal cells are more than just structural cells as they express and release inflammatory mediators, like IL-6, IL-8, TNF-α, which contribute to the neutrophil and monocyte infiltration to the lung. 30,31 The number of inflammatory cells, such as macrophages, neutrophils and CD8 + T cells, is increased in sputum and bronchoalveoalar lavage (BAL) of COPD patients. 37,38 Neutrophil chemotactic proteins including leukotriene B4 (LTB4), IL- 8, CXCL1 and CXCL8, GRO-a (growth-related oncogene-a), and ENA-78 (epithelial neutrophil-activating protein of 78 kDa) are increased in the sputum and BAL fluid of COPD patients. 3941 Macrophages also induce release of LTB4, IL-8, TNF-α, MCP-1, and reactive oxygen species upon cigarette smoke-induced injury. These secreted factors activate and recruit neutrophils to the lung, leading to increase secretion of proteases (neutrophil elastase, proteinase-3, matrix metalloproteinases (MMP)- 8, MMP-9, cathepsin G) which is associated with emphysema. 42,43 In addition, GM- CSF and granulocyte colony-stimulating factor (G-CSF) promote neutrophil survival, proliferation, and differentiation. 44,45 The transcription factor nuclear factor-κB (NF-κB) is known to be the central regulator of inflammatory protein expression. 46 In addition, E-selectin which mediates neutrophil adhesion to endothelial cells is increased on endothelial cells of bronchial mucosa of COPD patients. 47 Macrophages secrete chemokines interferon-c inducible protein (IP-10), interferon-inducible T-cell chemoattractant (I-TAC), and monokine-induced by interferon-c (Mig). 48 The increased numbers of macrophages in COPD patients can be a result of increased recruitment of circulatory monocytes and/or increased cell proliferation and survival. Collectively, accumulation of inflammatory cells in the lung aggravates a chronic inflammatory state and results in airway structural changes, airway obstruction, and respiratory symptoms observed in COPD. 49,50

6

Disruption of epithelial-driven innate immune functions is also strongly affected by impaired airway epithelial structure and composition following epithelial injury which will be described on the next section. Persistent airway inflammation leading to recruitment and activation of neutrophils and macrophages in COPD is illustrated in Figure 1.

goblet cells ciliated cells club cells Healthy epithelium
goblet cells
ciliated cells
club cells
Healthy epithelium
basal cells
basal cells
? Chapter 7 BMP4 goblet cell metaplasia loss of club cells COPD epithelium ? Chapter
? Chapter 7
BMP4
goblet cell metaplasia
loss of club cells
COPD epithelium
? Chapter 3
Fstl1
?
Chapter 5
? Chapter 5
airway smooth muscle cells
lung broblasts
IL-6

IL-8

Recruitment and ac�va�on of innate immune cells

neutrophils macrophages
neutrophils
macrophages

1

Figure 1. Persistent airway inflammation is a major hallmark of COPD pathogenesis. The healthy epithelium lining of adult airways is composed of a mixture balance of goblet cells, ciliated cells, basal cells and club cells. Cigarette smoke and inhaled toxic pollutants promotes airway epithelial remodeling, including goblet cell metaplasia, mucus hypersecretion, and loss of secretory club cells. In addition, cigarette smoke and inhaled toxic pollutants induce release of inflammatory mediators from epithelial cells with autocrine and paracrine effects on neighboring mesenchymal cells, such as fibroblasts and airway smooth muscle cells. Pulmonary mesenchymal cells secrete IL-6 and IL-8 that contributes to an infiltration of neutrophils and macrophages to the lungs. The abnormal accumulation of inflammatory cells aggravates airway inflammation in the lungs and leads to the development of COPD. The expression of Fstl1 in COPD compared to non-COPD lungs is investigated in Chapter 3. The role of Fstl1 in inflammatory cytokine release from pulmonary mesenchymal cells is shown in Chapter 5.The effect of BMP4 on adult airway epithelial cells is examined in Chapter 7.

7

1.3. Remodeling of airway epithelium in COPD

Airway epithelium acts as the first protective barrier between the external environment and the internal lung tissue and the rest of the body. The healthy epithelium lining of adult large cartilaginous airways is made up of a layer of basal cells that are attached to the basal lamina underneath a layer of airway lumen columnar cells with a balanced mixture of goblet cells, ciliated cells and club cells. This epithelial structure is important for the mucociliary clearance function. 16 In trachea, up to 60% of the total cell number are ciliated cells and approximately 20% are mucus secreting goblet cells. 51,52 The number of ciliated cells falls to approximately 15% by the 5 th airway generation. The distal airways predominantly consist of serous and secretory club cells. 29 In the proximal bronchioles, the epithelial cells become more cuboidal and, in addition to ciliated cells, contain secretory club cells. Finally, in the most distal bronchioles, only club cells are identified. 53 The cellular composition and function of COPD airway epithelium was found to be altered as evident by the loss of tight junctions, basal and goblet cell hyperplasia, and loss of secretory club cells and ciliated cells, resulting in loss of its barrier function and excessive mucus production. 16,54 Cigarette smoke causes the goblet cell hyperplasia and the loss of ciliated cells, resulting in a reduction of mucociliary clearance and mucus plug formation. In COPD, increased numbers of goblet cells are also found in the small bronchi and bronchioles, where there are normally very few. 55 The cellular events in epithelial repair after injury have been described. 49,56,57 The airway epithelium is more than just a physical barrier as evidenced by the fact that bronchial epithelial cell transcribe and secretes numerous soluble factors, such as cytokines, chemokines and growth factors. Club cells are important in controlling lung inflammation by secreting a number of anti-inflammatory agents, such as secretoglobin (SCGB3A) and uroplakin (UPK3A). 58 Surfactant proteins (SP-A, SP-B, SP-D), also called collectins, are produced by club cells and alveolar epithelial cells and play an important role in airway epithelial defense mechanism. At the bronchiolar level, the club cell secretory protein (CCSP), also called CC10, is able to modulate lung inflammatory and immune responses. However, club cells are reduced in bronchial biopsies from COPD patients 59,60 and in peripheral and central airways in lung tissue of COPD patients, 61 which could contribute to the aggravated inflammatory process. The air-liquid culture provides a valuable system to mimic a well differentiated epithelial cells in vitro and permits the study of the re- epithelialization after injury. 62,63 Therefore, this is an excellent tool to study epithelial cell differentiation under various condition. However, there are limited studies addressing the functional roles of BMP signaling in the adult lung epithelial cells which may enlighten the consequence of aberrant BMP signaling in the context of COPD.

1.4. Remodeling of extracellular matrix in COPD

In healthy lung, non-cartilaginous small airways (<2 mm) contribute to only ~25% to the total airway resistance, whereas in COPD lungs, it becomes the major site of increased airway resistance as a result of increased deposition of extracellular

8

matrix, thickening of airway smooth muscle and narrowed airway lumen. 6466 In COPD, infiltrating inflammatory cells release inflammatory mediators that promote production of extracellular matrix from pulmonary mesenchymal cells which contribute to tissue remodeling and respiratory dysfunction. 30 Multiple studies have reported increased extracellular matrix protein expression, such as fibronectin, collagen I, hyaluronan, and laminin in COPD airway and lung parenchyme. 6770 Airway smooth muscle cell hyperplasia and hypertrophy cause thickening of smooth muscle bundles surrounding COPD airways, whereas airway fibroblasts contribute to sub- epithelial fibrosis in the airway wall. The primary roles of pulmonary fibroblasts are tissue repair and remodeling by producing diverse extracellular matrix proteins, such as fibronectin, collagen, and airway smooth muscle actin, whereas airway smooth muscle cells are mainly responsible for airway contraction. Transforming growth factor (TGF)-β1 produced by epithelial cells in the small airways is a key player in tissue remodeling and is found to be markedly increased in COPD. It is associated with increased deposition of extracellular matrix within and surrounding the smooth muscle bundles of COPD, which results in thickened airway walls and increased in stiffness. 71 An imbalance between the production and degradation of extracellular matrix could possibly explain excessive matrix deposition and may lead to airway fibrosis in COPD in addition to proliferating airway smooth muscle cells induced by cigarette smoking. 72 In COPD, the number of myofibroblasts (airway fibroblasts with a more contractile phenotype) is increased and contributes to reduction of airway elasticity. 73 Fibroblasts from individuals with COPD have reduced capacity for tissue repair due to increased prostaglandin E (PGE) and TGF-β1 expression. 74 The thickness of small airway wall is associated with COPD severity. The obstructed small airways are characterized by abnormal architecture of epithelium and smooth muscle layers and the presence of fibrosis. 65,75

1

1.5. Remodeling of the pulmonary vasculature in COPD

Patients with COPD also frequently suffer from pulmonary arterial hypertension (PAH), one of the common comorbidities of COPD. PAH is characterized by increased arterial pressure in the lungs as a result of narrowing of vessel lumen due to vascular remodeling and increased vasoconstriction. 76,77 Endothelial cells are important for vascular homeostasis by maintaining vascular tone and remodeling. 78 Cigarette smoking disrupts endothelial functions of pulmonary arteries in COPD. 79,80 Endothelial cells are key players in regulation of cell and vessel growth, thus it is believed that endothelial dysfunction initiates vascular remodeling in COPD. Endothelial dysfunction leads to uncontrolled intimal endothelial cell proliferation consequently resulting in thickened pulmonary muscular arteries observed in smokers and patients with mild COPD. 79,80 Inflamed lung tissue is hypoxic and promotes angiogenesis by increasing growth factors such as vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and epidermal growth factor (EGF). 77,81 These growth factors are involved in tissue repair and vascular remodeling which eventually contribute to microvascular remodeling observed in COPD. The

9

opposing effects of angiogenic and angiostatic factors such as chemokines (CXC family) that induce or inhibit neovascularization, respectively, determines the angiogenesis process. 77,82 VEGF and its receptor seem to be important for endothelial and epithelial cell survival following injury. Numerous studies showed increased expression of VEGF and VEGF receptors (Flk-1 and Flt-1) in pulmonary muscular arteries of patients with mild and moderate COPD and in current smokers without airway obstruction. 81,8385 An increase of angiogenic factors are also associated with thickening of the pulmonary arterial walls. 76,81,8385 However, VEGF expression is low in total lung homogenates of severe emphysema patients. 86 It has been proposed that low VEGF may be involved in the emphysema process through cell apoptotic mechanisms, as the lung microvascular endothelial cells and alveolar septal capillary cells needs VEGF for cell survival. 86,87 Endothelial cell death leads to loss of capillaries may be a major mechanism of emphysema. 86 Macrophages, CD8+ T lymphocytes, neutrophils, fibroblasts that involves in immune response can promotes angiogenesis in many ways by secreting TNF-α which also is an angiogenic factor. Additionally, the protein expression of endothelin-1 (ET-1) and ET-1 receptor ETA that mediate vascular smooth muscle conctration is increased in PAH. 88,89

1.6. Current treatments

Currently, there is no effective cure for COPD. Inhaled corticosteroids (e.g. fluticasone, budesonide), phosphodiesterase 4 inhibitors (roflumilast), short- acting (e.g. albuterol) or long-acting b 2- adrenoreceptor agonists (e.g. salmeterol, formoterol), and long-acting anti-cholinergics (e.g. tiotropium, ipratropium, glycopyrronium bromide, umeclidinium) are used alone or in combination to relieve

the symptoms and inflammation. 90 However, these therapies do not change the course of the disease. 90 Therefore, understanding the molecular mechanism of COPD is undoubtedly important to identify a novel molecular target that can decelerate the progression of COPD. A better understanding of impaired repair process which contributes to COPD may lead to the identification of new molecular targets and more effective therapy options in COPD treatment.

2. Bone morphogenetic protein (BMP) signaling in the lung

In 1965, Marshall R. Urist discovered osteogenic factors present in bone matrix extracts capable of promoting de novo cartilage formation and bone formation in vivo, namely bone morphogenetic protein (BMP). 91,92 BMP signaling belongs to the TGF-β superfamily, which is phylogenetically conserved. 91 Genetic studies in mice demonstrate the importance of BMP signaling in embryonic dorsal-ventral paterning 9395 and embryonic lung development. 3,96,97 It is now evident that BMPs govern diverse cellular effects including stem cell maintenance, migration, differentiation, proliferation, and programmed cell death. 98 A growing body of evidence indicates the involvement of BMP signaling in normal lung physiology and pathology conditions in adulthood, strongly suggesting that BMP signaling also plays a pivotal role in adult lung homeostasis, including epithelial repair after injury. 3

10

2.1.

Players in BMP signaling

2.1.1.

BMP ligands

BMPs (which are also referred to as growth and differentiation factors (GDFs)) are secreted glycosylated proteins, with 20 different members identified and

characterized. 98 BMP polypeptides consist of an N-terminal secretory signal peptide,

a prodomain that ensures proper folding, and a C-terminal mature peptide. Mature

BMPs are derived from cleavage of the BMP precursors by serine endoproteases in the trans-Golgi network and subsequently secreted. Homo or heterodimerization of BMP ligands forms an active BMP agonist. Secreted BMPs bind either to the extracellular matrix, extracellular antagonists, co-receptors or to transmembrane receptors. Activation of BMP signal transduction leads to either transcriptional responses (e.g. Smad-dependent signaling) or non-transcriptional responses (e.g. Smad-independent signaling, cytoskeletal rearrangements). 98

1

2.1.2. BMP receptors and co-receptors

The BMP receptors are composed of two types of transmembrane serine/threonine kinase receptors, type I and type II receptors, which are highly homologous but not redundant, and are capable of activating both Smad-dependent and Smad- independent signaling. The receptors encompass an extracellular ligand binding domain and a cytoplasmic serine/threonine kinase domain. The type I receptor has two additional motifs in its kinase domain, a glycine/serine-rich region prior the GS-box kinase domain and a L45 loop composed of eight amino acids. 99 Type

I receptors include activin receptor-like kinase 1 (ALK1), activin receptor type Ia (ActRIa or ALK2), BMP receptor type Ia (BMPRIa or ALK3) and BMP receptor type Ib (BMPRIb or ALK6). These receptors form heteromeric complexes with the type

II receptors, including BMP receptor type II (BMPRII) and activin receptors type IIA

(ACVRIIA also known as ActRIIA) and activin receptors type IIB (ACVRIIB also known as ActRIIB). 100 The specificity of BMP signaling is tightly controlled by selective extracellular regulators, receptors, co-receptors, and cytosolic receptor-associated proteins to exert specific BMP functions which will be described in more detail below. Activation of BMP signaling is preceded by oligomerization of BMP ligands and type I receptor kinase. Activated type I receptor undergo transphosphorylation of its GS-box via constitutively active type II BMP kinase receptors. 98,99 After the formation of a heterotetrameric complex, the signal propagates to the nucleus either in intracellular regulator Smad-dependent (canonical) or Smad-independent (non- canonical) manner. 98 Co-receptors that positively regulates BMP signaling are the repulsive guidance molecules (RGM)-a and -c, Dragon (RGMb), the receptor tyrosine kinase (RTK) c-Kit, and the TGF-β1/BMP type III receptors Endoglin and Betaglycan. In contrast, BMP signaling is negatively regulated by the pseudoreceptor BMP and activin membrane-bound protein (BAMBI) and the RTKs Ror2 and TrkC. 98

11

2.1.3. Downstream BMP/Smad-dependent signaling

In the canonical pathway, the transduction of extracellular signals to regulation of gene transcription inside the nucleus is mediated by Smad proteins. 99 There are

three types of Smad proteins, BMP receptor-regulated Smads (R-Smads), common mediator Smad (co-Smad), and inhibitory Smads (I-Smads). BMP ligands bind to the type I BMP receptors resulting in phosphorylation of R-Smads (Smad1/5/8), followed by trimeric complex formation with co-Smad (Smad4), and translocation of the complex into the nucleus, 98,100,101 which subsequently induces transcription of BMP downstream target genes, 102 presumably in collaboration with other co-repressors and co–activators. 103 I-Smads (Smad6 and Smad7) negatively regulate BMP/Smad signaling by preventing phosphorylation of R-Smads, instead targeting R-Smads and type I receptor for ubiquitin–proteasome degradation. Two conserved domains of R-Smads are the N-terminal DNA and protein binding MH1 (mad homology 1) domain and the C-terminal MH2 domain which are connected by a variable proline- rich linker region. 104,105

2.1.4. Downstream BMP/Smad-independent signaling

In addition to canonical BMP signaling, BMP ligands activate gene transcription in a Smad-independent manner. BMP ligands can activate the MAPK pathway by recruitment of TAK1, TAB1, and XIAP to type I BMP receptors, which subsequently phosphorylate p38 MAPK or JNK. 106 Additionally, ERK mediates transcription of BMP2-regulated genes. 107 BMP regulates sets of genes which are involved in lung and vascular homeostasis, including epithelial and vascular remodeling. BMP regulated genes, including jagged1, GATA2, and endoglin, have been identified in endothelial cells. 102 BMPs can also activate TGF-β activated kinase 1 (TAK1) leading to p38/ JNK/Erk MAP kinase activation. 108,109 TAK1 mediates phosphorylation of Smad1 at C-terminal serine residues, suggesting it functions as an upstream activating kinase for Smad1/5/8 in BMP signaling. 109

2.1.5. Fine tuning of BMP signaling

BMP functions are tightly modulated by BMP antagonists, co-receptors, and intracellular regulatory proteins. BMP antagonists function through direct binding with BMP ligands and prevent BMPs from binding to their transmembrane receptors. Pseudo-receptors sequester BMP ligands at the cell surface. Co-receptors and intracellular regulatory proteins interact with the receptors to regulate downstream BMP functioning. The spatiotemporal interplay between BMP and its regulators govern developmental and cellular processes. BMP antagonists are cysteine knot containing motif which form a functional homodimer. BMP antagonists bind selectively to distinct BMP ligands in a context- and concentration-dependent manner to maintain BMP gradients, which have been extensively studied during embryonic lung development. BMP antagonists include Noggin, gremlin, twisted gastrulation (Tsg), and Fstl1. Antagonists are categorized based on their cysteine knot motif: the Chordin/Noggin family contains a ten-membered cysteine ring, Tsg

12

contains a nine-membered cysteine ring and the DAN/Cerberus family contains an eight-membered cysteine ring. 110 Molecular regulation of BMP signaling pathway is illustrated in Figure 2.

1

BMP Extracellular regulators (e.g.: Fstl1) Gremlin type III/ co-receptor (e.g.: Endoglin) ALK1 BMPRII ALK2
BMP
Extracellular regulators
(e.g.: Fstl1)
Gremlin
type III/ co-receptor
(e.g.: Endoglin)
ALK1
BMPRII
ALK2
ACVRIIA
type II
type I
ALK3
ACVRIIB
Extracellular
ALK6
Cytoplasm
P
P
Smad-dependent
Smad-independent
TAK1
P
Smad1/5
Smad4
P
MAPK
Smad1/5
Erk
JNK
p38
Nucleus
Smad1/5 P
Smad4
P
ON
ON
Smad1/5
BRE
BRE
Progenitor cell maintenance
Proliferation
Di
erentiation

Figure 2. Molecular regulation of BMP signaling. Activation of BMP signaling is initiated by binding of BMP ligands to the type I BMP receptors (ALK1, 2, 3, 6) followed by recruitment of constitutively active type II BMP receptor receptors (BMPRII, ACVRIIA, ACVRIIB) to form a signal-activating complex. In cytoplasm, the signal propagates either via Smad-dependent or Smad-independent manner. In a Smad-dependent signaling, the transduction of BMP signals is mediated by Smad1/5 proteins. Phosphorylated Smad1/5 proteins form a complex with Smad4 protein which subsequently translocate to nucleus and bind to a 52 base-pair BMP response element (BRE) on the promoter region of the target genes. In a non-Smad signaling, BMP ligands can activate the MAPK pathway by recruitment of TAK1 to type I BMP receptors, which subsequently phosphorylate Erk/JNK/p38. Thereby, phosphorylated Erk/ JNK/p38 can translocate into the nucleus. Among others, BMP functions are tightly regulated by co-receptors (e.g. Endoglin) and extracellular regulators (e.g. Fstl1).

13

2.2. BMP signaling in lung development and adult lung homeostasis

Lung development is orchestrated by precise coordination of several molecular pathways, including BMP signaling. The canonical BMP signaling is important in lung development.3 Fundamental roles of BMP signaling in lung development are evident from BMP mutations associated with congenital lung defects in human and genetic studies in transgenic mice and familial mutation in PAH. Deletion of lung epithelial- specific Smad1 resulted in impaired airway branching morphogenesis, decreased sacculation, disruption of distal lung epithelial cell proliferation and differentiation which contribute to severe postnatal respiratory distress. Wu et al. also revealed that BMP4/Smad1 signaling modulates other molecular pathways including Wnt/β- catenin by expressing Wnt inhibitory factor 1 (Wif1) in the developing fetal mouse lung.111 Overexpression of BMP4 in the epithelium, on the other hand, leads to smaller lungs and to a marked decrease in epithelial cell proliferation. 97 In adults,

lung tissue homeostasis is required for continuous regeneration and subsequent differentiation of stem cells in order to maintain lung architecture and proper functions. BMP signaling maintains an undifferentiated state of the airway and alveolar epithelial progenitors for lung epithelial homeostasis and tissue injury repair. 3 A tight and precise regulation of pulmonary vascular development is required for normal lung development. 112 Canonical BMP signaling plays key roles during embryonic development of the pulmonary vasculature. 3 Activation of BMPRII promotes pulmonary artery endothelial cell (PAEC) survival, proliferation, and migration. BMPRII is a novel mediator of endothelial nitric-oxide synthase activation. 113

2.3. BMP signaling in lung diseases

Dysregulation of BMP signaling has been implicated in several lung diseases. Although in adult lung tissue, active canonical BMP signaling is hardly detectable. 3 Reactivation

of canonical BMP signaling is observed after lung injury with naphthalene and bleomycin in the same pattern as early lung development in bronchial and alveolar epithelial cells, respectively, presumably as part of repair processes. 3 In addition, BMP ligands expression and BMP/Smad activity are upregulated inflamed bronchial epithelium of allergic asthma. 114,115 It has been demonstrated that activation of BMP signaling induces expression of its own antagonist, implying a negative feedback loop in the regulation of BMP signaling. The expression of the BMP4 antagonist gremlin was found to be upregulated in patients with idiopathic pulmonary fibrosis (IPH). 116 Additionally, the expression of BAMBI is increased in plasma and lung of COPD patients. 117,118 The role of BMP in lung cancer is contradictive. In one hand, BMP2 is increased along with activation of Smad1/5 and its downstream target Id1 and promote tumor growth in human lung cancer. 119 On the other hand, low levels of BMP7 in lung cancer tissues are correlated with lymph node metastasis. In vitro, BMP7 negatively regulates cell adhesion and migration of a lung cancer cell line. 120

14

2.4. BMP signaling in pulmonary vascular diseases

BMP signaling is important in embryonic vascular development and adult vascular homeostasis. Consequently, dysregulation of BMP signaling has been strongly associated with the pathogenesis of hereditary vascular diseases, including familial PAH. 121 BMP signaling regulates vascular smooth muscle maturation, endothelial cell proliferation and angiogenesis. 122 Endothelial cells are a major player in vascular homeostasis. Endothelial dysfunction, including abnormal proliferation, impaired endothelial mesenchymal communication, decreased endothelial nitric-oxide synthase (eNOS) activity, and loss of bioactive nitric oxide (NO), play a prominent role in the development of PAH. 113,123 Accumulating studies from genetic association study in hereditary vascular diseases and genetic studies in transgenic mice pinpoint the mutation of BMP components to be strongly associated with PAH. 124,125 Most importantly, BMP2 and BMP4 failed to stimulate eNOS phosphorylation in PAECs derived from patients carry mutations in the BMPRII gene. 113 This is supported by animal studies of lung endothelial-specific BMPR2 KO mice resulting in spontaneous PAH. 126 Interestingly, impaired BMP signaling was also observed in common forms of PAH, including hypoxic PAH. 127 Mechanistically, the negative regulator of vascular smooth muscle cell proliferation and pro-apoptotic, BMP2 and its downstream non- canonical BMP signaling are upregulated after acute hypoxia exposure. In contrast, prolonged hypoxia exposure results in downregulation of BMPRII expression and inactivation of its downstream signaling in pulmonary vasculature. 127 In addition, the expression of BMPRIb, BMPRII, and Smad4, 5, 6, and 8 was decreased in accordance with reduced levels of active Smad1 and Smad-regulated genes id1 and id3 in lungs of monocrotaline model of PAH. 128 Furthermore, the expression of the BMP antagonist gremlin 1 is increased in small pulmonary vessel walls of hypoxic PAH mouse models. 129 Taken together, these studies demonstrate a central role for BMP and its inhibitors in pulmonary vascular remodeling and the pulmonary vascular resistance in hypoxic PAH. 129

1

3. Follistatin-like 1

During lung development and adult homeostasis processes, the functions of BMPs are tightly controlled for proper morphogenesis. Although the expression of BMPs and their receptors is not strictly limited to certain areas, the expression of BMP antagonists is spatiotemporally tightly controlled, indicating that BMP antagonists fine tune the level of BMP functioning and act as molecular switches of BMP signaling. 1 The endogenous antagonist of BMP, Fstl1 (also known as TGF-β- stimulated clone 36 (TSC-36)), was originally identified as a TGF-β inducible gene in a mouse osteoblastic cell line with two isoforms. 130,131 Fstl1 is a secreted cysteine-rich glycosylated protein of 38 kDa containing an follistatin (FS)-like domain containing 10 conserved cysteine residues and a strong similiarity with BM-40/osteonectin/ SPARC family. 130 Human Fstl1 is highly conserved with >92% amino acid sequence identity with rat and mouse. 132 The Fstl1 orthologues have been identified and sequenced from human, rat, mouse, avian, xenopus, macaques, and fish. 132136 The

15

crystal structure of a truncated form of recombinant Fstl1 containing follistatin-like domain has been resolved. 137 Fstl1 is composed of three distinct domains, including follistatin N-terminal domain-like (FOLN), extracellular calcium (EC)-binding domain containing two EF-hand motifs, and a von Willebrand factor type C domain (VWC) with cell type specific glycosylation. However, unlike other family members, the calcium-binding domains of Fstl1 are non-functional. 131

3.1. Cellular expression of Fstl1

During embryonic development, Fstl1 mRNA is detected in different organs, but the highest expression is found in the lung, predominantly in mesenchymal cells, including vascular and airway smooth muscle cells, 138,139 but also in endothelial cells

and goblet cells of airway epithelium. In adult tissue, Fstl1 has been proposed as

a

cardiokine, 140143 myokine, 144,145 adipokine, 146 and, osteogenic factor 147 due to it

is

ubiquitous expression and functions in the heart, muscle, bone, skeletal muscle

tissue, 144,145,148 neurons, 149 and trophoblasts. 150 The effects of Fstl1 on its downstream targets and the upstream factors known to regulate Fstl1 expression has been reviewed. 151 In response to divers factors, such as TGF-β1, IL-1β, TNF-α and IL-6, the expression of Fstl1 gene was found to be highly expressed in mesenchymal lineages, including fibroblasts, cardiomyocytes, chondrocytes, adipocytes, and

osteocytes. 151153 However, recent studies showed that Fstl1 is also expressed by hematopoietic lineages, such as bone marrow-derived osteoclasts 147 and lung alveolar macrophages. 24 IL-13 triggers lung alveolar macrophages to express a significant increase of Fstl1 mRNA, whereas TGF-β and Fstl1 increase Fstl1 expression in lung epithelial cells. 22,24 Furthermore, Fstl1 triggers inflammatory cells, ranging from monocytes, macrophages, and T-cells to express and release pro-inflammatory cytokines and chemokines, including IL-1β, TNF-α, IL-6, IFN-γ, IL-8, MCP-1, and IP- 10. 151,154,155 Among others, expression of Fstl1 is negatively regulated by microRNAs (miRs), including miR-198, 156 miR-27a, 157 miR-21, 158 and miR-206. 159 Although Fstl1 is primarily known as a BMP antagonist, 21,160,161 current findings suggest that Fstl1 may also regulate various physiological processes by interacting with different receptors, including disco-interacting protein 2 homolog A (DIP2A), 162164 toll-like receptor 4 (TLR4), 165,166 and the sodium-potassium pump. 149

3.2. Fstl1 signaling in lung and pulmonary vascular development

Fstl1 is expressed in the developing lung. 25,138 Embryonic knockout of Fstl1 in mice results in an extensive distortion in lung morphology and neonatal lethality due to respiratory failure, demonstrating the functional importance of Fstl1 in lung development. 160,161 Whole body knockout of Fstl1 exhibits smaller and abnormal lung morphology. Histological analysis demonstrated thickening of alveolar walls and reduction in airspaces and impaired alveolar epithelial differentiation as seen in reduction in mature surfactant protein level. 160,161 In addition to embryonic lung morphogenesis, 25,138,151,160,161 the crucial roles of Fstl1 in organogenesis have also been shown in other organs, including brain, 167 heart, 168 and dorsal/ventral

16

axis patterning. 169 However, the role of Fstl1 in the development of pulmonary vasculature has not been previously explored.

1

3.3. Physiological roles of Fstl1

Several studies reported that Fstl1 has diverse biological functions, including regulating cell proliferation, 170172 differentiation, 171 migration , invasion, 157 wound healing, 156 tissue repair, 143,173,174 cell fate determination, 139 and innate immune responses. 172 The roles of Fstl1 in tissue repair in response to injury have been most widely studied in the cardiovascular system. Fstl1 was found to be increased in models of acute and chronic heart injury, including myocardial infarction, pressure overload-induced hyperthrophy, and ischemia/reperfusion injury. 140,173,175,176 Systemic administration of Fstl1 or overexpression of Fstl1 showed to be protective in the cardiovascular system by reducing cell apoptosis and inflammatory responses, and promoting endothelial cell survival and trigger a revascularization process and restore tissue function. 140,148,176,177 Recent studies demonstrated that Fstl1 expression is also induced in response to lung injury. 21,23,158 Further investigation is needed to unravel the impact of upregulation of Fstl1 in the lung. Collectively, these data suggest that the injury-induced upregulation of Fstl1 play a clinically relevant role in the modulation of pathological processes. Furthermore, previous studies demonstrate paracrine signaling of Fstl1 in cell and tissue communication. 141,142,144,148,172 However, the roles of secreted Fstl1 in cell-cell communication in the lung have not been previously studied.

3.4. The pathological roles of Fstl1 in inflammatory diseases

The function of Fstl1 has been most extensively studied in inflammatory diseases and a dual role of Fstl1 in inflammatory responses has been reported. It is clear that Fstl1 modulates inflammatory cytokine expression and release. However, the precise effect of Fstl1 in inflammatory responses, whether as a pro-inflammatory or an anti-inflammatory mediator remain controversial. A great body of evidence identifies Fstl1 as a pro-inflammatory cytokine that is induced by inflammatory cytokines, in turn Fstl1 triggers inflammatory responses from target cells, particularly inflammatory cells. 178 Several studies have shown that Fstl1 is markedly upregulated in inflammatory conditions. 179181 Furthermore, silencing of Fst1 decreases the production of TNF-α, IL-6, and IL-8 from human arterial endothelial cells induced by oxidized low-density lipoprotein. 166 Additionally, high Fstl1 is observed in response to bacterial infection 182 and low degree of inflammation in obese individuals. 183 An anti-inflammatory role for Fstl1 is supported by other studies. Mice treated with recombinant human Fstl1 show a decreased expression of IL-6, MMP3, and MMP9 in animal models of arthritis. 184,185 Immuno suppressant roles of Fstl1 have been also demonstrated in organ transplantation, and tissue injury. 166,186,187 These discrepancies may be explained by the differences in the experimental conditions and different organs. However, the inflammatory roles of Fstl1 in COPD have not been previously explored. Furthermore, Fstl1 has been proposed as a biomarker in several diseases, including systemic-onset juvenile rheumatoid arthritis, 153 osteoarthritis, 188

17

systemic juvenile idiopathic arthritis, 181 chronic systolic heart failure, 189 acute coronary syndrome, 190 inflammatory responses and oxidative stress. 191

3.5. The pathological roles of Fstl1 in airway remodeling in the lung

Recent studies showed upregulation of Fstl1 expression in the lungs patients with severe asthma and idiopathic pulmonary fibrosis. 22,23 Further in vivo studies demonstrated that Fstl1 haploinsufficient mice and specific inactivation of Fstl1 in myeloid cell lineages attenuate airway remodeling in animal models of asthma and lung fibrosis, respectively. 21,22 Studies from the same group demonstrated that recombinant Fstl1 induces lung macrophages to express pro-remodeling factor MMP9 mRNA and protein through TLR4 receptor activation. 24 Conversely, the other study showed that Fstl1 attenuates MMP9 expression in animal model of arthritis. 185

3.6. The pathological roles of Fstl1 in airway remodeling in cancer

Fstl1 has been implicated in several cancer, including lung cancer, 192194 pancreatic cancer, 195 bone metastasis, 196,197 ovarian cancer and endometrial carcinogenesis, 198,199 nasopharyngeal carcinoma, 172 glioblastoma, 200 and prostate cancer. 201 However, the role of Fstl1 in cancer is complex and controversial. On one hand, Fstl1 has been reported as a pro-cancer metastasis. On the other hand, Fstl1 shows an anti-cancer effect. High expression of Fstl1 is associated with poor prognosis of glioblastoma 200 and favors the progression of metastatic prostate cancer. 201 Therefore, Fstl1 has been proposed as therapeutic target for prostate cancer. 202 Targeting Fstl1 prevents bone metastasis by regulating the immune function, suggesting that Fstl1 can mediate cancer cell invasion. 197,203 Fstl1 is significantly downregulated in metastatic kidney cancer. Fstl1 mRNA is significantly lower in cancerous tissue compared to adjacent normal tissue. 204 A recent study demonstrated an association between Fstl1 polymorphisms and renal cell carcinoma (RCC) risk and prognosis, suggesting that the variant genotype CC of rs1259293 is associated with RCC development by suppressing Fstl1 expression. 205 Fstl1 has been suggested as putative tumor suppressor gene as decreased Fstl1 has been reported, 206 including in kidney cancer, 204 lung cancer, 192,194 ovarian and endometrial cancer, 198,199 nasopharyngeal carcinoma, 172 and bone metastasis of prostate cancer. 196 Hypermethylation of the Fstl1 promoter is observed in cancer, leading to cell proliferation and invasion. 172 Re-expression of Fstl1 and Fstl1 treatment negatively regulates lung cancer cell invasion and metastasis 193,207 and result in growth inhibition of human lung cancer cell lines. Fstl1 transcripts are not detectable in highly aggressive and proliferative lung cancer cells and overexpression of Fstl1 shows an anti-proliferative effect. 192 Tumor suppressant effects of Fstl1 in ovarian and endometrial carcinogenesis has also been suggested. 198 Knockdown of Fstl1 induces apoptosis through a mitotic arrest and caspase-dependent cell death, suggesting that Fstl1 plays important roles in cellular proliferation and apoptosis in lung cancer cells. 194

18

Scope of the thesis

The notion that developmental signaling pathways are reactivated during chronic lung disease attracted scientists to dissect the roles of these pathways related with the pathophysiology of COPD. However, little is known about the involvement of BMP signaling in COPD. BMP/Fstl1 signaling is a key player in embryonic lung morphogenesis, 85,86 with diverse physiological roles including cellular communication. 139,142,172 Recent studies demonstrate that aberrant Fstl1 expression is associated with several pathological lung conditions 2124,158 and inflammatory disorders, 154,155,180 underscoring its great importance in adult tissue homeostasis and repair. However, the involvement of Fstl1 in COPD remains unexplored. This thesis will delineate the role of the endogenous BMP antagonist Fstl1 in lung development and shed light on its potential contribution to the pathogenesis of COPD. The specific aims of this thesis are to investigate the role of Fstl1 in pulmonary vasculature development and COPD, particularly in airway epithelial-mesenchymal cell communication and adult tracheal epithelial cell differentiation. To this aim, the developmental roles of Fstl1 were studied in conditional endothelial-specific Fstl1 knockout mice and in vitro study using pulmonary cell lines, including bronchial epithelial cells, lung fibroblasts, and airway smooth muscle cells. In Chapter 2, the role of endothelial Fstl1 in the postnatal development of the pulmonary vasculature was investigated. The changes in molecular signaling, lung physiology, and morphology of pulmonary vessels were dissected in endothelial- specific Fstl1 knockout mice compared to littermate controls. Our investigation of Fstl1 expression and BMP/Smad activation in lung tissue of COPD patients is presented in Chapter 3, providing evidences of dysregulation of Fstl1 expression in different parts of COPD lung tissue. Chapter 4 provides a perspective on the expression levels and contribution of the TGF-β superfamily members, activin-A and its endogenous follistatin antagonist in smoking-induced airway inflammation in COPD both in vitro and in vivo. The role of Fstl1 in inflammatory cytokine release from lung mesenchymal cells was explored in Chapter 5, which provides evidences on pro-inflammatory roles of Fstl1 1 in coordinating epithelial-mesenchymal communication in inflammatory cytokine release in the lung. We identified epithelial-derived factors in culture supernatants of Fstl1 overexpressing bronchial epithelial cells which mediate Fstl1- conditioned media-induced IL-6 and IL-8 release from lung fibroblasts. Chapter 6 describes the latest understanding of the contribution of pulmonary mesenchymal cells in modulating airway inflammation in various lung diseases. Furthermore, the effect of BMP4 in differentiation of primary adult tracheobronchial epithelialcells using air-liquid interface culture was studied in Chapter 7. The potential implications of aberrant BMP signaling related with airway epithelial remodeling in COPD lungs was discussed.

19

1

References

1.

Yanagita M. BMP antagonists: their roles in development and involvement in pathophysiology. Cytokine Growth Factor Rev. 2005;16(3):309-317. doi:10.1016/j.cytogfr.2005.02.007.

2.

Rock J, Königshoff M. Endogenous lung regeneration: potential and limitations. Am J Respir Crit

Care Med. 2012;186(12):1213-1219. doi:10.1164/rccm.201207-1151PP.

3.

Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One. 2012;7(8):e41460. doi:10.1371/journal.pone.0041460.

4.

Vestbo J, Hurd SS, Agustí AG, et al. Global Strategy for the Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2013;187(4):347-365.

doi:10.1164/rccm.201204-0596PP.

5.

Lopez AD, Murray CCJL. The global burden of disease, 1990–2020. Nat Med. 1998;4(11):1241- 1243. doi:10.1038/3218.

6.

Corhay J-L, Frusch N, Louis R. [COPD: genetics and environmental interactions]. Rev Médicale Liège. 2012;67(5-6):292-297.

7.

Rovina N, Koutsoukou A, Koulouris NG. Inflammation and Immune Response in COPD: Where Do We Stand? Mediators Inflamm. 2013;2013:e413735. doi:10.1155/2013/413735.

8.

Pillai SG, Kong X, Edwards LD, et al. Loci identified by genome-wide association studies influence different disease-related phenotypes in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2010;182(12):1498-1505. doi:10.1164/rccm.201002-0151OC.

9.

van der Plaat DA, de Jong K, Lahousse L, et al. Genome-wide association study on the FEV1/FVC- ratio in never-smokers identifies HHIP and FAM13A. J Allergy Clin Immunol. September 2016.

doi:10.1016/j.jaci.2016.06.062.

10.

Morrow JD, Cho MH, Hersh CP, et al. DNA methylation profiling in human lung tissue identifies genes associated with COPD. Epigenetics. August 2016:0. doi:10.1080/15592294.2016.122645.

11.

Hobbs BD, Parker MM, Chen H, et al. Exome Array Analysis Identifies a Common Variant in IL27 Associated with Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2016;194(1):48-57. doi:10.1164/rccm.201510-2053OC.

12.

Bruse S, Moreau M, Bromberg Y, et al. Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility. Hum Genomics. 2016;10:1.

doi:10.1186/s40246-015-0058-7.

13.

Cho MH, Boutaoui N, Klanderman BJ, et al. Variants in FAM13A are associated with chronic obstructive pulmonary disease. Nat Genet. 2010;42(3):200-202. doi:10.1038/ng.535.

14.

Pillai SG, Ge D, Zhu G, et al. A genome-wide association study in chronic obstructive pulmonary disease (COPD): identification of two major susceptibility loci. PLoS Genet. 2009;5(3):e1000421.

15.

Barnes PJ. Chronic Obstructive Pulmonary Disease. N Engl J Med. 2000;343(4):269-

280.

doi:10.1056/NEJM200007273430407.

16.

Shaykhiev R, Crystal RG. Early events in the pathogenesis of chronic obstructive pulmonary disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells. Ann Am Thorac Soc. 2014;11 Suppl 5:S252-258. doi:10.1513/AnnalsATS.201402-049AW.

17.

Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol.

2008;8(3):183-192. doi:10.1038/nri2254.

18.

Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-

563.

doi:10.1513/pats.200905-031RM.

19.

Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med. 2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.

20.

De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38.

doi:10.1186/s12931-015-0202-x.

21.

Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.

22.

Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.

20

23. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein

Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-

615. doi:10.1016/j.ajpath.2015.10.032.

24. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.

doi:10.1016/j.jaci.2016.01.019.

1

25. Li X, Fang Y, Li X, et al. Apical Secretion of FSTL1 in the Respiratory Epithelium for Normal Lung Development. PloS One. 2016;11(6):e0158385. doi:10.1371/journal.pone.0158385.

26. Di Stefano A, Capelli A, Lusuardi M, et al. Severity of airflow limitation is associated with severity of airway inflammation in smokers. Am J Respir Crit Care Med. 1998;158(4):1277-1285.

doi:10.1164/ajrccm.158.4.9802078.

27. Saetta M, Di Stefano A, Turato G, et al. CD8+ T-lymphocytes in peripheral airways of smokers with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 1998;157(3 Pt 1):822-

826. doi:10.1164/ajrccm.157.3.9709027.

28. Saetta M, Baraldo S, Corbino L, et al. CD8+ve cells in the lungs of smokers with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 1999;160(2):711-717. doi:10.1164/

ajrccm.160.2.9812020.

29. Thorley AJ, Tetley TD. Pulmonary epithelium, cigarette smoke, and chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):409-428.

30. Alkhouri H, Poppinga WJ, Tania NP, Ammit A, Schuliga M. Regulation of pulmonary inflammation by mesenchymal cells. Pulm Pharmacol Ther. 2014;29(2):156-165. doi:10.1016/j.

pupt.2014.03.001.

31. Gosens R, Rieks D, Meurs H, et al. Muscarinic M3 receptor stimulation increases cigarette smoke- induced IL-8 secretion by human airway smooth muscle cells. Eur Respir J. 2009;34(6):1436- 1443. doi:10.1183/09031936.00045209.

32. Beg AA. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol. 2002;23(11):509-512. doi:10.1016/S1471-4906(02)02317.

33. Mio T, Romberger DJ, Thompson AB, Robbins RA, Heires A, Rennard SI. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells. Am J Respir Crit Care Med. 1997;155(5):1770-1776. doi:10.1164/ajrccm.155.5.9154890.

34. Mortaz E, Henricks P a. J, Kraneveld AD, Givi ME, Garssen J, Folkerts G. Cigarette smoke induces the release of CXCL-8 from human bronchial epithelial cells via TLRs and induction of the inflammasome. Biochim Biophys Acta. 2011;1812(9):1104-1110. doi:10.1016/j.

bbadis.2011.06.002.

35. Hellermann GR, Nagy SB, Kong X, Lockey RF, Mohapatra SS. Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells. Respir Res. 2002;3:22.

36. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.

37. Keatings VM, Barnes PJ. Granulocyte activation markers in induced sputum: comparison between chronic obstructive pulmonary disease, asthma, and normal subjects. Am J Respir Crit Care Med. 1997;155(2):449-453. doi:10.1164/ajrccm.155.2.9032177.

38. Pesci A, Balbi B, Majori M, et al. Inflammatory cells and mediators in bronchial lavage of patients with chronic obstructive pulmonary disease. Eur Respir J. 1998;12(2):380-386.

39. Traves S, Culpitt S, Russell R, Barnes P, Donnelly L. Increased levels of the chemokines GROα and MCP-1 in sputum samples from patients with COPD. Thorax. 2002;57(7):590-595. doi:10.1136/

thorax.57.7.590.

40. Keatings VM, Collins PD, Scott DM, Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med. 1996;153(2):530-534. doi:10.1164/ajrccm.153.2.8564092.

41. Nocker RE, Schoonbrood DF, van de Graaf EA, et al. Interleukin-8 in airway inflammation in patients with asthma and chronic obstructive pulmonary disease. Int Arch Allergy Immunol.

1996;109(2):183-191.

42. Beeh KM, Beier J. Handle with care: targeting neutrophils in chronic obstructive pulmonary disease and severe asthma? Clin Exp Allergy J Br Soc Allergy Clin Immunol. 2006;36(2):142-157.

21

doi:10.1111/j.1365-2222.2006.02418.x.

43. Roghanian A, Sallenave J-M. Neutrophil elastase (NE) and NE inhibitors: canonical and noncanonical functions in lung chronic inflammatory diseases (cystic fibrosis and chronic

obstructive pulmonary disease). J Aerosol Med Pulm Drug Deliv. 2008;21(1):125-144.

doi:10.1089/jamp.2007.0653.

44. Gomez-Cambronero J, Horn J, Paul CC, Baumann MA. Granulocyte-macrophage colony- stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the ribosomal p70 S6 kinase signaling pathway. J Immunol Baltim Md 1950. 2003;171(12):6846-

6855.

45. Hamilton JA. GM-CSF in inflammation and autoimmunity. Trends Immunol. 2002;23(8):403-408.

doi:10.1016/S1471-4906(02)02260-3.

46. Di Stefano A, Caramori G, Oates T, et al. Increased expression of nuclear factor-kappaB in bronchial biopsies from smokers and patients with COPD. Eur Respir J. 2002;20(3):556-563.

47. Di Stefano A, Maestrelli P, Roggeri A, et al. Upregulation of adhesion molecules in the bronchial mucosa of subjects with chronic obstructive bronchitis. Am J Respir Crit Care Med. 1994;149(3 Pt 1):803-810. doi:10.1164/ajrccm.149.3.7509705.

48. Saetta M, Mariani M, Panina-Bordignon P, et al. Increased expression of the chemokine receptor CXCR3 and its ligand CXCL10 in peripheral airways of smokers with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2002;165(10):1404-1409.

49. Puchelle E, Zahm J-M, Tournier J-M, Coraux C. Airway epithelial repair, regeneration, and remodeling after injury in chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2006;3(8):726-733. doi:10.1513/pats.200605-126SF.

50. Yoshida T, Tuder RM. Pathobiology of cigarette smoke-induced chronic obstructive pulmonary disease. Physiol Rev. 2007;87(3):1047-1082. doi:10.1152/physrev.00048.2006.

51. Wanner A, Salathé M, O’Riordan TG. Mucociliary clearance in the airways. Am J Respir Crit Care Med. 1996;154(6 Pt 1):1868-1902. doi:10.1164/ajrccm.154.6.8970383.

52. Lozewicz S, Wells C, Gomez E, et al. Morphological integrity of the bronchial epithelium in mild asthma. Thorax. 1990;45(1):12-15.

53. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.

54. Brune K, Frank J, Schwingshackl A, Finigan J, Sidhaye VK. Pulmonary epithelial barrier function:

some new players and mechanisms. Am J Physiol - Lung Cell Mol Physiol. 2015;308(8):L731-L745.

doi:10.1152/ajplung.00309.2014.

55. Cosio MG, Hale KA, Niewoehner DE. Morphologic and morphometric effects of prolonged cigarette smoking on the small airways. Am Rev Respir Dis. 1980;122(2):265-221. doi:10.1164/

arrd.1980.122.2.265.

56. Coraux C, Hajj R, Lesimple P, Puchelle E. In vivo models of human airway epithelium repair and regeneration. Eur Respir Rev. 2005;14(97):131-136. doi:10.1183/09059180.05.00009702.

57. Yahaya B. Understanding Cellular Mechanisms Underlying Airway Epithelial Repair: Selecting the Most Appropriate Animal Models. Sci World J. 2012;2012:e961684. doi:10.1100/2012/961684.

58. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio- Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961.

59. Gamez AS, Gras D, Petit A, et al. Supplementing Defect in Club Cell Secretory Protein Attenuates Airway Inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174.

60. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.

doi:10.1164/rccm.201305-0892OC.

61. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.

62. Whitcutt MJ, Adler KB, Wu R. A biphasic chamber system for maintaining polarity of differentiation of cultured respiratory tract epithelial cells. Vitro Cell Dev Biol J Tissue Cult Assoc.

1988;24(5):420-428.

63. Kaartinen L, Nettesheim P, Adler KB, Randell SH. Rat tracheal epithelial cell differentiation in

22

vitro. In Vitro Cell Dev Biol Anim. 1993;29A(6):481-492.

64. Hogg JC, Macklem PT, Thurlbeck WM. Site and nature of airway obstruction in chronic obstructive lung disease. N Engl J Med. 1968;278(25):1355-1360. doi:10.1056/NEJM196806202782501.

65. Hogg JC, Chu F, Utokaparch S, et al. The Nature of Small-Airway Obstruction in Chronic Obstructive Pulmonary Disease. N Engl J Med. 2004;350(26):2645-2653. doi:10.1056/NEJMoa032158.

66. Hogg JC, Timens W. The Pathology of Chronic Obstructive Pulmonary Disease. Annu Rev Pathol Mech Dis. 2009;4(1):435-459. doi:10.1146/annurev.pathol.4.110807.092145.

67. Eurlings IMJ, Dentener MA, Cleutjens JPM, et al. Similar matrix alterations in alveolar and small airway walls of COPD patients. BMC Pulm Med. 2014;14:90. doi:10.1186/1471-2466-14-90.

68. Kranenburg AR, Willems-Widyastuti A, Moori WJ, et al. Enhanced bronchial expression of extracellular matrix proteins in chronic obstructive pulmonary disease. Am J Clin Pathol.

2006;126(5):725-735.

1

69. Annoni R, Lanças T, Yukimatsu Tanigawa R, et al. Extracellular matrix composition in COPD. Eur Respir J. 2012;40(6):1362-1373. doi:10.1183/09031936.00192611.

70. Dentener MA, Vernooy JHJ, Hendriks S, Wouters EFM. Enhanced levels of hyaluronan in lungs of patients with COPD: relationship with lung function and local inflammation. Thorax. 2005;60(2):114-119. doi:10.1136/thx.2003.020842.

71. Barnes PJ, Shapiro SD, Pauwels RA. Chronic obstructive pulmonary disease: molecular and cellular mechanisms. Eur Respir J. 2003;22(4):672-688.

72. Pera T, Gosens R, Lesterhuis AH, et al. Cigarette smoke and lipopolysaccharide induce a proliferative airway smooth muscle phenotype. Respir Res. 2010;11(1):48. doi:10.1186/1465-

9921-11-48.

73. Evanko SP, Potter-Perigo S, Bollyky PL, Nepom GT, Wight TN. Hyaluronan and versican in the control of human T-lymphocyte adhesion and migration. Matrix Biol J Int Soc Matrix Biol. 2012;31(2):90-100. doi:10.1016/j.matbio.2011.10.004.

74. Togo S, Holz O, Liu X, et al. Lung Fibroblast Repair Functions in Patients with Chronic Obstructive Pulmonary Disease Are Altered by Multiple Mechanisms. Am J Respir Crit Care Med. 2008;178(3):248-260. doi:10.1164/rccm.200706-929OC.

75. van den Berge M, ten Hacken NHT, Cohen J, Douma WR, Postma DS. Small airway disease in asthma and copd: Clinical implications. Chest. 2011;139(2):412-423. doi:10.1378/chest.10-1210.

76. Hashimoto M, Tanaka H, Abe S. Quantitative analysis of bronchial wall vascularity in the medium and small airways of patients with asthma and COPD. Chest. 2005;127(3):965-972. doi:10.1378/

chest.127.3.965.

77. Siafakas NM, Antoniou KM, Tzortzaki EG. Role of angiogenesis and vascular remodeling in chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):453-462.

78. Green CE, Turner AM. The role of the endothelium in asthma and chronic obstructive pulmonary disease (COPD). Respir Res. 2017;18:20. doi:10.1186/s12931-017-0505-1.

79. Santos S, Peinado VI, Ramírez J, et al. Characterization of pulmonary vascular remodelling in smokers and patients with mild COPD. Eur Respir J. 2002;19(4):632-638.

80. Ferrer E, Peinado VI, Díez M, et al. Effects of cigarette smoke on endothelial function of pulmonary arteries in the guinea pig. Respir Res. 2009;10(1):76. doi:10.1186/1465-9921-10-76.

81. Santos S, Peinado VI, Ramirez J, et al. Enhanced expression of vascular endothelial growth factor in pulmonary arteries of smokers and patients with moderate chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2003;167(9):1250-1256. doi:10.1164/rccm.200210-1233OC.

82. Nilsson I, Shibuya M, Wennström S. Differential activation of vascular genes by hypoxia in primary endothelial cells. Exp Cell Res. 2004;299(2):476-485. doi:10.1016/j.yexcr.2004.06.005.

83. Kranenburg AR, de Boer WI, Alagappan VKT, Sterk PJ, Sharma HS. Enhanced bronchial expression of vascular endothelial growth factor and receptors (Flk-1 and Flt-1) in patients with chronic obstructive pulmonary disease. Thorax. 2005;60(2):106-113. doi:10.1136/thx.2004.023986.

84. Calabrese C, Bocchino V, Vatrella A, et al. Evidence of angiogenesis in bronchial biopsies of smokers with and without airway obstruction. Respir Med. 2006;100(8):1415-1422.

doi:10.1016/j.rmed.2005.11.009.

85. Peinado VI, Ramírez J, Roca J, Rodriguez-Roisin R, Barberà JA. Identification of vascular progenitor cells in pulmonary arteries of patients with chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol. 2006;34(3):257-263. doi:10.1165/rcmb.2005-0255OC.

23

86. Kasahara Y, Tuder RM, Taraseviciene-Stewart L, et al. Inhibition of VEGF receptors causes lung cell apoptosis and emphysema. J Clin Invest. 2000;106(11):1311-1319. doi:10.1172/JCI10259.

87. Voelkel NF, Gomez-Arroyo J, Mizuno S. COPD/emphysema: The vascular story. Pulm Circ. 2011;1(3):320-326. doi:10.4103/2045-8932.87295.

88. White DG, Cannon TR, Garratt H, Mundin JW, Sumner MJ, Watts IS. Endothelin ETA and ETB receptors mediate vascular smooth-muscle contraction. J Cardiovasc Pharmacol. 1993;22 Suppl

8:S144-148.

89. Böhm F, Pernow J. The importance of endothelin-1 for vascular dysfunction in cardiovascular disease. Cardiovasc Res. 2007;76(1):8-18. doi:10.1016/j.cardiores.2007.06.004.

90. Celli BR, MacNee W, ATS/ERS Task Force. Standards for the diagnosis and treatment of patients with COPD: a summary of the ATS/ERS position paper. Eur Respir J. 2004;23(6):932-946.

91. Wozney JM, Rosen V, Celeste AJ, et al. Novel regulators of bone formation: molecular clones and activities. Science. 1988;242(4885):1528-1534.

92. Urist MR. A morphogenetic matrix for differentiation of bone tissue. Calcif Tissue Res.

1970:Suppl:98-101.

93. Wagner DS, Mullins MC. Modulation of BMP Activity in Dorsal-Ventral Pattern Formation by the Chordin and Ogon Antagonists. Dev Biol. 2002;245(1):109-123. doi:10.1006/dbio.2002.0614.

94. Zuniga E, Rippen M, Alexander C, Schilling TF, Crump JG. Gremlin 2 regulates distinct roles of BMP and Endothelin 1 signaling in dorsoventral patterning of the facial skeleton. Development. 2011;138(23):5147-5156. doi:10.1242/dev.067785.

95. Hsu DR, Economides AN, Wang X, Eimon PM, Harland RM. The Xenopus dorsalizing factor

Gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell.

1998;1(5):673-683.

96. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-

4015.

97. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.

98. Sieber C, Kopf J, Hiepen C, Knaus P. Recent advances in BMP receptor signaling. Cytokine Growth Factor Rev. 2009;20(5-6):343-355. doi:10.1016/j.cytogfr.2009.10.007.

99. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in mammalian reproduction. Endocr Rev. 2004;25(1):72-101. doi:10.1210/er.2003-0007.

100. Miyazono K, Maeda S, Imamura T. BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk. Cytokine Growth Factor Rev. 2005;16(3):251-263. doi:10.1016/j.

cytogfr.2005.01.009.

101. Massagué J, Chen YG. Controlling TGF-beta signaling. Genes Dev. 2000;14(6):627-644.

102. Morikawa M, Koinuma D, Tsutsumi S, et al. ChIP-seq reveals cell type-specific binding patterns of BMP-specific Smads and a novel binding motif. Nucleic Acids Res. 2011;39(20):8712-8727.

doi:10.1093/nar/gkr572.

103. Shi Y, Massagué J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell .

2003;113(6):685-700.

104. Wrana JL. Regulation of Smad activity. Cell. 2000;100(2):189-192.

105. Xu L. Regulation of Smad Activities. Biochim Biophys Acta. 2006;1759(11-12):503-513.

doi:10.1016/j.bbaexp.2006.11.001.

106. Yamaguchi K, Nagai S, Ninomiya-Tsuji J, et al. XIAP, a cellular member of the inhibitor of apoptosis protein family, links the receptors to TAB1-TAK1 in the BMP signaling pathway. EMBO J. 1999;18(1):179-187. doi:10.1093/emboj/18.1.179.

107. Lai C-F, Cheng S-L. Signal transductions induced by bone morphogenetic protein-2 and transforming growth factor-beta in normal human osteoblastic cells. J Biol Chem. 2002;277(18):15514-15522. doi:10.1074/jbc.M200794200.

108. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 2003;425(6958):577-584. doi:10.1038/nature02006.

109. Shim J-H, Greenblatt MB, Xie M, et al. TAK1 is an essential regulator of BMP signalling in cartilage. EMBO J. 2009;28(14):2028-2041. doi:10.1038/emboj.2009.162.

24

110. Gazzerro E, Canalis E. Bone morphogenetic proteins and their antagonists. Rev Endocr Metab Disord. 2006;7(1-2):51-65. doi:10.1007/s11154-006-9000-6.

111. Xu B, Chen C, Chen H, et al. Smad1 and its target gene Wif1 coordinate BMP and Wnt signaling activities to regulate fetal lung development. Dev Camb Engl. 2011;138(5):925-935. doi:10.1242/

dev.062687.

1

112. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.

doi:10.1002/bdrc.21085.

113. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134- 33140. doi:10.1074/jbc.M111.274100.

114. Rosendahl A, Pardali E, Speletas M, Ten Dijke P, Heldin C-H, Sideras P. Activation of bone morphogenetic protein/Smad signaling in bronchial epithelial cells during airway inflammation. Am J Respir Cell Mol Biol. 2002;27(2):160-169. doi:10.1165/ajrcmb.27.2.4779.

115. Kariyawasam HH, Xanthou G, Barkans J, Aizen M, Kay AB, Robinson DS. Basal expression of bone morphogenetic protein receptor is reduced in mild asthma. Am J Respir Crit Care Med. 2008;177(10):1074-1081. doi:10.1164/rccm.200709-1376OC.

116. Koli K, Myllärniemi M, Vuorinen K, et al. Bone morphogenetic protein-4 inhibitor gremlin is overexpressed in idiopathic pulmonary fibrosis. Am J Pathol. 2006;169(1):61-71. doi:10.2353/

ajpath.2006.051263.

117. Zhang J-C, Chen G, Chen L, et al. TGF-β/BAMBI pathway dysfunction contributes to peripheral Th17/Treg imbalance in chronic obstructive pulmonary disease. Sci Rep. 2016;6:31911.

doi:10.1038/srep31911.

118. Drömann D, Rupp J, Rohmann K, et al. The TGF-beta-Pseudoreceptor BAMBI is strongly expressed in COPD lungs and regulated by nontypeable Haemophilus influenzae. Respir Res. 2010;11:67.

doi:10.1186/1465-9921-11-67.

119. Langenfeld EM, Kong Y, Langenfeld J. Bone morphogenetic protein 2 stimulation of tumor growth involves the activation of Smad-1/5. Oncogene. 2006;25(5):685-692. doi:10.1038/

sj.onc.1209110.

120. Chen J, Ye L, Xie F, Yang Y, Zhang L, Jiang WG. Expression of bone morphogenetic protein 7 in lung cancer and its biological impact on lung cancer cells. Anticancer Res. 2010;30(4):1113-1120.

121. Atkinson C, Stewart S, Upton PD, et al. Primary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor. Circulation. 2002;105(14):1672-1678. doi:10.1161/01.CIR.0000012754.72951.3D.

122. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.

123. Frank DB, Lowery J, Anderson L, Brink M, Reese J, Caestecker M de. Increased susceptibility to hypoxic pulmonary hypertension in Bmpr2 mutant mice is associated with endothelial dysfunction in the pulmonary vasculature. Am J Physiol - Lung Cell Mol Physiol. 2008;294(1):L98-L109.

doi:10.1152/ajplung.00034.2007.

124. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet. 2000;26(1):81-84. doi:10.1038/79226.

125. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.

126. Hong K-H, Lee YJ, Lee E, et al. Genetic ablation of the BMPR2 gene in pulmonary endothelium is sufficient to predispose to pulmonary arterial hypertension. Circulation. 2008;118(7):722-730.

doi:10.1161/CIRCULATIONAHA.107.736801.

127. Takahashi H, Goto N, Kojima Y, et al. Downregulation of type II bone morphogenetic protein receptor in hypoxic pulmonary hypertension. Am J Physiol - Lung Cell Mol Physiol. 2006;290(3):L450-L458. doi:10.1152/ajplung.00206.2005.

128. Morty RE, Nejman B, Kwapiszewska G, et al. Dysregulated bone morphogenetic protein signaling in monocrotaline-induced pulmonary arterial hypertension. Arterioscler Thromb Vasc Biol. 2007;27(5):1072-1078. doi:10.1161/ATVBAHA.107.141200.

129. Cahill E, Costello CM, Rowan SC, et al. Gremlin plays a key role in the pathogenesis of pulmonary

25

hypertension. Circulation. 2012;125(7):920-930. doi:10.1161/CIRCULATIONAHA.111.038125.

130. Shibanuma M, Mashimo J, Mita A, Kuroki T, Nose K. Cloning from a mouse osteoblastic cell line of a set of transforming-growth-factor-beta 1-regulated genes, one of which seems to encode a follistatin-related polypeptide. Eur J Biochem FEBS. 1993;217(1):13-19.

131. Hambrock HO, Kaufmann B, Müller S, et al. Structural characterization of TSC-36/Flik: analysis of two charge isoforms. J Biol Chem. 2004;279(12):11727-11735. doi:10.1074/jbc.M309318200.

132. Zwijsen A, Blockx H, Van Arnhem W, et al. Characterization of a rat C6 glioma-secreted follistatin- related protein (FRP). Cloning and sequence of the human homologue. Eur J Biochem FEBS.

1994;225(3):937-946.

133. Patel K, Connolly DJ, Amthor H, Nose K, Cooke J. Cloning and early dorsal axial expression of Flik, a chick follistatin-related gene: evidence for involvement in dorsalization/neural induction. Dev Biol. 1996;178(2):327-342. doi:10.1006/dbio.1996.0222.

134. Okabayashi K, Shoji H, Onuma Y, et al. cDNA cloning and distribution of the Xenopus follistatin- related protein. Biochem Biophys Res Commun. 1999;254(1):42-48. doi:10.1006/bbrc.1998.9892.

135. Tochitani S, Liang F, Watakabe A, Hashikawa T, Yamamori T. The occ1 gene is preferentially expressed in the primary visual cortex in an activity-dependent manner: a pattern of gene expression related to the cytoarchitectonic area in adult macaque neocortex. Eur J Neurosci.

2001;13(2):297-307.

136. Sun Y-W, Li F-G, Chen J, Jiang X-Y, Zou S-M. Two follistatin-like 1 homologs are differentially expressed in adult tissues and during embryogenesis in grass carp (Ctenopharyngodon idellus). Gen Comp Endocrinol. 2015;223:1-8. doi:10.1016/j.ygcen.2015.09.017.

137. Li L, Li X, Liu X, et al. Expression, characterization, and preliminary X-ray crystallographic analysis of recombinant murine Follistatin-like 1 expressed in Drosophila S2 cells. Biosci Trends.

2013;7(2):93-100.

138. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):

Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns. 2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.

139. Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. Follistatin-like-1, a diffusible mesenchymal factor determines the fate of epithelium. Proc Natl Acad Sci U S A. 2010;107(10):4601-4606.

doi:10.1073/pnas.0909501107.

140. Oshima Y, Ouchi N, Sato K, Izumiya Y, Pimentel DR, Walsh K. Follistatin-like 1 is an Akt-regulated cardioprotective factor that is secreted by the heart. Circulation. 2008;117(24):3099-3108.

doi:10.1161/CIRCULATIONAHA.108.767673.

141. Shimano M, Ouchi N, Nakamura K, et al. Cardiac myocyte follistatin-like 1 functions to attenuate hypertrophy following pressure overload. Proc Natl Acad Sci U S A. 2011;108(43):E899-906.

doi:10.1073/pnas.1108559108.

142. Hayakawa S, Ohashi K, Shibata R, et al. Cardiac Myocyte-Derived Follistatin-Like 1 Prevents Renal Injury in a Subtotal Nephrectomy Model. J Am Soc Nephrol JASN. 2015;26(3):636-646.

doi:10.1681/ASN.2014020210.

143. Wei K, Serpooshan V, Hurtado C, et al. Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature. 2015;525(7570):479-485. doi:10.1038/nature15372.

144. Miyabe M, Ohashi K, Shibata R, et al. Muscle-derived follistatin-like 1 functions to reduce neointimal formation after vascular injury. Cardiovasc Res. 2014;103(1):111-120. doi:10.1093/

cvr/cvu105.

145. Görgens SW, Raschke S, Holven KB, Jensen J, Eckardt K, Eckel J. Regulation of follistatin-like protein 1 expression and secretion in primary human skeletal muscle cells. Arch Physiol Biochem. 2013;119(2):75-80. doi:10.3109/13813455.2013.768270.

146. Wu Y, Zhou S, Smas CM. Downregulated expression of the secreted glycoprotein follistatin-like 1 (Fstl1) is a robust hallmark of preadipocyte to adipocyte conversion. Mech Dev. 2010;127(3- 4):183-202. doi:10.1016/j.mod.2009.12.003.

147. Kim H-J, Kang WY, Seong SJ, Kim S-Y, Lim M-S, Yoon Y-R. Follistatin-like 1 promotes osteoclast formation via RANKL-mediated NF-κB activation and M-CSF-induced precursor proliferation. Cell Signal. 2016;28(9):1137-1144. doi:10.1016/j.cellsig.2016.05.018.

148. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-

26

dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.

149. Li K-C, Zhang F-X, Li C-L, et al. Follistatin-like 1 suppresses sensory afferent transmission by activating Na+,K+-ATPase. Neuron. 2011;69(5):974-987. doi:10.1016/j.neuron.2011.01.022.

150. Mouillet J-F, Mishima T, Paffaro AM do A, et al. The expression and post-transcriptional regulation of FSTL1 transcripts in placental trophoblasts. Placenta. 2015;36(11):1231-1238. doi:10.1016/j.

placenta.2015.09.005.

1

151. Sylva M, Moorman AFM, van den Hoff MJB. Follistatin-like 1 in vertebrate development. Birth Defects Res Part C Embryo Today Rev. 2013;99(1):61-69. doi:10.1002/bdrc.21030.

152. Chaly Y, Fu Y, Marinov A, et al. Follistatin-like protein 1 enhances NLRP3 inflammasome- mediated IL-1β secretion from monocytes and macrophages. Eur J Immunol. 2014;44(5):1467-

1479. doi:10.1002/eji.201344063.

153. Wilson DC, Marinov AD, Blair HC, et al. Follistatin-like protein 1 is a mesenchyme-derived

inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid arthritis. Arthritis Rheum. 2010;62(8):2510-2516. doi:10.1002/art.27485.

154. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.

155. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-

1088. doi:10.1002/art.33422.

156. Sundaram GM, Common JEA, Gopal FE, et al. /`See-saw/’ expression of microRNA-198 and FSTL1 from a single transcript in wound healing. Nature. 2013;495(7439):103-106. doi:10.1038/

nature11890.

157. Shi D-L, Shi G-R, Xie J, Du X-Z, Yang H. MicroRNA-27a Inhibits Cell Migration and Invasion of Fibroblast-Like Synoviocytes by Targeting Follistatin-Like Protein 1 in Rheumatoid Arthritis. Mol Cells. 2016;39(8):611-618. doi:10.14348/molcells.2016.0103.

158. Liu M, Liu R, Wu H, et al. Radix puerariae extracts ameliorate paraquat-induced pulmonary fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2 signalling pathways through downregulation of miRNA-21 expression. BMC Complement Altern Med. 2016;16:11. doi:10.1186/s12906-016-0991-6.

159. Rosenberg MI, Georges SA, Asawachaicharn A, Analau E, Tapscott SJ. MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 2006;175(1):77-85. doi:10.1083/

jcb.200603039.

160. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.

161. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.

162. Ouchi N, Asaumi Y, Ohashi K, et al. DIP2A functions as a FSTL1 receptor. J Biol Chem . 2010;285(10):7127-7134. doi:10.1074/jbc.M109.069468.

163. Tanaka M, Murakami K, Ozaki S, et al. DIP2 disco-interacting protein 2 homolog A (Drosophila) is a candidate receptor for follistatin-related protein/follistatin-like 1--analysis of their binding with TGF-β superfamily proteins. FEBS J. 2010;277(20):4278-4289. doi:10.1111/j.1742-

4658.2010.07816.x.

164. Liang X, Hu Q, Li B, et al. Follistatin-Like 1 Attenuates Apoptosis via Disco-Interacting Protein 2 Homolog A/Akt Pathway After Middle Cerebral Artery Occlusion in Rats. Stroke. 2014;45(10):3048-3054. doi:10.1161/STROKEAHA.114.006092.

165. Murakami K, Tanaka M, Usui T, et al. Follistatin-related protein/follistatin-like 1 evokes an innate immune response via CD14 and toll-like receptor 4. FEBS Lett. 2012;586(4):319-324.

doi:10.1016/j.febslet.2012.01.010.

166. Guo J, Liang W, Li J, Long J. Knockdown of FSTL1 inhibits oxLDL-induced inflammation responses through the TLR4/MyD88/NF-κB and MAPK pathway. Biochem Biophys Res Commun. August

2016. doi:10.1016/j.bbrc.2016.08.138.

167. Liu R, Yang Y, Shen J, et al. Fstl1 is involved in the regulation of radial glial scaffold development. Mol Brain. 2015;8:53. doi:10.1186/s13041-015-0144-8.

168. van den Berg G, Somi S, Buffing AAM, Moorman AFM, van den Hoff MJB. Patterns of expression

27

of the Follistatin and Follistatin-like1 genes during chicken heart development: a potential role in valvulogenesis and late heart muscle cell formation. Anat Rec Hoboken NJ 2007. 2007;290(7):783-787. doi:10.1002/ar.20559.

169. Towers P, Patel K, Withington S, Isaac A, Cooke J. Flik, a chick follistatin-related gene, functions in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic hedgehog signalling. Dev Biol. 1999;214(2):298-317. doi:10.1006/dbio.1999.9421.

170. Ni S, Miao K, Zhou X, et al. The involvement of follistatin-like protein 1 in osteoarthritis by elevating NF-κB-mediated inflammatory cytokines and enhancing fibroblast like synoviocyte proliferation. Arthritis Res Ther. 2015;17:91. doi:10.1186/s13075-015-0605-6.

171. Chaly Y, Blair HC, Smith SM, et al. Follistatin-like protein 1 regulates chondrocyte proliferation and chondrogenic differentiation of mesenchymal stem cells. Ann Rheum Dis. 2015;74(7):1467- 1473. doi:10.1136/annrheumdis-2013-204822.

172. Zhou X, Xiao X, Huang T, et al. Epigenetic inactivation of follistatin-like 1 mediates tumor immune evasion in nasopharyngeal carcinoma. Oncotarget. 2016;7(13):16433-16444. doi:10.18632/

oncotarget.7654.

173. Maruyama S, Nakamura K, Papanicolaou KN, et al. Follistatin-like 1 promotes cardiac fibroblast activation and protects the heart from rupture. EMBO Mol Med. 2016;8(8):949-966.

doi:10.15252/emmm.201506151.

174. Chen W, Xia J, Hu P, et al. Follistatin-like 1 protects cardiomyoblasts from injury induced by sodium nitroprusside through modulating Akt and Smad1/5/9 signaling. Biochem Biophys Res Commun. 2016;469(3):418-423. doi:10.1016/j.bbrc.2015.12.026.

175. Lara-Pezzi E, Felkin LE, Birks EJ, et al. Expression of follistatin-related genes is altered in heart failure. Endocrinology. 2008;149(11):5822-5827. doi:10.1210/en.2008-0151.

176. Ogura Y, Ouchi N, Ohashi K, et al. Therapeutic impact of follistatin-like 1 on myocardial ischemic injury in preclinical models. Circulation. 2012;126(14):1728-1738. doi:10.1161/

CIRCULATIONAHA.112.115089.

177. Alteköester A-K, Harvey RP. Bioengineered FSTL1 Patches Restore Cardiac Function Following Myocardial Infarction. Trends Mol Med. 2015;21(12):731-733. doi:10.1016/j.

molmed.2015.10.006.

178. Chaly Y, Hostager B, Smith S, Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases. Immunol Res. 2014;59(1-3):266-272. doi:10.1007/s12026-014-8526-z.

179. Ehara Y, Sakurai D, Tsuchiya N, et al. Follistatin-related protein gene (FRP) is expressed in the synovial tissues of rheumatoid arthritis, but its polymorphisms are not associated with genetic susceptibility. Clin Exp Rheumatol. 2004;22(6):707-712.

180. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up- Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.

181. Gorelik M, Fall N, Altaye M, et al. Follistatin-like protein 1 and the ferritin/erythrocyte sedimentation rate ratio are potential biomarkers for dysregulated gene expression and macrophage activation syndrome in systemic juvenile idiopathic arthritis. J Rheumatol. 2013;40(7):1191-1199. doi:10.3899/jrheum.121131.

182. Campfield BT, Nolder CL, Marinov A, et al. Follistatin-like protein 1 is a critical mediator of experimental Lyme arthritis and the humoral response to Borrelia burgdorferi infection. Microb Pathog. 2014;73:70-79. doi:10.1016/j.micpath.2014.04.005.

183. Fan N, Sun H, Wang Y, et al. Follistatin-Like 1: A Potential Mediator of Inflammation in Obesity. Mediators Inflamm. 2013;2013:e752519. doi:10.1155/2013/752519.

184. Tanaka M, Ozaki S, Kawabata D, et al. Potential preventive effects of follistatin-related protein/ TSC-36 on joint destruction and antagonistic modulation of its autoantibodies in rheumatoid arthritis. Int Immunol. 2003;15(1):71-77. doi:10.1093/intimm/dxg005.

185. Kawabata D, Tanaka M, Fujii T, et al. Ameliorative effects of follistatin-related protein/TSC-36/ FSTL1 on joint inflammation in a mouse model of arthritis. Arthritis Rheum. 2004;50(2):660-668.

doi:10.1002/art.20023.

186. Le Luduec JB, Condamine T, Louvet C, et al. An Immunomodulatory Role for Follistatin-Like 1 in Heart Allograft Transplantation. Am J Transplant. 2008;8(11):2297-2306. doi:10.1111/j.1600-

6143.2008.02398.x.

187. Adams DC, Karolak MJ, Larman BW, Liaw L, Nolin JD, Oxburgh L. Follistatin-like 1 regulates renal

28

IL-1β expression in cisplatin nephrotoxicity. Am J Physiol - Ren Physiol. 2010;299(6):F1320-F1327.

doi:10.1152/ajprenal.00325.2010.

188. Wang Y, Li D, Xu N, et al. Follistatin-like protein 1: a serum biochemical marker reflecting the severity of joint damage in patients with osteoarthritis. Arthritis Res Ther. 2011;13(6):R193.

doi:10.1186/ar3522.

1

189. El-Armouche A, Ouchi N, Tanaka K, et al. Follistatin-like 1 in chronic systolic heart failure:

a marker of left ventricular remodeling. Circ Heart Fail. 2011;4(5):621-627. doi:10.1161/

CIRCHEARTFAILURE.110.960625.

190. Widera C, Horn-Wichmann R, Kempf T, et al. Circulating concentrations of follistatin-like 1 in healthy individuals and patients with acute coronary syndrome as assessed by an immunoluminometric sandwich assay. Clin Chem. 2009;55(10):1794-1800. doi:10.1373/

clinchem.2009.129411.

191. Hayakawa S, Ohashi K, Shibata R, et al. Association of Circulating Follistatin-Like 1 Levels with Inflammatory and Oxidative Stress Markers in Healthy Men. PloS One. 2016;11(5):e0153619.

doi:10.1371/journal.pone.0153619.

192. Sumitomo K, Kurisaki A, Yamakawa N, et al. Expression of a TGF-beta1 inducible gene, TSC-36, causes growth inhibition in human lung cancer cell lines. Cancer Lett. 2000;155(1):37-46.

193. Zhao W, Han H-B, Zhang Z-Q. Suppression of lung cancer cell invasion and metastasis by connexin43 involves the secretion of follistatin-like 1 mediated via histone acetylation. Int J Biochem Cell Biol. 2011;43(10):1459-1468. doi:10.1016/j.biocel.2011.06.009.

194. Bae K, Park KE, Han J, Kim J, Kim K, Yoon K-A. Mitotic cell death caused by follistatin-like 1 inhibition is associated with up-regulated Bim by inactivated Erk1/2 in human lung cancer cells. Oncotarget. 2016;7(14):18076-18084. doi:10.18632/oncotarget.6729.

195. Hodgson G, Hager JH, Volik S, et al. Genome scanning with array CGH delineates regional alterations in mouse islet carcinomas. Nat Genet. 2001;29(4):459-464. doi:10.1038/ng771.

196. Ding T, He X-Z, Xu X-L, Xu H-Y, Zhou C-X, Wang Y-J. [Expression of serum FSTL-1 in bone metastasis of prostate cancer and its clinical implication]. Zhonghua Nan Ke Xue Natl J Androl.

2014;20(12):1090-1092.

197. Kudo-Saito C, Fuwa T, Murakami K, Kawakami Y. Targeting FSTL1 Prevents Tumor Bone Metastasis and Consequent Immune Dysfunction. Cancer Res. 2013;73(20):6185-6193. doi:10.1158/0008-

5472.CAN-13-1364.

198. Chan QKY, Ngan HYS, Ip PPC, Liu VWS, Xue WC, Cheung ANY. Tumor suppressor effect of follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and functional analysis. Carcinogenesis. 2009;30(1):114-121. doi:10.1093/carcin/bgn215.

199. Ciarmela P, Florio P, Sigurdardottir M, et al. Follistatin-related gene expression, but not follistatin expression, is decreased in human endometrial adenocarcinoma. Eur J Endocrinol Eur Fed Endocr Soc. 2004;151(2):251-257.

200. Reddy SP, Britto R, Vinnakota K, et al. Novel glioblastoma markers with diagnostic and prognostic value identified through transcriptome analysis. Clin Cancer Res Off J Am Assoc Cancer Res. 2008;14(10):2978-2987. doi:10.1158/1078-0432.CCR-07-4821.

201. Trojan L, Schaaf A, Steidler A, et al. Identification of metastasis-associated genes in prostate cancer by genetic profiling of human prostate cancer cell lines. Anticancer Res. 2005;25(1A):183-

191.

202. Sepporta MV, Tumminello FM, Flandina C, et al. Follistatin as potential therapeutic target in prostate cancer. Target Oncol. 2013;8(4):215-223. doi:10.1007/s11523-013-0268-7.

203. Kudo-SaitoC.FSTL1promotesbonemetastasisbycausingimmunedysfunction.Oncoimmunology.

2013;2(11). doi:10.4161/onci.26528.

204. Tan X, Zhai Y, Chang W, et al. Global analysis of metastasis-associated gene expression in primary cultures from clinical specimens of clear-cell renal-cell carcinoma. Int J Cancer. 2008;123(5):1080- 1088. doi:10.1002/ijc.23637.

205. Liu Y, Han X, Yu Y, et al. A genetic polymorphism affects the risk and prognosis of renal cell

carcinoma: association with follistatin-like protein 1 expression. Sci Rep. 2016;6:26689.

doi:10.1038/srep26689.

206. Mashimo J ’ichi, Maniwa R, Sugino H, Nose K. Decrease in the expression of a novel TGF β1- inducible and ras-recision gene, TSC-36, in human cancer cells. Cancer Lett. 1997;113(1):213-

29

CHAPTER 2

Endothelial Follistatin-like 1 regulates the postnatal development of the pulmonary vasculature by modulating BMP/Smad signaling

Navessa P. Tania , Harm Maarsingh, I. Sophie T. Bos, Andrea Mattiotti, Stuti Prakash, Wim Timens, Quinn D. Gunst, Luis J Jimenez-Borreguero, Martina Schmidt, Maurice J.B. van den Hoff, Reinoud Gosens

Endothelial follistatin-like-1 regulates the postnatal development of the pulmonary vasculature by modulating BMP/Smad signaling.

Navessa P. Tania 1 , Harm Maarsingh 2 , I. Sophie T. Bos 1 , Andrea Mattiotti 3 , Stuti Prakash 3 , Wim Timens 4 , Quinn D. Gunst 3 , Luis J Jimenez-Borreguero 5 , Martina Schmidt 1 , Maurice J.B. van den Hoff 3 , Reinoud Gosens 1

1 University of Groningen, Department of Molecular Pharmacology, Groningen Research Institute for Asthma and COPD, Groningen, The Netherlands. 2 Palm Beach Atlantic University, Department of Pharmaceutical Sciences, Lloyd L. Gregory School of Pharmacy, West Palm Beach, Florida, USA. 3 Academic Medical Center, Department of Anatomy, Embryology and Physiology, Amsterdam,The Netherlands. 4 University of Groningen, University Medical Center Groningen, Department of Pathology and Medical Biology, Groningen Research Institute for Asthma and COPD, Groningen, The Netherlands. 5 Centro Nacional de Investigaciones Cardiovasculares & Hospital de La Princesa, Madrid, Spain.

32

Abstract

BMP signaling regulates vascular smooth muscle maturation, endothelial cell proliferation and tube formation. The endogenous BMP antagonist Follistatin-like 1 (Fstl1) is highly expressed in pulmonary vascular endothelium of the developing mouse lung, suggesting a role in pulmonary vascular formation and vascular homeostasis. The aim of this study was to investigate the role of Fstl1 in the pulmonary vascular endothelium. To this aim, Fstl1 was conditionally deleted from endothelial and endothelial-derived cells using Tie2-credrivenFstl1-KO mice (Fstl1-eKO mice). Endothelial-specific Fstl1 deletion was postnatally lethal, as ~70% of Fstl1-eKO mice died at 3 weeks after birth. Deletion of Fstl1 from endothelium resulted in a reduction of right ventricular output at 3 weeks after birth compared to controls. This was associated with pulmonary vascular remodeling, as the percentage of actin positive small pulmonary vessels was increased at 3 weeks in Fstl1-eKO mice compared to controls. Endothelial deletion of Fstl1 resulted in activation of Smad1/5/8 signaling and increased BMP/Smad-regulated gene expression of Jagged1, Endoglin, and Gata2 at 1 week after birth compared to controls. In addition, potent vasoconstrictor Endothelin-1, the expression of which is driven by Gata2, was increased in expression,both on the mRNA and protein level,at 1 week after birth compared to controls. At 3 weeks, Jagged1 was reduced in the Fstl1-eKO mice whereas Endoglin and Endothelin-1 were unchanged.In conclusion, loss of endothelial Fstl1 in the lung is associated with elevated BMP-regulated genes, impaired small pulmonary vascular remodeling and decreased right ventricular output.

33

2

Introduction

Pulmonary vascular development and maturation is a tightly controlledprocess that isorchestrated by multiple signaling pathways, including Bone Morphogenetic Protein (BMP),which control spatio-temporal gene expression patterns. BMP signaling is important in embryonicvascular developmentand adult vascular homeostasis. 1,2 Dysregulation of BMP signaling has been strongly associated with the pathogenesis of hereditary vascular diseases, including familial pulmonary arterial hypertension (PAH), hereditary hemorrhagic telangiectasia, atherosclerosis and cerebral cavernous malformation. 311 BMP signaling regulates vascular smooth muscle maturation, endothelial cell proliferation and tube formation. 9,12 Tight spatio- temporal control of BMP signaling and biological availability is therefore crucial for the normal development of vascular structure and function, including in the lung. BMP ligands elicittheir activity by binding to typeI BMP receptors (ALK1, 2,3,and 6) and by recruitingtype II BMP receptors (BMPRII, ACVRIIA, and ACVRIIB). After forming a heterotetrameric complex, the signal propagates to the nucleus byspecifically phosphorylating the Smad proteinsSmad1/5/8. Phosphorylated Smad1/5/8 proteins form a complex with Smad4,which results in accumulation of this complex in the nucleus. This directly and indirectly influences transcription of target genes, among which Endoglin, Gata2 and Jagged1. 13 Follistatin-like 1 (Fstl1) is anendogenous BMP antagonist that is highly expressed in pulmonary vascular endothelium of thedeveloping mouse lung, suggesting a role in pulmonary vasculature development. 14,15 Fstl1 is important for normal lung development.In fact, multiple organ defects were observed in whole-body knockout of Fstl1 (Fstl1-KO). 15,16 Fstl1-KOmice showed increased thickness of alveolar walls and increased numbers of immature cuboidal alveolar epithelial cells in the lung. 15,16 In addition, Fstl1-KOmice exhibited impaired tracheal cartilage formation, alveolar maturation and lung morphogenesis, resulting in respiratory failure and in postnatal lethality in mice. 15,16 Major defects in cardiac and skeletal development were alsoreported in Fstl1-KOmice. 15,16 Given the complex nature of BMP signaling and the predominant endothelial expression of the BMP antagonist Fstl1 in the developing lung, this study aimed to explore therole of endothelial Fstl1 signaling in pulmonary vascular development using Tie2-cremediated endothelial-specific deletion of Fstl1 in vivo. Specifically, we aimed to investigate the impact of Fstl1 deletion on the morphology of the pulmonary vasculature, on gene expression associated with BMP signaling, and its implication on pulmonary function.

34

Materials and Methods

Antibodies and reagents Polyclonal rabbit anti-Fstl1 (#HPA035251), polyclonal rabbit anti-Jagged1 (#HPA021555),and monoclonal mouse anti-β-actin (#A5441) were purchased from Sigma Aldrich (St. Louis, MO, USA). Polyclonal rabbit anti-α-smooth muscle actin(α-SMA,#AB5694) and polyclonal rabbit anti-CD31 (#AB28364)were obtained from Abcam(Cambridge, UK). Polyclonal goat anti-mouse Endoglin (#AF1320) was procured from R&D Systems (Oxford, UK). Polyclonal rabbit anti-phospho-Smad1/5/8 (#AB3848), monoclonal mouse anti-Troponin I (TnI) (#MAB16910)were obtained from Millipore (Molsheim, France) andpolyclonal rabbit anti-Smad1(#9743) from Cell Signaling (Danvers, MA, USA). Horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (#711-035-152), donkey anti-goat IgG (#705-035-003), and donkey anti-mouse IgG (#715-035-150) were purchased from Jackson Immunoresearch (West Grove, PA, USA). Alexa Fluor 647 donkey anti-mouse IgG (#A-31571) was obtained from Thermo Fisher Scientific (Waltham, MA, USA).All other chemicals were of analytical grade.

2

Tie-2cre mediated endothelial-specificdeletion of Fstl1 Conditional deletion of Fstl1 from vascular endothelial and endothelial-derived cells was achievedby crossing floxed homozygousFstl1 fl/fl mice with double heterozygousmice carrying one Fstl1 knockoutallele and the Tie2-cre cassette(Fstl1 WT/ KO Tie2-cre )on a FVB background. 15,17 Within this cross endothelial specific knockout mice(Fstl1 fl/KO Tie2-cre )and littermate controls(Fstl1 fl/WT Tie2-cre , Fstl1 fl/KO , and Fstl1 fl/WT ) were generated.Fstl1 fl/KO Tie2-cre mice are denoted as Fstl1-eKO and their littermate controls are denoted as controls. The breeding lines were maintained in the animal facility of the University of Amsterdam. All experimental procedures complied with institutional and national ethical guidelines regarding animal experimentation. Mice were sacrificed at 1 and 3 weeks after birth (1 week: n=12 Fstl1-eKO mice and n=16 controls; 3 weeks: n=11Fstl1-eKO miceand n=30 controls). The lung tissue was collected. Lung lobes (right superior, middle, and inferior lobes) were inflated with 50% Tissue-Tek (Sakura Finetek;Alphen-aan-den-Rijn, the Netherlands) in 0.9% NaCl (Braun; Kronberg, Germany) and fixed with 10% v/v formalin for paraffin-embedded sections. The non-inflated lobes (left and post caval lobes) were snap-frozen in liquid nitrogen for mRNA and protein analysis. The pups were genotyped using PCR with Fstl1 and cre-recombinase primer sets. Fstl1forward (5’-GCCAGAATCCCACTCCATCG- 3’); Fstl1reverse (5’-TCGGAGCCTGGTGATAAGCG-3’); cre-recombinase forward (5’-GGTTCGCAAGAACCTGATGGACAT-3’); cre-recombinase reverse (5’-GCTAGAGCCTGTTTTGCACGTTCA-3’).

In situ hybridization In situ hybridization was performed as previously described. 18 In short, lung sections were deparaffinized and rehydrated in a graded series of alcohol, followed by 15

35

min incubation at 37°C in 10 mg/ml proteinase K dissolved in PBS. The sections were post-fixed for 10 min in 4% paraformaldehyde (PFA) and 0.2% glutaraldehyde in

PBS, followed by rinsing in PBS. Pre-hybridization was done for at least 1 hr at 70°C in hybridization mix (50% formamide, 5xSSC (20xSSC; 3 M NaCl, 0.3 M tri-sodium citrate, pH 4.5)), 1% blocking solution, 5 mM EDTA, 0.1% 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate (Sigma Aldrich; St. Louis, MO, USA), 0.5 mg/

ml heparin (BD Biosciences; Erembodegem, Belgium), and 1 mg/ml yeast total RNA

(Roche Applied Science; Penzberg, Germany). A digoxigenin (DIG)-labeled probe (1 ng/ml) was added to the hybridization mix. Probes specific to Fstl1 were used. After overnight hybridization, the sections were rinsed with 2xSSC, followed by two washings(50% formamide, 2xSSC, pH 4.5) at 65°C, and rinsing with TNT (0.1 M Tris-HCl, pH  7.5, 0.15 M NaCl, 0.05% Tween-20) at room temperature. The sections were incubated for 1 hr in MABT-block (100 mM maleic acid, 150 mM NaCl, pH 7.4, 0.05% Tween-20, 2% blocking solution), followed by 2 hr incubation in MABT-block containing 100 mU/ml alkaline phosphatase-conjugated anti-DIG Fab fragments (Sigma Aldrich; St. Louis, MO, USA). After rinsing in TNT and subsequently in NTM (100 mM Tris, pH 9.0, 100 mM NaCl, 50 mM MgCl 2 ), probe binding was visualized

using nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (Roche Applied Science; Penzberg, Germany). The sections were dehydrated in

a graded alcohol series, rinsed in xylene, and embedded in Entellan (Millipore; Molsheim, France). Images were captured using a Leica DFC320 camera mounted

on an AxioPhot microscope (Zeiss; Oberkochen, Germany).

Pulmonary physiological measurement Pulmonary physiological functions were measured in miceat 1 week (n=4 Fstl1-eKO mice and n=14 controls)and 3 weeks (n=8 Fstl1-eKO mice and n=19 controls) after birth using transthoracic echocardiography as previously described. 19

RNA isolation and real time quantitative PCR

Total RNA was extracted from lung tissue (post caval lobe) using the NucleoSpin® RNA isolation kit according to the manufacturer’s instruction (Macherey Nagel;Düren, Germany). The total RNA concentration was determined using theNanoDrop® ND1000 spectrophotometer (Thermo Fisher Scientific;Waltham, MA, USA). Equal amounts of total RNA were reverse transcribed using the Reverse Transcription System (Promega; Madison, WI, USA) to generate cDNA. Diluted cDNA was mixed with FastStart Universal SYBR Green Master Mix (Roche Applied Science; Penzberg, Germany) and gene of interest primer sets (Biolegio;Nijmegen, the Netherlands). Primer sequences are listed in Supplementary Table 1. Real-time quantitative PCR was performed using the Illumina Eco Personal qPCR System (Westburg; Leusden, The Netherlands). The qPCR reaction was started by denaturation at 95°C for 15 minutes followed by 45 cycles of denaturation at 94°C for 30 s, annealing at 59°C

for 30 s and elongation at 72°C for 30 s. Final elongation was for 5 minutes at 72 °C.

Real time PCR data was analyzed using LinRegPCR software version 2013.1. 20 Data

36

were expressed in arbitrary unitsas ratio ofthe starting concentration (N 0 ) of each geneofinterest corrected to the geometric mean of the N 0 value of two reference genes (B2m and Hprt). Comparing the expression levels of the genes of interest between the three non-conditional knockout groups (Fstl1 fl/WT Tie2-cre , Fstl1 KO/fl , or Fstl1 WT/fl mice), did not reveal significant differences, allowing pooling of the data and using them as age-matched controls.

Supplementary Table 1. Primers used for qRT-PCR analysis.

2

Gene

 

Primer sequence (5’

Gene   Primer sequence (5’ 3’) NCBI accession number

3’)

NCBI accession number

Fstl1

Forward

TCGCTGTGTCTGTTCCTGTGGC

NM_008047.5

 

Reverse

TTCTGCTGTGCCCTGGTGCTTC

 

Eng

Forward

GCACCTTGTCCCAGGAAGTC

NM_001146350.1

 

Reverse

GGAGGCTTGGGATACTCACG

 

Jag1

Forward

CCAGTGTCAGAATGACGCCT

NM_013822.5

 

Reverse

AGTGACCCCCATTCAAGCAG

 

Gata2

Forward

CCCCTATCCCGTGAATCCG

NM_008090.5

 

Reverse

GGTCCACTACTGTGTCTTGGG

 

Edn1

Forward

GGCCCAAAGTACCATGCAGA

NM_010104.3

 

Reverse

GATGGCCTCCAACCTTCGTA

 

B2m

Forward

ATGGGAAGCCGAACATACTG

NM_009735.3

 

Reverse

CAGTCTCAGTGGGGGTGAAT

 

Hprt

Forward

AGGCCAGACTTTGTTGGATTTGA

NM_013556.2

 

Reverse

ACTGGCAACATCAACAGGACTC

 

Abbreviations: Fstl1, Follistatin-like 1; Eng, Endoglin; Jag1, Jagged1; Gata2, GATA binding protein 2; Edn1, Endothelin-1; B2m,b 2 -microglobulin; and Hprt, hypoxanthine guanine phosphoribosyl transferase.

Western blot Total protein was extracted from lung tissue (left lobe) using RIPA lysis buffer (RIPA lysis buffer (65 mM Tris, 155 mM NaCl, 1% Igepal CA-630, 0.25% sodium deoxycholate, 1 mM EDTA, pH 7.4) supplemented with protease inhibitors (1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A, 1 mM Na 3 VO 4, 1 mM NaF, 1 mM β-glycerophosphate). Equal amounts of protein lysate were subjected to SDS PAGE electrophoresis and transferred to nitrocellulose or polyvinylidene difluoride (PVDF) membranes to evaluate the expression level of non-phosphorylated (β-actin, Jagged1, Endoglin, total Smad1) , and phosphorylated (pSmad1/5/8)proteins, respectively. Proteins ofinterest were detected using primary antibodies for overnight at 4°C in in TBST (50 mM Tris-HCl, 150 mM NaCl, 0.05% (w/v) Tween-20, pH 7.4). The following day, membranes were incubated with HRP-conjugated secondary antibodies for 2 hr at room temperature. Protein bands were subsequently visualized using enhanced chemiluminescence substrate(Perkin Elmer; Groningen, the Netherlands)using the G-box gel documentation system (Syngene; Cambridge, UK). Protein band intensities were quantified using Image Studio Lite version 5. Data are presented as ratio of non-

37

phosphorylated protein band intensity corrected to b-actinas a reference protein. For phosphorylated proteins, data are presented as ratio of phosphorylated protein corrected to total protein.

Immunostaining Paraffin-embedded lung tissues were sectioned at 5 µm thickness and stained for α-SMA (Abcam; Cambridge, UK), which was visualized by staining with HRP- conjugated secondary antibody and diaminobenzidine as a substrate (Sigma Aldrich; St. Louis, MO, USA). To determine the actin content in large vessels (>50 µm in diameter), 21 the α-SMA staining surrounding muscular and elastic vessels was digitally captured in two lung tissue sections per animal and quantified using Image J (National Institute of Health, USA) in a blinded fashion. Data are expressed as ratio of the actin positive area over the square of the length of the tunica intima. To determine the total number of small vessels (<50 µm in diameter), 21 CD31 staining was performed in serial sections to stain for endothelial cells. Data are expressed as the total number of CD31-positive small vessels corrected to lung surface area (cm 2 ). Furthermore, the number of actin positive small vessels as well as the total number of CD31-positive small vessels was quantified in two lung tissue sections per animal, in a blinded fashion. Data are expressed as the number of actin positive small vessels corrected to the total number of CD31-positive small vessels. To evaluate muscularization of the right heart, paraffin-embedded heart tissues were sectioned at 10 µm and stained using the myocardial marker TnI which was visualized by staining with Alexa Fluor 647-conjugated secondary antibody. The images were digitally captured in a blinded manner using a fluorescent microscope (Leica Dm6000; Wetzlar, Germany). The right ventricular free wall was outlined in each section and the mean fluorescence intensity of the outlined structure was measured using 3D Amira software (Version 5.4.3).

Endothelin-1 enzyme-linked immunosorbent assays (ELISA) The Endothelin-1 protein concentration in lung homogenates was determined using ELISA according to the manufacturer’s protocol (R&D system;Oxford,UK) in duplicate. The sample absorbance was determined at 450 nm and at 570 nm to correct for optical imperfections using Gen5an software using a plate reader (BioTek; Winooski, VT, USA). The lower and upper detection limits for Endothelin-1 were 0.39 pg/ml and 25 pg/ml, respectively.

Hematoxylin and eosin staining Paraffin-embedded lung tissue sections of 5 µm thick were deparaffinized and rehydrated in a graded series of alcohol, followed by hematoxylin staining. After washing with flowing water, sections were counterstained with eosin. The sections were dehydrated in a graded series of alcohol, rinsed in xylene, and embedded

38

in KP-mounting medium (Klinipath BV;Duiven, the Netherlands). Images were captured using Cell^D imaging software using a light microscope (Olympus BX41; Zoeterwoude, the Netherlands).

Data analysis Data are presented as medians per genotype-group except otherwise stated. To determine the normality of data distribution, a Shapiro-Wilk normality test was performed prior to further statistical analysis. The statistical significance of differences of normally distributed data was performed using an independent samples 2-tailedt-test for comparing 2 groups or a two-way ANOVA followed by a post hocTukey multiple comparisons test for comparing more than 2 groups. For non- Gaussian distributed data, the statistical significance of differences was determined usinga non-parametric Mann-Whitney U test for comparing 2 groups or non- parametric one-way ANOVA with apost hoc Kruskal-Wallis multiple comparisons test for comparing more than 2 groups. The Bonferroni correction was used to correct for multiple testing. Differences were considered to be statistically significant at p<0.05.

Results

2

Loss of Fstl1 from endothelial cells is postnatally lethal in mice. We and others have previously demonstrated that the homozygote global Fstl1 knockout mice die at birth due to respiratory distress. Here, we generated a mouse line in which Fstl1 is conditionally impaired in endothelial and endothelial-derived cells using Tie2-cre targeted gene deletion, which will be referred to as Fstl1-eKO. Fstl1-eKO knockout pups were born alive at the expected Mendelian ratio (25%). However, ~70% of Fstl1-eKO mice had died by 3 weeks after birth whereas all their littermate controls, Fstl1 fl/WT Tie2-cre , Fstl1 KO/fl , and Fstl1 WT/fl mice survived(Figure 1A). In contrast to Fstl1-KO mice, which display abnormal tracheal cartilage formation and thickening of alveolar septa, Fstl1-eKO mice had macroscopically normal tracheal cartilage formation and normal alveolarization (Figure S1). In view of the postnatal lethality of Fstl1-eKO mice and the marked differences with the globalFstl1-KOmice, we quantified Fstl1 mRNA and protein in the lungs of these animals. Fstl1 was highly expressed in the control mice at 1 week after birth and significantly declined 3 weeks after birth (mRNA p<0.005; protein p<0.05; Figure 1B and 1C), suggesting Fstl1 is crucial in the early stages of postnatal lung development. The expression of Fstl1 mRNA and protein in lung homogenates of Fstl1-eKO mice were significantly reduced compared to age-matched controls at 1 week after birth (mRNA p<0.005; protein p<0.05; Figure 1B and 1C), whereas at 3 weeks after birth the expression of Fstl1 mRNA and protein were not significantly different in Fstl1-eKO mice compared to age-matched controls (Figure 1B and 1C). In situ hybridization on sections of control mice showed expression of Fstl1 mRNA both in blood vessels and lung parenchyma at 1 week. At 3 weeks after birth the pattern of expression was not different, though

39

the staining intensity was markedly less, which is in line with the qPCR findings

(Figure 1D). In the Fstl1-eKO mice, the expression pattern of Fstl1 mRNA was similar to the control mice, except that Fstl1 mRNA was not or hardly detectable in the endothelium of the blood vesselsboth at 1 and 3 weeks after birth (Figure 1D).

.

vesselsboth at 1 and 3 weeks after birth (Figure 1D). . Figure 1. Endothelial deletion of

Figure 1. Endothelial deletion of Fstl1 in mice is postnatally lethal. (A) Kaplan Meijer survival curve of Fstl1-eKO mice compared to controls. ~70% of Fstl1-eKO mice died at 3 weeks after birth compared to controls. (B) Gene expression analysis of Fstl1 in lung homogenates using quantitative real time PCR. Horizontal line represents the median of 16-30 mice per group. (C) Immunoblot analysis of Fstl1 protein in lung homogenates. Data are expressed as means ± SEM of the ratio of Fstl1 protein corrected to β-actin as a reference protein from 4-9 mice per group. (D) Representative images of Fstl1 in situ hybridization in lung tissue of Fstl1- eKO mice compared to controls. Red arrowheads point to the absence or presence of Fstl1 probes. AW indicates an airway and V indicates a blood vessel. Each data point represents an individual animal. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group; ns = not significant.

40

Right ventricular output is reduced in Fstl1-eKO mice

To shed light on the cause of neonatal lethality of Fstl1-eKO mice, we determined the physiological function of the pulmonary vasculature using echocardiography. During normal postnatal development, a significant increase in right ventricular output was observed at 3 weeks compared to 1 week as shown by the pulmonary valve (PV) and velocity-time integral (VTI) parameters (p<0.05; Figure 2A). A significant reduction

in right ventricular output in Fstl1-eKO mice was observed at 3 weeks compared to

age-matched controls (p<0.05; Figure 2A). Other physiological parameters, including PV peak gradient, PV mean gradient, PV peak velocity, and PV mean velocity, were significantly increased at 3 weeks compared to 1 week after birth both in control and in Fstl1-eKO mice (p<0.05; Figure 2B-2E). No differences between Fstl1-eKOmice and age-matched controls were observed for these parameters (Figure 2B-2E). A validated non-invasive method to assess pulmonary vascular resistance 22,23 was

performed by measuring pulmonary acceleration time (PAT) corrected for the pulmonary ejection time (ET). There was no significant difference in pulmonary vascular resistance during normal postnatal lung development as reflected by the

ratio of PAT/ET in control mice at 3 weeks compared to 1 week after birth (Figure 2F).

A significant change was also not observed between Fstl1-eKO mice compared to

age-matched controls either at 1 week or 3 weeks after birth (Figure 2F). Moreover, we evaluated the muscularization of the right ventricle using myocardial marker TnI, as an indicative of right ventricle hypertrophy by measuring the volume of the right ventricle. There were no changes in the right ventricle volume at 3 weeks compared to 1 week after birth in the control mice (Figure 2G). At 3 weeks, there was a trend towards increased RV volume in Fstl1-eKO mice compared to age-matched controls (Figure 2G). A significant increase in RV volume was observed in Fstl1-eKO mice at 3 weeks compared to 1 week after birth (p=0.005; Figure 2G).

41

2

Figure 2. Right ventricular output is reduced in Fstl1 -eKOmice. Pulmonary functions were measured using

Figure 2. Right ventricular output is reduced in Fstl1-eKOmice. Pulmonary functions were measured using echocardiograph. (A) Pulmonary valve (PV)-velocity time integral (VTI) was significantly decreased in Fstl1-eKO mice compared to age-matched controls.(B) PV peak gradient, (C) PV mean gradient, (D) PV peak velocity, (E) PV mean velocity, and (F) the ratio of Pulmonary Acceleration Time (PAT) corrected by the pulmonary ejection time (ET) in percentage were unaltered in Fstl1-eKO mice compared to age-matched controls. Data are expressed as the mean ± SEM of 4-19 mice per group. (G) The right ventricle (RV) volume of Fstl1-eKO mice was unaltered compared to age-matched controls. A significant increase in RV volume was observed in Fstl1-eKO mice at 3 weeks compared to 1 week after birth. Data are expressed as the mean ± SEM of 3 mice per group. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group; ns = not significant.

42

Pulmonary vascular remodeling in Fstl1-eKO mice In view of these results, we examined the effect of endothelial deletion of Fstl1 on pulmonary vascular phenotypes and quantified the morphological changes and actin content in large and small pulmonary vessels. During normal development, the thickness of the large muscular arteries was unaltered in lung tissue of control mice at 3 weeks compared to 1 week after birth(Figure 3A), whereas the actin content was reduced in large elastic (p<0.005) and muscular arteries (p<0.005) in lung tissue of control mice at 3 weeks compared to 1 week after birth (Figure 3B and 3C).In Fstl1-eKO mice, the thickness and the actin content in large muscular arteries were unaltered at 3 weeks compared to 1 week after birth (Figure 3A and 3C), whereas the actin content in large elastic arteries was significantly reduced at 3 weeks compared to 1 week after birth (p< 0.005; Figure 3B). No significant differences were observed in the thickness of the large muscular arteries (Figure 3A) and in the actin content in large elastic and muscular arteries in lung tissue of Fstl1-eKO mice compared to age- matched controls at either 1 or 3 weeks after birth (Figure 3B and 3C). Reduction in actin content at 3 weeks after birth seems to be limited to vascular smooth muscle as there were no temporal changes in the actin content in the airway smooth muscle bundlesand there was no observed difference between Fstl1-eKO mice compared to age-matched controls(Figure 3D). We also explored the number of small blood vessels in lung tissue as these may contribute to an important extent to changes in pulmonary blood pressure. In normal development, no significant temporal change in theCD31 positivetotal number of vessels was observed, whereas the percentage of actin positive vessels was significantly reduced at 3 weeks compared to 1 week after birth (p<0.01; Figure 3E and 3F). Although the CD31 positive total number of vessels was not significantly different between Fstl1-eKO mice compared to age-matched controls (Figure 3E), the percentage of actin positive small pulmonary vessels was significantly higher in Fstl1-eKO mice at 3 weeks after birth compared to age-matched controls(p<0.05; Figure 3F).

43

2

Figure 3. Number of actin-positive small pulmonary vessels is increased in the lung tissue of

Figure 3. Number of actin-positive small pulmonary vessels is increased in the lung tissue of Fstl1-eKOmice at 3 weeks. (A) The thickness of large muscular arteries in lung tissue was

quantified and expressed as ratio of total area of tunica media over the square of the length

of the tunica intima. Horizontal lines represent the median of n = 9-16 vessels from N= 6-8

mice per group. (B) The α-SMA content in large elastic arteries and (C) in large muscular

arteries in lung tissue was quantified and expressed as ratio of the actin positive area over the square of the length of tunica intima. Horizontal lines represent the median of n= 9-26 vessels per group from N= 5-12 mice per group. (D) The α-SMA content in airway smooth muscle bundles surrounding the airway in lung tissue was quantified and expressed as ratio

of the actin positive area over the square of the length of basement membrane. Horizontal

lines represent the median of n=9-34 vessels per group from N= 5-13 mice per group. (E) Total number of vessels in lung tissue was quantified using CD31 staining and expressed as

ratio of total vessel number/lung surface area (cm 2 ). Horizontal lines represent the median

of the vessel number/cm 2 of N= 7-12 mice per group. (F) The percentage of actin positive

small pulmonary vessels in lung tissue was quantified and expressed as percentage of actin positive small vessel number/total vessel number. Horizontal lines represent the median of the percentage of actin positive vessels of N= 7-12 mice per group. Representative images

of

tissue sections taken at 3 weeks after birth were shown. AW indicates an airway and

V

indicates a blood vessel. Scale bars represent 100 µm. Magnification 200x. *p<0.05;

**p<0.01; ***p<0.005 compared to the indicated group.

44

Increased BMP/Smad signaling in the lung of Fstl1-eKO mice To unravel whether endothelial Fstl1 modulates BMP signaling during postnatal development, we investigated the activity of BMP/Smad signaling in lung homogenates using pSmad1/5/8 antibodies. During normal postnatal development, Smad1/5/8 phosphorylation was higher at 3 weeks compared to 1 week after birth (p<0.05; Figure 4A). In addition, we found an increased levels ofpSmad1/5/8in lung homogenates of Fstl1-eKO compared to age-matched controls at 1 week after birth (p<0.05; Figure 4A), whereas,mthe level of pSmad1/5/8at 3 weeks was unaltered in Fstl1-eKO mice compared to age-matched controls (Figure 4A). To study the role of BMP signaling further, we selected previously identified pSmad1/5/8 target genes which relate to vascular remodeling 24 : Id3, Epas1, Zeb2, Zfp423, Ephb4, Klf4, Flt1, Jag1, Eng, Gata2, Vegf. Of these, we found that the expression of Jagged1, Endoglin, and Gata2 was altered in Fstl1-eKO mice compared to age-matched controls with a nominal p value <0.05, whereas the expression level of the other genes was not different. Therefore, Jagged1, Endoglin, and Gata2 were included for further analysis. Consistent with the increased Smad1/5/8 activation, Jagged1 and Endoglin mRNA and protein were increased in lung tissue of control mice at 3 weeks compared to 1 week after birth (Jagged1 mRNA p<0.05; protein p<0.05; Figure 4B and 4D; Endoglin protein p<0.01; Figure 4C and 4E). In line with increased phosphorylation of Smad1/5/8, the expression of Jagged1 and Endoglin mRNA and protein was also increased in lung homogenates of 1 week Fstl1-eKO mice compared to age-matched controls (Jagged1 mRNA p<0.05; protein p<0.05; Figure 4B and 4D; Endoglin mRNA p<0.05; protein p<0.01; Figure 4C and 4E). At 3 weeks, Jagged1 mRNA (p<0.01) and protein (p<0.05) were reduced in the Fstl1-eKO mice compared to age-matched controls (Figure 4B and 4D), whereas Endoglin was not different compared to age-matched controls (Figure 4C and 4E). The mRNA expression of the transcription factor Gata2 was higher in the lung homogenates of control mice at 3 weeks compared to 1 week after birth (p<0.01; Figure 5A). Accordingly, the level of mRNA and protein expression ofthe Gata2 target gene Endothelin-1, a potent vasoconstrictor, was also increased in lung homogenates of control mice at 3 weeks compared to 1 week after birth (mRNA p<0.005; protein p<0.05; Figure 5B and 5C). Gata2 mRNA and Endothelin-1 mRNA and protein levels were increased in lung homogenates of Fstl1-eKO mice compared to age-matched controls at 1 week after birth (Endothelin-1 mRNA p< 0.05; protein p<0.01; Figure 5B and 5C). These levels did not further increase at 3 weeks after birth and were no longer different compared to age-matched controls (Figure 5A-C).

45

2

Figure 4. Increased activation of Smad1/5/8 and Smad1/5/8-regulated genes in the lung of Fstl1 -eKO

Figure 4. Increased activation of Smad1/5/8 and Smad1/5/8-regulated genes in the lung of Fstl1-eKO mice. (A) Immunoblot analysis of pSmad1/5/8 in lung homogenates. Data are expressed as means ± SEM of the ratios of pSmad1/5/8 corrected to total Smad1 of 4-9 mice per group. Pulmonary expression of the pSmad1/5/8-regulated genes, Jagged1 (B) and Endoglin (C) in lung homogenates. Data are expressed as starting concentration N in arbitrary units corrected to B2m and Hprt as reference genes. Horizontal lines represent medians of 11-30 mice per group. (D) Immunoblot of Jagged1 protein in lung homogenates and its quantification. Data are expressed as means ± SEM of the ratios of Jagged1 over the reference protein β-actin of 4-9 mice per group. (D) Immunoblot of Endoglin in lung homogenates and its quantification. Data are expressed as means ± SEM of the ratios of Endoglin over the reference protein β-actin of 4-9 mice per group. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group.

0

46

***p<0.005 compared to the indicated group. 0 46 Figure 5. Increased Endothelin-1 in the lung of

Figure 5. Increased Endothelin-1 in the lung of Fstl1-eKO mice. (A) Pulmonary mRNA expression of Gata2 transcription factor and (B) Endothelin-1 in the lung homogenates. Data are expressed as starting concentration N in arbitrary units corrected toB2m and Hprt as reference genes. (C) Endothelin-1 protein concentration in lung homogenates is expressed

as Endothelin-1 concentration in pg/ml per 1 µg protein lysates. Each data points represent an individual animal. Horizontal line represents the median of Endothelin-1 concentration of 8-12 mice per group. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group.

0

47

2

Discussion

Proper formation and maturation of the pulmonary vasculature is essential to support normal lung development and function. 25 BMP signaling is crucial in dynamic processes of vessel growth and vessel maturation. 9,12,2629 Maturation of immature vessels proceeds according to the developmental steps: (1) stabilization of the immature vessels, (2) vessel branching, remodeling, and pruning and (3) vessel specialization. 30 Deregulation of molecules involved in vessel growth and maturation leads to vascular abnormalities and dysfunction. In this study, the role of endothelial Fstl1 in postnatal maturation of the pulmonary vasculature was investigated in vivo using Tie2-cre targeted endothelial- specific deletion. Conditional deletion of Fstl1 from endothelium was postnatally lethal, and resulted in small pulmonary vessel changes, pointing to a critical role of endothelial Fstl1 in postnatal lung development. In line with the idea that Fstl1 is a BMP antagonist, phosphorylation of BMP/Smad signaling showed the inverse pattern of Fstl1 expression level during normal postnatal development. In the early stages of postnatal development, high Fstl1 expression is associated with low phosphorylated Smad1/5/8 at 1 week after birth whereas at later stages of postnatal development, decreased in Fstl1 expression is associated with increased phosphorylation of BMP/ Smad signaling in lung tissue of control mice. We also demonstrate that during early stages of postnatal development, high Fstl1 expression coincides with high actin content in the large muscular and elastic arteries and high percentage of actin positive small pulmonary vessels in lung tissue of control mice. In later stages of postnatal development, low Fstl1 expression coexists with low actin content in the large muscular and elastic arteries and low percentage of actin positive small pulmonary vessels in lung tissue of control mice. Recently, it was reported that Fstl1 mediates TGF-β-induced α-SMA expression by antagonizing BMP signaling in lung fibroblasts. 31 We speculate that Fstl1 antagonizes BMP signaling to facilitate TGF-β-induced α-SMA expression from vascular smooth muscle cells in the early stages of normal vascular development. Reduced Fstl1 levels in later stages of development in turn result in reduction in actin content, suggesting that Fstl1 possibly mediates endothelial-mural cell communication by modulating BMP/TGF-β signaling during normal pulmonary vascular development. During normal postnatal vascular development, transient reduction of actin content in pulmonary vessels is normal and an indication of maturation of pulmonary vessels by reducing contractility of pulmonary arteries. 32 Our data indicate that loss of Fstl1 in endothelium prevents this normal reduction of actin in small pulmonary vessels and as such delays pulmonary vascular maturation. Mechanistically, Fstl1-eKO mice have increased Smad1/5/8 phosphorylation and expression of pSmad1/5/8-regulated genes in the lung, including Gata2, Endoglin, and Jagged1. Previous studies demonstrated the important role of Jagged1 and Endoglin in vascular specialization and vascular remodeling, respectively, in the later stages of vessel maturation. 10,33,34 In early stages of normal development, high levels

48

of Fstl1 inhibit BMP signaling and its regulated genes, Gata2, Jagged1 and Endoglin, indicating that modulation of BMP signaling by Fstl1 is important in early stages of postnatal lung development. On the other hand, low levels of Fstl1 in later stages of development lead to increased BMP-mediated Smad phosphorylation and its regulated genes Gata2, Jagged1, and Endoglin. Endoglin is a type III TGF-β receptor which is predominantly expressed in proliferating endothelial cells and triggers endothelial cell proliferation and vascular remodeling. 3437 The importance of Endoglin for normal vascular formation and homeostasis is evident in Endoglin null (Eng -/- ) mice, which exhibit vascular deformities. 3740 Increased Endoglin expression in Fstl1-eKO mice at the early stages of postnatal pulmonary vascular development might shift the balance towards endothelial cell migration and proliferation instead of maturation. This supports the contention that Fstl1-eKO mice have delayed pulmonary vascular maturation. The Notch ligand Jagged1 is an important regulator of cell fate in embryonic development 41 and vessel fate in pulmonary vascular maturation. 10,33 In addition, it has a significant role in angiogenesis and vascular homeostasis. 42,43 Ablation of Jagged1 in mice is embryonically lethal and leads to vascular abnormalities and defects in vascular remodeling. 33 The aberrant Jagged1 expression during early stages of postnatal pulmonary vascular development in Fstl1-eKO mice might lead to deregulation of vascular remodeling and disruption of the vessel specialization programs. BMP/Smad increases expression of the transcription factor Gata2, subsequently promoting the expression of the most potent vasoconstrictor Endothelin-1. 4446 We demonstrate that Endothelin-1 levels are low at the early stages of normal development and increase at the later stages of normal development. We found that endothelial deletion of Fstl1 is associated with increased Endothelin-1 mRNA and protein expression at the early stages of development in the lung. Increased Endothelin-1 has been reported to promote proliferation and migration of endothelial cells and contribute to increased pulmonary vascular resistance and subsequent right ventricle hypertrophy, 47,48 suggesting pivotal roles of Endothelin-1 in vessel formation, vascular remodeling, and vascular tone maintenance. Our data suggest that Endothelin-1 expression is negatively regulated by Fstl1 via inhibiting Smad1/5/8 and the Gata2 transcription factor, presumably by antagonizing BMP signaling. These findings are in line with previous studies demonstrating that Endothelin-1 expression is regulated by BMP via Smad1/5/8 in endothelial cells. 4446 Lower right ventricular output and small vascular remodeling were visible at 3 weeks after birth, whereas elevation in BMP/Smad phosphorylation and of its downstream targets Jagged1, Endoglin, Gata2, and Endothelin-1 were more prominent at 1 week after birth in Fstl1-eKO mice, indicating that molecular changes are more transient than their physiological and morphological consequences. As a consequence the functional and morphological differences seen at 3 weeks after birth were initiated earlier during postnatal development. Alternatively, the activation of BMP/Smad signaling alone may not be sufficient to affect the pulmonary vasculature structurally and functionally at early stages of development,

49

2

but instead becomes evident at a later time point. Despite of higher percentages of actin positive small pulmonary vessels and notably decreased right ventricular output, there were minimum morphological defects of large pulmonary vessels, normal pulmonary vascular resistance as reflected by the ratio of PAT/ET in Fstl1-eKO mice and a trend towards right ventricle hypertrophy. This may suggest very early stages of pulmonary vascular dysfunction in Fstl1-eKO mice. This phenotype is also commonly observed in patients with PAH, in which molecular changes/defects in BMP signaling manifest early in the disease followed by physiological and structural changes which are observed at later stages of the disease progression. 49 In addition, our data may imply that the molecular and morphological changes in the lung are possibly a secondary consequence of the right heart dysfunction as reflected by reduction in RV output. The morphological and physiological functions of the heart of Fstl1-eKO mice are currently under investigation. In conclusion, our findings demonstrate that loss of endothelial Fstl1 in the lung is associated with increased BMP/Smad phosphorylation and elevations in its downstream targets Jagged1, Endoglin, Gata2 and Endothelin-1. These changes are associated with impaired small pulmonary vascular remodeling and decreased right ventricular output. Taken together, our findings suggest a key role of Fstl1 in titrating the level of BMP signaling for proper postnatal lung development.

Acknowledgements The authors would like to thank Jan M. Ruijter for expert advice on real time PCR data analysis and Frank Ensink for technical assistance. This study was financially supported by a grant from the Netherlands Lung Foundation (grant 3.2.12.083).

Conflict of interest The authors have no conflict of interest.

50

of interest The authors have no conflict of interest . 50 2 Supplementary Figure 1. Endothelial

2

Supplementary Figure 1. Endothelial Fstl1 knockout mice showed normal alveolarization as shown by hematoxylin and eosin staining. Alveoli surrounding the airways (A) and alveoli in lung parenchyma (B) of Fstl1-eKO mice and of age-matched controls show no differences at 1 week after birth. Scale bars represent 100 µm. Magnification 200x.

51

References

1. Lowery JW, de Caestecker MP. BMP signaling in vascular development and disease. Cytokine Growth Factor Rev. 2010;21(4):287-298. doi:10.1016/j.cytogfr.2010.06.001.

2. Liu D, Wang J, Kinzel B, et al. Dosage-dependent requirement of BMP type II receptor

for maintenance of vascular integrity. Blood. 2007;110(5):1502-1510. doi:10.1182/

blood-2006-11-058594.

3. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.

4. Harrison RE, Flanagan JA, Sankelo M, et al. Molecular and functional analysis identifies ALK-

1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic telangiectasia. J Med Genet. 2003;40(12):865-871.

5. Fujiwara M, Yagi H, Matsuoka R, et al. Implications of mutations of activin receptor-like kinase

1 gene (ALK1) in addition to bone morphogenetic protein receptor II gene (BMPR2) in children

with pulmonary arterial hypertension. Circ J Off J Jpn Circ Soc. 2008;72(1):127-133.

6. Johnson DW, Berg JN, Baldwin MA, et al. Mutations in the activin receptor-like kinase 1 gene in hereditary haemorrhagic telangiectasia type 2. Nat Genet. 1996;13(2):189-195.

7. McAllister KA, Grogg KM, Johnson DW, et al. Endoglin, a TGF-beta binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 1994;8(4):345- 351. doi:10.1038/ng1294-345.

8. Pi X, Lockyer P, Dyer LA, et al. Bmper inhibits endothelial expression of inflammatory adhesion molecules and protects against atherosclerosis. Arterioscler Thromb Vasc Biol. 2012;32(9):2214- 2222. doi:10.1161/ATVBAHA.112.252015.

9. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.

10. Yao Y, Yao J, Radparvar M, et al. Reducing Jagged 1 and 2 levels prevents cerebral arteriovenous malformations in matrix Gla protein deficiency. Proc Natl Acad Sci U S A. 2013;110(47):19071- 19076. doi:10.1073/pnas.1310905110.

11. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet. 2000;26(1):81-84. doi:10.1038/79226.

12. Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9 induces proliferation of multiple types of endothelial cells in vitro and in vivo. J Cell Sci. 2010;123(Pt 10):1684-1692.

13. Wang RN, Green J, Wang Z, et al. Bone Morphogenetic Protein (BMP) signaling in development and human diseases. Genes Dis. 2014;1(1):87-105. doi:10.1016/j.gendis.2014.07.005.

14. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):

Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns. 2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.

15. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.

16. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)

4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.

2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.

17. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230(2):230-242.

doi:10.1006/dbio.2000.0106.

18. Somi S, Klein ATJ, Houweling AC, et al. Atrial and ventricular myosin heavy-chain expression in the developing chicken heart: strengths and limitations of non-radioactive in situ hybridization. J Histochem Cytochem Off J Histochem Soc. 2006;54(6):649-664. doi:10.1369/jhc.5A6846.2006.

19. Cruz-Adalia A, Jiménez-Borreguero LJ, Ramírez-Huesca M, et al. CD69 limits the severity of cardiomyopathy after autoimmune myocarditis. Circulation. 2010;122(14):1396-1404.

doi:10.1161/CIRCULATIONAHA.110.952820.

20. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. doi:10.1093/nar/

gkp045.

52

21. Hong K-H, Lee YJ, Lee E, et al. Genetic ablation of the BMPR2 gene in pulmonary endothelium is sufficient to predispose to pulmonary arterial hypertension. Circulation. 2008;118(7):722-730.

doi:10.1161/CIRCULATIONAHA.107.736801.

22. Thibault HB, Kurtz B, Raher MJ, et al. Noninvasive assessment of murine pulmonary arterial pressure: validation and application to models of pulmonary hypertension. Circ Cardiovasc Imaging. 2010;3(2):157-163. doi:10.1161/CIRCIMAGING.109.887109.

23. Weyman AE, Dillon JC, Feigenbaum H, Chang S. Echocardiographic Patterns of Pulmonic Valve Motion with Pulmonary Hypertension. Circulation. 1974;50(5):905-910. doi:10.1161/01.

CIR.50.5.905.

2

24. Morikawa M, Koinuma D, Tsutsumi S, et al. ChIP-seq reveals cell type-specific binding patterns of BMP-specific Smads and a novel binding motif. Nucleic Acids Res. 2011;39(20):8712-8727.

doi:10.1093/nar/gkr572.

25. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.

doi:10.1002/bdrc.21085.

26. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134- 33140. doi:10.1074/jbc.M111.274100.

27. Xu J, Zhu D, Sonoda S, et al. Over-expression of BMP4 inhibits experimental choroidal neovascularization by modulating VEGF and MMP-9. Angiogenesis. 2012;15(2):213-227.

doi:10.1007/s10456-012-9254-4.

28. Moreno-Miralles I, Ren R, Moser M, Hartnett ME, Patterson C. Bone morphogenetic protein endothelial cell precursor-derived regulator regulates retinal angiogenesis in vivo in a mouse model of oxygen-induced retinopathy. Arterioscler Thromb Vasc Biol. 2011;31(10):2216-2222.

doi:10.1161/ATVBAHA.111.230235.

29. Helbing T, Rothweiler R, Ketterer E, et al. BMP activity controlled by BMPER regulates the proinflammatory phenotype of endothelium. Blood. 2011;118(18):5040-5049. doi:10.1182/

blood-2011-03-339762.

30. Jain RK. Molecular regulation of vessel maturation. Nat Med. 2003;9(6):685-693. doi:10.1038/

nm0603-685.

31. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.

32. Hall SM, Gorenflo M, Reader J, Lawson D, Haworth SG. Neonatal pulmonary hypertension prevents reorganisation of the pulmonary arterial smooth muscle cytoskeleton after birth. J Anat. 2000;196(Pt 3):391-403. doi:10.1046/j.1469-7580.2000.19630391.x.

33. Xue Y, Gao X, Lindsell CE, et al. Embryonic Lethality and Vascular Defects in Mice Lacking the Notch Ligand Jagged1. Hum Mol Genet. 1999;8(5):723-730. doi:10.1093/hmg/8.5.723.

34. Chen Y, Hao Q, Kim H, et al. Soluble endoglin modulates aberrant cerebral vascular remodeling. Ann Neurol. 2009;66(1):19-27. doi:10.1002/ana.21710.

35. Lebrin F, Goumans M-J, Jonker L, et al. Endoglin promotes endothelial cell proliferation and TGF- beta/ALK1 signal transduction. EMBO J. 2004;23(20):4018-4028. doi:10.1038/sj.emboj.7600386.

36. Pece-Barbara N, Vera S, Kathirkamathamby K, et al. Endoglin null endothelial cells proliferate faster and are more responsive to transforming growth factor beta1 with higher affinity receptors and an activated Alk1 pathway. J Biol Chem. 2005;280(30):27800-27808. doi:10.1074/

jbc.M503471200.

37. Mahmoud M, Allinson KR, Zhai Z, et al. Pathogenesis of arteriovenous malformations in the absence of endoglin. Circ Res. 2010;106(8):1425-1433. doi:10.1161/CIRCRESAHA.109.211037.

38. Arthur HM, Ure J, Smith AJ, et al. Endoglin, an ancillary TGFbeta receptor, is required for extraembryonic angiogenesis and plays a key role in heart development. Dev Biol. 2000;217(1):42- 53. doi:10.1006/dbio.1999.9534.

39. Li DY, Sorensen LK, Brooke BS, et al. Defective angiogenesis in mice lacking endoglin. Science.

1999;284(5419):1534-1537.

40. Bourdeau A, Dumont DJ, Letarte M. A murine model of hereditary hemorrhagic telangiectasia. J Clin Invest. 1999;104(10):1343-1351. doi:10.1172/JCI8088.

41. Le TT, Conley KW, Brown NL. Jagged 1 is necessary for normal mouse lens formation. Dev Biol.

53

CHAPTER 3

1

The effect of cigarette smoking on pulmonary Follistatin-like 1 expression: potential implication in chronic obstructive pulmonary disease

Navessa P. Tania, Reinoud Gosens, Wim Timens, Maurice J.B. van den Hoff, Martina Schmidt, Harm Maarsingh

55

The effect of cigarette smoking on pulmonary Follistatin-like 1 expression:

potential implication in chronic obstructive pulmonary disease

Navessa P. Tania 1* , Reinoud Gosens 1 , Wim Timens 2 , Maurice J.B. van den Hoff 3 , Martina Schmidt 1 , Harm Maarsingh 4

1 University of Groningen, Department of Molecular Pharmacology, Groningen Research Institute for Asthma and COPD, Groningen, The Netherlands. 2 University of Groningen, University Medical Center Groningen, Department of Pathology and Medical Biology, Groningen Research Institute for Asthma and COPD, Groningen, The Netherlands. 3 Academic Medical Center, Department of Anatomy, Embryology and Physiology, Amsterdam, The Netherlands. 4 Palm Beach Atlantic University, Lloyd L. Gregory School of Pharmacy, Department of Pharmaceutical Sciences, West Palm Beach, Florida, USA.

56

Abstract

Bone morphogenetic protein (BMP) signaling is pivotal for embryonic lung morphogenesis and epithelial repair in adult. The endogenous BMP antagonist Follistatin-like 1 (Fstl1) is increased in several inflammatory diseases, but has not been explored in chronic obstructive pulmonary disease (COPD) yet. Here, we report that Fstl1 protein expression is increased in airway epithelium of COPD ex- smokers compared to non-COPD ex-smokers. Accordingly, phosphorylated Smad1/5, indicative of active BMP signaling, was found reduced in total lung homogenates. Taken together, our study provides a novel link between Fstl1 and COPD, provoking further studies to unravel the Fstl1 functions in the lung and its implication in COPD.

57

3

Letter to the editor

Chronic obstructive pulmonary disease (COPD) is characterized by persistent inflammation of the airways and lung parenchyma primarily triggered by tobacco smoke exposure. 1 Bone morphogenetic proteins (BMPs) belong to the TGF-β superfamily that regulate embryonic lung morphogenesis and adult airway epithelial homeostasis. 2 The endogenous BMP antagonist Follistatin-like 1 (Fstl1) is an extracellular glycoprotein shown to be crucial during embryonic lung development 3,4 and contributes to inflammatory processes, such as in arthritis. 5 Despite its’ importance in lung development, little is known about the role of Fstl1 in the adult lung in health and disease. Here, we determined the expression of Fstl1 in the lung of COPD patients compared to individuals with normal lung function. Lung tissue and homogenates were obtained from twenty-two ex-smoker COPD patients of GOLD stage II (n=11) and IV (n=11) and from twenty-nine non-COPD control individuals without airway obstruction and with different smoking status (8 never-smokers, 10 current smokers and 11 ex-smokers) for immunostaining and western blot analysis. COPD stages classification referred to the Global Initiative for Chronic Obstructive Lung Disease (GOLD) criteria. 6 Patient characteristics are

Disease (GOLD) criteria. 6 Patient characteristics are 58 3 Figure 1. The expression of Fstl1 is

58

(GOLD) criteria. 6 Patient characteristics are 58 3 Figure 1. The expression of Fstl1 is increased

3

Figure 1. The expression of Fstl1 is increased in COPD lung. (A) Representative immunoblot of Fstl1 and quantification of Fstl1 protein expression in lung homogenates of COPD stage II and IV patients compared to non-COPD controls differentiated by smoking status: NS, never- smoker; CS, current-smoker; ES, ex-smoker. (B) Representative image of Fstl1 staining in lung tissue. Red arrowhead points to airway epithelium, green arrowhead points to endothelium, blue arrowhead points to vascular smooth muscle bundles, and purple arrowhead points to inflammatory cells. AW, airway; V, blood vessel. Scale bar represents 200 µm. Magnification of 100x. (C) Representative images of Fstl1 staining in the airway epithelium within the different groups. Semi quantitative analysis of Fstl1 immunostaining in airway epithelium (D), endothelium of large muscular arteries (E), vascular smooth muscle bundles (F), and inflammatory cells (G). Each dot represents an individual patient. The horizontal line represents median of each group (n=5-7 for NS; n=8-10 for CS; n=8-12 for ES; n=11 for ES COPD II n=11; n=10-11 for ES COPD IV). The number of analyzed compartments in each group varied due to some patients did not have the cell type of interest in their tissue section. Scoring of the staining intensity (absent, low, medium, high) was performed by two persons independently in a blinded manner. Statistical significance of differences was determined with either a one-way ANOVA followed by a post hoc Tukey multiple comparisons test or a non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test for Gaussian and non-Gaussian distributed data, respectively. The Bonferroni correction was used to correct for multiple testing. *p<0.05; **p<0.01; ***p<0.005 compared to indicated groups.

provided in supplementary Table S1 and S2. We observed that the expression of Fstl1 protein was significantly increased

in total lung homogenates of non-COPD ex-smokers alone (p=0.033) or combined

with non-COPD current smokers (p=0.016) compared to non-COPD never-smokers (Figure 1A), suggesting that smoking induces a long-lasting increase of pulmonary Fstl1 protein. In support, in comparison with the non-COPD never smoker group,

the total expression of Fstl1 protein in lung homogenates was significantly increased

in

patients with COPD stage II alone (p=0.004) or in combination with COPD stage

IV

(p=0.007; Figure 1A), all of which are ex-smokers. Notably, Fstl1 was originally

59

identified as a TGF-β target gene and exerts immunomodulatory functions. 7,8 The pulmonary expression of another BMP antagonist Noggin was also studied but was found unaffected by cigarette smoking or disease state (non-COPD controls vs COPD patients; supplementary figure 1). This indicates that the increase in BMP antagonists was selective for Fstl1. To dissect which cell types express Fstl1 in the lung, immunostaining for Fstl1 was performed. Fstl1 protein was expressed in different cell types in the lung, including airway epithelium, endothelium, vascular smooth muscle cells, and inflammatory cells (Figure 1B). The intensity of Fstl1 staining was markedly stronger in airway epithelium of COPD patients compared to non-COPD controls (Figure 1C). Semi-quantitative analysis of Fstl1 staining demonstrated that Fstl1 was significantly increased in the airway epithelium (p=0.002; Figure 1D), endothelium (p=0.002; Figure 1E), vascular smooth muscle (p=0.003; Figure 1F) and inflammatory cells (p=0.034; Figure 1G) of the combined COPD stage II and IV patients compared to the combined non-COPD controls. However, we did not observe an ever-smoking effect for any of the studied compartments in the non-COPD groups. Interestingly, the expression of Fstl1 protein was significantly increased in airway epithelium of COPD stage II and IV patients (all ex-smokers) compared to non-COPD ex-smokers (p=0.004; Figure 1D). This might indicate that increased Fstl1 in airway epithelium is associated with COPD and is not only associated with smoking. Given that Fstl1 is a BMP antagonist, we examined whether increased Fstl1 was associated with reduced BMP/Smad signaling in the lung by investigating the expression of phosphorylated, BMP-specific, Smad1/5 in total lung homogenates. Indeed, we observed that, when compared to non-COPD never smokers, phosphorylated Smad1/5 was significantly reduced in the lung homogenates of non-COPD of current smokers alone (p=0.01), ex-smokers alone (p=0.006) and the combination of both (p=0.001; Figure 2A). Similarly, the expression of phosphorylated Smad1/5 was also decreased in both COPD stage II and IV ex-smoker groups individually (p=0.002; p=0.003) and combined (p=0.00018; Figure 2A) compared to non-COPD never smokers. These findings show that there is a clear contribution of ever smoking to reduced phosphorylated Smad1/5. To exclude that the reduction in phosphorylated Smad1/5 is caused by a reduced pulmonary expression of BMP4 rather than the increased expression of Fstl1, BMP4 protein levels were examined in the total lung homogenates. We did not observe any significant changes in BMP4 protein among the different groups (Figure 2B). Taken together, our data suggest increase expression of Fstl1 and a subsequent decreased phosphorylated Smad1/5 levels in the lung are associated with ever smoking effect. Previous studies demonstrated that in vitro and in vivo overexpression of Fstl1 triggers increased production of inflammatory cytokines and chemokines. 7,8 Furthermore, a growing body of evidence demonstrates that Fstl1 contributes to fibrotic processes in pulmonary fibrosis and in the airway wall of severe asthma. 9,10 Whether increased expression of Fstl1 is coupled to such functional roles in COPD requires further investigation.

60

functional roles in COPD requires further investigation. 60 3 Figure 2. BMP-specific Smad1/5 activation is reduced

3

Figure 2. BMP-specific Smad1/5 activation is reduced in the lung homogenates of COPD patients. Representative immunoblots and quantitative protein expression analysis of (A) phosphorylated Smad1/5 and (B) BMP4 in lung homogenates of COPD stage II and IV patients compared to non-COPD controls differentiated by smoking status. Each dot represents an individual patient. Horizontal line represents median of each group (n=5 for NS; n=8 for CS; n=8 for ES; n=11 for ES COPD II; n=10 for ES COPD IV). Data are expressed as ratios of proteins of interest over the reference protein. Unphosphorylted Smad1 was used as a reference protein for pSmad1/5, and GAPDH for BMP4. *p<0.05; **p<0.01; ***p<0.005 compared to indicated groups.

In conclusion, cigarette smoking increases the expression of Fstl1 protein and downregulates phosphorylated Smad1/5 in the lung which persists even after smoking cessation. Airway epithelium of both COPD stage II and IV patients express Fstl1 to a higher degree compared to non-COPD ex-smokers. Increased expression of the BMP-antagonist Fstl1 was accompanied with decreased phosphorylation of BMP-specific Smad1/5 in the lung, suggesting inhibition of the BMP/Smad signaling pathway by Fstl1. These findings provoke future investigations addressing the precise roles of Fstl1 in airway epithelial driven inflammation, epithelial remodeling, and epithelial repair in non-COPD smokers and its potential contribution to the development and pathophysiology of COPD.

61

Supplementary figure 1. The expression of the other endogenous BMP antagonist Noggin was unaltered in

Supplementary figure 1. The expression of the other endogenous BMP antagonist Noggin was unaltered in lung homogenates of patients with COPD compared to non-COPD. (A) A representative immunoblot and (B) quantitative protein expression analysis of Noggin in the lung homogenates of COPD compared to non-COPD controls with different smoking status. Each dot represents an individual patient. Horizontal line represents median of each group (NS n=5; CS n=8; ES n=8; ES COPD II n=11; ES COPD IV n=10). Data are expressed as ratios of Noggin over the GAPDH reference protein. The statistical significance of differences was determined either with a one-way ANOVA followed by a post hoc Tukey multiple comparisons test or a non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test for Gaussian and non-Gaussian distributed data, respectively. The Bonferroni correction was used to correct for multiple testing.

Table S1. Characteristics of COPD patients and non-COPD controls used for immunostaining.

Characteristics

Non-COPD

Non-COPD

Non-COPD

COPD II

COPD IV*

Smoking status

NS

CS

ES

ES

ES

Number of subjects

8

10

11

11

11

Age (years)

55.1

55.6

62.11

70.9

59.4

(42.0-70.0)

(45.0-68.0)

(46.0-74.0)

(58.0-80.0)

(50.0-73.0)

Male/female

5/3

2/8

5/6

8/3

5/6

Pack years

 

42.33

25.75

26.3

28.1

0

(14.0-75.0)

(1.5-65.0)

(0.0 -45.0)

(0.0-48.8)

FEV1% predicted

102.03

97.07

96.9

61.4

22.0

(78.5-130.0)

(74.0-107.0)

(63.7 -121.0)

(41.7 -76.0)

(13.0-36.0)

FEV1/FVC%

76.2

79.35

76.3

61.6

37.7

(73.0-83.0)

(62.39-92.0)

(64.0-86.2)

(45.7-80.0)

(25.0-66.0)

* FEV1% predicted and FEV1/FVC% were measured post bronchodilators. NS, never-smoker; CS, current smoker; ES, ex-smoker.

62

Table S2. Characteristics of COPD patients and non-COPD controls used for immunoblot.

Characteristics

Non-COPD

Non-COPD

Non-COPD

COPD II

COPD IV*

Smoking status

5

8

9

11

11

Number of subjects

53.3

56.25

59.7

70.9

59.4

(45.0-65.0)

(45.0-68.0)

(46.0-68.0)

(58.0-80.0)

(50.0-73.0)

Age (years)

4/1

2/6

3/6

8/3

5/6

Male/female

 

43.29

22.3

26.3

28.1

0

(14.0-75.0)

(1.5-65.0)

(0.0 -45.0)

(0.0-48.8)

Pack years

101.8

95.52

100.2

61.4

22.0

(78.5-130.0)

(74.0-107.0)

(63.7-121.0)

(41.7 -76.0)

(13.0-36.0)

FEV1% predicted

77.52

78.14

76.3

61.6

37.7

(73.0-83.0)

(62.4-92.0)

(64.0-85.3)

(45.7-80.0)

(25.0-66.0)

FEV1/FVC%

76.2

79.35

76.3

61.6

37.7

(73.0-83.0)

(62.39-92.0)

(64.0-86.2)

(45.7-80.0)

(25.0-66.0)

3

* FEV1% predicted and FEV1/FVC% were measured post bronchodilators.

63

Materials and Methods

Fstl1 immunostaining Human lung tissue sections were stained with primary rabbit anti-human Fstl1 antibody (1:200; ABS616, Merck Milipore, Billerica, MA, USA) overnight at 4°C. The following day, tissue sections were incubated with HRP-conjugated goat anti-rabbit antibody for 2 h (1:100, 711-035-152, Jackson Immunoresearch, West Grove, PA, USA).

Immunoblot Equal amounts of lung homogenates were loaded to SDS PAGE electrophoresis and transferred to PVDF membranes. After incubation with 1x ROTI block (Carl Roth; Karlsruhe, Germany), membranes were incubated with antibody of interest: rabbit anti-Fstl1 (1:2000; ABS616, Merck Millipore; Billerica, MA, USA), mouse anti-BMP4 (1:500; MAB757-100; R&D system, Oxford, UK), rabbit anti-pSmad1/5 (1:750; 9516; Cell Signaling; Danvers, MA, USA), rabbit anti-Smad1 (1:1000; 9743; Cell Signaling, Danvers, MA, USA), mouse anti-GAPDH (1:2000; sc-47725; Santa Cruz Biotechnology, Heidelberg, Germany), goat anti-Noggin (1:1000; AF719; R&D system, Oxford, UK). The following day, horseradish peroxidase (HRP) conjugated antibodies were added, either donkey anti-rabbit IgG (1:4,000; 711-035-152), anti-goat IgG (1:4,000; 705- 035-003), or anti-mouse IgG (1:4000; 715-035-150 Jackson Immunoresearch, West Grove, PA, USA). Protein band intensities were quantified using Image Studio Lite version 5.0.

Statistical analysis Data are presented as individual data points with medians per patient-group unless stated otherwise. To determine the normality of data distribution, a Shapiro- Wilk normality test was done prior to further statistical analysis. The statistical significance of differences of normally distributed data was performed using a one-way ANOVA followed by a post hoc Tukey multiple comparisons test. For non- Gaussian distributed data, the statistical significance of differences was determined using a non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test. The Bonferroni correction was used to correct for multiple testing. Differences were considered to be statistically significant at p<0.05.

64

Footnotes Contributors: NPT designed and performed the experiments, interpreted the data and drafted the first manuscript version. RG, HM, MS, WT designed the experiments, interpreted the data and contributed to the writing of the manuscript. All authors approved of the final version of the manuscript.

Funding: This study was financially supported by a grant from the Netherlands Lung Foundation (grant 3.2.12.083).

Competing interest: none declared.

Patient consent: not applicable, see below

3

Ethics approval: not applicable; Research was conducted according to the Research Code of the University Medical Center Groningen (http://www.umcg.nl/EN/ Research/Researchers/General/ResearchCode/Paginas/default.aspx) and national ethical, legal and professional guidelines (“Code of conduct; Dutch federation of biomedical scientific societies”; https://www.federa.org/).

Acknowledgement The authors would like to thank Sophie Bos and Marjan Luinge for technical assistance.

65

References

1. Garvey C. Recent updates in chronic obstructive pulmonary disease. Postgrad Med. 2016;128(2):231-238. doi:10.1080/00325481.2016.1118352.

2. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One. 2012;7(8):e41460. doi:10.1371/journal.pone.0041460.

3. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.

4. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.

5. Chaly Y, Hostager B, Smith S, Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases. Immunol Res. 2014;59(1-3):266-272. doi:10.1007/s12026-014-8526-z.

6. Vestbo J, Hurd SS, Agustí AG, et al. Global Strategy for the Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2013;187(4):347-365.

doi:10.1164/rccm.201204-0596PP.

7. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.

8. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082- 1088. doi:10.1002/art.33422.

9. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.

10. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.

66

67

3

CHAPTER 4

Activin-A: active in inflammation in COPD

Navessa P. Tania, Martina Schmidt, Reinoud Gosens

Activin-A: active in inflammation in COPD

Navessa P. Tania, Martina Schmidt, Reinoud Gosens

Department of Molecular Pharmacology and GRIAC Research Institute, University of Groningen, Groningen, The Netherlands.

70

Chronic obstructive pulmonary disease (COPD) is characterised by irreversible airflow limitation in which chronic inflammation of the airways plays a major role. The persistent inflammation is triggered by inhaled toxic substances, such as cigarette smoke. Accumulating evidence indicates the involvement of developmental pathways in chronic lung diseases, including COPD. 1 Signalling pathways such as transforming growth factor (TGF)-β, WNT and Sonic hedgehog have all been linked to COPD, either because of genetic associations or because of differential gene and protein expression in lung tissue. 24 Although these pathways were originally primarily known for their role in development, it is now increasingly clear that these pathways also play crucial regulatory roles in tissue inflammation and repair, providing a plausible explanation for the involvement of these pathways in COPD. 3 Activin-A, a member of the TGF-β superfamily, is an important regulator of embryonic development, haematopoiesis and a broad range of tightly regulated biological processes, including immunity and tissue repair. 5 Dysregulation of activin-A may contribute to the development of disease. Recently, increased expression of activin-A has been demonstrated in pulmonary hypertension, 6 acute lung injury 7 and asthma. 8 Oxidative stress, Toll-like receptor ligands and inflammatory cytokines stimulate the expression and production of activin-A, which in turn regulates inflammatory cytokine release, explaining its role in inflammatory responses. 7 Accordingly, the endogenous activin-A inhibitor follistatin has attracted great interest in view of its ability to counteract activin-A activity. Due to its involvement in inflammatory responses, it is rational to connect activin-A to the pathogenesis of inflammatory diseases. An imbalance between activin-A and follistatin potentially leads to excess activin-A-mediated inflammatory responses. However, the roles of activin-A and follistatin have not yet been established in COPD. In this issue, Verhamme et al. 9 demonstrate for the first time that activin-A is an important regulator of cigarette smoke-induced inflammation in COPD. They found that activin-A is elevated and activated in the airway epithelium, airway smooth muscle and alveolar macrophages of COPD patients. These findings were further validated in vivo, demons