CHARACTERIZATION AND FUNCTIONAL

ANALYSIS OF MUTANT p53 SECRETOME IN

HUMAN CANCER

Reshma Shakya

Bachelor of Science in Biotechnology (Hons)

Thesis submitted for the degree of

Doctor of Philosophy

Centre for Personalised Cancer Medicine

Faculty of Health Sciences,
School of Medicine,
The University of Adelaide, South Australia

June 2016
 Dedication

This thesis is dedicated to my loving mom and dad

Usha and Purushottam man Shakya,

my sisters Punam, Kalyani and Merina Shakya

and my partner Aabhash Shrestha

Table of Contents

ABSTRACT ...........................................................................................................................5
DECLARATION ...................................................................................................................8
AWARDS & SCHOLARSHIPS ............................................................................................9
PUBLICATIONS .................................................................................................................10
ACKNOWLEDGEMENTS .................................................................................................12
Chapter 1: Introduction ....................................................................................................16
Preface ........................................................................................................................16
Tumour suppressor protein: p53.................................................................................17
Mutations of p53 ........................................................................................................18
Mutant p53 gain-of-function ................................................................................20
The landscape of p53 mutations in human cancer ...............................................22
Transcriptional activity of mutant p53.................................................................24
Mutant p53 and the p53 family members, p63 and p73 ......................................25
Biological effects /activities of mutant p53 in cancer..........................................28
Targeting mutant p53 in human cancer ......................................................................30
Restoring wild-type p53 activity of mutant p53 ..................................................31
Mutant p53 elimination or degradation ...............................................................38
Targeting mutant p53 induced downstream oncogenic effects ...........................41
Mutant p53 and the cancer cell secretome ...........................................................51
Research Gaps and Objectives of the thesis ...............................................................52
Thesis Outline.............................................................................................................54
Chapter 2: General Materials and Methods .....................................................................57
Cell lines and inducible expression system ................................................................57
iTRAQ analysis by 2D nanoLC ESI MS/MS .............................................................58
Sample collection .................................................................................................58
Instruments used ..................................................................................................58
Sample preparation and digestion ........................................................................59
Strong cation exchange HPLC/ Chromatographic fractionation of peptides ......59
NanoLC-ESI-MS/MS analysis ............................................................................60
 Data processing and criteria .................................................................................60
Data analysis ........................................................................................................61
Bioinformatics analysis ..............................................................................................61
Real-time PCR analysis ..............................................................................................62
Western blot analysis ..................................................................................................63
Immunofluorescence ..................................................................................................63
Conditioned medium collection .................................................................................64
Generation of knockdown cell lines ...........................................................................64
Migration assay ..........................................................................................................66
Inverted invasion assay.............................................................................................66
Chicken chorio-allantoic membrane (CAM) invasion assay....................................67
CAM immunohistochemistry (IHC) ........................................................................67
Lung tissue microarrays (TMAs) .............................................................................68
Immunohistochemistry .............................................................................................69
Image capture and quantification of A1AT and p53 immunostaining .....................70
In silico analysis of p53 and p63 response elements ................................................70
Chromatin Immunoprecipitation assays (ChIP) .......................................................71
Soft Agar Colony Formation Assay .........................................................................72
Cell proliferation and cell cycle analysis .................................................................72
Chapter 3: Characterization of mutant p53 secretome .....................................................78
Preface ........................................................................................................................78
3.2 Introduction ................................................................................................................79
3.3 Results ........................................................................................................................83
3.3.1 Mutant p53 drives the release of pro-invasive factors .........................................83
3.3.2 iTRAQ based quantitative analysis of mutant p53 secretome .............................85
3.3.3 Bioinformatics analysis and profiling of the mutant p53 induced secreted
proteins..........................................................................................................................92
3.3.4 Validation of Mutant p53 induced secreted proteins in experimental and array
datasets ........................................................................................................................102
3.3.5 Identification of potential secreted target of mutant p53 ...................................108
3.4 Discussion ................................................................................................................111
Chapter 4: Alpha-1 Antitrypsin (A1AT) functions as a novel secreted mediator of
mutant p53 gain-of-function ..............................................................................................119
Preface ......................................................................................................................119
Introduction ..............................................................................................................120
Results ......................................................................................................................124
Sustained expression of mutant p53 is required for invasion of lung cancer cells
....................................................................................................................................124
A1AT induces cell invasion and migration .......................................................126
A1AT specifically mediates mutant p53 driven cell migration and invasion....128
A1AT drives lung cancer cell invasion in an in vivo chick chorio-allantoic
membrane (CAM) model ............................................................................................130
A1AT alters epithelial-mesenchymal transition (EMT) marker expression ......132
Secreted A1AT enhances mutant p53 induced cell migration and invasion .....134
Blockade of secreted A1AT using neutralizing antibody ablate mutant p53
induced cell migration and invasion ...........................................................................137
Discussion ................................................................................................................140
Chapter 5: Mutant p53 regulated Alpha-1 Antitrypsin (A1AT) is a prognostic marker of
lung adenocarcinoma .........................................................................................................145
Preface ......................................................................................................................145
Introduction ..............................................................................................................146
Results ......................................................................................................................148
Analysis of A1AT expression in lung cancer cell lines .....................................148
A1AT expression is upregulated in lung ADC tumours ....................................150
Elevated p53 expression associates with high A1AT expression in lung ADC
TMAs ..........................................................................................................................152
Elevated A1AT expression correlates with poor overall survival in human lung
ADC as well as gastric cancer patients. ......................................................................158
Discussion ................................................................................................................162
Chapter 6: Mutant p53 interacts with p63 to regulate SERPINA1 (protein: A1AT)
expression………………………………………………………………………………...165
Preface ......................................................................................................................165
Introduction ..............................................................................................................166
 Results ......................................................................................................................170
Identification of p53 response element in mutant p53 regulated SERPINA1 gene
....................................................................................................................................170
Investigation of p63 binding to specific response elements ..............................172
Investigation of p53 binding to specific response elements ..............................174
Mutant p53 is co-recruited with p63 to the DNA of SERPINA1 gene ..............176
Activated wild-type p53 regulates SERPINA1 expression ................................178
SERPINA1 promotes tumourigenesis in lung cancer cell lines .........................182
Discussion ................................................................................................................184
Chapter 7: Role of Alpha-1 Antitrypsin (A1AT) in breast cancer.................................188
Preface ......................................................................................................................188
Introduction ..............................................................................................................189
Results ......................................................................................................................193
Analysis of A1AT expression in breast tumours ...............................................193
A1AT is a target of mutant p53 GOF in TNBC ................................................197
A1AT induces the invasive phenotype in the p53 mutant TNBC cell line MDA-
MB-231 in vitro and in vivo........................................................................................199
A1AT alters Epithelial-Mesenchymal Transition (EMT) marker expression and
supports cell survival function ....................................................................................201
Secreted A1AT enhances the invasive ability of the TNBC cell line MDA-MB-
231 while A1AT neutralization reduces invasion.......................................................203
Discussion ................................................................................................................206
CONCLUSIONS ................................................................................................................209
APPENDIX 1 .....................................................................................................................211
APPENDIX II ....................................................................................................................216
REFERENCES...................................................................................................................218
ABSTRACT

Among several genetic alterations in human cancer, mutations in the TP53 tumour

suppressor gene represent the most common, occurring in approximately 50% of all human

cancers. The majority of these mutations in p53 are missense mutations, resulting in cancer

cells expressing stable, full-length mutated p53 proteins. Missense mutant p53’s exhibit loss

of tumour suppressive property of wild-type p53, dominant negative effects that can

inactivate any wild-type p53 protein, and gain-of-function (GOF) properties that promote

tumour progression and metastasis. Evidence suggests that cancer cells depend on the

sustained expression of mutant p53 GOF. Thus, identifying the common downstream factor

that drive mutant p53 GOF can provide an attractive approach to therapeutically target

mutant p53 expressing tumours.

This thesis presents the study of the characterization and functional analysis of mutant p53

secreted factors called “the mutant p53 secretome”. In particular, the thesis aims at

identifying the critical secreted effector of mutant p53 GOF that can serve as a potential

therapeutic target for treatment of mutant p53 expressing tumours. Furthermore, the thesis

investigates the association of the identified factor within the secretome with clinical

parameters such as patient’s survival. This thesis makes several original contributions to the

field of cancer research, which are briefed below.

Firstly, the mutant p53 induced secretome was characterized using quantitative proteomics

of conditioned medium from mutant p53 expressing inducible H1299 human lung cancer
5
cells. The majority of the identified secreted proteins were the transcriptional targets

influenced by mutant p53. Alpha-1 antitrypsin (A1AT) was selected for further

investigation, as it was the protein showing the highest expression in the mutant p53

secretome.

The role of A1AT in driving the oncogenic activity of mutant p53 in human lung cancer cells

was explored. A1AT was shown to drive mutant p53 induced invasion in lung cancer cell

lines. Ablation of A1AT using antibodies and gene knockdown approaches inhibited the

mutant p53 driven invasion, providing a rational to investigate the development of antibody-

based cancer therapies that target A1AT.

The clinical association of A1AT was further investigated in tissue microarray (TMA)

samples of lung adenocarcinoma (ADC) patients. Mutant p53 expression was shown to

correlate with A1AT, which validates in vivo that A1AT is a bonafide target of mutant p53.

Furthermore, elevated expression of A1AT was demonstrated to correlate with increased

local invasion and poor prognosis of lung ADC patients.

Mutant p53 is reported to function as an aberrant transcription factor that can interact with

other transcription factors to reprogram the cellular transcriptome of cancer cells. The

mechanism of regulation of A1AT by mutant p53 was confirmed to involve p63.

6
The role of A1AT in driving the mutant p53 induced invasive behavior of breast cancer cells

was also explored, and a relationship of A1AT with p53 status and with different subtypes

of breast cancer was established. In p53 mutant basal-like subtypes, A1AT expression was

shown to drive invasion and treatment with anti-A1AT antibodies inhibited invasion. This

suggests that the A1AT-targeted are potential therapies in various cancer types and its

regulation in breast cancer may also extend beyond p53.

Collectively, these studies provide new insights into the invasive behavior of mutant p53

that are manifested through aberrant secretion of extracellular proteins. The identification of

A1AT as a critical and indispensable effector of mutant p53 gain-of-function offers a new

therapeutic options for treatment of p53 mutant tumours. The findings in this thesis involve

significant elements of novelty describing how mutant p53 influences the cellular secretome.

7
DECLARATION

I, Reshma Shakya certify that this work contains no material which has been accepted for

the award of any other degree or diploma in my name, in any university or other tertiary

institution and, to the best of my knowledge and belief, contains no material previously

published or written by another person, except where due reference has been made in the

text. In addition, I certify no part of his thesis will, in the future, be used in a submission in

my name, for any other degree or diploma in any university or other tertiary institution

without prior approval of the University of Adelaide and where applicable, any partner

institution responsible for the joint-award of this degree.

I give consent to this copy of my thesis, when deposited in the University Library, being

made available for loan and photocopying, subject to the provisions of the Copyright Act

1968. The author acknowledges that copyright of published works contained within this

thesis resides with the copyright holder (s) of those works.

I also give permission for the digital version of my thesis to be made available on the web

via the University‘s digital research repository, the Library Search and also through web

search engines, unless permission has been granted by the University to restrict access for a

period of time.

Signed: Date:

8
AWARDS & SCHOLARSHIPS

SAHMRI Beat Cancer Travel Grant 2015

University of Adelaide, Discipline of Medicine Travel Grant 2015

Walter & Dorothy Duncan (for Research & Travel) 2015

Best Poster Presentation (School of Medicine Award) 2015

University of Adelaide, Postgraduate Research Conference

Royal Adelaide Hospital Research Foundation 2013

Dawes Top-Up Scholarship

Australian Post Graduate Scholarship 2012

9
PUBLICATIONS

Shakya R, Tarulli GA, Lokman NA, Ricciardelli C, Pishas KI, Selinger CI, Kohonen-Corish

MRJ, Cooper WA, Turner A, Neilsen PM. and Callen DF. (2016) Mutant p53 induces Alpha-

1antitrypsin (A1AT) secretion to promote invasion in lung cancer. Oncogene, Submitted

(ONC-2016-00631)

Shakya R, Tarulli GA, Neilsen PM. and Callen DF (2016) Characterization of mutant p53

secretome. Text in manuscript

Tarulli GA, Laven-Law G, Shakya R, Tilley WD, Hickey TE. (2015) Hormone-sensing

mammary epithlial progenitors: Emerging identify and hormonal regulation. J Mammary

Gland Biol Neoplasia. 20, 75-91.

Some relevant component of the work has been presented in following national and

international conferences and seminars:

Shakya R, Tarulli GA, Lokman NA, Ricciardelli C, Pishas KI, Selinger CI, Kohonen-Corish

MRJ, Cooper WA, Turner A, Neilsen PM. and Callen DF, “Secretomic analysis identifies

Alpha-1 Antitrypsin (A1AT) as a critical secreted mediator of mutant p53 gain of function”.

Oral presentation at QIMR Berghofer Medical Research Institute, March, 2016, Brisbane,

Australia.

10
Shakya R, Tarulli GA, Lokman NA, Ricciardelli C, Pishas KI, Selinger CI, Kohonen-Corish

MRJ, Cooper WA, Turner A, Neilsen PM. and Callen DF, “Alpha-1 antitrypsin is a

prognostic biomarker in lung adenocarcinoma that mediates mutant p53 driven oncogenic

function”, Developmental Biology and Cancer Conference, AACR, 2015, Boston, United

States.

Shakya, R, Neilsen, MP, and Callen, FD, “Alpha-1 antitrypsin is a prognostic biomarker in

lung adenocarcinoma that mediates mutant p53 driven oncogenic function” 2015 FHS

Postgraduate Research Conference, Adelaide, Australia.

Shakya, R, Neilsen, MP, Callen, FD, “SerpinA1 is an essential mediator of mutant p53

driven metastasis”, 6th International mutant p53 Workshop, 2013, Toronto, Canada.

Shakya, R, Neilsen, MP, and Callen, FD, “SerpinA1 is an essential mediator of mutant p53

driven metastasis”, CPCM Symposium 2013, Adelaide, Australia.

Shakya, R, Neilsen, MP, and Callen, FD “SerpinA1 is an essential mediator of mutant p53

driven metastasis”, 2013 FHS Postgraduate Research Conference, 2013, Adelaide, Australia.

Shakya, R, Neilsen, MP, and Callen, FD, “Novel Avenues to inhibit mutant p53 driven

invasion and metastasis”, The first Australian p53 Workshop, 2012, Melbourne, Australia.

11
ACKNOWLEDGEMENTS

First and foremost, I would like convey my deepest gratitude to my supervisors Prof. David

Frederick Callen, Dr Paul Matthew Neilsen and Dr Gerard Tarulli for their guidance and

support throughout my candidature. My principal supervisor, Prof. David Callen advised me

with his open view and broad knowledge in the field of genetics and cancer biology. His

thoughtful comments were always constructive and fruitful to improve the quality of my

research. I am also grateful to him for providing me opportunity to conduct PhD project in

his laboratory and for providing invaluable support and guidance to help me grow as a

researcher. In addition, my external supervisor Dr Paul Matthew Neilsen provided me with

his solid knowledge in the field of mutant p53 in cancer biology. He served as my principal

supervisor for one and half year during the candidature. He has significantly helped me to

embark in the field of mutant p53 and find my direction in exploring the global influence of

mutant p53 secretome in cancer. Further, I would like to express my gratitude to my co-

supervisor, Dr Gerard Tarulli for providing support, encouragement and advice, when it

counted most. Dr Tarulli’s expertise in the field of confocal microscopy and digital image

analysis was of great importance towards my PhD research. He always encouraged me to

conduct high quality research and publication. Besides his enthusiastic supervision, he has

helped me to develop professionally and build my confidence in research.

Another key person whom I am strongly indebted to is my good friend and brilliant

researcher, Dr Kathleen Irene Pishas who provided continuous support and encouragement

throughout the course of my PhD. In addition, my sincere gratitude goes to Dr. Noor Alia

12
Lokman, a real CAM assay expert, for her significant help towards using CAM assay models

for my study. Noor was also of big help after the CAM assay was completed and

tremendously helped me to process and analyze the results from assay. I am also indebted to

Dr Carmela Ricciardeli, an expert in biostatistics for helping me to use SPSS program for

the analysis of clinical data. I would also like to thank our collaborators in Sydney, Prof

Wendy Cooper, Prof Maija RJ Kohonen Corish, and Christina I selinger for providing us

with TMAs of lung ADC patient’s tumors samples which has formed a major part of my

study. I would like to extend my gratefulness to all the patients who selflessly donated their

tissues for research purpose.

I am indebted to Prof. Wayne Tilley and his group from Dame Roma Mitchell Cancer

Research Laboratory (DRMCRL) for being kind and for providing space and reagents to

conduct immunohistochemistry in their laboratory. I would also like to thank Prof Tilley, Dr

Theresa Hickey, Dr Gerard Tarulli and Dr Luke Selth for inviting me to attend and present

my research at their weekly group meeting. I would like to thank the office and support staff

of the school of medicine, including IT officers Vanessa Burzacott, Christina Tsaousidis and

Ryan King and administrative staff, Liz westwood, for her support and assistance. I would

also like to thank Head of Discipline of Medicine, Prof. Gary Wittert and Head of School of

Medicine, Prof Alastair Burt for their support with research travels and softwares required

during my candidature. In addition, I am thankful to health and safety officer, Andrew Gyory

who provided me an-depth practical training on health and safety. As part of my role as

school’s health and safety student representative, I am thankful for the opportunity I received

13
to conduct several inspections in research laboratories including hospital based research

centres.

My jouney de PhD is really memorable for me because of my great friends and colleagues

in cancer therapeutics laboratory (CTL) and DRMCRL. My great friends, Alaknanda Adwal,

Qingging wang, Sheng Lei, Feng yu and Dr Rajdeep Das were always there for me to discuss

both scientific and non-scientific life issues together and laugh at our problems and

difficulties as PhD students. I am also thankful to Dr Andrew Turner for supporting me and

for reviewing and proofreading my papers and thesis. In addition, my sincere gratitude goes

to past lab members, Renee Schulz and Rebecca Haycox for their technical support.

Looking back at my alma mater, I am indebted to my Honor’s Postgraduate Coordinator, Dr.

Mukunda Ranjit for his great supervision and encouraging attitude towards research. Other

scholars who contributed towards my academic backgrounds are Prof Don Cooper, Dr

Praphul Shakya, Dr Pramod Aryal, Dr Manushree Hada, Dr Krishna Manandhar, Dr

Tribikram bhattarai, Mr Ramesh Rajbanshi and Mr Manoj Chettri.

I recognize that this research would not have been possible without the financial assistance

of Australian Government via a generous Australian Postgraduate Award (APA)

Scholarship. During my candidature, I was awarded several other travel grants, scholarships

and awards by several organizations. Here, I would like to deeply appreciate these

organizations support including Dawes Top-Up Award from Royal Adelaide Hospital
14
Research Foundation (2013-2016), Beat Cancer Travel Grant (2015) from Cancer Council

SA, Walter and Dorothy Research and Travel Support (2015) and School of Medicine for

Travel Award (2015) and poster prize (2015).

All these generous travel support enabled me to attend and present my research findings at

the Developmental biology and cancer conference that was organized by American

Association for Cancer Research (AACR) in Boston, United states last year. In addition to

presenting my research at conference, I received a great opportunity from Prof Rakesh K.

Jain, a director of Edwin L.Steele Laboratory from tumor biology at Harvard University to

visit his laboratory and discuss my research plans and interests. While in Steele lab, I met

Professor Dan Duda and Dr Igor Garkavtsev from Harvard University. Prof Duda kindly

introduced me to his interest on understanding the interaction of immune cells and stromal

cells in chemo and radio resistance pancreatic adenocarcinoma. It was great to learn about

most cutting edge field of cancer immunology and at the same time, discuss my own research

interest in tumour microenvironment with these renowned researchers.

Back to my home country, my endless gratitude goes to my mother and father who always

endow me with infinite support, encouragement, continuous love, well wishes and patience.

I also thank my best and kindest sisters for their love, support and inspiration. Last but not

the least, my heartfelt thanks are due to my partner, Aabhash who stood by me in all ups and

downs of my PhD and always endowed me with his endless love and support.

-Reshma Shakya

15
Chapter 1: Introduction

Preface
This chapter provides a background on mutant p53 gain of function mutations in human

cancer, discusses their biological consequences in cancer, and highlights the importance of

unraveling the molecular pathways of mutant p53 which will be essential for therapeutic

intervention. The chapter provides a brief background on the current strategies that are being

employed to target mutant p53 tumours for therapy. This chapter outlines current research

gaps and the rationale behind the current study. Furthermore, the research questions, aims

and objectives of the thesis and goals are discussed. Finally, the structure and outline of this

thesis are presented.

16
 Tumour suppressor protein: p53
The p53 protein, first discovered in 1979, was the first tumour suppressor gene to be

identified (1). It was originally identified as a transformation related protein (2) and a cellular

protein that complexes with the large T-antigen protein of the cancer causing simian virus

40 (SV40) (3). Furthermore, high levels of p53 mRNA were detected in transformed cells,

while its overexpression in normal cell lines led to their neoplastic transformation (3).

However, almost ten years after its discovery, improved DNA sequencing revealed that the

“wild-type” TP53 gene, which was believed to demonstrate oncogenic properties of p53 in

cell transformation, was in fact the consequence of a mutated p53 that possessed gain-of-

function (GOF) properties (4, 5). Now, it is well established that TP53 mutations are found

in over 50% of all human cancer types (6). Evidence from germ-line TP53 mutations in the

rare highly cancer-prone human genetic disease “Li-fraumeni Syndrome”, together with the

findings from the first p53 knock-out mouse models provides inarguable evidence for p53

as a tumour suppressor (7-10). With the subsequent convergent lines of research, wild-type

p53 is now regarded as a major “guardian of the genome” (11). In normal unstressed cells,

the p53 protein is maintained at very low levels due to its short half-life of one minute,

whereas in response to diverse stresses, for example DNA damage, hypoxia, hyper

proliferative signals, viral infection, or nutrient starvation, p53 level rise dramatically and

result in the activation and transcription of hundreds of genes involved in diverse biological

consequences, such as cell cycle arrest, senescence, apoptosis, chromosomal segregation,

DNA recombination and anti-angiogenesis (12).

17
 Mutations of p53
The tumour suppressive function of p53 can be eliminated by several mechanisms including

lesions that prevent p53 activation, mutations in the downstream mediators of p53 function

or mutation within the p53 gene itself (13). To date, over 25,000 different TP53 gene

mutations have been identified in all major types of human cancer. Collectively p53 is

mutated or lost in over 50% of all human cancers, making p53 mutation the most common

genetic lesion in human cancer (14, 15). DNA sequencing of cancer studies has revealed that

about 75% of TP53 mutations are missense point mutations that are generally associated

with high-levels of mutant p53 expression, due to its stabilization in the nucleus (Figure1.1).

The unusually high representation of missense p53 point mutations in human cancers

suggests that the presence of the resulting mutant p53 (mutp53) protein, rather than the lack

of wild-type p53 function may confer a selective advantage to the cancer cell during tumour

evolution (16).

Figure 1.1 Somatic TP53 mutation in human cancers. Unlike most tumour suppressor genes
which typically undergo bi-allelic inactivation during carcinogenesis, TP53 is frequently
(74%) inactivated by a single mono-allelic missense mutations: Data from the IARC TP53
database (http://www-p53.iarc.fr/).

18
The missense mutations are more frequently located in the DNA-binding domain that is

responsible for sequence-specific binding of p53 to regulatory regions within target genes

(17, 18), whereas few p53 mutations are found in the p53 regulatory domain. The distribution

of mutations in the DNA binding domain are also non-random with about 28% of these

mutations present in six ‘hotspot’ residues of p53, namely R175, G245, R248, R249, R273

and R282 (Figure 1.2) (19). Based on the effect of mutations on thermodynamic stability of

the protein, mutant p53s are classified into two categories: ‘DNA contact’ and

‘conformational’ mutations. The ‘DNA contact’ group includes mutation present in the

codons that directly bind DNA such as R248Q and R273H. The ‘conformational’ group

consists of mutations that cause local (such as G245S and R249S) or global (R175H and

R282W) structural distortion of the p53 protein that prevents proper folding of the core

domain of p53 and deprives its ability to bind the normal p53 DNA response elements (20).

Figure 1.2 Schematic representation of the distribution of missense mutations found in p53.

Enrichment for mutations is observed within the core DNA binding domain of p53, with

over-representation of six ‘hotspot’ sites.

19
In general, p53 mutations within a cell, have three different outcomes. First, mutant p53

abrogates the sequence specific DNA-binding activity to wild type p53 responsive elements

and thus hinders the overall p53 response against external cellular stress (21). Second,

mutant p53 isoforms can impart dominant negative effects over the co-expressed wild-type

p53 allele forming hetero-oligomers that impairs the DNA association and transactivation

(22-24). The third and arguably the most significant consequence of mutant p53 is the gain

of new oncogenic properties, “gain-of-function”, that are independent of wild-type p53.

Mutant p53 gain-of-function

A number of in vitro and in vivo studies have demonstrated that mutant p53 expression can

lead to enhanced growth of tumour cells, both in the presence or absence of wild-type p53.

Specifically, it has been demonstrated through xenograft studies that the transfection of

hotspot mutant p53 into TP53-null type or wild-type p53 cancer cell line enhances the ability

to form tumours in mice (25-27). Conversely, knockdown of endogenous mutant p53 in

cancer cell lines resulted in decreased cellular proliferation and tumour formation in mouse

models (28, 29). Using in vivo mouse models, a recent study showed that the elimination of

stabilized mutant p53 protein can regress tumours as well as extend animal survival (30).

These findings indicate that tumourigenesis is not just driven by lack of normal p53 function,

but also by the acquired GOF properties associated with mutant p53 (Figure 1.3).

20
Figure 1.3 Mutant p53 Gain of function mode of action. Schematic of the mechanisms

through which mutant p53 exerts its oncogenic function with or independently of wild-type

p53 in tumorigenesis.

21
 The landscape of p53 mutations in human cancer

TP53 mutations contributes to human cancer in various ways. First, cancer restricted somatic

mutation in TP53, is the most frequent mode of TP53 inactivation (14); secondly, germ-line

mutation which predisposes to a wide spectrum of early-onset cancers (including breast

carcinomas, brain tumours, soft tissue sarcomas, adrenal cortical carcinomas) define the Li-

Fraumeni syndrome (31); third, there are TP53 polymorphisms in coding and non-coding

regions of TP53 that can influence p53 activity and increase cancer susceptibility (32).

A compendium of TP53 mutations (18) shows up to 50% of all human cancers contain

mutations in the TP53 gene. Whereas mutations in most other tumour suppressor genes,

including RB, APC, and BRCA1, frequently involve deletions or truncations that lead to

disappearance or aberrant synthesis of the gene product, 74% of TP53 gene mutations are

missense mutations.

TP53 is mutated in almost 75% of the cancer of the upper aero-digestive tract (oral,

esophageal or bronchial cancers), and particularly in smokers the mutation is detectable in

early, pre-neoplastic lesions. TP53 mutations are less common in early neoplastic stages of

the lower digestive tract but become highly predominant during adenocarcinoma transition.

In lung cancer, somatic mutations and increased expression of TP53 are found in ~65% of

non-small cell lung cancers (NSCLCs) and this can rise up to 97% for NSCLCs for smokers,

while about 25% of breast cancer cases involve p53 mutations. Cancers with lower

22
frequencies of TP53 mutations are cervix, testicular cancers, neuro-blastoma and malignant

melanomas, where prevalence is only about 5% (Figure 1.4) (18)

Figure 1.4 Frequency of somatic TP53 mutations in different human cancers. Data from
the IARC TP53 database (18).

23
 Transcriptional activity of mutant p53

The p53 protein primarily functions as a tetrameric transcription factor that regulates a set

of target genes in tumour suppression (33), although transcriptionally independent roles have

also been described (34). Genes activated by wild-type p53 are functionally diverse and

constitute downstream effectors of multiple signaling pathways which cause various

responses such as senescence, cell survival or programmed cell death (35). The GOF p53

mutations in human cancers are vital in maintaining the oncogenic state of the cell. The broad

range of genes activated by mutant p53 is quite distinct from that of wild-type p53 and

instead contribute to the establishment of tumour phenotypes, which constitute the hallmarks

of cancer progression, such as resistance to apoptosis, pro-survival, increased invasive and

metastatic potential, and angiogenesis (36).

Since the discovery of the oncogenic potential of mutant p53, research has focused on

elucidating the mechanism of these gain of function properties (25, 26, 37). Based on the

findings so far there are two possible mechanisms (not mutually exclusive) to explain mutant

p53 GOF: (a) one that involves the regulation of gene expression by direct binding of mutant

p53 to DNA. Mutant p53 has been demonstrated to selectively bind to DNA on the

chromosome, particularly in G/C rich regions near transcription start sites of genes including

GAS1 and HTR2A, indicating that the loss of binding to canonical p53 binding sites does

not necessarily indicate a complete loss of DNA binding ability (38-40). However, to date

no consensus binding site for mutant p53 has been established in target DNA, suggesting

that specificity of mutant p53 DNA binding may be distinct to the sequence specific

24
recognition property of wild type p53 (41). (b) a second mechanism; involves indirect

regulation, or protein-protein interactions (42).

Mechanistically, such transcriptional effects of mutant p53 gain of functions are largely

mediated by either of two types of molecular interactions (43, 44). First, mutant p53 can

engage in protein-protein interactions with other transcription factors, thereby modulating

their transcriptional ability to activate or repress target genes (45-48). For example, the

mutant p53/E2F1 complex has been identified on the promoter of ID4, resulting in

upregulation of this gene involved in cell proliferation and tumourigenesis (49). Additional

transcription factors are known to interact with mutant p53, these include, Ets1, Ets2, Sp1,

CREB, VDR and NFY-A (42, 45-48, 50-53). Second, despite facilitating the transcription

machinery, mutant p53 can also physically interact with transcription factors including its

family members p63 and p73 (54, 55) and alter their transcriptional activity and their anti-

tumourigenic functions. These studies indicate that the interaction of mutant p53 with

different transcription factors is likely to be an important route to execute its GOF activity.

Mutant p53 and the p53 family members, p63 and p73

Human p53 belongs to a small protein family with two additional paralogs: p63 (56) and p73

(57). The p53, p63 and p73 proteins have a similar structure and share a high degree of

sequence homology within their DNA binding domains (58, 59). Both p63 and p73 function

as transcription factors and can transactivate a number of p53 target genes, as well as

independent groups of target genes (60). Mice heterozygous for p63 and p73 are predisposed
25
to spontaneous tumour development. However mice heterozygous for p63 or p73, together

with p53 heterozygosity show increased tumour burden and metastasis compared with p53

heterozygosity alone (61).

Although these three proteins share structural and functional similarity, p53 has evolved in

higher organisms to prevent tumour formation, while p63 and p73 have major roles in normal

developmental biology (62) together with anti-tumourigenic functions (63). Mechanistically,

mutant, but not wild-type p53 is reported to interact with p73 subsequently repressing its

transactivation functions and contributing to tumourigenesis and resistance to

chemotherapies (54, 64). Microarray analyses of six common inducible p53 mutants

(R175H, R248Q, R273H, R248W and R282W) and wild-type p53 in the p53 null H1299

cell line show that the genes activated by mutant p53 largely overlap between mutant

variants, but interestingly share similarities in promoter sequences with p63 and wild-type

p53 (53). This indicates that mutant p53 mediated promoter activation involves interaction

with p63 as a distinct mechanism for mutant p53 GOF.

26
Figure 1.5 Models of mutant p53 function. In order to regulate the GOF property, mutant

p53 interacts with different proteins or transcription factors to activate its oncogenic function

or suppress their regulatory action (65).

27
 Biological effects /activities of mutant p53 in cancer

Wild-type p53 suppresses cellular migration and invasion (66), therefore mutation of p53

may result in loss-of-function (LOF) or dominant negative effects on invasion and

subsequent metastatic properties of p53. However, the introduction of missense mutant p53

in the p53 null NSCLC background also drives invasion (67, 68), indicating that the GOF

properties are characteristics of mutant p53 and are sufficient to drive the invasive phenotype

in cancer.

A most critical event during tumourigenesis is the evolution of a primary tumour into an

invasive disseminating metastasis. This event is accompanied by several modifications of

cell morphology that enable cancer cells to leave the site of the primary tumour, spread to

distant sites, and form new colonies ultimately leading to metastasis (69). Epithelial-

mesenchymal transition (EMT) is a series of transcriptional events that is thought to be

critical to initiate the process of invasion and metastasis. The EMT process involves changes

in cell-shape, in which epithelial cells become detached from each other, penetrate the

extracellular basement membrane and acquire a more flexible migratory property akin to the

mesenchymal cells (70). Wild-type p53 has been shown to suppress EMT and associated

invasion by enhancing the expression of E-cadherin that is required for cell-cell adhesion,

by promoting MDM2-mediated degradation of EMT regulator Slug (71) and opposing the

pro-migratory function of transcription factors such as Twist (72). In addition, many p53

null tumours have increased Slug expression and this correlates with loss of E-cadherin (73,

74).

28
In general, it appears that the loss of p53 can induce a more mesenchymal phenotype and

subsequent invasion in human cancer. In addition to the loss of normal p53 functions, mutant

p53 protein can function as a transcription factor and modulate the expression of Twist or

Slug that has the ability to suppress the synthesis of E-cadherin, therefore resulting in partial

EMT- like transition and subsequent cancer cell invasion (71, 75). Increasing evidence

suggest an indirect effect of mutant p53 on gene expression through binding to other

transcription factors that underlies the novel activities of mutant p53s. It has been

demonstrated that mutant p53 interacts with and inhibits p63 and can regulates a pro-invasive

transcription program that includes regulation of the expression of Sharp-1, Cyclin G2 and

Dicer (67, 76). Besides inhibiting p63, mutant p53 inhibits and interacts with other proteins

including the MRE11-Rad51-NSB complex, p73, and SP-1 to induce genomic instability,

chemoresistance, or proliferation (42, 54, 77). Similarly, mutant p53 gain of function has

been shown to influence a number of other oncogenic activities including proliferation,

genomic stability, somatic cell reprogramming, anti-apoptosis, chemo resistance, pro-

survival function, cell migration, and invasion (36, 78-81).

Consistent with in vitro findings, in vivo studies have demonstrated that genetically

engineered mice harboring missense p53 mutations develop more aggressive and metastatic

tumours than p53 knockout mice, which exhibit increased tumour burden but lesions are less

invasive and metastatic (30, 82-84). These studies indicate that the presence of GOF mutant

p53 drives an increasingly aggressive tumour profile. Indeed, in vivo clinical observations

have shown that the tumours expressing mutant p53 are associated with poor patient

prognosis in a number of cancers, including those of the breast (85, 86), colon (87, 88), and
29
lung (89, 90). More recently, in R248Q knockin mice, conditional inactivation of this mutant

showed regression in tumour growth and improved survival of mice, indicating that

sustained expression of mutant p53 is required by tumour cells for their growth and survival

(30). Strategies to target mutant p53 may therefore provide an attractive therapeutic benefit

to those patients expressing p53 mutant tumours, although no therapy directly targeting

mutant p53 has yet reached the clinic.

Targeting mutant p53 in human cancer

Disrupting the specific signals that favour growth and survival of cancer cells is a rational

approach to selectively kill cancer cells with minimal effects on normal cells. Since TP53 is

one of the most frequently mutated gene in cancer, strategies aiming at restoring the wild-

type p53 tumour suppressive function and eliminating the mutant p53 GOF may be

potentially instrumental for personalized treatment of hundreds of thousands of cancer

patients carrying p53 mutant tumours worldwide. The development and testing of drugs

targeting such properties will be particular relevance if the identified mutant p53 processes

and/or downstream pathways are shared or common to at least hotspot missense mutant p53

variants.

In recent years, several attempts have been made to target mutant p53 for the treatment of

human cancer, some of which are discussed below.

30
 Restoring wild-type p53 activity of mutant p53
With so many different mutations and phenotypes, a variety of strategies have been explored

over the last two decades to target tumours expressing mutant p53s. Wild-type p53 is a potent

inducer of apoptosis and senescence in tumour cells, hence there have been a number of

attempts to restore the wild-type tumour suppressive activity of p53 mutants, including the

introduction of second point mutations in p53, binding of specific p53 mutant antibodies and

delivery of short peptides or chemical compounds that have been characterized and are

reviewed in several publications (91-94). Some small molecules and peptides that have been

identified to have some function in restoring wild-type activity to mutant p53 are discussed

below.

CP-31398
CP-31398 (styrylquinazoline) was identified through a structure-based screening as the first

small synthetic compound that could restore native wild-type p53 conformation from a

denatured conformation in the DNA-binding domain, using a conformation specific antibody

PAb1620 (95, 96). CP-31398 treatment resulted in the induction of wild-type p53 target gene

expression, p21 and induced apoptosis in Saos-2 (p53-null) cells expressing either the

p53V173A or p53R249S mutants. In addition, administration of CP-31398 also inhibited tumour

growth of A375.S2 and DLD1 cells expressing p53R249S and p53S241F mutants in nude mice

(97). The p53 wild-type restoration function of CP31398 has been demonstrated to be p53

specific with no effect on its family members p63 or p73 (96). However CP31398 is also

known to cause p53 independent cell death through free radical formation (98), suggesting

that CP-31398 is not an ideal molecule for treatment of mutant p53 tumours.
31
 STIMA-1
STIMA-1 (SH Group-Targeting Compound That Induces Massive Apoptosis), a low

molecular weight compound, that is a derivative of CP-31398, induces mutant p53 (p53R175H

or p53R273H)-dependent growth suppression. Both CP31398 and STIMA-1 bind to the

cysteine residue in the mutant p53 core domain leading to restoration of wild-type p53

conformation and subsequent transcriptional activity (99). STIMA-1 increased DNA binding

ability of mutant p53, upregulated expression of the wild-type p53 target genes, p21, PUMA

and BAX and leads to p53 dependent apoptosis.

The amlemide MIRA-1 was identified from the same screening strategy as PRIMA-1 (see

next section 1.3.1.3). MIRA-1, and its structural analogs MIRA2 and MIRA3, contain a

reactive carbon-carbon double bond and are structurally distinct from PRIMA-1 or CP-

31398, but highly potent in inducing cell death in cancer cells expressing the p53 mutants

R175H or R273H (100). MIRA-1 and its analogs act by shifting the equilibrium between the

native and unfolded conformation of p53 towards the native conformation thereby enhancing

the sequence specific DNA binding activity of mutant p53 (R175H and R248Q) and

transactivation of wild-type p53 target genes, p21 and MDM2 in several cancer cell lines

(100). The anti-tumour activity of MIRA-1 analogs have also been confirmed using a mouse

xenograft model of multiple myeloma (101).

32
 PRIMA-1/APR-246
The most widely studied compounds for restoring active conformation of mutant p53 is

PRIMA-1 (p53 Reactivation and Induction of Massive Apoptosis). PRIMA-1 was identified

by screening a library of 2000 low molecular weight compounds from the National Cancer

Institute that could suppress the proliferation of Saos-2 osteosarcoma cells that express the

p53 mutant R273H, both in vitro and in vivo in mouse xenograft models (102, 103). PRIMA-

1 compounds can rescue the activity of p53 with either DNA contact or conformational

mutations by restoring the sequence specific DNA binding. Treatment of cells with PRIMA-

1 restored the wild-type conformation of R273H and R175H mutants and induced the

activation of endogenous p53 target genes MDM2, CDKN1A, PUMA and BAX resulting in

subsequent cell cycle arrest and increased apoptosis. In addition, systemic administration of

PRIMA-1 was also shown to inhibit tumour growth in mouse xenograft models. The

extensive characterization of PRIMA-1 revealed that PRIMA-1 forms an adduct with thiol

residues in the mutant p53 core domain and induces apoptosis in tumour cells (104). No

toxic effects have been observed in p53 wild-type or p53 null cells, following administration

of low doses of PRIMA-1 required to kill mutant p53 expressing cells, however at higher

doses PRIMA-1 has been shown to adversely affect wild-type p53 expressing cells (103).

Despite this, the use of PRIMA-1 is still considered to have beneficial effects to mutant p53

expressing tumours and remains non-toxic to normal cells.

PRIMA-1MET (also known as APR-246), a more potent and less toxic methylated derivative

of PRIMA-1 has been shown to restore the p53 wild-type conformation leading to the

inhibition of growth of several different types of mutant p53 expressing cancer cells as well

33
as human xenograft tumour growth in mouse models (105-109). In addition to exerting anti-

tumour effects, several in vitro and in vivo studies have shown that PRIMA-1MET can

synergize with various clinically used anticancer drugs such as cisplatin, adriamycin to

enhance tumour cell apoptosis in vitro and inhibit tumour xenograft growth in mouse models

(105, 107, 110, 111), suggesting greater potential as a combination therapy.

Although, early reports indicated that the anti-tumourigenic activity induced by PRIMA1

and PRIMA-1MET was dependent on mutant p53, recent findings suggest that PRIMA-1MET

can induce tumour growth suppression independent of mutant p53. At higher concentrations,

the PRIMA-1MET compound was shown to induce apoptosis in melanoma (112) and Ewing

sarcoma cells (113) via wild-type p53. Similarly, PRIMA-1MET induced apoptosis in

multiple myeloma cells via the p53 family member, p73 (110), while in lung cancer cells,

PRIMA-1MET appeared to target specific mutant forms of p63 and p73 (114) .

To our knowledge, PRIMA-1MET is the first and only compound that has undergone

investigation in clinical trials (115, 116). It has been clinically tested in a phase I/II clinical

trial of 22 patients with acute myeloid leukemia and hormone refractory prostate cancer

(115). Overall PRIMA-1MET was well tolerated, with some common side effects being

fatigue, dizziness, confusion and head ache. Currently, PRIMA-1 is undergoing initial phase

Ib/II clinical trial in patients with recurrent high grade serous ovarian cancer (Clinical-

Trials.gov Identifier: NCI02098343) (116).

34
Although PRIMA-1 and PRIMA-1MET have been reported as promising compounds to

activate mutant p53, it is unclear whether these compounds also bind to or alter the properties

of other cellular proteins. The fact that compounds can also reactivate the mutant form of

the p53 family member p63 and p73 indicates a possible effect of these compounds on

various p53 isoforms. Hence, further investigation is required to investigate the target

specificity of these drugs.

CDB3-molecular chaperone
In addition to small molecules, a short synthetic nine residue peptide known as CDB3,

derived from a p53 binding protein that interacts with the p53 core domain, has been shown

to stabilize the structure of p53 missense mutant proteins. CDB3 restores the sequence

specific DNA binding activity of mutant p53 by inducing a shift of equilibrium from a

denatured mutant confirmation towards a native functional wild-type p53 (117). Treatment

with CDB3 restored the transcriptional activity of the p53 mutants R273H and R175H,

resulting in up-regulation of the p53 target genes MDM2, GADD45A and p21, and

accompanied by p53 dependent partial restoration of apoptosis. Furthermore, CDB3

stabilizes wild-type p53 and sensitizes cancer cells to gamma radiation (118). Although

CDB3 could not restore full biological activity, it may serve as a lead for novel p53

reactivating drugs. In addition to CDB3, several other synthetic p53 short peptide derived

from the C-terminal region of p53 have been identified to restore the transcriptional function

in DNA contact p53 mutants and induce apoptosis in cancer cells expressing DNA contact

mutant p53. (119, 120). Another highly stable p53 C-terminal peptide known as RI-TAT

p53 C’ can activate endogenous p53 activity, increase apoptosis and suppress tumour volume
35
and extend life span in mouse models with terminal peritoneal carcinomatosis and peritoneal

lymphoma (121). Studies have shown that the C-terminus of p53 can regulate gene

expression via multiple mechanisms depending on the tissue and target, resulting in distinct

specific phenotypic effect in vivo. This further raises a concern regarding the therapeutic use

of p53 C-terminus derived small peptides that may have unintended consequences on normal

hematopoietic tissues of patients beside acting as an anti-tumourigenic agent (122).

ReACp53
Recently, Eisenberg and coworkers (123) designed a cell penetrating 17-residue peptide

inhibitor of p53 aggregation called ReACp53, which was shown to inhibit p53 amyloid

formation and rescue the p53 functions in cancer cell lines and in organoids derived from

high-grade serous ovarian carcinomas (HGSOC). ReACp53 treatment was further shown to

specifically reduce cell viability and proliferation of cancer cells expressing mutant p53

when grown as organoids. Rescued p53 behaved similarly to its wild-type counterpart and

was capable of upregulating p53 targets such as p21, GADD45B, PUMA, THBS1, NOXA and

DRAM1. Furthermore, intraperitoneal administration of ReAC53 was found to significantly

decrease tumor proliferation and shrink xenografts expressing mutant p53 in vivo, while the

MCF-7 xenografts expressing wild-type p53 were not irresponsive. Although the study

supports treating susceptible cancers as a protein aggregation disease and has shown

ReACp53 to target two of the three most common p53 hotspot mutations in HGSOC (R175

and R248Q), the spectrum of p53 mutants that can be targeted by this peptide still remains

to be investigated.

36
 Pk7088 and PhiKan083
In contrast to PRIMA-1, PRIMA-1MET and the several other mutant p53 reactivating

compounds discussed above, which target several different mutant p53 missense variants,

some compounds show preference to a particular variant of mutant p53. Studies have

identified Pk7088 and PhiKan083 as compounds that can specifically target and reactivate

the missense p53 hotspot mutant Y220C which is found at a relatively high frequency in

breast cancer (124, 125). The Y220C hot spot mutation in p53 creates a destabilizing surface

cavity on the mutant p53 protein that has been referred to as a “druggable surface”. PK7088

is biologically active in cancer cells carrying the Y220C mutant and induces cell cycle arrest

and apoptosis through upregulation of the wild-type p53 target genes NOXA and p21 (125).

PhiKan083 binds to the cavity and increases the melting temperature of the mutant protein,

thereby stabilizing the protein. However, the biological activity of PhiKan083 is yet to be

characterized.

Similarly, NSC319726 [zinc metallochaperone-1 (ZMC1)], a thiosemicarbazone derivative

is another such compound identified from the screening of the NCI60 panel of human tumour

cell lines that exhibited specific in vivo activity towards cells carrying the R175H mutant but

with minimal effects on cells expressing wild-type p53 and other p53 mutants tested (R248Q

and R273H) (126). NSC319726 was found to restore wild-type p53 conformation and

function to p53 R175H mutant cell lines and induce apoptosis by up regulating wild-type

p53 target genes (p21, PUMA and MDM2). NSC319726 also exhibited greater toxicity in

p53 R172H (equivalent to human R175H) mutant mice than in wild-type mice and

suppresses tumour growth of p53 R175H mutant carrying cancer cells (126, 127).
37
Despite the promising effects, the clinical use of these compounds may be limited due to its

specificity towards a particular p53 mutant form. Further studies may be required to

determine if these compounds affect other common cancer related p53 mutations.

Mutant p53 elimination or degradation

Although strategies of restoring the wild-type p53 activity in mutant p53 seem to be

effective, it remains unclear whether this could be effective to all p53 mutants or specific

mutant types. At this time, PRIMA-1MET/APR-246, is the only drug that has reached clinical

trials, however the target specificity of this compound is still controversial. Thus, the strategy

of reactivating p53 in cancer remains challenging. Another approach to target mutant p53 is

to develop compounds that can selectively and specifically eliminate and/or degrade mutant

p53 protein with minimal or no effect on wild-type p53. Several compounds that deplete

mutant p53 have been developed and are discussed below.

1.4.2.1 Hsp90 Inhibitors: Geldanamycin, 17-AAG, Ganetespib

Stabilization of mutant p53 requires a complex formation with Hsp90, a molecular

chaperone that inactivates the specific ubiquitin ligases, MDM2 and CHIP, that are

important for proteasome-mediated degradation of both wild-type and mutant p53 proteins

(128-131). Treatment of cancer cells Hsp90 inhibitors such as 17-AAG and an analog of

geldanamycin promotes destabilization of a variety of p53 mutants (R175H, L194F, R273H

and R280K) thereby decreasing the viability of cells expressing mutant p53 (131, 132).

Recently, an in vivo study reported that treatment with the geldanamycin derivative 17-

38
DMAG or a new generation synthetic Hsp90 inhibitor-ganetespib, destabilizes mutant p53

but not wild type p53 and significantly extends the survival of mutant p53 knock-in mice

expressing R248Q or R172H mutants (30). Importantly, ganetespib is 50 fold more potent

that 17AAG (a first generation HSP90 inhibitor. Currently, Ganetespib is under evaluation

in clinical trials for patients with metastatic breast cancer (133), hepatocellular carcinoma

(134) and non-small cell lung cancer (135). In addition to mutant p53, inhibition of Hsp90

leads to depletion of other important oncogenic proteins such as Raf-1 and ErbB2 (132, 136).

Thus, it is uncertain whether the in vivo effect observed from the treatment of Hsp90 inhibitor

is through direct destabilization of mutant p53.

1.4.2.2 Histone Deacetylase Inhibitors: SAHA/Vorinostat

In order to stabilize, mutant p53 is required to form complexes with the chaperones HSP70

and HSP90 through the involvement of HDAC6 with the complex, which is essential for

proper functioning (131, 137, 138). The histone deacetylase, HDAC6 is an obligatory

positive regulator of HSP90 that acts through deacetylation. HDAC inhibitors such as

suberoylanilide hydroxamic acid (SAHA, also known as vorinostat), a FDA approved

HDACi are promising anti-cancer drugs that inhibits class I, II and IV HDACs including the

cytoplasmic HDAC6 activity which leads to the destabilization of mutant p53 by

dissociating the HDAC6-HSP90 complex, and subsequent release of mutant p53 for MDM2

and CHIP mediated degradation (131, 138, 139). SAHA shows more potent preferential

cytotoxicity for mutant p53 expressing cancer cells than cells that express wild type p53

and/or are p53 null (138). Besides regulating mutant p53 stability, SAHA has also been

shown to regulate transcription via the p53 activator HoxA5 and HDAC8 (140). However,
39
this effect was not restricted to mutant p53, and HDAC inhibitors also decreased wild type

p53 expression, indicating that theclinical use of HDAC inhibitors should be approached

with caution and requires thoughtful consideration of genetic alterations such as p53 status.

1.4.2.3 YK-3-237
YK-3-237, a small molecule activator of SIRT1, was identified to preferentially inhibit the

proliferation of breast cancer cells expressing mutant p53. SIRT1, a class I enzyme that

belongs to the family of silent information regulator 2 (Sir2) or sirtuins proteins is one of the

deacetylases/ADP ribosyltransferase enzymes that deacetylates both wild-type and mutant

p53. YK-3-237 was found to activate SIRT1 enzymes activity in vitro and reduce the levels

of several mutant p53 variants (V157F, M237I, R249S, R273H and R280K) by deacetylating

the protein at lysine 382 residue in a SIRT1-dependent manner. Furthermore, YK-3-237 was

shown to induce apoptotic cell death and cell cycle arrest in triple negative breast cancer cell

lines through upregulation of wild-type p53 target genes PUMA and NOXA (141). However

due to the diverse role of SIRT1 driven enzymatic activity in the cell, the underlying

mechanism behind its inhibition strategy needs further research.

Some other approaches to reduce/eliminate the mutant p53 protein involves knockdown of

p53 with small interfering RNA (siRNA) and blocking mutant p53 activation by targeting

proteins such as Pin1 and TopBP1. While targeting mutant p53 may seems feasible, it is

unclear whether simple removal of mutant p53 can provide an effective therapeutic response

in the clinic and therefore requires further confirmation.

40
 Targeting mutant p53 induced downstream oncogenic effects
Instead of targeting mutant p53 directly, an alternative approach is to identify and target the

downstream oncogenic pathways/targets activated by mutant p53 GOF. Using genomics

(gene expression microarray, RNA sequencing and ChIP sequencing) and proteomic

approaches, several mechanisms and targets associated with a particular variant of mutant

p53 have been discovered using a p53 null background. Such studies have identified

important roles of mutant p53 in steroid synthesis (mevalonate pathway) (142), integrin

recycling (76), PDGFRB signaling (143), regulation of PARP localization (144), Warburg

effect (145), inhibition of p63/p73 mediated tumour suppression (67, 146), etc. Some of the

pathways with their known targeting drugs are grouped on the basis of genomic and

proteomic approaches and are discussed below.

1.4.3.1 Genomic approaches in the analysis of mutant p53 signaling

In the past decade, numerous efforts were made to identify the target genes altered by mutant

p53 through various genomic techniques including microarray expression analysis, RNA

sequencing and ChIP sequencing (Figure 1.6). Some of the identified targets/pathways of

mutant p53 with their known drugs/inhibitors are discussed below:

41
Figure 1.6 Schematic view of gain-of-function mutant p53 activators, downstream

mediators and pathways and therapeutic opportunities to target tumours. Below are

the inhibitors and drugs identified from genomic studies.

1.4.3.1.1 PDGFRB signaling in pancreatic cancer can be targeted by imatinib

Mice harboring pancreatic cancers driven by oncogenic Kras and a mutant p53 allele show

more metastases compared to identical mice harboring a p53 null allele (147). In order to

analyze the molecular basis of mutant p53 mediated metastatic phenotype in pancreatic

ductal adenocarcinoma (PDAC), genome-wide transcriptome profiling by RNA sequencing

(RNAseq) was performed in KPC pancreatic cancer cells, KPC+sh.Ctrl, with those stably

expressing shRNAs targeting mutant p53 R175H (143). These studies identified that mutant

p53 drives metastasis in pancreatic cancer cells through the induction of the platelet-derived

42
growth factor receptor beta (PDGFRb). PDGFRb is a receptor tyrosine kinase that mediates

PDGF-regulated proliferation, survival and chemotaxis (148). Mutant p53 was shown to

sequester p73 from NF-Y complex allowing this transcriptional complex to regulate the

expression of PDGFRb resulting in a pro-metastatic phenotype. Furthermore, treatment of

KPC pancreatic cells with the PDGFRb inhibitor, imatinib was found to significantly

diminish the metastatic potential of KPC pancreatic cell lines in vitro as well as in vivo (143).

Imatinib is a FDA-approved drug which is known as a potent inhibitor of PDGFRb as well

as c-KIT and BCR-ABL activity. Although the c-KIT and BCR-ABL kinases have not been

linked to PDAC development (149), it raises concerns on the specificity of this drug for the

treatment of mutant p53 tumours and requires further consideration.

1.4.3.1.2 Mevalonate pathway in breast cancer can be targeted by statins

One mutant p53 regulated downstream pathway that has shown therapeutic promise is the

cholesterol biosynthesis pathway. In order to study the mutant p53-inudced phenotypic

alteration in mammary tissue architecture, Freed-Pastor et al. (142) performed genome wide

expression profiling on MDA-MB-468 breast cancer cells, MDA-MB-468 sh.Ctrl grown

in 3D culture, with those of stably expressing shRNAs targeting mutant p53 R273H. Several

genes that encode enzymes within the mevalonate pathway were identified to be

significantly reduced following depletion of endogenous mutant p53. Mutant p53 was

further shown to interact with SREBPs (SREBP-1 and 2, the sterol regulatory element

bindings proteins), key transcriptional factors in cholesterol synthesis for mutant p53-

mediated up regulation of mevalonate pathway genes.

43
The mevalonate pathway is responsible for the de novo synthesis of cellular cholesterol.

Mutant p53 was also shown to disrupt the morphology of mammary cells when grown as

spheroids in 3D culture conditions. HMG-CoA reductase, a rate limiting enzyme in

cholesterol biosynthesis, is the target of numerous cholesterol reducing statins (150). Statins

are among the most commonly prescribed drugs to treat hypercholesterolemia and have also

been demonstrated to exhibit anti-cancer activity. Statins was also shown to inhibit the

mevalonate pathway and reduce tumour malignancy in breast cancer cells expressing mutant

p53 (142). Treatment of breast cancer cells expressing an endogenous mutant p53 in 3D

condition with statins were shown to reduce invasive potential as well as inhibit tumor

growth when implanted in immunocompromised mice. In summary, the study suggests that

the inhibition of the mevalonate pathway, either alone or in combination with other therapies,

may offer a novel, and much needed, therapeutic option for tumours bearing mutant p53.

However, the effect of statins was tested using a limited number of p53 mutants and cell

backgrounds and the anti-tumour mechanism of statin has not been firmly established. It is

also unclear whether wild-type p53 regulates the level of sterol biosynthesis genes. Hence,

further studies will be required to examine the possibility of blocking cholesterol

biosynthesis pathways as a treatment for targeting p53 mutant tumours.

1.4.3.1.3 Mutant p53 driven chromatin regulation can be targeted by COMPASS

inhibitors

Recently, Zhu et al. carried out chromatin immunoprecipitation followed by sequencing

(ChIP-seq) to determine genome-wide binding locations of p53 in a panel of breast cancer

44
cell lines expressing either wild-type p53 or different p53 missense mutants (R248Q, R249S

and R273H) (151). Mutant p53 was identified to bind a newly identified group of gene

targets and drive the expression of genes comprising a chromatin signature. Within the

chromatin signature gene group targeted by GOF p53, the COMPASS methyltransferase

pathway including MLL1 and MLL2 was identified to be particularly well represented,

together with the binding of other chromatin regulators, such as the acetyltransferase, MOZ

that were not present in wild-type p53. Furthermore, up regulation of MLL1, MLL2 and MOZ

was found in human tumours with p53 missense mutants, but not in wild-type p53 or p53

null-tumours (151). More importantly, both human cancer cells and Li-Fraumeni Syndrome

(LFS) cells expressing GOF p53 mutations were shown to lose growth and tumour formation

potential with similar timing kinetics upon depletion of MLL1 as they do with knockdown

of GOF p53. However, those cells expressing wild-type p53 had very little response to MLL1

knockdown. This was further supported by the treatment of cells with COMPASS inhibitors,

compounds that inhibits the MLL1/COMPASS complex function, which was shown to

specifically inhibit the proliferation of cancer cells expressing GOF p53 but not p53 null,

suggesting that the GOF p53 cells are dependent for growth on the MLL1 pathway. This

study provides evidence on the dependency of GOF mutant p53 on chromatin pathways and

opens a new way amenable to epigenetic therapeutics. In summary, mutant p53 uses multiple

pathways to contribute to the GOF phenotypes of cells.

The above pathways and targets associated with mutant p53 were identified using in vitro

and in vivo genomic models in an endogenous mutant p53 background. Whether these

pathways and targets have the same role in diverse cellular context is unclear and needs
45
further investigation. In an attempt to fill this gap, several studies have conducted

overexpression of mutant p53 variants in a p53 null or wild-type background and studied its

GOF effect. These studies have identified several transcription independent roles of mutant

p53 in integrin recycling (76), Warburg effect (145) and NF-kB signaling (152) exhibited

through cooperation with transcription factors.

1.4.3.2 Proteomic approaches in the analysis of mutant p53 signaling

The term proteome can be defined as the complete set of proteins expressed by a cell (153)

while proteomics refers to the global analysis of such proteins (154). While genomic

approaches have been widely utilized to exploit the gain of function activities of mutant p53

in cancer (155), proteomics have become a necessary tool to validate the dysfunction of

biochemical pathways at the protein level (156, 157). The studies of gene expression by

microarray and sequencing analysis have enlightened our understanding of multiple

signaling pathways influenced by mutant p53, however mutant p53 driven biological

responses may also be independent of observable differences in gene expression due to post-

transcriptional and post-translational modifications. In addition, the function of p53 proteins

can also be altered by protein-protein interaction or binding of biomolecules, which directly

affect cellular functions and responses (158). To date, only a few studies have utilized the

proteomics approach to detect the influence of mutant p53 on the cancer cell proteome

(Figure 1.7). These studies are mainly conducted using quantitative proteomic approaches

on whole cell lysates from cancer cells, or embryonic stem cells. Some of the targets and

pathways of mutant p53 identified using proteomics approaches are discussed below.

46
Figure 1.7 Schematic view of gain-of-function mutant p53 activators, downstream

mediators and pathways and therapeutic opportunities for targeting tumours.

1.4.3.2.1 HB-EGF signaling

In order to identify the mutant p53-specific interacting proteins that leads to neomorphic

functions in cancer cells, Coffill et al (159) used SILAC based interactome analyses and

comparative immunoprecipitation (IP) on whole cell lysates from p53 null H1299 lung

adenocarcinoma cells expressing wild-type p53 or mutant p53 R273H. Among the several

new p53 binding proteins identified, was nardilysin (NRD1; N-arginine dibasic convertase)

that specifically interacts with mutant p53 R273H but not with wild-type p53. This

interaction was further shown to be important for mutant p53 R273H driven cellular invasion

towards HB-EGF (heparin binding- epidermal growth factor) (159). This suggests that

mutant p53 specific interacting partners can lead to neomorphic functions in cancer and new

functions may be associated with distinct mutations in p53. Hence, modulating the specific

binding partners and inhibiting the expression of, or activity of, mutant p53 may be a

promising therapeutic approach to p53 driven tumour progression. However, these findings
47
were solely based on the overexpression of mutant p53 in p53 null cells, and the biological

response in an endogenous mutant p53 background needs to be confirmed. Furthermore,

results from in vivo experiments are required to support these findings and to provide

relevance to clinical settings. In addition, HB–EGF is a ligand for both EGFR and the growth

factor receptor HER4 (160), which has also been shown to bind to NRD1(161). The physical

interaction of mutant p53R273H with NRD1 may affect HB–EGF interaction with its

receptors to promote an invasive response. Hence further detailed study of growth factor

receptors, HB–EGF ligand and p53 interactions, including NRD1 will be required.

1.4.3.2.2 DNA replication and PARP signaling

It is well known that the quantitative proteomic based approaches allow changes in protein

abundance in whole cell lysates or individual organelles to be determined. However, the use

of subcellular proteomics provides improved detection of proteomic signals for different

cellular events and subcellular compartments, including protein translocation to various parts

of cells. Jill et al (144) combined cell fractionation with SILAC based quantitative mass

spectrometry (MS) to study the global influence of mutant p53 on the proteome of cell

MDA-MB-468 breast cancer cells expressing the endogenous mutant p53 R273H. Among

the several proteins identified, mutant p53 was found to increase the production of enzymes

of the cholesterol biosynthesis pathway. This is in agreement with previous findings which

showed that mutant p53 R273H in MDA-MB-468 cells up-regulates the transcription of

mevalonate pathway genes through an interaction with the SREBP family of transcription

factors (142).

48
Mutant p53 R273H was also shown to upregulate DNA replicating proteins, cell nuclear

antigen (PCNA) and minichromosome maintenance 4 (MCM4) proteins in breast and colon

adenocarcinoma cell lines, without changing the amount of corresponding gene transcripts.

Interestingly MDA-MB-231 cells expressing mutant p53 R280K did not have similar

influences on PCNA and MCM4 protein expression. This suggests that the different

mutations in p53 may result in distinct outcomes and mutant p53 R273H may in particular

increase replication to drive tumourigenesis. More importantly, depletion of mutant p53

R273H in breast cancer cells increased the localization of poly (ADP ribose) polymerase 1

(PARP1) to the cytoplasm, and decreased the level of chromatin associated PARP proteins.

PARP is a family of protein that catalyzes the transfer of ADP ribose to target proteins which

is critical for a number of biological processes, including regulating transcription, DNA

replication, and DNA repair (162). The re-localization of PARP to the cytoplasm following

mutant p53 R273H depletion suggests that cytoplasmic PARP is a cell cycle checkpoint

signal, and this may offer a mechanism to target cancers that express high levels of mutant

p53. Treatment of MDA-MB-468 breast cancer cells with the PARP inhibitor (rucaparib)

induces a potential synthetic lethal combination for mutant p53 R273H expression and

PARP inhibition. This study provides supporting evidence on the potential use of PARP

inhibitors as part of a synthetic lethal approach for treating breast cancer cells expressing

mutant p53. However, a detailed study on the influence of mutant p53 on chromatin

associated proteins is required to elucidate if mutant p53 is involved in chromatin remodeling

and the proteins involved. Whether the use of PARP inhibitors is limited specifically to

mutant p53 R273H or its application may be extended to other mutant p53 variants needs

further investigation.

49
In addition to above mentioned studies, two more studies have used a proteomic approach

to examine mutant p53 specific interacting proteins in whole cell lysates of cancer cells and

embryonic stem cells. These studies have identified molecular chaperones like CCT complex

as a factor responsible for the regulation of cancer cell invasion and reversion of

conformational mutant p53 to wild-type p53 structure and function (163, 164). Targeting

these p53 binders that stabilize mutant p53 into wild-type p53 and regulates invasion can

also form a basis to develop mutant p53 targeted cancer therapy.

50
 Mutant p53 and the cancer cell secretome

Metastasis is a complex, multistep process that involves tumour cell dissemination, invasion,

and adhesion to secondary organs sites, and organogenesis of the metastasized cells in the

new environment. During the metastatic process, cells secrete several proteins that are

known to enhance invasion. Studies have indicated that these secreted proteins are also

associated with cancer metastasis. In addition, secreted proteins, also known, as the

“secretome”, are released by a cell, tissue or organism though various classical and non-

classical secreted pathways and the secretome can be detected in bodily fluids. Thus,

secretome analysis allows investigation of the molecular mechanisms and functions of

secreted protein and can also help discover the biomarkers of cancer.

Although mutant p53 has widely been shown to regulate cellular invasion, it is not clear

whether this occurs primarily performed through intracellular means or via extracellular

secreted factors. Mutant p53 has been shown to drive aberrant transcription of genes (158)

whose protein forms can be secreted into the extracellular environment. Once secreted, these

proteins can modulate the tumour environment and enhance the pro-tumourigenic potential

of cancer cells.

Mutant p53 has been demonstrated to enhance invasion and metastasis through (i)

modulation of the extracellular matrix (ECM) components; (ii) secretion of pro-

inflammatory, immunomodulatory interleukins and cytokines; (iii) modification of the

51
extracellular pH; and (iv) regulation of the crosstalk between tumour and stromal cells which

has been reviewed in detail (165). This involvement of mutant p53 in the regulation of cancer

cell secreted proteins and signaling molecules indicates an important role of mutant p53 in

altering the tumour microenvironment. It has been shown that the secretome of mutant p53

can induce an invasive potential in H1299 (p53 null) and ZR75-1 (p53 wild-type) cell lines,

suggesting the presence of an oncogenic secretome (166). Experimental approaches using

transcriptomic and proteomics of mutant p53 have led to the discovery of numerous

pathways controlled by mutant p53. However, one might ask what is the global influence of

mutant p53 secretome in human cancer? The motivation of this thesis is defined around this

question.

Research Gaps and Objectives of the thesis

Identifying the common downstream mechanism, which drives mutant p53 GOF will

provide a possible therapeutic approach to target p53 mutant tumours. However, despite the

identification of several downstream targets of mutant p53, there are still major unanswered

questions.

- What molecular pathways drives the mutant p53 GOF?

- Are different p53 missense mutations associated with different GOF mechanisms?

- Can the identification of the downstream mechanisms be translated into therapeutic

applications for mutant p53 tumours?

The lack of conclusions regarding mutant p53 GOF may be due to the intrinsic structural

diversity in mutant p53 proteins and its complex signaling pathways. These facts have led
52
to the use of several genomics and proteomics approaches to dissect the key signal

transduction targets of mutant p53. These studies have demonstrated the activities of mutant

p53, both in the cell cytoplasm and in the nucleus.

However, the research gap is that, despite the role of mutant p53 in altering the extracellular

secreted proteins and their pathways, no study has reported the global influence of mutant

p53 on the cancer cell secretome. Therefore, there is a need to characterize the mutant p53

induced secretome to understand the biological events that characterize the alteration of the

tumour microenvironment and to identify specific secreted biomarkers that may indicate the

presence of GOF mutant p53 proteins in cancer patients.

The main objectives of this thesis are to investigate the secretome of GOF mutant p53s, by

use of a quantitative proteomics approach. In particular, this thesis aims to identify the

critical secreted effector of mutant p53 GOF that can serve as a potential therapeutic target

for treatment of mutant p53 expressing tumours. The major effector of mutant p53 GOF

discussed in this thesis is alpha-1 antitrypsin (A1AT). This thesis also compares the

identified secreted target in terms of cancer outcomes, to justify that this target has a role in

cancer.

53
 Thesis Outline
This thesis encompasses seven chapters. In the current chapter some introductory remarks

on mutant p53 and the biological consequences of mutant p53 GOF in cancer were

addressed. In addition, discussions on the importance of identifying downstream

targets/pathways essential for targeting p53 mutant tumours, were provided. Furthermore,

we discussed the motivation of this thesis for exploring and investigating the mutant p53

induced secretome in order to identify novel pathways/target for the treatment of p53 mutant

tumours.

Chapter 3 is a manuscript under preparation. It provides an in-depth investigation of mutant

p53 regulated secreted proteins using the inducible H1299 cell lines and quantitative

proteomic approach. This chapter identifies a significant overlap in the mutant p53 regulated

secretome with the target genes previously identified using microarray analysis. The chapter

identifies alpha-1 antitrypsin (A1AT) as a highly expressed secreted target of mutant p53.

Some sections of results in this chapter are included in the manuscript which is under final

stages of review in Oncogene.

Chapter 4 demonstrates A1AT is a downstream secreted mediator of mutant p53 GOF

pathways, including EMT, migration and invasion both in vitro and in vivo. The work

described in this chapter provides a rational to investigate the development of antibody-

based cancer therapies that target A1AT. Findings from this chapter are included in the

manuscript which is under final stages of review in Oncogene.

54
Chapter 5 demonstrates the clinical correlation of A1AT expression in lung adenocarcinoma

(ADC) patients. It is shown that levels of A1AT protein are related to prognosis in lung ADC

and have the potential to be used for personalized treatment of p53 mutant tumours. Findings

from this chapter are included in the manuscript which is under final stages of review in

Oncogene.

Chapter 6 describes the mechanism of regulation of A1AT by mutant p53. The chapter

identifies p63 as a molecular chaperone of mutant p53 in the regulation of A1AT. It also

presents A1AT as a target of wild-type p53. Findings from this chapter are included in the

manuscript which is under final stages of review in Oncogene.

Chapter 7 further explores the oncogenic role of A1AT in mutant p53 expressing breast

cancer subtypes. It demonstrates that A1AT is a potential therapeutic target in breast cancers.

Furthermore, its correlation with estrogen receptor expression in breast cancer indicates

possible regulation beyond p53.

Chapter 8 provides concluding remarks for this thesis. It also discusses future research

directions that can be followed based on the studies carried out and presented in the current

thesis.

55
In a nutshell, considering the background material provided in this thesis and with regards

to the versatile study performed on the characterization and functional analysis of the mutant

p53 secretome, the current thesis may be of great help for readers with various backgrounds.

It may benefit biomedical students to grasp an overview of mutant p53, as well as more

experienced scientific researchers who would like to learn and be familiar with the field of

the mutant p53 secretome, and their field of research. In addition, clinical oncologists in the

field of p53, who would like to study the prognostic and diagnostic significance of mutant

p53 driven secreted proteins for the personalized treatment of cancer patients, will find this

thesis useful.

56
Chapter 2: General Materials and Methods

Cell lines and inducible expression system

H1299, a p53 null, non-small cell lung carcinoma cell line was purchased from American

Type Culture Collection (ATCC) and cultured in the Dulbecco’s Eagle’s medium (DMEM)

supplemented with 10% fetal bovine serum (FBS) under 5% CO2. The generation of

Ponasterone A (PonA) inducible H1299 derivatives has been previously described (167).

Using expression constructs encoding the p53 mutations R175H, R248Q, R248W, R249S,

R273H and R282W (kind gifts from Dr Chikashi Ishioka, Dr. Sumitra Deb and Dr Maria

Lung), a panel of ecdysone-inducible mutant p53 H1299 cell lines (notated as EI-H1299)

were generated. SBC-3, lung cancer cell line was a kind gift from Dr. Sandra Hodge

(University of Adelaide, Australia) and was maintained in DMEM with 10% FBS, HEPES

and PSG (Penicillin-streptomycin-glutamine). H2009 (lung adenocarcinoma; ADC), H1466

(lung ADC) and SBC-3 (small cell carcinoma) cell lines were a kind gift from Dr. Sandra

Hodge (University of Adelaide, Australia). H2009 and H1466 cell lines were maintained in

RPMI supplemented with 10% FBS, PSG and HEPES. SBC-3 cell line was cultured in

DMEM supplemented with 10% FBS, PSG and HEPES. MDA-MB-231 (a basal-like triple

negative breast cancer expressing mutant p53R280K) cell line was cultured in DMEM

supplemented with 10% FBS, SPG and HEPES. MCF-7 (a luminal breast cancer expressing

wild-type p53) cell line was maintained 10% FBS, PSG, HEPES and 10 μg/ml insulin. Cell

lines were sourced from ATCC.

57
 iTRAQ analysis by 2D nanoLC ESI MS/MS

Sample collection

EI-H1299 R175H and EI-H1299 R248Q cells were cultured separately in a T75 flask using

DMEM media. At approximately 70-80% confluence, cells were washed with endotoxin

free Phosphate Buffer Saline (PBS) and replaced with 15 ml of fresh serum free media either

in the presence or absence of inducible agent (2.5 μg/ml PonA) for 72 hours. Conditioned

medium (secretome) were harvested by centrifugation at 4,000 g for 5 min. Supernatant was

collected and stored at -80oC until shipment to Australian Proteomic Analysis Facility

(APAF) on dry ice.

Note that the iTRAQ proteomics was performed in The Australian Proteome analysis facility

(APAF), NSW, Australia. Materials and Method sections from 2.2.2 – 2.2.6 were performed

in APAF.

Instruments used

Mass spectrometer (MS/MS): Triple TOF 5600 (AB Sciex)

NanoLC system: Eksigent Ultra nanoLC system (Eksigent)

Analytical column: SGE ProteCol C18, 300 Å, 3μm, 150μm x 10cm

SCX HPLC: Agilent 1100 quaternary HPLC system with Polysulfoethyl A 100mmx2.1mm

5μm 200 Å column

58
 Sample preparation and digestion

15 ml of conditioned media from each sample were buffer exchanged into 0.5M

triethylammoniumbicarbonate (TEAB), 0.02% SDS using 5kDa Vivaspin 6 cartridges.

Bicinchoninic acid (BCA) assay was performed on the samples. A total of 80μg of protein

for each sample was subsequently denatured, alkylated and digested. Proteins were labeled

with the iTRAQ tags (Applied Biosystems, Foster City, CA, USA) as follows: EI H1299

p53 R175H +PonA-114 isobaric tag, EI H1299 p53 R175H -PonA -115 isobaric tag, EI

H1299 p53 R248Q +PonA -116 isobaric tag and EI H1299 p53 R248Q -PonA -117 isobaric

tag. Labeled peptides were mixed together and evaporated before sample fractionation.

Strong cation exchange HPLC/ Chromatographic fractionation of peptides

The labeled samples were combined, desalted and fractionated and the dried peptide mixture

were reconstituted and acidified with buffer A (5mM Phosphate 25% Acetonitrile, pH 2.7)

for fractionation by SCX HPLC. SCX separation was performed using a linear binary

gradient of 0-45% buffer B (5mM Phosphate, 350mM KCL, 25% Acetonitrile, pH 2.7) in

buffer A (5mM Phosphate 25% Acetonitrile, pH 2.7) at a flow rate of 300 μl/min. The eluent

of SCX was collected at every 2min in the beginning of the gradient and then at 4min interval

thereafter.

59
 NanoLC-ESI-MS/MS analysis

Each fraction was dried and re-dissolved in buffer C (0.1% formic acid, 2% acetonitrile,

97.9% water) and the fractions desalted using a SGE ProteCol C18 analytical column.

Peptides were eluted from the column using a linear solvent gradient, with steps, from

mobile phase A: mobile phase B (98:2) to mobile phase A: mobile phase B (65:35) where

mobile phase A is 0.1% formic acid and mobile phase B is 90% CAN/0.1% formic acid at

600nL/min overall 100min period.

The Triple TOF instrument was subjected to positive ion nanoflow electrospray analysis.

Mass spectrometry of iTRAQ labeled samples was acquired in an information dependent

acquisition mode (IDA). In IDA mode a TOFMS survey scan was acquired (m/z 400-1500,

0.25 second), with the ten most intense multiply charged ions (counts > 150) in the survey

scan sequentially subjected to MS/MS analysis. MS/MS spectra were accumulated for 200

milliseconds in the mass range m/z 100 – 1500 with the total cycle time 2.3 seconds. The

iTRAQ labeled samples fragmented to produce reporter ions at 114.1, 115.1, 116.1 and

117.1 and fragment ions of the labeled peptides and identification of the corresponding

proteins. The relative abundance of the peptides and proteins in the samples were determined

by the ratios of the peak areas of four iTRAQ reporter ions.

Data processing and criteria

Peptide and protein quantification was performed on a software tool ProteinPilot V4.2b (AB

Sciex) using the Swissprot 2012 Human database. The confidence levels of the altered
60
expression of proteins were calculated by Protein Pilot as P-values, which allowed the results

to be evaluated based on the confidence level of expression changes, not just by the

magnitude of the changes. Bias correction was selected to eliminate any variations imparted

due to unequal mixing during combining different labeled samples. The detected protein

threshold (unused ProtScore) was set as larger than 1.3 (better than 95% confidence) to

satisfy good quality scores and high confidences.

Data analysis

Altogether 19,610 distinct peptides sequences were identified that resulted in identification

of 1,025 proteins. To prevent false positive identification, proteins with P-value < 0.05

(manually validated) were accepted as high confidence protein identifications. A total of 85

and 106 proteins from induced EI-H1299 p53 R175H and EI-H1299 p53 R248Q cell lines

respectively fulfilled these criteria. The identified proteins were further selected with the

criteria of fold change between induced and un-induced samples of >1.6 or <1.6, to identify

the ‘significantly altered’ (up- or down-regulated) proteins. These significantly altered

proteins were selected for pathway analysis.

Bioinformatics analysis
Gene Ontology (GO) analysis was used to identify their cellular localization and biological

processes of the identified proteins. The molecular function and signaling pathway and

networks of significantly altered proteins were analyzed using Ingenuity Pathway Analysis

(IPA, Ingenuity Systems, Mountain View, CA). Proteins were uploaded and mapped to
61
corresponding “gene objects” in the Ingenuity Pathways Knowledge Base (IPKB).

Biological networks were then generated using their Knowledge Base for interactions

between mapped Focus Genes (user’s list) and all other gene objects stored in the knowledge

base. In addition, functional analysis of the networks was done to identify their biological

functions and any diseases that were significantly associated with the gene in the network.

Real-time PCR analysis

The mRNA expression levels of genes of interest were determined by qRT-PCR using

specific forward and reverse primers (as listed in Appendix I). Total RNA was isolated from

cells using the RNAeasy mini kit (Sigma), using on-column RNase-free DNase digestion

according to the manufacturer’s instructions. Complimentary DNAs (cDNAs) were

synthesized from 1μg RNA by reverse transcribing the RNA using random primers

(Promega) and Moloney-murine leukemia virus reverse transcriptase (Promega) as per

manufacturer’s protocol. Real time PCR reactions were performed with IQ SYBR Green

Supermix reagent in a real-time PCR machine (BIO-RAD) with the following parameters:

denaturation at 95oC for 3min, annealing at 61oC for 15sec and elongation at 72oC for 20min,

for 45 cycles. Changes in the mRNA expression was determined using the ΔCt method

(168). All reactions were performed in triplicate in a final volume of 20μl. Relative target

mRNA expressions were normalized to the relative average Ct value of peptidylpolyl

isomerise G (PPIG), a housekeeping gene. Expression data was normalized to the un-

induced control (where applicable).

62
 Western blot analysis
Cells were lysed in 50mM Tris-HCL (pH 7.5), 250mM NaCl, 1mM EDTA, 0.5% Triton-X

100, 50mM NaF, 0.1mM Na3VO4 with 1 x protease inhibitors (Roche). Lysates were

sonicated for 20 seconds at 25% amplitude (Sonics Vibra Cell Sonicator) and then

centrifuged (13,200 rpm, 4oC) for 20 min. Clarified lysates were assayed for total protein

content using a Pierce BCA Protein Assay Kit (Thermo Scientific). Equal amounts of

protein were resolved using SDS PAGE electrophoresis on 8% polyacrylamide gels and

electro-transferred to Hybond-C Extra nitrocellulose membranes (GE Healthcare).

Membranes were probed using indicated primary antibodies and hybridized with the

appropriate horseradish peroxidase-conjugated secondary antibodies and detected using an

ECL detection system (GE Healthcare) in accordance with the manufacturer’s instructions.

Immunofluorescence
Cells were plated at 10% confluence on sterilized glass cover slips then fixed with 4%

paraformaldehyde in PBS and then permeabilized in 0.05% Triton X-100/PBS. Samples

were incubated with primary antibody in 10% goat serum for overnight at 4oC and the

secondary antibody for 30 minutes at room temperature. Cells were mounted in Vectashield

mounting medium with 4’,6-diaminodino-2-phenylindole (DAPI, Vector Laboratories,

Burlingame, CA, USA). Images were acquired using a ZEISS confocal microscope.

63
 Conditioned medium collection
Cultured cells at 80% confluence were washed with PBS and replaced with fresh serum free

medium and treated with 2.5 μg/ml PonA. After 72 hours, the conditioned medium was

collected and concentrated using Amicon Ultra-Centrifugal filter (Millipore, Billercia, MA,

USA) with molecular cutoff of 10 kDa at 12000 rpm at 4oC for 30 mins. Columns were

washed with PBS and concentrated medium (40X) was obtained by spinning the column in

an inverted position. Equal volume of concentrated proteins was loaded and resolved using

SDS PAGE electrophoresis on 8% polyacrylamide gels and electro transferred to Hybond-

C Extra nitrocellulose membranes (GE Healthcare). Membranes were probes with rabbit

anti-A1AT (Spring Bioscience E3442) primary antibody and hybridized with the appropriate

horseradish peroxidase-conjugated secondary antibody and detected using an ECL detection

system (GE Healthcare) in accordance with the manufacturer’s instructions.

Generation of knockdown cell lines

EI-H1299 p53 R248Q was engineered to inducibly express either sh.A1AT or a non

targeting control. HEK-293T cells were seeded at 50% confluence and transfected with

TRIPZ-shA1AT or TRIPZ-non targeting (Open Biosystems) vectors. Briefly, 5 μl of

Expression ArrestTM Translentiviral Packaging Mix was added to 250 μl OPTI-MEM

reduced serum medium (Invitrogen) with 1.5 μg DNA mixed with 10 μl Arrest-In

Transfection Reagent with 250 μl OPTI-MEM and incubated at room temperature for 20

min. 293T cells were replaced with 1 ml of OPTI-MEM prior to incubation with transfection

mix. Growth medium was changed after 4-6 hours and cells were incubated at 37oC with 5%

64
CO2 for 48 hours. Recipient cells, EI-H1299 p53R248Q cells were seeded at 50% confluence

and incubated with filtered media containing lentivirus for 48 hours. Growth medium was

subsequently changed and cells were selected in 500 ng/ml puromycin (Sigma-Aldrich,

Castle Hill, NSW, Australia). This is called a double inducible cell lines in which (i)

treatment with ponasterone (PonA 2.5 μg/ml) for 24 hours induces mutant p53 and (ii)

treatment with doxycycline (Dox; 2 μg/ml) for 24 hours induces the expression of sh.A1AT.

H2009 and MB231 cell lines with silenced A1AT was generated using GIPZ lentiviral

shRNAmiR system (Open BioSystems). HEK-293T cells were seeded at 50% confluence

and transfected using Translentiviral packaging mix similar to as described above (Open

BioSystems). For constitutive knockdown of A1AT, the pGIPZ lentiviral shRNAmir system

(Open Biosystems) expressing A1AT-speific short hairpin RNA (shRNA) oligonucleotides

(V3LHS_319251) was used in accordance with the manufacturer’s protocol (Open

Biosystems).

Transient transfections were performed in OPTI-MEM media using lipofectamine

RNAiMax transfection reagent in accordance with the manufacturer’s protocol (Invitrogen).

Briefly, cells were seeded at 50% confluence in an antibiotic-free medium. The indicated

amount of DNA was mixed with 250 μl OPTI-MEM, and 10 μl of lipofectamine RNAiMax

was mixed with 250 μl OPTI-MEM in a second tube. The aliquots were incubated at room

temperature for 5 min, mixed and incubated for another 20 min. Complexes were

subsequently added drop-wise to the recipient cells and incubated for at least 48 hours. The

medium was replaced 6 hours post-transfection with fresh medium.

65
 Migration assay
Real time migration assays were performed using Incucyte (Essen, MI, USA). Monolayer

cultures were grown on 24 well ImageLock plate. The cultures were scratched using scratch

device (Essen) and washed to remove detached cells. Cells were cultured in a fresh media

supplemented with the desired treatment. Phase contrast images were captured with a 20X

objective every 30mins.

Inverted invasion assay

Invasive ability of the cells were determined using modified Boyden chamber invasion

assay, also known as inversion invasion assay (169). Matrigel was allowed to polymerize in

transwell inserts (Corning) for 30 min at 37oC. Inserts were then inverted and 5X104 cells

were seeded directly onto the opposite of the filter. After 6 hours incubation, chambers were

washed three times in PBS and incubated in FCS free medium with desired treatment in an

upright position. Medium supplemented with 10% FCS and 25 ng/ml Epidermal growth

factor (EGF) was placed on top of the matrix, providing a chemotactic gradient. 72 hours

after seeding, transwells were placed in cold methanol for 20 min. Cells were then stained

with 10 μg/ml propidium iodide for 20 min and invasion toward a gradient of chemo

attractant (FBS and EGF) was visualized by Zeiss LSM700 confocal microscopy with serial

optical sections being captured at 10 μm intervals.

66
 Chicken chorio-allantoic membrane (CAM) invasion assay
Fertilized white leghorn chicken eggs (Hi Chick, SA, Australia) were maintained at 37oC in

60% relative humidity in a Multiquip Incubator E2 (Multiquip). Ethical approval for the

study was obtained from the University of Adelaide Animal Ethics Review Committee (AEC

M-2014-153). On day 3 of chick embryo development, a small opening was made under

aseptic conditions in the eggshell. To investigate the effect of A1AT knockdown in lung

cancer cell invasion in the CAM model, H2009 cells (5X105 cells) stably expressing

sh.A1AT or non-targeting control (sh.Ctrl) were mixed with matrigel (8 mg/ml, BD

Biosciences) in a total volume of 30 μl and gently inoculated on the upper CAM of day 11

chick embryos. Five days post inoculation, the CAM with developing tumours were excised,

paraffin embedded and the invasion of cancer cells into the mesoderm past ectoderm was

assessed in the serial sections of CAM stained with haematoxylin, eosin and pan-cytokeratin

immunohistochemistry.

CAM immunohistochemistry (IHC)

For the pan-cytokeratin immunohistochemistry, slides with CAM sections (6 μm) were

heated at 50oC for 1.5 hours followed by dewaxing with xylene, rehydration with ethanol

and PBS washes. Slides were subsequently treated with 1:100 dilutions H2O2 in PBS for 5

min followed by PBS wash. Next, antigen retrieval step was performed in EDTA pH 8 by

heating on high power until boiling (approximately 5 min), allowing slides to stand for 5min

before microwaving at 50% power for an additional 5min. Slides were allowed to cool for

60 minutes and washed 2 X 3 min in PBS. Sections were encircled with a wax pen and pan-

67
cytokeratin (1:100; Dako) antibody diluted in PBS with 10% normal goat serum was applied

overnight at 4οC. Slides were washed twice for 5 min in PBS, followed by incubation with

secondary antibody diluted in PBS (1:400) with 10% normal goat serum for 60 min at room

temperature (goat anti-mouse biotinylated, Dako). Next, streptavidin (1:500 dilution in PBS;

Dako) was added and incubated for 60 min in a humid chamber. 3,3-Diaminobenzidine

(DAB) and H2O2 solutions were added and incubated at room temperature for 6 min.

Sections were counterstained with Lillie-Mayer haematoxylin for 15-30sec, washed in a

running tap water and dehydrated using increasing concentration of ethanol (70%, 90% and

100%) and 3 X 5 min washed with xylene. Slides were mounted with DPX. The area of the

tumour in CAM mesoderm layer was quantified using NDP view imaging software (NDP

scan software v2.2, Hamamatsu Photonics).

Lung tissue microarrays (TMAs)

Ethical approval was obtained from the Royal Adelaide Hospital Human Research Ethics

Committee (140301b). Primary lung adenocarcinoma (ADC) samples were obtained from

107 patients with stage I-III tumours resected at Royal Prince Alfred Hospital, Sydney,

NSW, Australia. A tissue microarray containing representative tumour samples and

matching normal alveolar lung parenchyma and bronchial epithelium from each case were

constructed as previously described (170). Briefly, each core was 1mm in diameter and

consisted of 3-6 tumour core replicates with cores of matching normal control adjacent

tissue. ADC tumours were staged using the AJCC tumour, node and metastasis (TNM)

68
classification. The cohort consisted of 55 (52%) stage I, 39 (37%) stage II and 11 (11%)

stage III tumours.

Immunohistochemistry
Immunohistochemistry was performed to determine A1AT and p53 expression. Slides were

heated at 50οC for 2 hr followed by dewaxing 3X5min in xylene, rehydration 3X5min with

100% ethanol and 2X5min with PBS. Endogenous peroxide activity was quenched by

treating the slides in H2O2 in PBS at room temperature followed by 2X5min wash in PBS.

Next, antigen retrieval was performed in 600ml of 1mM EDTA (pH 8) by heating on high

power until boiling (approximately 5min), allowing slides to stand for 5min before

microwaving at 50% power for an additional 5min. Slides were allowed to cool for

60minutes and washed 2 X 3min in PBS. Sections were encircled with a wax pen and

primary antibody diluted in PBS with 10% normal goat serum was applied overnight at 4οC

(mouse anti-p53 DO-1 1:100 (santa cruz Biotechnology); or mouse anti-A1AT 1:50 (Abcam

ab9399). Slides were washed twice for 5min in PBS, followed by incubation with secondary

antibody diluted in PBS (1:400) with 10% normal goat serum for 60 min at room temperature

(goat anti-mouse biotinylated, Dako). Next, Streptavidin (1:500 dilutions in PBS; Dako) was

added and incubated for 60min in a humid chamber. 3,3-Diaminobenzidine (DAB) and H2O2

solutions were added and incubated at room temperature for 6mins. Sections were

counterstained with Lillie-Mayer haematoxylin for 15-30sec, washed in a running tap water

and dehydrated using increasing concentration of ethanol (70%, 90% and 100%) and

3X5mins washed with xylene. Slides were mounted with DPX.

69
 Image capture and quantification of A1AT and p53 immunostaining
Slides were digitally scanned using NanoZoomer Digital Pathology System (Hamamatsu

Photonics, SZK, Japan). The digitized images were edited to exclude stromal regions. Brown

pixels (A1AT) were extracted from each image using Adobe Photoshop and the colour range

tool and a fuzziness factor of 25 as described previously (171). Extracted pixels were

converted to greyscale format and a consistent threshold was applied. The intensity of A1AT

at the cytoplasm and epithelial-stromal interface was determined using ImageJ software. An

average of the integrated density were quantified per sample. The quantitative scores were

converted into log base 10 values and the average values of each patient sample were

grouped into two categories based on A1AT staining intensity levels, with those tumours

below the median expression level of the cohort defined as ‘low expression’ and those

tumours above the median expression level of the cohort defined as ‘high expression’. Semi-

quantitative analysis was performed for nuclear staining of p53 and scored blind as positive

and negative. Comparison analysis and Kaplan-Meier survival analysis was done using IBM

SPSS statistics 22 software.

In silico analysis of p53 and p63 response elements

p53 and p63 scan (172) were used to identify putative p53-response elements (Res) or 63-

REs in the SERPINA1 gene sequence. Gene sequence was derived from NCBI, with

Aceview used to define the classical promoter region (10kB upstream), intronic regions or

3’ UTR.

70
 Chromatin Immunoprecipitation assays (ChIP)
Following treatments, cells were collected and DNA and proteins were cross-linked by

addition of 1% formaldehyde for 9 min with rotation at room temperature. 625 nM cold

glycine was added to stop the reaction and centrifuged for 5 min at 200 g. Cells were

subsequently washed twice with 50 ml cold PBS. Cell pellets were lysed in 400 μl SDS Lysis

buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.1) with protease inhibitors, followed

by sonication (6 x 15 sec; 30% amplitude, 3 mm tip, Sonics Vibra Cell sonicator). Following

clarification, lysates were diluted 10 fold in dilution buffer (0.01% SDS, 1.1% Triton X-100,

1.2 mM EDTA, 16.7 mM Tris-HCl pH8.1, 167 mM NaCl) and inputs were collected

separately. Lysates were precleared with Protein A sepharose beads with BSA and sonicated

salmon sperm DNA (ssDNA) at 4 oC with rotation for 2 hours. Lysates were subsequently

incubated with 4 μg of anti-p53, anti-p63 or mouse IgG at 4 oC with rotation overnight.

Immune complexes were precipitated with Protein A sepharose with ssDNA at 4 oC with

rotation for 2 hours. Beads were washed once each with low salt immune complex wash

buffer (20 mM Tris-HCl pH 8, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS),

high salt immune complex wash buffer (20 mM Tris-HCl pH 8, 500 mM NaCl, 2 mM EDTA,

1% Triton X-100, 0.1% SDS), LiCl immune complex wash buffer (10 mM Tris-HCl pH 8,

1 mM EDTA, 0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate) and twice with TE buffer

(10 mM Tris-HCl pH 8, 1 mM EDTA). Specific immune complexes were eluted in 250 μL

SDS Elution Buffer (1% SDS, 0.1 M NaHCO3). Cross-links were reversed by addition of 10

μL 5 M NaCl and heating at 65°C for 16 hours, followed by addition of 10 μL 0.5 M EDTA,

20 μL 1 M Tris-HCl pH 6.5 and 4 μL 10 mg/mL Proteinase K and heating at 45°C for 1

hour. DNA was purified using a PCR Purification kit following the manufacturers protocol

71
(Qiagen). Levels of gene specific promoter DNAs were determined by real-time PCR using

primers spanning the p53 response elements (Appendix I). Levels of specific promoter

DNAs were determined by qRT- PCR using primers spanning the p53 response elements.

Soft Agar Colony Formation Assay

To examine anchorage independent growth, 1 x 104 cells were suspended in 0.32% agarose

with medium supplemented with 10% FCS, and seeded in triplicate in 6-well plate pre-

coated with 0.72% agar in complete growth medium and cultured for 14 days at 37oC under

5% CO2. Colonies were stained with 0.005% crystal violet in 20% methanol. Colonies were

photographed and counted from four microscopic fields per well and expressed as mean of

triplicates.

Cell proliferation and cell cycle analysis

To evaluate the direct effect of SERPINA1 on cell proliferation, 1 x 104 cells were seeded in

a 96-well plate. Cell growth was determined using the CellTitre-Glo Luminescent Cell

Viability assay (Promega) as per the manufacturer’s protocol. Briefly, media was removed

from wells, followed by addition of 30 μl fresh media and 30 μl CellTitre-Glo reagents.

Plates were placed on an orbital shaker at ~200 rpm for 2 min followed by equilibration at

room temperature for 10 min. Plates were read on a luminometer (Lumistar Galaxy). For

cell cycle analysis (propidium iodide), cells were harvested and processed (FACS Calibur

flow cytometry, Becton Dickinson Immunocytometry Systems) as previously described

(173).
72
Table 2.1 List of antibodies used throughout the study

Antibody Origin Source Purpose

Western blot
Santa Cruz
α-p53 DO-1 mouse Immunofluorescence
Biotechnology
Immunohistochemistry
Western blot
A1AT rabbit Spring Biosciences
(secretome)
Western blot (cell
lysates)
A1AT mouse Abcam
Immunofluorescence
Immunohistochemitry
β-tubulin rabbit Abcam Western blot
Western blot
Fibronectin rabbit Abcam
Immunofluorescence
Western blot
Vimentin rabbit Abcam
Immunofluorescence
Rabbit Alexa 488 Goat Immunofluorescence
monoclonal
Rabbit Sigma Blocking assay
A1AT antibody
Pan-cytokeratin Mouse Dako Immunohistochemistry

73
Table 2.2 Real-time PCR primers

Primer name Sequence (5’ -> 3’) Direction

PPIG-F CAGATGCAGCTAGCAAACCGTTTG Forward
PPIG-R CTCTTCAGTAGCACTTTCGGAATCAGAGG Reverse
A1AT-F ACTGTCAACTTCGGGGACAC Forward
A1AT-R GGGTCTCTCCCATTTGCCTT Reverse
BIGH3-F AAGGTAACGGCCAGTACACG Forward
BIGH3-R TCGCCTTCCCGTTGATAGTG Reverse
TGFB1-F GTACCTGAACCCGTGTTGCT Forward
TGFB1-R GTATCGCCAGGAATTGTTGC Reverse
TGFBR2-F GGGGAAACAATACTGGCTGATCA Forward
TGFBR2-R GAGCTCTTGAGGTCCCTGTGCA Reverse
SNAI1-F CGCGCTCTTTCCTCGTCAG Forward
SNAI1-R TCCCAGATGAGCATTGGCAG Reverse
SNAI2-F GAGCATTTGCAGACAGGTCA Forward
SNAI2-R ACAGCAGCCAGATTCCTCAT Reverse
ZEB1-F AGCAGTGAAAGAGAAGGGAAT Forward
ZEB1-R GGTCCTCTTCAGGTGCCTCAG Reverse
p21-F TGGACCTGGAGACTCTCAGGGTCG Forward
p21-R TTAGGGCTTCCTCTTGGAGAAGATC Reverse
p63-F TTCTTAGCGAGGTTGGGCTG Forward
p63-R GATCGCATGTCGAAATTGCTC Reverse
Fibronectin-F GTCAGTCAAAGCAAGCCCGG Forward
Fibronectin-R CAGTCCCAGATCATGGAGTC Reverse
Vimentin-F TCCATTGGGTGGGAGAGCCAAGG Forward
Vimentin-R CCAGAGGGAGTGAATCCAGATTA Reverse
Tenascin-F TCTGATGGGGGTGGATGGAT Forward
Tenascin-R TTCAGGTTGTCCAGCCCAAG Reverse
E-cadherin-F GCTTTGACGCCGAGAGCTACAC Forward
E-cadherin-R GTCGACCGGTGCAATCTTCAAA Reverse

74
Table 2.3 ChIP PCR primers

Primer name Sequence (5’ -> 3’) Direction

A1AT-chip-BS1-F GAGACCAATGTCACAGCCCAA Forward
A1AT-chip-BS1-R GCTTTCCCAGCACTCAGATCA Reverse
A1AT-chip-BS2-F TAAAGAAGGGTTGAGCTGGTCC Forward
A1AT-chip-BS2-R TACAGCCTCAGCAGGCAAAG Reverse
A1AT-chip-BS3-F CCCGTGTTTCTCTGGGTGTA Forward
A1AT-chip-BS3-R AAGCCTGTCTCATCTTGCCC Reverse
PLK2-Chip-F CACCCCTAAGCCCCACCCCTTA Forward
PLK2-Chip-R AGGCTTTGCCATTAGCGAGGAGAA Reverse

Table 2.4 List of siRNAs used throughout the study

siRNA name Sequence Direction

p53 siRNA-1 GAGGGAUGUUUGGGAGAUGUA Sense
p53 siRNA-1 UACAUCUCCCAAACAUCCCUC Antisense
p53 siRNA-2 GAGGGAUGUUUGGGAGAUGUA Sense
p53 siRNA-2 UACAUCUCCCAAACAUCCCUC Antisense
p63 siRNA-1 CAUCUGACCUGGCAUCUAAUU Sense
p63 siRNA-1 AAUUAGAUGCCAGGUCAGAUG Antisense
p63 siRNA-2 AGUUGCACUUAUUGACCAUUU Sense
p63 siRNA-2 AAAUGGUCAAUAAGUGCAACU Antisense

75
76
77
Chapter 3: Characterization of mutant p53 secretome

Preface
This chapter describes extensive research to understand how mutant p53 influences the

global cancer cell secretome. First, the secretome of mutant p53 from inducible EI H1299

cell lines were demonstrated to drive the release of pro-invasive extracellular secreted

factors. Further to this, extracellular secreted factors induced by two-hotspot p53 mutants

pR175H and R248Q, were characterized and compared using quantitative proteomic

analysis. The association of the identified secreted protein with their biological functions,

disease, and signaling pathways were determined. The chapter analyzes the overlap between

these identified secreted proteins with their corresponding genes that were previously

identified by our laboratory using expression array analysis. A significant overlap is

identified, and a new mechanism is suggested, whereby mutant p53 modulates the

expression of secretory genes to alter the tumour microenvironment. Through proteomics

and transcriptomic analyses, the alpha-1 antitrypsin (A1AT) protein is identified as a

secreted target of mutant p53 with oncogenic potential. The findings from this chapter form

the basis for the work discussed in chapter 4, 5 and 6.

78
3.2 Introduction
Missense mutations in the TP53 tumour suppressor gene inactivate its anti-tumourigenic

properties and endow the incipient cells with newly acquired gain-of-function (GOF)

properties that drive invasion and metastasis (174). The identification of the commonalities

in the mechanisms through which mutant p53 proteins function, and targeting these

downstream pathways offers a promising approaches for the treatment of mutant p53

expressing tumours. Experimental approaches using genomics and proteomics have

identified numerous targets and pathways that are controlled by mutant p53 (144, 158, 159,

164). Such targets serve as a potential platform for the development of p53 based cancer

therapy. Mutant p53 has been shown to regulate oncogenic effects such as cellular invasion,

however, it is unclear whether the impact is primarily mediated through intracellular means

or extracellular secreted factors induced by mutant p53.

The development of tumour metastasis depends on the mutual communication between

cancer cells and their stromal environment. The molecular interaction of tumour cells with

the host cells and extracellular matrix (ECM) enable the tumour cells to acquire a more

aggressive phenotype that favors ECM remodeling, host tissue degradation, immune evasion

and increased motility and angiogenesis, all of which are essential for metastasis (175). It is

generally believed that tumour derived secreted factors plays a critical role in the process of

tumourigenesis. A plethora of secreted proteins have been shown to induce direct cell-cell

and cell-environment interactions that promote cancer cell dissemination. These include

molecules like growth factors, cell motility factors, immune-regulatory cytokines, proteases

and protease inhibitors, which are vital for cancer progression and metastasis (176). Several
79
studies have demonstrated the involvement of mutant p53 in regulation of cancer cell

secreted enzymes, proteins and inflammatory cytokines that alter the tumour

microenvironment (177). For example, mutant p53 can represses the transcription of TIMP

(issue inhibitor of metalloproteinases (TIMP)-3 and secreted interleukin-1 receptor

antagonist (sIL-1Ra) leading to increased secretion of MMPs (178) and IL-1 response (179).

Such tumour derived secreted factors can not only remodel the local microenvironment for

tumour spreading but can alter distant tissues for the establishment of pre-metastatic niche.

Overall, the cancer cell secretome constitutes a rich source of information for the

identification of biomarkers and signal transduction targets of therapeutic benefit, and thus

is a topic of great interest for cancer research (176, 180).

Proteomics provide a powerful way for comprehensive analysis and comparison of the

secreted protein complement in different cell lines, tissues or organs. With recent

advancement in quantitative proteomics based approaches, a number of studies have

characterized the cancer cell secretome associated with cancer progression (181-185), which

have enlightened our understanding on the role of secreted proteins in cancer. Despite the

diagnostic and therapeutic applications of secreted proteins, the global impact of mutant p53

on the cancer cell secretome has not been studied. A possible GOF mechanism of mutant

p53 may involve oncogenic secreted factors that regulate cell autocrine/paracrine signaling

into the surrounding environment. Indeed, using a combination of DNA bindings studies and

transcriptome profiling, our laboratory has previously shown that mutant p53 protein can

regulate the expression of genes that encode secreted protein products (166). Additionally,

it has also been demonstrated that these secreted factors can drive the surrounding cells in
80
the tumour microenvironment to become highly invasive, providing a plausible mechanism

for mutant p53 secretome to promote invasion of tumours (166).

Thus, implementing combined proteomic approaches with mass spectrometry (LC-MS/MS)

in mutant p53 secretome samples has the potential to identify critical secreted targets of

mutant p53. As such, the use of label-based approach, such as iTRAQ labeling that

incorporates stable isotopes into an NHS-ester derivative amine tagging reagent, is ideally

suited for comparative proteomic applications as it provides both quantitation and

multiplexing in a single reagent (186, 187).

Importantly, it is also necessary to employ such tools on the system that allows for direct

analysis of the consequences of p53 expression and allows the comparison between the

expressions of different p53 hotspot mutants in a common genetic background. To overcome

this challenge, our laboratory has previously generated a panel of isogenic H1299 derivatives

with the inducible expression of several common cancer-associated p53 mutants (167). This

system was also used for the investigation of global gene regulatory network of mutant p53

(166). The study of mutant p53 driven outcome on cancer cell secretome has the potential

to determine the diagnostic biomarkers and signal transduction targets for which

pharmacological protein inhibitors or activators could be designed. In addition, p53

mutations are predominantly found in the early invasive stage of lung carcinomas (188),

hence the identification of key regulatory pathways that mediate the mutant p53 GOF

properties may uncover new targets for lung cancer therapy.

81
In this chapter the secreted proteins present in the conditioned medium of inducible H1299

cell lines expressing either the mutant p53 R175H or R248Q are characterized and quantified

using iTRAQ-based combined proteomics approach. Through additional transcriptomic

analyses of mutant p53 induced gene network, a new mechanism for mutant p53 GOF is

suggested whereby mutant p53 modulates the extracellular environment by altering the

expression of genes that encode secreted proteins. Hence, this chapter also contains the data

that further supports and contributes to research previously performed in our laboratory and

published in Oncotarget (166). In addition, a novel target, alpha-1 antitrypsin is identified

as an overrepresented protein indicating a possible oncogenic role in mutant p53 GOF. The

following chapter will investigate in more detail the role of A1AT in mutant p53 induced

tumourigenesis.

82
3.3 Results

3.3.1 Mutant p53 drives the release of pro-invasive factors

Using an xCelligence (Roche) invasion assay, our laboratory has previously shown that

mutant p53 cell lines produce a pro-invasive secretome (166). Therefore, it was of interest

to further these findings using a matrigel based inversion invasion assay (189). Matrigel acts

as a surrogate basement membrane and supports cell growth and survival. While the

advantage of using an inversion invasion assay is that it allows visualization and

quantification as well as reconstruction of z-series image stacks into three-dimensional

representations for visualization of cells invading into the matrigel, which recapitulates the

tumour microenvironment. Conditioned medium was collected from either un-induced or

induced EI-H1299 p53 R248Q mutant cells following 72 hours of induction with PonA. The

conditioned media were separately added in a 50:50 dilutions to the primary lung cancer cell

lines, H1299 p53 null (NSCLC) and SBC-3 p53 wild-type (small cell lung cancer, SCLC)

and incubated for an additional 72 hours. Incubation of lung cancer cells in conditioned

medium from H1299 cells with induced expression of p53 R248Q mutant increased their

capacity to invade through matrigel, compared with the conditioned media from the un-

induced EI-H1299 R248Q cells (Figure 3.1). These observations provide additional evidence

for a role of mutant p53 in the induction of a pro-invasive cancer cell secretome.

In the following section, the extracellular proteins secreted by induced mutant p53 are

identified and their association is analyzed with signaling pathways and transcriptomic

changes to identify novel secreted targets of mutant p53.

83
Figure 3.1. Mutant p53 induces a pro-invasive secretome

EI-H1299 cells with inducible expression of p53 mutant R248Q were cultured in the

presence of PonA (2.5 μg/ml) or vehicle control (ethanol) for 72 hours. Independent cultures

of H1299 or SBC-3 were grown in a dilution (50:50) of this conditioned media (CM) and

their invasion into the matrigel was quantified as described in the experimental procedures.

Data presented as means ± standard error of mean (SEM) from three independent replicates.

**P < 0.005. Representative z-stack images of invading cells are shown (right).

84
3.3.2 iTRAQ based quantitative analysis of mutant p53 secretome

To identify and quantify the critical extracellular factors released by mutant p53, an iTRAQ

(isobaric tag for relative and absolute quantitation) based labeled proteomic approach

combined with liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis

was employed. Previous studies that investigate the influence of mutant p53 on cellular

proteome using cell lysates have focused on single p53 mutant or multiple genetic

backgrounds. To overcome these challenges, to comprehensively investigate the impact of

mutant p53 on the cellular secretome, quantitative proteomics analysis was performed using

the conditioned medium from two EI-H1299 p53 mutant cell lines. The mutants investigated

were two hot spot mutants; one structural (R175H) and other DNA contact (R248Q). Each

cell line was cultured in serum-free medium in the presence or absence of PonA for 72 hours

prior to harvesting medium for analysis of secreted proteins. The relative abundances of

proteins in the induced conditioned medium were compared to those in their un-induced

counterparts.

Based on LC-MS/MS data, a total of 85 and 106 proteins respectively were identified as

aberrantly secreted by induced p53 R175H and R248Q mutants with at least 95%

confidence, compared with their un-induced controls. The identified proteins were further

selected to eliminate false positive signals using a criteria of P < 0.05 and fold change of

>1.6 or <1.6 to represent ‘significantly altered (up-or down-regulated)’ proteins. A total of

49 significantly altered proteins were identified as secreted by induced p53 R175H mutant

compared with the un-induced control (Figure 3.2A, Table 3.1). Similarly, expression of p53

85
R248Q mutant resulted in secretion of 46 significantly altered proteins compared with the

un-induced control (Figure 3.2A, Table 3.1). Of these significantly altered proteins, several

proteins previously reported to be involved in cancer metastasis, such as DKK1, LAMC2,

A1AT and BIGH3 were identified (190-193). In addition, there were 12 proteins that were

significant common between the two-p53 mutants (Figure 3.2B). These included 2 activated

proteins and 8 repressed proteins (Table 3.2). This data indicates that the secreted factors

released by mutant p53 protein may be conserved across the hotspot mutants.

86
Figure 3.2 Identification of mutant p53 induced secreted factors

(A) Schematic workflow of iTRAQ LC-MS/MS quantitative proteomics performed.

(B) Two-way venn diagram representing the number of proteins that were significantly

activated or repressed between two p53 mutants (R175H and R248Q), with criteria of P <

0.05 and fold change >1.6 or <1.6.

87
Table 3.1. List of significantly up- and down-regulated secreted protein from induced versus

un-induced EI-H1299 R175H and R248Q with criteria of P<0.05 and fold change >1.6 or

<1.6

Protein name Gene name R175H

Activated proteins
A1AT SERPINA1 P01009 3.00
BGH3 TGFBI Q15582 2.16
IBP6 IGFBP6 P24592 2.09
SCRN1 SCRN1 Q12765 2.00
FBN1 FBN1 P35555 1.88
LTBP1 LTBP1 Q14766 1.84
PCDG3 PCDHGA3 Q9Y5H0 1.81
RS4X RPS4X P62701 1.76
Repressed proteins
COCH COCH O43405 0.62
H32 HIST2H3A Q71DI3 0.61
VAT1 VAT1 Q99536 0.61
CD44 CD44 P16070 0.61
FABP5 FABP5 Q01469 0.61
VIME VIM P08670 0.60
ITM2B ITM2B Q9Y287 0.59
DJB11 DNAJB11 Q9UBS4 0.59
TKT TKT P29401 0.59
PLTP PLTP P55058 0.58
DCBD2 DCBLD2 Q96PD2 0.58
PSA4 PSMA4 P25789 0.58
NP1L1 NAP1L1 P55209 0.57
CALR CALR P27797 0.57
1433T YWHAQ P27348 0.56
DPEP3 DPEP3 Q9H4B8 0.56
COF1 CFL1 P23528 0.56
PROF1 PFN1 P07737 0.55
PGAM1 PGAM1 P18669 0.54
ENOA ENO1 P06733 0.54
TPD54 TPD52L2 O43399 0.54
CATD CTSD P07339 0.54
LMNA LMNA P02545 0.54
TCEA1 TCEA1 P23193 0.53

88
 PPIA PPIA P62937 0.52
GLCM GBA P04062 0.52
G6PI GPI P06744 0.49
CATC CTSC P53634 0.48
BTF3 BTF3 P20290 0.47
IMB1 KPNB1 Q14974 0.47
TPIS TPI1 P60174 0.47
FAM3C FAM3C Q92520 0.46
HNRPQ SYNCRIP O60506 0.45
CLC11 CLEC11A Q9Y240 0.43
LDHA LDHA P00338 0.43
LDHB LDHB P07195 0.41
CO6A1 COL6A1 P12109 0.41
AT1B3 ATP1B3 P54709 0.34
PPIB PPIB P23284 0.34
RS27A RPS27A P62979 0.28
GELS GSN P06396 0.26

Protein name Gene name R248Q

Activated proteins
A1AT SERPINA1 P01009 21.63
CCD80 CCDC80 Q76M96 6.44
FETUA AHSG P02765 3.96
SFRP1 SFRP1 Q8N474 3.75
STC1 STC1 P52823 3.71
BGH3 TGFBI Q15582 2.44
ANGL4 ANGPTL4 Q9BY76 2.09
AKA12 AKAP12 Q02952 2.08
ITA3 ITGA3 P26006 1.96
LAMC2 LAMC2 Q13753 1.95
CBPA4 CPA4 Q9UI42 1.93
A2MG A2M P01023 1.69
GRP78 HSPA5 P11021 1.63
ICAM1 ICAM1 P05362 1.62
Repressed proteins
COIA1 COL18A1 P39060 0.62
DJB11 DNAJB11 Q9UBS4 0.62
ADAM9 ADAM9 Q13443 0.61
DCBD2 DCBLD2 Q96PD2 0.61
TPA PLAT P00750 0.59
89
 PPIB PPIB P23284 0.59
GPR56 GPR56 Q9Y653 0.59
CLC11 CLEC11A Q9Y240 0.58
G3P GAPDH P04406 0.57
LOXL2 LOXL2 Q9Y4K0 0.56
FBLN1 FBLN1 P23142 0.56
ITA6 ITGA6 P23229 0.55
LTBP2 LTBP2 Q14767 0.54
VGF VGF O15240 0.54
H15 HIST1H1B P16401 0.52
UROK PLAU P00749 0.52
GDN SERPINE2 P07093 0.51
PLTP PLTP P55058 0.51
CATC CTSC P53634 0.50
DPEP3 DPEP3 Q9H4B8 0.48
SRPX SRPX P78539 0.47
NOV NOV P48745 0.47
H13 HIST1H1D P16402 0.46
FAM3C FAM3C Q92520 0.46
TENA TNC P24821 0.46
LTBP1 LTBP1 Q14766 0.45
MMP1 MMP1 P03956 0.39
CO6A1 COL6A1 P12109 0.37
H2B1N HIST1H2BN Q99877 0.25
H32 HIST2H3A Q71DI3 0.25
GELS GSN P06396 0.22
H4 HIST1H4A P62805 0.19

90
Table 3.2. List of significantly activated and repressed secreted proteins common between

two induced p53 mutants, EI-H1299 R175H and EI-H1299 R248Q, with criteria of P<0.05

and fold change >1.6 or <1.6.

Protein name Gene name R175H R248Q

Activated proteins
A1AT SERPINA1 P01009 3.00 21.63
BGH3 TGFBI Q15582 2.16 2.44
Repressed proteins
H32 HIST2H3A Q71DI3 0.61 0.25
PLTP PLTP P55058 0.58 0.51
DCBD2 DCBLD2 Q96PD2 0.58 0.61
DPEP3 DPEP3 Q9H4B8 0.56 0.48
CATC CTSC P53634 0.48 0.50
FAM3C FAM3C Q92520 0.46 0.46
CLC11 CLEC11A Q9Y240 0.43 0.58
CO6A1 COL6A1 P12109 0.41 0.37
PPIB PPIB P23284 0.34 0.59
GELS GSN P06396 0.26 0.22

91
3.3.3 Bioinformatics analysis and profiling of the mutant p53 induced secreted

proteins

For initial validation of these identified proteins, Gene Ontology (GO) analysis was

performed to classify proteins based on their cellular localization. GO cellular component

analysis indicated that, in both p53 mutant cell lines, the most significantly overrepresented

localization was “extracellular region” (P= 2.14E-13 and P = 1.71E-16 for p53 R175H and

p53 R248Q, respectively), confirming the efficacy of the experimental approach employed

to identify secreted proteins (Figure 3.3A). These secreted proteins were also identified to

be significantly associated with the disease “Cancer” (Figure 3.3B).

Furthermore, molecular and cellular function analysis confirmed that ontologies pertinent to

tumourigenesis and metastasis, such as “Cellular growth and proliferation”, “Cell death and

survival” and more specifically “Cellular movement” were enriched in conditioned medium

of both induced p53 mutants (Figure 3.3C, Table 3.3). Interestingly, Ingenuity Pathway

Analysis (IPA) revealed that ~50% of these significantly altered proteins in the secretome

of both induced p53 mutants belonged to the functional class of “cellular movement” which

is consistent with the experimental findings that the mutant p53 secretome can drive an

invasive phenotype of lung cancer cells. The cancer/metastasis associated GO biological

processes enriched in conditioned medium of p53 R248Q mutants included “cellular

structure organization”, “wound response”, “response to stress”, “migration” and

“adhesion”, while proteins in p53 R175H mutant were largely involved in “metabolic

processes” (Figure 3.3D). Notably, one ontology was significantly overrepresented in the

92
proteins of both p53 mutants - “Extracellular structure organization” (16.3% (P = 2.19E-2)

and 36.4% (P = 2.75E-13), for p53 R175H and R248Q, respectively), indicating the possible

involvement of mutant p53 secreted proteins in lung cancer metastasis and lung tissue

biology or structure (Figure 3.3D).

To further investigate and compare globally enriched pathways, Ingenuity Pathways analysis

(IPA) was performed. IPA analysis further confirmed the biological relevance of those

identified secreted proteins with their canonical pathways. Interestingly, pathways such as

“coagulation system”, “role of osteoblast, osteoclasts and chondrocytes”, “tissue factor in

cancer”, “oncostatin M” and “integrin signaling” were found to be significantly enriched in

the secreted proteins of p53 R248Q, while proteins of p53 R175H were largely involved in

glycolysis, gluconeogenesis and metabolic processes (Figure 3.3E). Similarly, one pathway

was significantly overrepresented in CM of both mutants – “Regulation of actin based

motility by RhoA” (P = 1.38E-03 and P = 1.73E-02, for p53 R175H and R248Q,

respectively).

While significant overlap was observed between the proteins in terms of overrepresentation

in bio-function and pathways, only two proteins was observed to be significantly up

regulated between the conditioned medium of the two p53 mutants- A1AT and BIGH3

(Table 3.2). Accordingly, the IPA protein networks of the secreted proteins were found to

be densely interconnected, with each containing “SERPINA1 (gene that encode A1AT

protein)” consisting of 3 and 10 connections in p53 R175H and p53 R248Q induced proteins.

93
Taken together, GO analysis and IPA strongly suggest that the secretome of two p53 mutants

do indeed consist of a high percent of secreted proteins involved in cancer generally, and

metastasis/lung biology and lung tissue structure specifically (Figure 3.3F).

94
B

95
D

96
F (i) EI-H1299 R175H

97
(ii) EI-H1299 R248Q

Figure 3.3 iTRAQ based Quantitative secretome analysis

(A) iTRAQ proteomics identified mutant p53 induced secreted proteins were subjected to

Gene Ontology Cellular compartment (localization) analysis. Percentage (left) and

significance (right) of the most highly overrepresented cellular component in each mutants

98
(ECR-Extracellular region), is shown. The dashed line represents significance cutoff

(P=0.05).

(B) Blue bars that cross the threshold line (P < 0.05) represent top diseases and functions

that are significantly changed in the secretome of two p53 mutants (R175H (left) and R248Q

(right)) H1299 cells. Data was analyzed through the use of ingenuity pathway analysis.

(C) Ingenuity pathway analysis (Ingenuity Systems, http://www.ingenuity.com). Bars (P

<0.05) representing molecular and cellular functions significantly altered (activated and

repressed) in cell secretome following mutant p53 induction.

(D) The proteins were subjected to Gene Ontology (GO) database for significantly

overrepresented biological processes in the secretome of two p53 mutants (R175H (left) and

R248Q (right)) H1299 cells. The dashed line represents significance cutoff (P =0.05), and

green text indicates overrepresentation in both p53 mutants.

(E) The proteins were subjected to Ingenuity Pathway Analysis (IPA) for significantly

overrepresented IPA canonical pathways in the secretome of two p53 mutants (R175H (left)

and R248Q (right)) H1299 cells. The dashed line represents significance cutoff (P =0.05),

and red text indicates overrepresentation in both p53 mutants.

(F) The most significant IPA networks are shown for proteins in each mutants (i) EI-H1299

R175H (top) and (ii) EI-H1299 R248Q with the “SERPINA1 (encode for A1AT)”

connectivity node being highlighted with additional text in each case

99
Table 3.3. Molecular and Cellular function analysis of significantly altered proteins

(Ingenuity Pathway analysis; IPA).

%
No. of
Category p-value Molecules protein
Molecules
s
R175H
DCBLD2,FBN1,CLEC11A,YWH
AQ,COCH,PPIA,PPIB,CD44,GB
Cellular 4.72E-07-
A,TGFBI,LMNA,CALR,VIM,CFL 23 46.9
Movement 9.46E-03
1,PFN1,GSN,SERPINA1,CTSC,F
ABP5,CTSD,PLTP,GPI,IGFBP6
YWHAQ,COL6A1,TGFBI,LMNA
,TPD52L2,VIM,CFL1,PFN1,FAB
Cellular P5,CTSD,ENO1,NAP1L1,GPI,IG
9.39E-07-
Growth and FBP6,DCBLD2,FBN1,CLEC11A, 28 57.1
9.42E-03
Proliferation PSMA4,PPIA,PPIB,CD44,CALR,
GSN,LDHA,SERPINA1,CTSC,RP
S4X,LTBP1
YWHAQ,COL6A1,PCDHGA3,L
MNA,TGFBI,VIM,CFL1,FABP5,
ENO1,CTSD,GPI,IGFBP6,FBN1,
Cell Death 5.59E-07-
CLEC11A,COCH,BTF3,PPIA,PPI 29 59.2
and Survival 9.42E-03
B,CD44,GBA,KPNB1,CALR,GS
N,LDHA,SERPINA1,CTSC,PLTP,
ITM2B,LTBP1
FBN1,CLEC11A,COCH,PPIA,CD
Cell-To-Cell
1.95E-04- 44,TGFBI,CALR,VIM,CFL1,PFN
Signaling and 18 36.7
9.42E-03 1,GSN,CTSC,SERPINA1,FABP5,
Interaction
CTSD,PLTP,GPI,LTBP1
TCEA1,CLEC11A,YWHAQ,COC
H,COL6A1,PPIA,CD44,LMNA,C
Cellular 3.35E-05- ALR,VIM,SYNCRIP,CFL1,PFN1,
22 44.9
Development 7.07E-03 GSN,SERPINA1,FABP5,CTSD,N
AP1L1,ENO1,GPI,LTBP1,IGFBP
6
TCEA1,FBN1,DCBLD2,PPIB,CD
Cell 1.64E-05- 44,GBA,TGFBI,LMNA,KPNB1,V
18 36.7
Morphology 9.42E-03 IM,CALR,SYNCRIP,CFL1,PFN1,
GSN,CTSD,GPI,ITM2B
100
 Cellular
FBN1,CD44,LMNA,TGFBI,KPN
Assembly 1.68E-06-
B1,VIM,CALR,CFL1,PFN1,GSN, 13 26.5
and 9.42E-03
CTSD,GPI,ITM2B
Organization
R248Q
PLAU,ITGA3,SERPINE2,SFRP1,
STC1,VGF,ANGPTL4,TGFBI,A2
M,AKAP12,TNC,LTBP2,ADAM
Cellular 1.73E-17- 9,DCBLD2,CLEC11A,ITGA6,PL
32 69.6
Movement 2.21E-03 AT,PPIB,GPR56,COL18A1,NOV
,FBLN1,LAMC2,LOXL2,GSN,HS
PA5,SERPINA1,CTSC,AHSG,IC
AM1,MMP1,PLTP
PLAU,ITGA3,COL6A1,SERPINE
2,SFRP1,HIST1H1B,STC1,VGF,
ANGPTL4,TGFBI,A2M,AKAP12
Cellular
4.75E-12- ,TNC,ADAM9,DCBLD2,CLEC11
Growth and 33 71.7
2.17E-03 A,ITGA6,PLAT,PPIB,GPR56,NO
Proliferation
V,COL18A1,FBLN1,LOXL2,GSN
,HSPA5,SERPINA1,CTSC,GAPD
H,AHSG,ICAM1,MMP1,LTBP1
PLAU,ITGA3,COL6A1,SERPINE
2,SFRP1,STC1,VGF,ANGPTL4,T
GFBI,A2M,SRPX,AKAP12,TNC,
Cell Death 2.85E-12- CLEC11A,ITGA6,PLAT,PPIB,GP
32 69.6
and Survival 2.17E-03 R56,NOV,COL18A1,FBLN1,LO
XL2,GSN,HSPA5,CCDC80,SERP
INA1,CTSC,GAPDH,ICAM1,M
MP1,PLTP,LTBP1
PLAU,ITGA3,SERPINE2,SFRP1,
STC1,VGF,TGFBI,A2M,AKAP12
Cell-To-Cell ,TNC,LTBP2,ADAM9,CLEC11A,
5.42E-09-
Signaling and ITGA6,PLAT,GPR56,PPIB,NOV, 30 65.2
2.45E-03
Interaction COL18A1,LAMC2,LOXL2,GSN,
HSPA5,CTSC,SERPINA1,AHSG,
ICAM1,MMP1,PLTP,LTBP1
PLAU,ITGA3,COL6A1,SERPINE
2,SFRP1,STC1,VGF,ANGPTL4,T
GFBI,A2M,AKAP12,TNC,ADA
Cellular 9.8E-09-
M9,CLEC11A,ITGA6,PLAT,COL 27 58.7
Development 2.19E-03
18A1,NOV,LOXL2,GSN,HSPA5,
CCDC80,GAPDH,AHSG,ICAM1
,MMP1,LTBP1
101
 DCBLD2,PLAU,ITGA3,ITGA6,S
ERPINE2,SFRP1,PLAT,VGF,PPI
Cell 5.45E-06-
B,ANGPTL4,COL18A1,NOV,TG 21 45.7
Morphology 2.45E-03
FBI,A2M,FBLN1,SRPX,AKAP12
,GSN,TNC,ICAM1,LTBP2
ADAM9,PLAU,ITGA3,ITGA6,SE
Cellular RPINE2,SFRP1,PLAT,STC1,VGF
Assembly 7.74E-07- ,ANGPTL4,COL18A1,TGFBI,A2
22 47.8
and 2.17E-03 M,AKAP12,LOXL2,GSN,HSPA5
Organization ,TNC,GAPDH,ICAM1,MMP1,L
TBP2

3.3.4 Validation of Mutant p53 induced secreted proteins in experimental and array

datasets

To further validate the identified mutant p53 induced secreted factors, the extent of

transcriptomic expression of genes encoding those identified secreted proteins was

investigated in microarray datasets. Previously, our laboratory has analyzed the

transcriptome changes induced by mutant p53 using the same inducible p53 mutant cell lines

(166). Therefore, we analyzed the overlap of mutant p53 induced secreted proteins with the

genes that were previously identified by the expression array analysis. The transcriptomic

dataset consisted of 50 genes significantly (1.6 fold) up or downregulated by p53 R175H

mutant of which 10 encode secreted proteins, while p53 R248Q mutants regulated 99 genes

of which 28 encode secreted proteins. Two (20%) and eight (29%) of these secreted proteins

regulated by induced p53 R175H and p53 R248Q mutants were found in the list of

significantly regulated proteins identified by proteomic analysis (Figure 3.4A). These

secreted proteins in common were significantly enriched with proteins up regulated by

102
mutant p53 with >1.6 fold. Conversely, the down-regulated or repressed proteins detected

by proteomics did not have corresponding genes in the microarray dataset (Figure 3.4A).

Interestingly, two proteins were robustly enriched in the conditioned medium of both p53

mutants as well as in expression array datasets: A1AT and BIGH3 (Figure 3.4B).

103
 A

Figure 3.4. Mutant p53 secreted proteins overlap with target genes in expression array

analysis

(A) Two way venn diagram representing the overlapping genes (secreted) and proteins in

EI-H1299 p53 R175H and Ei-H1299 R248Q mutants. R248Q) as derived from microarray

(166) and proteomics with criteria of P < 0.05 and fold change >1.6 or <1.6. Cellular

localization of the identified target was derived from Genecard Human Database.

(B) Differentially expressed proteins were further compared against their genes identified in

previous microarrays (166) and two commonly activated proteins were identified whose

expression was determined by qRT-PCR.

104
Table 3.4. List of secreted mutant p53 175H targets that were previously identified using

expression array analysis (166). Information on cellular localization of the identified target

was derived from Genecard Human Database. The blue text indicates those genes whose

protein product was also present in the proteomic analyses.

Accession Gene Name Gene Cellular

Number Symbol Localizatio
n
NM_199511 coiled-coil domain containing 80 CCDC80 secreted
NM_012242 dickkopf homolog 1 (Xenopus laevis) DKK1 secreted
NM_005860 follistatin-like 3 (secreted glycoprotein) FSTL3 secreted
NM_152637 methyltransferase like 7B METTL7B secreted
NM_002905 retinol dehydrogenase 5 (11-cis/9-cis) RDH5 secreted
NM_00100223 serpin peptidase inhibitor, clade A (alpha- SERPINA1 secreted
6 1 antiproteinase)
NM_003012 secreted frizzled-related protein 1 SFRP1 secreted
NM_006528 tissue factor pathway inhibitor 2 TFPI2 secreted
NM_000358 transforming growth factor, beta-induced, TGFBI secreted
68kDa
NM_005562 laminin, gamma 2 LAMC2 secreted

105
Table 3.5. List of secreted mutant p53 248Q targets that were previously identified using

expression array analysis. Information on Cellular localization was derived from NCBI gene

entry or Genecard. The blue texts represent those genes whose protein product is present in

proteomic analysis.

Accession Gene Name Gene Cellular

Number Symbol Localization
NM_199511 coiled-coil domain containing 80 CCDC80 secreted
NM_012242 dickkopf homolog 1 (Xenopus laevis) DKK1 secreted
NM_005860 follistatin-like 3 (secreted glycoprotein) FSTL3 secreted
NM_152637 methyltransferase like 7B METTL7 secreted
B
NM_002905 retinol dehydrogenase 5 (11-cis/9-cis) RDH5 secreted
NM_00100223 serpin peptidase inhibitor, clade A (alpha- SERPINA secreted
6 1 antiproteinase) 1
NM_003012 secreted frizzled-related protein 1 SFRP1 secreted
NM_006528 tissue factor pathway inhibitor 2 TFPI2 secreted
NM_000358 transforming growth factor, beta-induced, TGFBI secreted
68kDa
NM_005562 laminin, gamma 2 LAMC2 secreted
NM_021021 syntrophin, beta 1 (dystrophin-associated SNTB1 secreted
protein A1, 59kD)
NM_003155 stanniocalcin 1 STC1 secreted
NM_139314 angiopoietin-like 4 ANGPTL secreted
4
NM_005347 heat shock 70kDa protein 5 (glucose- HSPA5 secreted
regulated protein, 78k)
NM_003619 protease, serine, 12 (neurotrypsin, PRSS12 secreted
motopsin)
NM_006379 sema domain, immunoglobulin domain SEMA3C secreted
(Ig), short basic domain
NM_003326 tumour necrosis factor (ligand) TNFSF4 secreted
superfamily, member 4
NM_006226 phospholipase C-like 1 PLCL1 secreted
NM_001645 apolipoprotein C-I APOC1 secreted
NM_001785 cytidine deaminase CDA secreted
NM_152644 family with sequence similarity 24, FAM24B secreted
member B

106
NM_001657 amphiregulin (schwannoma-derived AREG secreted
growth factor)
NM_00101230 arylsulfatase family, member I ARSI secreted
1
NM_015036 endonuclease domain containing 1 ENDOD1 secreted
NM_002317 lysyl oxidase LOX secreted
NM_015274 mannosidase, alpha, class 2B, member 2 MAN2B2 secreted
BC111960 wingless-type MMTV integration site WNT9A secreted
family, member 9A
NM_014143 CD274 molecule CD274 secreted

107
3.3.5 Identification of potential secreted target of mutant p53
A quantitative proteomic approach was used to provide an insight into potential molecular

pathways and signal transduction targets that are aberrantly regulated by mutant p53 in

H1299 NSCLC. This thesis is specifically aimed at identifying the critical mediator(s) of

mutant p53 GOF that can serve as a potential therapeutic target for the treatment of mutant

p53 expressing tumours. Our findings so far demonstrate that individual mutant p53 variants

can each drive a variable secretome however, there is an overlap in between target proteins

and their corresponding mRNA expression levels for a particular mutant.

Two proteins, Alpha-1 Antitrypsin (A1AT) and BIGH3 were the only proteins in common

to the conditioned medium of both p53 mutants, and in addition the encoding genes were

significantly over-expressed in the transcriptome of these two mutants. Secreted A1AT

(encoded by SERPINA1) has been reported to enhance the metastatic potential of lung

adenocarcinoma (192). Similarly, BIGH3 (encoded by TBFBI) has been reported to promote

metastasis of colon cancer by enhancing cell extravasation (193). These reports are

consistent with the hypothesis that missense mutant p53s can drive the expression of specific

secreted proteins that can modulate the extracellular environment to drive tumourigenesis.

Since A1AT consistently showed the highest expression differences in the secretome

between induced and un-induced mutant p53s this was the focus for subsequent studies that

aims at identifying the secreted mediator of mutant p53 GOF with the therapeutic potential.

The A1AT protein has been reported to be up regulated in multiple cancer types (194-196),

but to date the expression of A1AT has not been related to the presence of mutant p53.

108
To confirm the increased expression levels of A1AT observed in the LC-MS/MS analyses,

the expression of A1AT was validated in the same EI-H1299 cell lines expressing p53

R175H and R248Q mutants using immunofluorescence. H1299 cell lines not expressing

mutant p53 had low levels of A1AT but these levels were increased in the cytoplasmic

membrane of the cells upon induction of the mutant p53 with PonA (Figure 3.5A). Next, to

test our hypothesis that A1AT expression is conserved across different p53 mutants, A1AT

mRNA and secreted protein abundance levels were determined in a panel of isogenic H1299

p53 null cell line with inducible expression of eight common hotspot p53 mutants: R249S,

R175H, R282W, G245S, R248W, R248Q, R273H and R273C using qRT-PCR and western

blot analysis. A1AT mRNA and secreted protein abundance was variably but consistently

up-regulated in the conditioned medium of all of the eight induced mutant p53 H1299 cells

compared to the un-induced control cells (Figure 3.5B). This demonstrates that mutant p53

driven expression of the A1AT protein is highly conserved across different missense mutant

p53s.

109
 A B

Figure 3.5 Expression of A1AT is driven by eight different hotspot p53 mutations

(A) Immunofluorescence image representing expression of A1AT levels and p53 proteins

expression in the cell lysates of two p53 mutants inducible H1299 cell lines: R248Q (top)

and R175H (bottom).

(B) Real time qRT-PCR and western blot analysis of secreted A1AT in the conditioned

medium (equal volume loaded) and p53 protein in the cell lysates of a panel of inducible

p53 mutant H1299 cell lines. β-tubulin was used as a loading control.

110
3.4 Discussion
In this study, we have presented what is, to our knowledge, the first analysis of proteins that

are specifically secreted by two-hotspot mutant p53s (R175H and R248Q). With the use of

inducible overexpression of mutant p53, in conjunction with iTRAQ based quantitative

proteomic approach, this study globally profiled the secreted proteins that were induced by

two p53 mutants R175H and R248Q in H1299 cells.

Ingenuity Pathways Analysis of the secreted proteins identified significant overlap in the

pathways associated with the secreted proteins. Pathways and proteins with molecular

functions related to “cell growth and proliferation”, “cell death and survival” and “cellular

movement” were overrepresented in the secretome of both hotspot p53 mutants. The global

enrichment of GO biological processes related to extracellular structure component and

canonical pathways related to actin based motility by RhoA were observed in the secretome

of both p53 hotspot mutants. RhoA regulates the aggregation of the actin filament skeleton

and affects cell movement, adhesion in the cell-cell or cell –matrix and the reconstruction of

extracellular matrix (197, 198). Additionally, recent studies also showed that the activation

of RhoA by mutant p53 contributes to the GOF of mutant p53 in tumour proliferation,

invasion and metastasis (199-201). Future studies will be required to determine if mutant

p53 induced secreted proteins are involved in the regulation of the RhoA pathways.

Moreover, it is of note that the GO biological processes and canonical pathways of p53

R175H mutants were highly enriched with processes and pathways associated with glucose

metabolism. Recent studies have shown that tumour associated mutant p53 can stimulate the

Warburg effect; much higher levels of glucose uptake, glycolytic rate and lactate production,
111
in both cultured cells (expressing p53 mutants R175H, R248Q and R273H) and in mouse

embryonic fibroblasts (MEFs) from p53R172H/R172H knock in mice (equivalent to human

R175H) (202). This metabolic-related oncogenic function of mutant p53 was achieved

through activation of RhoA/ROCk signaling that promoted the translocation of GLUT1

(glucose transporter 1) to the plasma membrane. The results presented suggest that secreted

proteins driven by mutant p53 may influence the RhoA/Warburg pathways. Future studies

are needed to further resolve the roles of secreted proteins in regulating the pathways that

are essential for mutant p53 GOF in cancer.

It is likely that the secretome of each missense p53 mutation may vary and accordingly the

GOF of each mutant may also vary. It was found that the expression of the p53 R175H

mutant was enriched with GO biological processes associated with metabolism, while in

contrast the expression of p53 R248Q mutant in the same H1299 background showed GO

biological processes that were enriched with structure organization, cell adhesion and

locomotion. Tumour derived secreted factors can not only remodel the local

microenvironment for tumour spreading but can also alter distant tissues for the

establishment of pre-metastatic niche (176, 180). Hence, it is possible that the differences in

the proteins secreted by various hotspot p53 mutants determines the ability of primary cells

to seed into the secondary sites. Future studies will be required to test this possibility.

Comparison of the secretome dataset and the expression array dataset from each of the two

induced p53 mutant cell lines demonstrated proteins/genes in common. (Figure 3.3 and 3.4).

112
Interestingly, some proteins, such as STC1 (203), LAMC2 (191), ANGL4 (204) and GRP78

(205) were the functional mediators of metastasis that were commonly over-represented in

both microarray and proteomics of p53 R248Q mutant. However, their expressions were

significantly reduced in both microarray and proteomics analysis of p53 R175H mutant.

Whether structurally distinct p53 mutants exert the GOF to the same extent and through

similar mechanisms remains to be resolved. However, in our study both conformations (e.g.,

R175H) and structural mutants (e.g., R248Q) were capable of inducing the secreted proteins

that are pertinent to cancer metastasis and lung biology/structure. Hence, the discovery of

critical secreted mediators of mutant p53 will significantly contribute to our understanding

of the mechanism of mutant p53 GOF in particular, and also to furthering an understanding

of the mechanism of metastasis in general. Longer term implications for our findings are the

potential of these secreted proteins as diagnostic markers of carcinoma metastasis, possible

as serum based markers and the possibility that they will provide novel therapeutic targets

for humanised antibodies.

There were two significantly upregulated proteins, A1AT and BIGH3, that were in common

between the secretome of both p53 mutants and detected by both proteomics and

transcriptome analysis. Interestingly, there were no repressed proteins in common. The

expression of A1AT encoded by SERPINA1 has been shown to enhance the metastatic

potential of lung adenocarcinoma (192). Similarly, BIGH3 encoded by TBFBI has been

reported to promote metastasis of colon cancer by enhancing cell extravasation (193). It is

proposed that these two secreted proteins are major contributors to mutant p53 GOF. In

addition, these identified secreted targets of mutant p53 were previously reported to
113
represent a small (3%) proportion of wild-type p53 targets (166) and speculated as the

oncogenic ‘darkside of p53’. Thus the analysis on the secretomic differences between wild-

type and mutant p53 remains to be further investigated.

A1AT was chosen for subsequent detailed study as this protein showed the highest levels of

up-regulation following induction of the two missense mutant p53s and the function of

A1AT is specific to lung biology. Expression studies subsequently showed mutant p53

driven induction in all eight hot-spot mutant p53s (Figure 3.5) suggesting that A1AT is the

critical common secreted protein associated with mutant p53 GOF. Whether this is restricted

to mutant p53 expressed in lung cancer or is common to other cancers will require additional

studies.

A1AT is a circulating 52 kDa glycoprotein that is encoded by the gene SERPINA1 and

produced mainly by the liver (206). A1AT is a protease inhibitor whose targets include

elastase, plasmin, thrombin, trypsin, chymotrypsin and plasminogen activator (207). The

balance between proteases inhibitors and its target proteases is essential for normal

homeostasis of lung tissues (208). The most common disease associated with A1AT is

A1AT-1 deficiency, a genetic disorder caused by defective production of A1AT. Due to

decreased A1AT activity in blood, neutrophil elastase breaks elastin whose function is to

maintain the elasticity of lungs, resulting in serious respiratory complications (209).

Clinical research has shown that A1AT levels are higher in serum samples of cancer patients

than in healthy individuals (210-212). Additionally, A1AT is reported to correlate with poor

114
prognosis in several cancer types including colorectal, gastric, squamous cell and lung

adenocarcinoma (194, 196, 213, 214). An imbalance in protease and proteases inhibitor in

cancer cells has been widely reported (215). Among them, A1AT is generally regarded, as

a tumour promoter as in tumour cells it is often present in high levels. However, there are

conflicting reports regarding the role of A1AT in cancer. While some studies report the

oncogenic roles of A1AT in tumour cell migration, invasion of several cancer types (216).

In lung cancer, there are limited studies. The function of secreted A1AT have been tested

mainly in the two lung cancer cell lines: CL1-0 and CL1-5, where A1AT overexpression

promotes metastasis growth (192). Therefore, additional evidence is required to determine

if A1AT is involved in lung cancer metastasis. Furthermore, it is unknown whether

mutations in p53, which are observed in pre-cancerous stages of lung cancer (188), can drive

over-expression of A1AT to promote metastasis.

In summary, this chapter studies the global influence of mutant p53 on cancer cell secretome.

Mutant p53 secretome is identified to be enriched with proteins involved in the cellular

movement, indicating its pro-invasive property in tumour microenvironment. Furthermore,

it is discovered that the GOF mutant p53 alters its tumour microenvironment by modulating

the expression of numerous genes that are subsequently secreted from the cells. A1AT is

identified as a possible secreted mediator of mutant p53, whose, mRNA and secreted protein

abundance was consistently upregulated by various p53 mutant variants. The next chapter

presents the role and function of A1AT in mutant p53 induced tumourigenesis. It also

highlights the potential of A1AT as a therapeutic target.

115
116
117
 '

'
'
'
'

!
!

118
Chapter 4: Alpha-1 Antitrypsin (A1AT) functions as a novel
secreted mediator of mutant p53 gain-of-function

Preface
As discussed in Chapter 2, the identification of key downstream targets or signaling

pathways that mediate mutant p53 gain of function offers an alternative therapeutic approach

to target tumours expressing p53 mutations. Significantly, a previously described iTRAQ

based quantification of mutant p53 secretome identified alpha-1 antitrypsin (A1AT) as a

potential candidate protein for further investigation. In this chapter, first the role of A1AT

in mutant p53 driven cell migration and invasion was investigated, and then the therapeutic

benefit of A1AT depletion in lung cancer studied. These investigations show that A1AT is

a key mediator of mutant p53 driven cell migration and invasion. Both A1AT blocking

antibody and hairpin mediated gene knockdown approaches both ablate the mutant p53

driven invasion. To the best of our knowledge, the protein A1AT presented in this chapter

is the first secreted target of mutant p53 identified using secretome analysis. The expression

of A1AT is conserved across several cancer-associated p53 mutants. This chapter shows that

A1AT is a key downstream-secreted mediator of mutant p53 GOF in cancer and provides a

rationale to investigate the development of antibody-based therapies targeting A1AT.

119
 Introduction
The p53 tumour suppressor protein, encoded by the TP53 gene, is a key transcription factor

that regulates the expression of several cellular stress response genes involved in processes

that include DNA repair, cell-cycle arrest, apoptosis and senescence (217, 218).

Approximately 50% of all human cancers have p53 mutations and ~75% harbor missense

mutations that gives rise to the full length mutated p53 proteins with single amino acid

substitution (219). Missense mutation in the p53 protein frequently occur at six discrete

hotspot codons within the DNA binding domain: codons R248, R175, G245, R249, R273,

and R282 (220). The consequence of mutations in p53 results in both loss- and gain-of-

function properties. Loss-of-function is largely due to the inability of mutant protein to bind

the canonical wild-type p53-binding site and transactivate its targets genes resulting in

impaired tumour suppressive function with deregulated cell cycle and cell death mechanism.

In contrast, gain-of-function (GOF) properties of mutant p53 gives rise to more aggressive

tumour profile with increased tumour growth and metastasis (174, 221). A variety of

oncogenic GOF phenotypes of mutant p53 have been reported, including increased ability

of cancer cell to invade through the local microenvironment, spread to distant organs

(metastasise), resistance to chemotherapies, regulation of anti-apoptotic and pro-

inflammatory signaling pathways, morphological changes, increased genomic instability

and morphological changes to a more aggressive mesenchymal state. All these processes

contribute to the survival advantages and selective growth of cancer cells during

tumourigenesis (174, 221).

120
Findings from in vivo studies have demonstrated that genetically engineered mice harboring

missense p53 mutations develop more aggressive and metastatic tumours compared to p53-

null or heterozygous mice (30, 82-84), confirming that the GOF activity is a characteristic

of mutant p53. These experimental findings are consistent with in vivo clinical observations,

whereby tumours that express mutant p53 are associated with poor patient prognosis in

number of cancers, including those of breast (85, 86), colon (87, 88), and lung (89, 90).

Using in vivo mouse models, elimination of stabilized mutant p53 protein have shown to

regress tumour and extend animal survival, suggesting that the strategies targeting mutant

p53 may provide therapeutic benefit to those patients expressing p53 mutant tumours (30).

As described in chapter 1, several strategies targeting mutant p53 tumours have led to the

discovery of compounds that are shown to be effective against p53 mutant cancers.

However, a major issue in mutant p53 targeting drugs is their slow progress towards the

clinic, with the majority of drugs still at an early stage of development (222). At this time,

PRIMA-1MET (APR-246), a compound that directly targets mutant p53, is the only drug that

has reached clinical trials, however the target specificity of this compound is still

controversial (91, 223-225).

Studies have revealed diverse oncogenic processes that are driven by mutant p53 (155).

Therefore, another alternative approach to targeting mutant p53 is to exploit and identify the

commonly regulated downstream pathways or targets of mutant p53 that mediate the GOF

activity. Using such strategies a number of pathway targeting drugs have been identified

121
such as statin that inhibits the mevalonate pathway (226), imatinib targeting PDGFRB (227)

or COMPASS inhibitors (151) that are shown to increase cell death in p53 mutant tumours

(see chapter 1). However despite their promising performance, a major drawback of these

studies is the limited number of p53 mutants and cellular backgrounds that have been tested.

Using a novel mutant p53 secretome based analysis, we have identified in chapter 3 that the

A1AT protein is a possible mediator of mutant p53 GOF with A1AT expression shown to

be conserved across several p53 hotspot mutants. A1AT was identified from the analyses of

both gene expression and secreted proteins. Currently, there are several targets (discussed in

chapter 1) of mutant p53 identified using genomics and proteomics approaches (155, 159,

164, 228). However, to the best of our knowledge there is no known secreted target of mutant

p53 identified using secretome analysis other than those presented in this thesis. Secreted

proteins abound in the extracellular microenvironment and can also enhance the invasive

ability of cancer cells (229). Identification of mutant p53 induced secreted factors will not

only contribute to an understanding of the mechanism of mutant p53 gain-of-function but

will also serve as novel diagnostic markers, possibly serum based markers and therapeutic

targets for humanized antibodies.

This chapter studies the role of A1AT in mutant p53 induced GOF. It is shown that mutant

p53 retains its ability to induce invasion in lung cancer. Further, it is demonstrated for the

first time that A1AT is a key secreted mediator of mutant p53 GOF and has the potential to

serve as a therapeutic target. The remainder of this chapter is organized as follows. In section

122
5.5.3.1, mutant p53 driven invasion in lung cancer is presented. Section 5.5.3.2 demonstrates

that A1AT drives cell migration invasion. Section 5.5.3.3 demonstrate A1AT as a mediator

of mutant p53 induced invasion. The invasive ability of secreted form of A1AT is presented

in Section 5.5.3.4. Section 5.5.3.5 shows that blockade of secreted A1AT could completely

ablate mutant p53 driven invasion. Section 5.5.4 gives concluding remarks of the chapter.

Most of the results presented in this chapter form a part of a manuscript that is in the final

stage of review at Oncogene.

123
 Results

Sustained expression of mutant p53 is required for invasion of lung cancer cells
Mutation in p53 is often found is the early stage of tumourigenesis and is further associated

with highly metastatic lung cancer and poor survival outcome (188, 230). To assess the

impact of p53 mutations on the invasion of lung cancer cells, inversion invasion assay was

performed. We used H2009, a human NSCLC cell line that endogenously expresses the

R273L mutant of p53. The expression of p53 R273L GOF mutant was silenced using p53

siRNA (Figure 4.1A) and the invasive behavior of H2009 expressing siRNA-targeting

(mutant) p53, and non-targeting siRNA control were compared (Figure 4.1A). The siRNA2

was used for the assay since it had a better knockdown efficiency compared to siRNA1

(Figure 4.1A). To gain insight into the regulation of A1AT by endogenous mutant p53, the

expression of A1AT was measured in the same H2009 cell line expressing p53 R273L

mutation. The knockdown of endogenous p53 R273L mutant resulted in a significantly

reduced level of A1AT mRNA and protein levels when compared to control siRNA, (Figure

4.1A) confirming A1AT as a target of mutant p53.

We confirmed that H2009 cells expressing mutant p53 efficiently invaded through matrigel

towards the chemoattractant (EGF, 25ng/ml). This invasion depended on mutant p53, as

mutant p53 knockdown in H2009 cells significantly reduced the invasion (Figure 4.1B). This

result indicates that mutant p53 can contribute to lung cancer cell invasion and that inhibiting

its activity may have an anti-tumourigenic effect.

124
 A

Figure 4.1. Mutant p53 drives invasion in lung cancer cell line

(A) qRT-PCR and western blot analysis for A1AT and p53 in H2009 cells with two p53

siRNA (si.p53-1 and si.p53-2) or control (si.Ctrl). β-tubulin was used as a loading control.

Data presented as mean ± standard error of mean (SEM) from three replicates. *P < 0.05.

(B) H2009 cells transfected with si-p53-2 or si.Ctrl were placed onto matrigel for 72 hours,

and invasion was analyzed by confocal microscope and quantified as described in Materials

and Methods. Data presented as means ± standard error of mean (SEM) from three replicates.

**P < 0.005. Representative z-stack images of invading cells are shown (left).

125
 A1AT induces cell invasion and migration
Section 4.3.1 demonstrates the invasive ability of H2009 cell line is dependent on the

expression of mutant (R273L) p53. Since in chapter 3, the major protein identified in the

mutant p53 secretome is A1AT, the expression of this protein was knocked down to

determine the effect on invasion. Indeed, the shRNA (A1AT-short hairpin RNA) mediated

A1AT knockdown significantly decreased the ability of H2009 cells to invade through

matrigel to a similar extent as to knockdown of mutant p53 in section 4.3.1 (Figure 4.2A),

indicating a role for A1AT in mediating mutant p53 driven invasion. This was further

confirmed using a scratch wound assay where wound closure, reflecting cellular migration

was significantly decreased in A1AT knockdown cells compared to its control (Figure 4.2B).

126
 A

Figure 4.2 A1AT induces cell invasion and migration

(A) The invasion of H2009 cells stably expressing control (sh.ctrl) or a shRNA against

A1AT (sh.A1AT) was measured and quantified. Data presented as means ± standard error

of mean (SEM) from three biological replicates. **P < 0.005. Representative z-stack images

of invading cells are shown (left).

(B) Quantification of wound confluence in scratch wound assays at 0 and 24 hr after

wounding of human H2009 cells stably expressing a non targeting control (sh.ctrl) or a

shRNA targeting A1AT (sh.A1AT) (right). Data presented as mean ± SEM. **P < 0.005

compared. Representative phase contrast images from the live cell recordings of two

conditions are shown at 0 and 24 hr (left).

127
 A1AT specifically mediates mutant p53 driven cell migration and invasion
To further confirm whether A1AT specifically mediates mutant p53 driven invasion, we

established a doxycycline (DOX) inducible A1AT knockdown derivative of the EI-H1299-

R248Q cell line using pTRIPZ Lentiviral Inducible shRNAmir (Open Biosystems). In this

double inducible EI-H1299-R248Q cell line, the knockdown of A1AT is facilitated through

the treatment with doxycycline (Dox) while induction of mutant p53 is achieved through

addition of PonA (Figure 4.3A). Treatment of this cell line with PonA triggered an increase

in mutant p53 dependent migration (right, P<0.005; Figure 4.3B) and invasion (left,

P<0.005; Figure 4.3B). Remarkably, knockdown of A1AT by addition of doxycycline

completely ablated the ability of induced mutant p53 to drive migration and invasion.

Importantly, knockdown of A1AT did not alter the basal level of migration and invasion

(Figure 4.3B) in the absence of induced mutant p53, collectively demonstrating that the role

of A1AT in migration and invasion of this lung cancer cell line is specific to the mutant p53

pathway. These results demonstrate the feasibility of using the double inducible expression

system in in vitro assays and shows A1AT, a secreted protein, is critical for the ability of

mutant p53 to enhance invasion.

128
 A

Figure 4.3 A1AT mediates mutant p53 driven cell invasion and migration

(A) qRT-PCR of A1AT mRNA expression in double inducible EI-H1299 p53R248Q cells

transfected with doxycycline (2 μg/ml) inducible shRNA targeting A1AT. Induction of p53

protein was determined by western blot analysis (right). β-tubulin was used as a loading

control.

(B) Invasion (left) and migration (left) assay analysis of double inducible EI-H1299 R248Q

sh.A1AT cells. Data presented as means ± SEM from three biological replicates compared

to un-induced. **P < 0.005, *P < 0.05.

129
 A1AT drives lung cancer cell invasion in an in vivo chick chorio-allantoic
membrane (CAM) model
Next, we employed the CAM invasion assay to investigate whether mutant p53 induced

A1AT expression enhances H2009 lung cancer cell invasion in vivo. H2009 cells with stable

knockdown of A1AT, or control, were mixed with matrigel and placed onto the CAM of 11-

day old chick embryos. The invasion of cells through the ectoderm into the mesoderm was

assessed by immunohistochemical analysis using a pan-cytokeratin antibody (Figure 4.4A).

Consistent with our in vitro observation, haematoxylin and eosin staining and pan-

cytokeratin immunostaining of H2009 cells showed invasion of cells through the ectoderm

into the mesoderm of the CAM (Figure 4.4A). In contrast, H2009 cells expressing sh.A1AT

exhibited minimal invasion through the ectoderm and mesoderm of the CAM. Quantitative

analysis showed that A1AT depletion significantly inhibited H2009 NSCLC cell invasion

into the CAM mesoderm. Knockdown of A1AT resulted in a 6-fold reduction in cancer cell

invasion compared with H2009 cells expressing sh.Ctrl (P<0.005; Figure 4.4B).

Collectively, these findings further provide evidence that A1AT is a key downstream target

of mutant p53 that promotes cellular invasion.

130
 A

Figure 4.4 A1AT drives invasion in vivo

(A) CAM invasion assay were performed using H2009 cells expressing sh.Ctrl or sh.A1AT.

The layers ectoderm (ECT), mesoderm (MES) and endoderm (END) of CAM, 5 days post

implantation is evident. Haematoxylin and eosin and pan-cytokeratin immunohistochemistry

of the CAM with transfected cells are shown.

(B) Quantification analysis of invasion of H2009 cells with sh.Ctrl or sh.A1AT into CAM.

Data presented as means ± standard deviation (SD) from indicated replicates. **P < 0.005.

131
 A1AT alters epithelial-mesenchymal transition (EMT) marker expression
The association between EMT and p53 has been widely reported and is attributed to multiple

signaling pathways such as TGF-β/Smad (231, 232), including direct involvement in

modulating key transcriptional regulators of EMT process, TWIST1 (233), SLUG (234) and

ZEB1 (75).

We examined whether A1AT induced suppression of migration and invasion involved

alteration in expression of key drivers of mesenchymal transformation. Indeed, silencing of

A1AT expression in the H2009 cell line resulted in significant repression of several key

target genes, including TGFB1, TGFBR2, SNAI1, SNAI2, ZEB1, FN, VIM and TNC (P<0.05;

Figure 4.5A). Immunofluorescence studies further confirmed decreased expression of

fibronectin and vimentin proteins in A1AT depleted H2009 cells (Figure 4.5B). Collectively,

these observations indicate that elevated A1AT levels promote cellular transformation and

invasion by altering the network of EMT genes

132
Figure 4.5 A1AT alters epithelial-mesenchymal transition (EMT) markers expression.

(A) The protein level of A1AT and vimentin were determined by western blotting (left).

qRT-PCR analysis of mesenchymal markers expression in H2009 expressing sh.Ctrl or

sh.A1AT (right). Data presented as a fold change in expression relative to cells expressing

scrambled RNA sequence (sh.ctrl), which has been set at 1.

(B) Immunofluorescence staining of H2009 expression sh.A1AT or sh.Ctrl cells using anti-

fibronectin and vimentin antibodies.

133
 Secreted A1AT enhances mutant p53 induced cell migration and invasion
In order to compare the secretion levels of A1AT in the lung cancer H2009 mutant p53 cell

line with the p53 wild-type (SBC-3) and p53 null (H1299) cell lines, the conditioned medium

(CM) was collected and concentrated by ultra-centrifugal filter concentration. Interestingly,

A1AT protein was abundantly secreted in p53 mutant (H2009) cells but not in the p53 wild-

type or null cells (Figure 4.6A). To investigate whether secreted A1AT was a driving factor

of cellular invasion, H2009-sh.A1AT cells were incubated with the concentrated conditioned

medium from H2009-sh.Ctrl cells and the degree of invasion was assessed using the inverted

invasion assay. The concentrated conditioned medium harvested from H2009-sh.A1AT

contained less secreted A1AT (Figure 4.6B) and reduced the invasion through matrigel,

compared to concentrated conditioned media from H2009-sh.Ctrl cells (P<0.005; Figure

4.6B). In addition, the loss of the migratory ability of H2009 cells following A1AT

knockdown was rescued by the growth in concentrated conditioned medium from H2009-

sh.Ctrl cells in a dose-dependent manner (P < 0.05; Figure 4.6C), suggesting that secreted

A1AT promotes cellular migration and invasion. To test, whether secreted A1AT influences

the tumour microenvironment, SBC-3 (expressing p53 wild-type) and H1299 (p53 null) cells

were incubated with the concentrated conditioned medium of induced EI-H1299 R248Q cell

line. Indeed, incubation of lung cancer cells with the induced concentrated secretome

enabled the cells to acquire the capacity to invade through matrigel, as compared to the

control cells (P<0.05; Figure 4.6D). These observations indicate A1AT as a pro-invasive

secreted target of mutant p53 secretome.

134
 A.

C. D.

135
Figure 4.6 Secreted A1AT drives cellular migration and invasion

(A) Western blot analysis of A1AT in CM from H2009, SBC-3 and H1299 cells.

(B) Invasion assay analysis following incubation of H2009-sh.A1AT cells with the

conditioned media from H2009-sh.Ctrl or sh.A1AT transfected cells. Data presented as

mean ± standard error of mean (SEM) from triplicate experiments. **P < 0.005.

Representative z-stack images of invading cells (left). Western blot analysis of A1AT

secreted protein in conditioned medium from H2009 cells expressing sh.Ctrl or sh.A1AT

(top).

(C) Scratch wound migration assay of H2009 sh.A1AT cells incubated with serially diluted

concentrated conditioned medium from H2009 cells expressing sh.Ctrl. Data presented as

mean ± standard error of mean (SEM) from three replicates. *P < 0.05, ** P < 0.005.

(D) Migration assay analysis following incubation of H1299 and SBC-3 cells with

concentrated conditioned medium from un-induced or induced EI-H1299 R248Q cells. Data

presented as means ± standard error of mean (SEM) from triplicate experiments. *P < 0.05,

** P < 0.005.

136
 Blockade of secreted A1AT using neutralizing antibody ablate mutant p53
induced cell migration and invasion
To further confirm that A1AT is a critical factor in the mutant p53 secretome that drives

cellular invasion, we sought to determine whether A1AT neutralization/inhibition could

prevent the invasion of lung adenocarcinoma which is dependent on mutant p53. Inhibition

of secreted A1AT in H2009 lung adenocarcinoma cells (expressing p53 R273L) using anti-

A1AT blocking antibody strongly reduced the invasion of cells into matrigel in the inverted

invasion assay (Figure 4.7A). In addition, wound closure, reflecting cellular migration in a

scratch wound assay, was significantly decreased in H2009 cells treated with A1AT

neutralizing antibody compared to IgG control treated cells (Figure 4.7B).

To determine whether the effects were dependent on mutant p53 driven A1AT expression,

the expression inducible H1299 cell line was used. Interestingly, treatment of inducible

H1299 cells expressing the p53 R248Q mutant with A1AT blocking antibody significantly

attenuated the mutant p53 induced cell migration (Figure 4.7C) and invasion (Figure 4.7D).

In addition, A1AT blocking antibody attenuated the mutant p53 driven migration in a dose-

dependent manner (Figure 4.7E). Collectively, these results suggest that the effect of A1AT

inhibition is specific to the mutant p53 pathway at least for R248Q and R273L mutants. In

addition, we speculate that the general property of mutant p53 GOF involves the induction

of A1AT as a secreted mediator, hence A1AT targeted therapies may be applicable for broad

range of p53 mutant types.

137
C

138
Figure 4.7 Blockade of secreted A1AT attenuates mutant p53 induced cell migration

and invasion.

(A) Invasion assay analysis following incubation of H2009 cells with the A1AT1-blocking

antibody (40 μg/ml A1AT IgG) or control IgG. Data presented as mean ± standard error of

mean (SEM) from triplicate experiments. **P < 0.005. Representative z-stack images of

invading cells (left).

(B) Migration assay analysis following incubation of H2009 cells with the A1AT-blocking

antibody (40 μg/ml A1AT IgG) or control IgG. Data presented as mean ± standard error of

mean (SEM) from triplicate experiments. **P < 0.005.

(C) Migration assay analysis following incubation of un-induced or induced EI-H1299

R248Q cells with the A1AT-blocking antibody (A1AT IgG) or control IgG. Data presented

as mean ± standard error of mean (SEM) from triplicate experiments. **P < 0.005. Phase

contrast images taken at time 0 and 24 hr following wounding (right).

(D) Invasion assay analysis following incubation of un-induced or induced EI-H1299

R248Q cells with A1AT-blocking antibody or control IgG. Data presented as means ±

standard error of mean (SEM) from triplicate experiments. **P < 0.005, ***P < 0.0005.

Representative z-stack images of invading cells (right).

(E) Migration assay following incubation of induced EI-H1299 R248Q cells with the

increasing concentration (10 μg/ml, 20 μg/ml and 40 μg/ml) of A1AT-blocking antibody

(A1AT IgG) or Control (IgG). Data presented as means ± standard error of mean (SEM)

from triplicate experiments compared to induced IgG set at 100%. *P < 0.05.

139
 Discussion
Missense mutations that occur in the p53 tumour suppressor inactive the wild-type tumour

suppressive p53 function and can endow the cancer cells with newly acquired “gain-of-

function” (GOF) properties that can contribute to tumourigenesis, survival and metastasis

(221). In the previous chapter, we defined a new role for mutant p53 in altering the tumour

microenvironment through modulating the cancer cell secretome. A1AT was identified as

an overrepresented secreted target of mutant p53, whose expression was highly conserved

across various p53 mutants. Here, we explored the functional role of A1AT in lung cancer

using in vitro and in vivo models. We show that mutant p53 mediates the invasive phenotype

in lung cancer cells by inducing the secretion of A1AT, and the depletion of secreted A1AT

can significantly ablate mutant p53 driven invasion.

The A1AT protein encoded by the serine protease inhibitor 1 (SERPINA1) gene is a major

serum trypsin inhibitor, whose predominant role is linked to human diseases such as

emphysema and liver cirrhosis (235). Emerging evidence suggests the association of A1AT

with progression and metastasis of various cancers including gastric, lung and colorectal

adenocarcinoma (194, 195, 236). Despite the evidence of clinical relevance in cancer, the

regulation of A1AT and its functional and mechanistic behavior are not yet fully understood.

Our findings suggest that the role of A1AT downstream of mutant p53 is tumour cell-

specific. Hence, the oncogenic functions of A1AT are unlikely to be attributed to its

physiological function as a serum trypsin inhibitor in lung tissues. Our findings were also

confirmed using in vivo CAM model, which shows that knockdown of A1AT significantly

ablates the invasive ability of p53 mutant lung cancer cell lines. CAM contains extracellular
140
matrix proteins (ECM) such as fibronectin, laminin, collagen type I and integrins which

mimics the physiological environment of tumours (237). This model has been well

established to study tumour angiogenesis and invasion in several malignancies such as

glioma (238, 239), prostate cancer (240, 241), leukemia (242), osteosarcoma (243) and

ovarian (244, 245). In addition, using a unique double inducible system that integrates the

inducible expression of mutant p53 together with inducible specific knockdown of A1AT

gene, we have confirmed that the role of A1AT in migration and invasion is specific to

mutant p53 GOF pathway. These findings demonstrates the feasibility of using double

inducible system in in vitro experimental models.

Establishment of metastasis from a primary tumour requires sequential events. For epithelial

originating tumours an epithelial-mesenchymal transition (EMT) potentiates tumour cells to

disseminate from the primary tumour by migrating through the local microenvironment, and

hence invade local tissues (231, 232). Our studies shows that A1AT drives cellular invasion

and can also alter the expression of several EMT related genes: TGFB1, TGFBR2, SNAI1,

SNAI2, ZEB1, FN, VIM and TNC. This finding indicates a role for A1AT in intravasation

and dissemination of tumour cells throughout the body by the circulatory system. Although

the mechanism of A1AT in tumourigenesis is not fully understood, it is likely that the

regulation of EMT markers by A1AT involves an indirect mechanism, as A1AT is not a

transcription factor. Previous studies have reported an anti-apoptotic effect of A1AT on lung

endothelial cells via inhibition of caspase-3 activity (246). Studies also indicate that A1AT

is an irreversible inhibitor of extracellular serine proteases, such as trypsin and kallikreins

(247) and matripase (248, 249). In addition, A1AT has been shown to inhibit the activity of
141
natural killer cells against tumour cells (250, 251), indicating that A1AT primarily functions

via inhibiting the activity of enzymes present in the extracellular environment.. Two

important proteases, mast cell chymase and leukocyte elastase are known to activate TGFB

signaling that can induce an EMT in cancer (252). Hence, further study on chymase activity

and A1AT may help uncover the mechanism on how A1AT regulates the expression of EMT

network genes. In addition to the well-recognized extracellular A1AT activity, intracellular

synthesized A1AT has been shown to regulate the autophagy mediated cell death within the

cell (253). Besides it’s function as a protease inhibitor, A1AT has been reported to induce

the release the angiopoietin-like protein4 (Angptl4) in a adherent human blood monocyctes

and in human lung microvascular endothelial cells via a proliferator-activated receptor

(PPAR) dependent pathway (254), indicating that A1AT has multiple functions in cancer.

Metastasis requires the establishment of a “pre-metastatic niche”, a hospitable

microenvironment for the establishment and growth of the disseminating tumour cells. This

tissue microenvironment is critical to the spread of metastatic disease, as the vast majority

of disseminated tumour cells fail to establish secondary tumors in the metastatic site (255).

Our study shows that secreted A1AT has the potential to alter the ability of surrounding cells

to become highly invasive, indicating a crucial role of A1AT in several stages of metastatic

processes.

Cytokines released by the infiltrating inflammatory cells and surrounding stromal cells

promote tumour cell invasion while the cytokines produced by tumour cells functions to

142
create optimal growth condition within the tumour microenvironment (256). Several

inflammatory cytokines such as TNF-a, IFN-gamma, IL-1B, Oncostatin M (a member of the

IL-6 family) have been shown to enhance the expression of A1AT. In addition, mutant p53

has also been reported to be involved in the regulation of cancer cell secreted proteins and

inflammatory cytokines (177). A recent study has highlighted a role for mutant p53 in

supporting a prompt IL-1B response through direct repression of an IL-1B antagonist (179).

Notably, interleukin-1B also induces A1AT expression in squamous cell carcinoma (213).

Thus we speculate that A1AT, through cell paracrine mechanism, may also support a pro-

inflammatory microenvironment to provide favorable support to mutant p53 driven tumour

malignancy. Our findings contribute to an understanding of the mechanism of p53 mutant

GOF in particular and also furthering our understanding of the mechanism of metastasis in

general.

Currently, there are approximately 3 million people worldwide currently living with a

tumour that contains a bonafide gain-of-function mutation in p53 (219). This represents over

one eighth of the population of current cancer patients. Although we are fully aware of

mutant p53’s capacity to drive invasion and metastasis, we are yet to therapeutically target

it due to our lack of understanding of its mechanisms. We have demonstrated that the

antibodies targeting secreted A1AT in lung cancer can significantly ablate mutant p53

induced migration and invasion. Thus our findings provide a strong rationale for the

development of antibody-based therapies targeting A1AT, which has the potential to treat

patients with mutant p53 tumours. Based on our evidence, we propose that A1AT is a critical

and indispensable secreted mediator of mutant p53 GOF with therapeutic potential.
143
However, determining the clinical significance of A1AT in p53 mutant lung cancer will be

essential to benefit the patients with A1AT targeted therapies. This will be explored in the

next chapter.

144
Chapter 5: Mutant p53 regulated Alpha-1 Antitrypsin (A1AT)
is a prognostic marker of lung adenocarcinoma

Preface
This chapter describes the clinical significance of A1AT expression in human lung

adenocarcinoma and correlates its expression with that of p53. Chapter 4 showed that A1AT

is a secreted target of mutant p53 in lung cancer. In this chapter, the immunohistochemical

studies of human lung adenocarcinoma (ADC) TMAs show that the expression of A1AT is

significantly correlated with elevated expression of p53. These results validate in vivo that

A1AT expression is driven by mutant p53. Furthermore, the association of A1AT with

clinical parameters is determined and shows that the expression of A1AT is significantly

elevated in lung ADC tumours compared with matching normal control tissue. The elevated

expression of A1AT is further shown to be significantly correlated with increased local

invasion and shorter overall survival of lung ADC patients. The results in this chapter

support a notion that A1AT is a target of mutant p53 and a prognostic marker of lung

adenocarcinoma.

145
 Introduction
In tumours, missense mutant p53 is often stabilized leading to high expression levels, which

can be easily detected by immunohistochemistry (257). Human tumours with p53 mutations

correlate with advanced or aggressive diseases (258). p53 mutations are present in up to 70%

of lung cancer cases, where they precede the metastatic spread to lymph nodes and also

correlate with poor patient prognosis (259). Despite the recent advances and the use of

several targeting drugs for lung cancer therapy, the five-year survival has remained at 15%

for the past three decades (260).

Approximately 80% of human lung cancers are histologically non-small cell lung cancer

(NSCLC), which consists mainly of squamous cell carcinoma (SCC), adenocarcinoma

(ADC) and large cell carcinoma (LCC). NSCLC tumour development involves multiple

genetic abnormalities that contribute to malignant transformation of bronchial epithelial

cells, followed by invasion to lymph node and ultimately distant metastasis (261, 262).

Among such abnormalities, the p53 tumour suppressor gene appears to be the most frequent

target for alteration and plays an important role in tumourigenesis of lung epithelial cells

(263). Studies suggest that among patients with NSCLC cancer the presence of p53

mutations is associated with the poorest prognosis and are relatively more resistant to

chemotherapeutic drugs and radiation (264). Since most p53 mutations occur before the

metastasis, they are highly preserved throughout the stages of tumour development (188).

Since, tumour cells do not select against p53 mutations during metastasis this suggests a role

for p53 GOF properties in oncogenesis and lung tumour progression. Hence, a strategy

focused on abrogating the oncogenic effect of mutant p53 would be an effective approach
146
for the treatment of NSCLC patients. One of the predominant mechanisms whereby mutant

p53 promotes invasion is by regulating its oncogenic targets (222). In previous chapters, we

identified A1AT as a highly expressed target in the mutant p53 secretome and the role of

A1AT as a downstream mediator of mutant p53 GOF was further demonstrated.

In this chapter, the clinical association of A1AT in NSCLC is explored. A1AT mRNA

expression is shown to be significantly higher in lung cancer cell lines expressing missense

mutations than to those cell lines with an intact or non-functional wild-type p53 allele. The

expression of mutant p53 and A1AT in lung adenocarcinoma tumours is shown to be

correlated. In addition, the association of A1AT expression with clinicopathological

characteristics of lung adenocarcinoma patient’s sample is examined. The results show that

elevated A1AT is significantly correlated with increased local invasion and poor outcome

of lung adenocarcinoma patients. The finding presented is of potential interest for future

development of diagnostic and prognostic biomarker in lung ADC tumours expressing p53

mutations.

147
 Results

Analysis of A1AT expression in lung cancer cell lines

Previous chapters identified A1AT as a critical secreted mediator of mutant p53 GOF. Here,

we first examined if A1AT is upregulated in mutant p53 expressing lung cancer cell lines,

through the analysis of expression profiling data from the “Cancer Cell Line Encyclopedia”

consisting of a panel of 162 different human lung cancer cell lines (265) with known p53

status. Indeed, A1AT expression levels were significantly elevated in lung cancer cell lines

expressing p53 missense mutations than in those cell lines with an intact or non-functional

wild-type p53 allele, also referred as “Other” (Figure 5.1). Cell lines with hotspot mutations

of p53 at codons: 285 (cell line NCIH854), 163 (BEN), 162 (EPLC272H), 141 (NCIH1435),

245 (COLO668), 47 (NCIH1373), 273 (NCIH2405) and 157 (DMS454) had the highest

expressions of A1AT mRNA. Collectively, these data support a notion of A1AT as a mutant

p53 target gene in lung cancer.

148
Figure 5.1 Mutant p53 regulates A1AT expression in lung cancer cell lines

The mRNA levels for A1AT in 162 human lung cancer cell lines with various p53 status.

Affymetrix dataset were obtained from Cancer Cell Line Encyclopedia (265). Data presented

as mean normalized A1AT expression ± SD. *P < 0.05.

149
 A1AT expression is upregulated in lung ADC tumours
To gain further insight into the expression of A1AT in different subtypes of lung cancer, we

analyzed the publicly available TCGA datasets of two histological subtypes of NSCLC

tumours in which the global mRNA expression levels had been profiled (266, 267). The

datasets consisted of a cohort of 129 lung adenocarcinomas (ADC) and 178 squamous cell

carcinomas (SCC). Comparison of the A1AT mRNA expression levels between ADC and

SCC tumours revealed that A1AT (SEPRINA1) mRNA level was on average 168% higher

in lung ADC patient tumours than in SCC (Figure 5.2A).

These differences in A1AT expression of A1AT were further explored in an independent

lung ADC patient cohort. A1AT expression was evaluated by immunohistochemistry (IHC)

staining on a tissue microarray (TMA) consisting of a cohort of 105 lung ADC tumour

samples (stages I-III) and matching normal tissue using a monoclonal anti-A1AT antibody

(Figure 5.3). The intensities of A1AT levels were quantitatively scored as described in

Material and Methods. The IHC analysis showed that A1AT expression was on average 26%

higher in lung ADC tumours that with the matching normal (Figure 5.2B). Furthermore,

A1AT was predominantly present in the cytoplasm and at the boundary between tumour and

stroma (Figure 5.4C). This supports our observations in cell lines in which A1AT expression

is overrepresented in the cytoplasm/extracellular matrix region of the cells (Chapter3, Figure

3.5).

150
 A B

Figure 5.2 A1AT expressions in upregulated in lung ADC

(A) Box plot of A1AT mRNA expression in TCGA lung adenocarcinomas (ADC, n=129)

and squamous cell carcinomas (SCC, n=178) obtained from cBioPortal (266, 267)****P <

0.00001.

(B) A1AT protein levels in lung adenocarcinoma tumours versus matching normal lung

tissues. A1AT protein levels were assessed by immunohistochemistry (IHC) on tissue

microarray from patients with completely resected stage I-III lung ADC patients and scored

quantitatively as described in Materials and Methods. Scored values are presented as log

base 10. Data presented as means ± SEM. ****P < 0.0001.

151
 Elevated p53 expression associates with high A1AT expression in lung ADC
TMAs
Since, A1AT expression is higher in lung ADC tumours than in adjacent normal lung tissue,

it was possible that A1AT was upregulated by mutant p53 in lung ADC tumours. To further

investigate this possibility, the association between A1AT levels and the status of p53 was

also evaluated by staining the lung TMAs with monoclonal anti-A1AT and anti-p53

antibody. While chemotherapeutic agents can induce the expression of wild-type p53 (268),

none of the patients whose tumours were used for this study have had received adjuvant

chemotherapy. Tumours were stratified for A1AT levels, with tumours below the median

expression level of the cohort defined as “low expression” and those tumours above the

median expression level of the cohort defined as “high expression”. We used high p53

staining expression as a surrogate marker for the presence of missense p53 mutation. In

contrast to loss-of-function mutations, missense mutations in TP53 are frequently associated

with the expression of high levels of the mutated form of p53 protein that accumulates in the

nucleus (221). Consistent with our findings in cell lines, significantly higher levels of

activated A1AT were observed in those ADC tumours that showed strong nuclear

accumulation of p53 (Figure 5.3). These data further supports findings obtained from cell

line models and are consistent with a role for mutant p53 in regulating A1AT in lung ADC

tumours.

Mutations in EGFR, KRAS, ALK and TP53 are common in lung cancer, which prompted us

to investigate whether the other activating alterations other that p53 were associated with

A1AT expression in lung cancer. The expression of A1AT was further correlated with

152
mutation status of the oncogenes, KRAS, ALK and EGFR, Those data on the same cohort of

lung tumours were supplied by Royal Prince Alfred Hospital (269). Interestingly, A1AT

overexpression showed no association with the activating alterations of those lung ADC

oncogenes (Table 5.1), suggesting that A1AT activation in lung ADC is solely associated

with the presence of elevated p53 levels.

153
Figure 5.3 Elevated A1AT correlates with higher p53 expression in Lung ADC

Stratification of human ADC samples (n=105) based on high and low A1AT and p53

expression levels. The levels of p53 and A1AT were determined by immunohistochemistry

(IHC) and representative images are shown (below). Data calculated using chi-square test

(P = 0.003).

154
Table 5.1 Association between A1AT expression in tumour cells and clinicopathological

characteristics in 105 lung ADC patients.

Variables A1AT low A1AT high χ2 P-values

Median age (years)
<69 33 27 0.191
>69 20 25
Gender
Male 35 29 0.190
Female 18 23
Smoking
Current Smoker 9 7 0.787
Ex-smoker 27 28
Never smoked 1 1
Unknown 7 11
AJCC7 stage
I (A&B) 36 19 0.003*
II (A&B) 15 24
III (A&B) 2 9
Vessel invasion
Negative 46 46 0.515
Positive 7 6
Perineural invasion
Negative 48 47 0.617
Positive 5 5
Histological grade
1 11 11 0.846
2 33 30
3 9 11
p53
Low 40 25 0.003*
High 13 27
Kras mutation
Negative 35 40 0.154
Positive 18 12
EGFR mutation
Negative 48 47 0.617
Positive 5 5
ALK mutation
Negative 52 52 0.505
Positive 1 0

155
Abbreviation: A1AT= Alpha-1 Antitrypsin

Significances of association were determined using a χ2 test

* denotes statistically significant

5.2.4 A1AT promotes invasion in lung ADC TMAs

The association of A1AT with metastasis was evaluated in human lung ADC tumours by

staining TMAs of paraffin-embedded formalin fixed tissues with monoclonal A1AT

antibody. The cohort consisted of 55 (52%) stage I, 39 (37%) stage II, and 11 (11%) stage

III tumours. The invasive potential of the 105 lung ADC tumours was assessed by American

Joint Committee on Cancer (AJCC) tumour, node and metastasis (TNM) classification. The

results revealed a highly significant association of elevated A1AT levels and increased

propensity for lung tumour invasion in distant organs or sites (Figure 5.4A and 5.4B). In

addition, elevated A1AT levels in ADC tumours were significantly higher in T2 and T3

tumours than in T1, which represents an independent marker of tumour size and invasion

into adjacent tissue (Figure 5.4C). This data further provides in vivo support for the

hypothesis that A1AT drives tumour cell dissemination and invasion in lung ADCs.

Elevated expression of A1AT was not significantly associated with other clinical paramters

tested, such as: age, gender, smoking, vessel invasion, perineutal invasion, and histological

grade. This could possibly be due to small sample size and needs to be further confirmed in

large patient cohort.

156
 A C

Stage1 Stage2 Stage3

A1AT Intensity

Figure 5.4 Elevated A1AT expressions is associated with increased tumour invasion in

vivo

(A) Immunohistochemistry for A1AT expression was performed on lung ADC TMA. A1AT

expression was significantly associated with more invasive tumours as assessed by Tumour,

node and metastasis (TNM) staging as defined by the AJCC classification. Data calculated

using chi-square test (P = 0.003).

(B) IHC images representing A1AT intensity levels in stage 1, stage 2 and stage 3 lung ADC

tumours.

(C) Box plot representing significantly higher A1AT expression in T2 and T3 tumours than

in T1 tumours (Chi-square test; P = 0.0001).

157
 Elevated A1AT expression correlates with poor overall survival in human lung
ADC as well as gastric cancer patients.
Since patient survival data was available for the 105 lung ADC patient cohort the prognostic

significance of A1AT gene expression in human lung cancer was determined. Only lung

cancer-specific deaths were included in the survival analysis. Strikingly, Kaplan Meier

survival analysis showed that lung ADC patients with tumours with elevated A1AT levels

were associated with a significantly shorter overall survival (Figure 5.5A) indicating A1AT

is a predictive prognostic factor of lung ADC.

These findings were further confirmed in an independent cohort of 720 lung ADCs, sourced

from publicly available datasets (270). In agreement with our findings from IHC analysis,

high expression levels of A1AT were significantly associated with decreased overall

survival of lung ADC patients (Figure 5.5A). In contrast, the analysis of A1AT expression

in a publically available dataset of lung squamous cell carcinoma (SCC) samples (270)

showed no significant association with the overall survival of squamous cell carcinoma

patients (Figure 5.5B).

It has been reported that p53 mutations are predictive of outcome in gastric cancer patients

(271). Thus, the prognostic significance of A1AT was analyzed in publically available

gastric cancer patients datasets (270). Kaplan Meier survival analysis showed that the gastric

cancer patients with tumours expressing low A1AT levels exhibit a significant increased

survival compared to patients with A1AT high expressing tumours (Figure 5.5C). This

indicates that A1AT is also a prognostic biomarker in other cancer types.

158
In summary, analysis of A1AT expression levels in lung ADC tumours show elevated A1AT

expression significantly associates with tumour stage and invasion depth, and is associated

with poor overall patient survival. In addition, using p53 expression as a surrogate marker

of missense p53 mutations, A1AT increased levels are associated with mutant p53.

159
Figure 5.5 High A1AT expressions in human lung ADC and gastric cancer correlates

with reduced overall survival

(A) Kaplan Meier survival curves of 105 lung adenocarcinoma patients with low or high

A1AT expressing tumours. Survival comparison and P-values were calculated by the log-

rank test. Tumours below the median expression level of the cohort were defined as ‘Low

Expression’ and those tumours above the median expression level of the cohort defined as

‘High Expression’.

160
(B) Kaplan Meir survival derived from publicly available survival data associated with a

cohort of lung ADC containing 720 samples in relation to expression of A1AT. Tumours

below the median expression level of the cohort were defined as ‘Low’ and those tumours

above the median expression level of the cohort defined as ‘High’. Survival comparisons

and P-values were determined by log-rank test.

(C) Kaplan Meir survival derived from publicly available survival data (270) associated

squamous cell carcinoma (SCC) containing 524 samples in relation to expression of A1AT.

Tumours below the median expression level of the cohort were defined as ‘Low’ and those

tumours above the median expression level of the cohort defined as ‘High’. Survival

comparisons and P-values were determined by log-rank test.

(D) Kaplan Meir survival derived from publicly available survival data (270) associated with

a cohort of 876 gastric cancer tumours, as a function of A1AT-low versus A1AT-high

expressing tumours. Tumours below the median expression level of the cohort were defined

as ‘Low’ and those tumours above the median expression level of the cohort defined as

‘High’. Survival comparisons and P-values were determined by log-rank test.

161
 Discussion
Lung carcinogenesis is a prolonged process that results from the accumulation of several

genetic events including alteration in oncogenes and tumour suppressor genes such as

EGFR, TP53, ALK and KRAS (272). These molecular alterations can serve as valuable

markers for diagnosis, staging and prognosis of lung cancer. However, to date it remain

unclear how each mutations contributes to the malignant evolution of this aggressive disease.

In chapter 4, we provided evidence for a role of the mutant p53 secretome in lung cancer

invasion and identified A1AT as a critical mediator of mutant p53 GOF. In this chapter, the

clinical significance of A1AT in lung cancer was determined by immunohistochemistry of

TMA consisting of 105 lung ADC tumours and matching normal tissues. The analyses

showed that A1AT can serve as a prognostic predictor of progression and patient survival of

lung adenocarcinoma.

The A1AT protein, encoded by the SERPINA1 gene, is a major plasma serpin that has broad

inhibitor spectrum against serine proteases, and has been associated with the invasive

potential of gastric, lung and colorectal adenocarcinomas (214, 273, 274). In agreement with

our findings in chapter 3, we observed that the mRNA expression of A1AT is markedly

higher in lung cancer cells lines expressing p53 missense mutations compared with those

cells expressing intact or non-functional p53. Moreover, the analysis of the expression of

A1AT in between two histological subtypes of NSCLC using the TCGA datasets identified

that the A1AT mRNA (“SERPINA1”) is significantly higher in lung ADC tumours than in

SCC. These differences in A1AT expression were further confirmed by

immunohistochemistry using a monoclonal anti-A1AT antibody on a tumour microarray

162
(TMA) consisting of 105 lung ADC tumour samples and matching normal tissue. IHC

analysis showed that A1AT was significantly higher in lung ADC tumours than in matching

normal tissues. Further to this, the association of elevated A1AT with p53 expression was

evaluated by staining TMAs with an anti-p53 antibody. IHC staining of lung ADCs showed

a strong association between elevated A1AT staining and high expression of p53 (an

indicator of the presence of mutant p53), and this association was mutually exclusive with

activating alteration of lung ADC oncogenes: EFGR, KRAS and ALK (269). Our findings

are in agreement with the model of A1AT as a secreted target of mutant p53 and provides in

vivo evidence to support the hypothesis that A1AT expression is specifically induced in the

presence of mutant p53. Although the effects of A1AT have been studied in lung cancer

(192), the expression of A1AT has not been reported to be correlated with any molecular

abnormalities of lung cancer. Thus, our study present the first report, to the best of our

knowledge, that the expression of A1AT in lung adenocarcinoma is association with the

presence of missense mutant p53 in lung ADC.

p53 plays an important role in lung cancer progression and its altered expression is a negative

prognostic factor for overall survival of lung adenocarcinoma patients (263, 275). This

influence of mutant p53 on survival is likely to be mediated by a GOF driven by secreted

A1AT. Elevated A1AT levels were associated with more advanced and invasive tumours.

These findings are consistent with the findings of chapter 4 where in lung cancer cell lines

high levels of A1AT increased invasion. Kaplan Meier analysis of lung ADC patient survival

are consistent with the hypothesis that higher levels of A1AT drive tumour cells

dissemination and invasion since elevated A1AT levels was associated with poorer overall
163
survival. Analysis of a gastric cancer patient cohort show similar findings suggesting A1AT

levels may influence survival in other cancers.

Late diagnosis and low response to therapeutic treatments is often attributed to the cause of

poor patient survival outcomes (276). Since p53 mutations are present in almost half of

NSCLCs, such oncogenic secreted mediators of mutant p53 GOF have the potential to not

only provide potential therapeutic targets but can also serve as a prognostic and diagnostic

markers. Our results indicate that A1AT levels is a potential prognostic biomarker for ADC

cancer progression. Several studies have reported higher levels of secreted A1AT in blood

and urine samples of cancer patients compared with healthy individuals (210, 277). In

addition, serum A1AT levels have also been reported to provide diagnostic benefits in

bladder cancer patients (278). Further studies will be required to confirm whether A1AT can

be used as a clinical biomarker for predicting prognosis of lung adenocarcinoma patients.

In summary, this study shows an in vivo association between the expression of A1AT and

mutant p53 in lung ADC tumours. Our results demonstrate that the expression of A1AT

associates with increased tumour invasion in lung ADC and may be used as a prognostic

biomarker for patients with lung ADC. The next chapter will explore possible mechanisms

of how mutant p53 regulates the expression of A1AT in lung ADC tumours.

164
Chapter 6: Mutant p53 interacts with p63 to regulate
SERPINA1 (protein: A1AT) expression

Preface
This chapter describes the mechanism by which mutant p53 regulates the expression of the

SERPINA1 (encoding the A1AT protein) gene in lung cancer. It is shown that mutant p53

interacts with its family member p63 to bind to response elements in the SERPINA1 gene.

Knockdown of endogenous p63 in a lung cancer cell line prevents the binding of mutant p53

to the DNA and results in decreased expression of SERPINA1. In addition, it is shown that

SERPINA1 is responsive to both mutant and wild-type p53. The function of SERPINA1 in

wild-type p53 mediated cell cycle response is determined. This chapter also discusses some

of the possible oncogenic function of wild-type p53. We show that SERPINA1 has no effect

on proliferation, rather it supports the survival potential of lung cancer cell lines. All these

results demonstrate SERPINA1 is a transcriptional target of mutant p53 with important roles

in the tumourigenesis of lung cancer.

Note: In this chapter the A1AT has been referred by its gene name SERPINA1.

165
 Introduction
The molecular properties of wild type p53 protein strongly determine its role in tumour

suppression. Despite the presence of transcriptionally independent roles (34), the p53 protein

primarily functions as a tetrameric transcription factor that regulates a set of target genes

with roles in tumour suppression (33). Indeed, genes activated by wild-type p53 are

functionally diverse and constitute downstream effectors of multiple signaling pathways

which cause various responses such as senescence, cell survival or programmed cell death

(35).

In human cancers, mutation in p53 gene are found in approximately 50% of all cancer types

(221). The mutations within the p53 gene can result in three types of functional

consequences:

1. Loss of function mutations. Almost all mutations in p53 fall under this category. The

mutation is in the DNA binding domain of p53 and unequivocally affects the sequence-

specific transactivation potential via loss of binding to wild-type p53 response elements

(wtp53-REs) (279), thereby resulting in loss of its normal tumour suppressive function.

2. Dominant negative mutations. The mutant p53 can hetero-oligomerize with wild-type p53

through its carboxy terminus and inactivate wild-type p53 resulting in reduced wild-type

tumour suppression.

3. Gain of function (GOF) mutations.

GOF p53 mutations in human cancers play vital in maintaining the oncogenic state of cell.

There are three functions that contribute to mutant p53 GOF. (i) loss of wild-type
166
transactivation function that results in deregulation of growth, (ii) loss of transcriptional

repression function of wild-type p53 that results in growth promotion and (iii) gain of new

(oncogenic) properties of missense p53 mutation that allow activation of genes involved in

oncogenic events and tumour progression (discussed in detail in chapter 2) (174).

Different promoters activated by mutant p53 shows no sequence homology, suggesting that

specificity of mutant p53 DNA binding may be distinct to that of the sequence specific

recognition property of wild type p53 and involve multiple mechanism (41). The broad

range of genes activated by mutant p53 are known to contribute to the establishment of

tumour phenotypes, which constitute the hallmarks of cancer progression, such as resistance

to apoptosis, pro-survival, increased invasive and metastatic potential, and angiogenesis

(36).

In chapter 3, this thesis identified SERPINA1 (encoding the A1AT protein) as a key

downstream-secreted mediator of mutant p53 GOF in lung cancer. It was shown that mutant

p53 can regulate SERPINA1 expression in lung cancer cell lines. In addition, in vivo

correlation between high p53 and elevated A1AT levels were demonstrated in human lung

ADC TMAs. The mechanism of regulation of SERPINA1 by mutant p53 in lung cancer is

investigated in this chapter. Mechanistically, the transcriptional effects of mutant p53 GOF

are largely mediated by either of two sub-types of molecular interactions (43, 44). On the

one hand, mutant p53 can regulate gene expression through specific protein-protein

interactions, and subsequent aberrant regulation of, various transcription factors including

167
its family members, p63 and p73 (45-48). Those known so far to interact with p53 (both

wild-type and mutant) includes E2F1, Ets1, Ets2, Sp1, CREB(50), VDR and NFY-A (47-

49, 52, 53, 280). On the other hand, despite facilitating the transcription machinery (281),

mutant p53 can also physically interact with cofactors including its family members p63 and

p73 (54, 55) and alter their transcriptional activity and their anti-tumourigenic functions.

Mutant p53 has the ability to both physically interact and inactivate the p53 family member

p63. p63 is a pivotal transcription factor that plays major role in normal developmental

biology (62) and has anti-tumourigenic functions (63). Since p53 and p63 proteins share a

high degree of sequence homology within their DNA binding domains (282, 283), p63 can

bind the canonical p53-RE and subsequently regulate several p53 target genes including p21,

MDM2 and BAX (283, 284). Mutant p53 can also interact with p63 and prevent it’s binding

to DNA (51, 285), subsequently inhibiting its transcriptional activity. In addition, binding of

mutant p53 with p63 can modify the DNA binding properties of p63, resulting in recruitment

of the complex to sites distinct from those that p63 would normally bind, and also impairing

normal p63 function (52, 53, 281).

Our laboratory has previously reported that, of the genes activated by mutant p53 some also

exhibit p63-mediated regulation (166). In this study, mutant p53 activated genes frequently

share promoter sequences with consensus motifs that would allow binding of either p63 or

wild-type p53. The SERPINA1 (encoding A1AT protein) gene identified in this thesis is a

target of mutant p53 and has been reported to contain promoter binding sites for p63 (286).

168
Thus we examined whether mutant p53 interacted with p63 to regulate the expression of

SERPINA1.

In this chapter, the mechanism of regulation of SERPINA1 by mutant p53 is investigated. It

is demonstrated that mutant p53 uses p63 as a molecular chaperone to bind the DNA of

SERPINA1. It is also shown that SERPINA1 expression is responsive to both mutant and

wild-type p53. Furthermore, SERPINA1 is proposed to enhance the tumourigenic potential

of lung cancer cells.

169
 Results

Identification of p53 response element in mutant p53 regulated SERPINA1 gene

To explore if the regulation of SERPINA1 by mutant p53 was mediated through a direct or

indirect mechanism, we first employed an in silico analysis. A 10 kB upstream and

downstream region of the transcription start site of SERPINA1 was scanned for putative p53

response element (REs) using p53 scan software (172). Three putative response elements

were identified in the intron and 3’ UTR region of SERPINA1 gene (Figure 6.2). The results

of the p53/p63 scan are presented in Table 6.1.

Identification of putative p63-REs in SERPINA1

The discovery of putative p53-REs in the SERPINA1 gene indicates that SERPINA1 may be

a potential transcriptional target of mutant p53s. However, missense mutant p53 is unable to

bind the canonical p53 RE and this results in the loss of the transcriptional functions of wild-

type p53. Therefore mutant p53 is likely to regulate SERPINA1 gene through an indirect

mechanism. Mutant p53 has been previously shown to transactivate target genes indirectly

through interaction with other transcriptions factors.

Mutant p53 has been reported to piggyback on p63 as a molecular chaperone to tether p63

to the promoter of its target gene (52, 53, 281). Our laboratory has previously reported that

the genes activated by mutant p53 exhibit some p63-mediated regulation and frequently

share a promoter with sequence similarities with p63 and/or wild-type p53. SERPINA1 gene

170
is a target of mutant p53, and has been reported to contain promoter binding sites for p63

(286), indicating a role of p63 in the regulation of SERPINA1. Therefore, we speculated that

SERPINA1 could also represent a direct p63 target gene.

To investigate the potential role of p63 in regulating the expression of SERPINA1, the in

silico analysis was expanded to identify putative p63-REs using p63-scan software. Results

from this scan identified three putative p63 REs in the same location in introns and 3’UTR

region of SERPINA1 (Table 6.1). This observation is not unusual due to significant similarity

in the consensus sequence of p63 and p53 REs (166). These sites are potentially responsive

to both p53 and p63 and are therefore referred to as p53/p63-REs (Figure 6.2).

Figure 6.2 p53/63 REs identified through in silico analysis using p53- and p63-scan

software

Schematic diagram representing the putative p53/p63 binding sites on SERPINA1 gene as

identified using p53 and p63 scan.

171
Table 6.1 p53/63-REs identified through in silico analysis using p53-scan and p63 scan

software.

SERPINA1 (protein name: A1AT) gene region, including 10000 bases upstream

Genomic Location Sequence Sequence Location in

Start End gene
nd
14742 14762 GGGAAAGCCA AGACTTGTTC 2 intron
20809 20828 GGCAAGATG AGACAGGCTT 3rd intron
22314 22333 AGCTGGTCC CTGCCTGCAT 3’UTR

Investigation of p63 binding to specific response elements

To investigate whether p63 could associate with the identified p53/p63 REs in SERPINA1,

ChIP analysis was performed on those sites. The ability of endogenous p63 to ChIP with

DNA following silencing of p63 expression in H2009 NSCLC cell line (expressing p53

R273L) was examined. The fold enrichment for p63 binding to specific sites was determined

by real-time qRT-PCR. ChIP analyses demonstrated that the knockdown of endogenous p63

significantly reduces the amount of p63 bound to all three p53/p63 RE-s of SERPINA1 gene

in H2009 cells (Figure 6.3A).

Next, we examined whether in cells expressing p63 the SERPINA1 expression was

constitutively up-regulated. The endogenous p63 in the H2009 NSCLC cell line was

knocked-down and the expression of SERPINA1 was measured. Indeed, knock down of

endogenous p63 resulted in 3.4 fold decrease in the expression of SERPINA1, suggesting

p63 can drive expression of SERPINA1 (Figure 6.3B).

172
 A B

Figure 6.3 p63 bind identified p53/p63 REs and regulates SERPINA1 expression

A. H2009 (p53 R273L) cells were transfected with either p63-specific siRNA (si.p63) or

non-targeting control (si.Ctrl) and subjected to ChIP analysis using either a p63-specific

antibody or IgG control. Data presented as fold enrichment of p63 binding (si.Ctrl versus

si.p63). Data represents two biological replicates. *P < 0.05, **P < 0.005.

B. Endogenous p63 was silenced in H2009 cells using a p63 specific siRNA and the relative

expression of SERPINA1 was determined by qRT-PCR analysis. p63 knockdown was

confirmed using western blot analysis (top). Data represented as mean ± standard error of

mean (SEM). **P < 0.005.

173
 Investigation of p53 binding to specific response elements
These results suggest that SERPINA1 is a direct target of p63. Furthermore, we also

observed constitutive up-regulation of SERPINA1 by p63 (Figure 6.3B). Based on these

results, we speculated that mutant p53 is recruited to the DNA of SERPINA1 through its

direct interaction with p63. To investigate this possibility, the ability of mutant p53 to

associate with DNA was investigated using the PonA inducible EI-H1299 cell lines

expressing p53R175H, p53R248Q and p53R248W mutants. The human PLK2 promoter

served as a positive control, as it has been previously shown that p53 mutant can drive its

transcription (53). The fold enrichment for p53 binding to specific sites was determined by

qRT-PCR. Data from ChIP analyses was consistent with our hypothesis, as following

induction of all three different missense p53 mutants there was increased association with

the putative p53/p63 REs of SERPINA1 gene in H1299 cells compared with an un-induced

control (Figure 6.4).

174
Figure 6.4. p53 binds the identified p53/p63 REs

EI-H1299 cells with inducible p53 R175H, R248Q or R282W were cultured in the presence

of PonA (2.5ug/ml) or vehicle control for 24 hours prior to ChIP analysis using a anti-p53

specific antibody. Fold enrichment of mutant p53 binding to DNA is presented relative to

the un-induced control. Data represents three biological replicates. The p53RE within PLK2

promoter was used as a positive control. *P < 0.05, **P < 0.005 (below).

175
 Mutant p53 is co-recruited with p63 to the DNA of SERPINA1 gene
Our observations so far suggest that both mutant p53 and p63 can regulate SERPINA1

expression. Furthermore, we also provide evidence that mutant p53 and p63 are recruited to

the identical specific p53/p63 REs. We next hypothesized that p63 recruits mutant p53 and

this potentiates tethering of the complex to these binding sites. To investigate this possibility,

the ability of mutant p53 to associate with these binding sites following depletion of p63

expression in H2009 cell line (expressing endogenous p53 R273L mutant) was determined.

Silencing of p63 resulted in a complete dissociation of the endogenous p53 mutant from the

p53/p63 REs of SERPINA1 (Figure 6.5A and 6.5B). This data suggests that p63 can drive

expression of SERPINA1 via binding to the three REs but this is further potentiated by the

formation of a mutant p53-p63 complex that allows increased transactivation of this gene.

176
 A

Figure 6.5 Mutant p53 associations with p53/p63 REs is decreased by silencing p63

expression

(A) H2009 (p53 R273L) cells were transfected with either p63-specific siRNA (si.p63) or

non-targeting control (si.Ctrl) and was subjected to ChIP analysis using either a p53-specific

antibody or IgG control. Fold enrichment of mutant p53 binding to DNA is presented relative

to IgG control. **P < 0.005.

(B) Diagram representing the mechanism of action of mutant p53 in regulating SERPINA1

expression.
177
 Activated wild-type p53 regulates SERPINA1 expression
The p53 family member, p63 can bind to a subset of canonical p53-REs and subsequently

regulate the expression of a subset of p53 target genes including p21, MDM2 and BAX (283,

284). Previous findings from our laboratory have demonstrated that the genes activated by

mutant p53 contain p63 REs that are in common with a subset of wild-type p53 REs.

Consistent with this, the majority of genes identified as responsive to mutant p53 expression

were also shown to be regulated by wild-type p53. The data presented within this chapter

demonstrate that the mutant p53 regulated SERPINA1 gene also exhibits p63-mediated gene

regulation as it is shown that p63 can associate to the identified p53/p63 REs within the

regulatory region of SERPINA1. This led us to speculate that SERPINA1 may also be a direct

target of wild-type p53. To test this hypothesis, we induced wild-type p53 in EI-H1299 p53

WT cell lines with PonA and measured the expression of SERPINA1. Indeed, induction of

wild-type p53 significantly upregulated the expression of SERPINA1 in H1299 cells (Figure

6.6A).

In normal unstressed cells, the p53 protein is maintained at very low levels (287) and the

basal expression of SERPINA1 is also low. In chapter 5, we demonstrated that the basal

expression of SERPINA1 mRNA is significantly lower in p53-wild-type lung cancer cell

lines. Thus we speculated that induction of SERPINA1 will depend on the activation of wild-

type p53. To test this possibility, we treated a panel of lung cancer cell lines expressing wild-

type p53, null or mutant p53 with the wild-type p53 activator, nutlin-3a (10 μM). Indeed,

the treatment with the nutlin-3a significantly upregulated SERPINA1 mRNA levels in p53

wild-type expressing SBC-3 small cell lung cancer cell line (Figure 6.6B and 6.6C). This
178
increase following nutlin-3a treatment was directly related to the activation of wild-type p53

since increased SERPINA1 mRNA expression was not observed in p53 null H1299 or p53

mutant cell lines; H1446 (Frameshift (Fs); codon 89) and H2009 (missense; R273L).

Furthermore, treatment of the p53 isogenic cell lines HCT116 p53 -/- and HCT116 p53 +/+

with nutlin-3a upregulated the SERPINA1 expression of HCT116 p53 +/+ but did not change

SERPINA1 expression in HCT116 p53 -/- cells (Figure 6.6D). In order to investigate the

ability of wild-type p53 to associate with the identified p53/p63 binding sites in SERPINA1,

we performed ChIP analyses using the EI-H1299 p53 WT cell line. When wild-type p53 was

induced, there was increased binding to all three identified p53/p63 binding sites compared

to un-induced control (Figure 6.6E). Taken together, this data suggests that wild-type p53

specifically and directly regulates SERPINA1 expression.

Since wild-type p53 is largely known to transactivate the genes that are involved in anti-

tumourigenic properties we hypothesize that SERPINA1 may also be involved in anti-

tumourigenic function. Therefore, we examined the functional role of SERPINA1 in wild-

type p53 mediated cell cycle control. The expression of SERPINA1 was silenced in the p53

wild-type expressing SBC-3 cell line and subsequently treated with p53 activator, nutlin 3a

for 24 hours. Unexpectedly, knockdown of SERPINA1 had no effect in activated p53

mediated cell cycle function in SBC-3 cell line (Figure 6.6F). Furthermore, knockdown of

SERPINA1 did not affect the proliferation in p53 mutant H2009 cells (Figure 6.6G).

Collectively, these data suggest that although SERPINA1 is a target of wild-type p53, but the

function of A1AT in a wild-type p53 scenario remains to be determined.

179
180
Figure 6.6 SERPINA1 is a target of wild-type p53 with no possible role in cell cycle

function

(A) Western blot analysis of secreted SERPINA1 protein levels in conditioned media and

p53 protein in cell lysates of EI-H1299 p53 wild-type cell line. β-tubulin was used as a

loading control.

(B) qRT-PCR for SERPINA1 expression in panel of lung cancer cell lines: H1299 (p53 null),

SBC-3 (p53 WT), H1466 (p53 frame shift) and H2009 (p53R273L) incubated with 10 μM

of nutlin-3a for 24 hours. p21 mRNA expression was used as a positive control (right).

(C) Western blot analysis of p53 proteins levels in the panel of lung cancer cell lines: H1299

(p53 null), SBC-3 (p53 WT), H1466 (p53 frame shift) and H2009 (p53R273L) incubated

with 10 μM of Nutlin-3a for 24 hours. 10 μg of each protein samples were loaded on 8%

polyacrylamide gels. β-tubulin was used as a loading control.

(D) qRT-PCR for SERPINA1 expression in two isogenic HCT 116 -/- and HCT 116 +/+ cells

incubated with 10 μm of Nutlin-3a for 24 hours. The activation of p21 mRNA levels was

used as a positive control for p53 activation (right).

(E) EI-H1299 cells with inducible p53 wild-type (WT) was cultured in the presence of PonA

(2.5μg/ml) or vehicle control for 24 hours prior to ChIP analysis using a p53 specific

antibody. Fold enrichment of a putative p53/p63 REs within the SERPINA1 gene (as

compared with un-induced control) was determined for three independent experimental

replicates. The p53RE within PLK2 promoter was used as a positive control. *P < 0.05, **P

< 0.005 (right).

181
(F) qRT-PCR for A1AT mRNA expression in SBC-3 cells stably expressing sh.ctrl or

sh.A1AT (left). ***P < 0.0005. SBC-3 cells expressing sh.ctrl or sh.A1AT were treated with

Nutlin-3a for 24 hours and cell cycle distribution was analyzed by flow cytometry of

propidium iodide (PI) stained cells. Percentage of cells in G0-G1, S and G2-M phase (right).

Decrease in S phase was observed at 24 hours following Nutlin-3a treatment. Representative

flow cytometric histograms of PI-treated cells after Nutlin-3a treatment for 24 hours (below).

Percentage of cells in sub-G1 population is indicated in histogram.

(G) Cell proliferation was measured for H2009 cell line stably expressing sh.Ctrl or

sh.SERPINA1 using luminescent cell viability assay (Promega). Data presented as mean ±

standard error of mean (SEM) from triplicate experiments.

SERPINA1 promotes tumourigenesis in lung cancer cell lines

Apart from the role in normal cells as a tumour suppressor, expression of wild-type p53 in

tumours has been implicated in a number of pro-survival pathways. Thus we examined

whether SERPINA1 supported the anchorage independent growth potential of potential of

lung cancer cell lines in the context of wild-type p53. Indeed, knockdown of SERPINA1 in

p53 wild-type SBC-3 cell lines resulted in a significantly reduced colony size and numbers

when cultured in soft agar, suggesting a potential oncogenic role for SERPINA1 in p53 wild-

type cell lines (Figure 6.7).

Expression of several hot spot p53 mutants such as R175H, R248Q and R273H in H1299

cells has been shown to promote tumourigensis (202). We investigated whether SERPINA1
182
has a role in mutant p53 driven tumourigenesis. Indeed, in H2009 cells expressing p53

R273L mutant, knockdown of SERPINA1 significantly reduced the anchorage independent

growth of H2009 cell line (Figure 6.7).

In a lung cancer cell line, SERPINA1 does not influence p53 mediated cell cycle function,

however in either wild-type p53 or in a mutant p53 scenario, knockdown of SERPINA1

reduced the anchorage independent growth potential, indicating its pro-survival function.

Figure 6.7 SERPINA1 promotes anchorage independent growth.

Anchorage independent growth potential of H2009 and SBC-3 cells stably expressing sh.Ctrl

or sh.SERPINA1 as measured using soft agar assay (right). Data presented as a mean ±

standard error of mean (SEM) of triplicate replicates. *** P <0.0005, ** P < 0.005.

Representative photographs of the colonies (left), note the reduced number and size of cells

transfected with sh.SERPINA1.

183
 Discussion
A widely accepted mechanism of how mutant p53 mediates its oncogenic ability has been

derived from exploring the ability of mutant p53 to physically interact with and inactivate

its family members, p63 and p73 (54, 55). Mutant p53 has been shown to interact with p63,

and inhibit its transcriptional function as a tumour suppressor resulting in increased invasive

and metastatic potential of cells (51, 285), Furthermore, it has been proposed that mutant

p53 can use p63 to tether to the promoter of p53 target genes (52, 53, 281). These target

genes activated by mutant p53 are conserved across several p53 mutant variants and their

REs have shared homologies to both the consensus sequences of p63 and wild-type p53.

p63 is known to bind the consensus p53-REs of endogenous target genes and regulate their

expression (283, 284, 288-290). In addition, the data presented within this chapter

demonstrate crosstalk between p63 and mutant p53 in relation to activation of SERPINA1, a

secreted mediator of mutant p53. We show that p63 regulates the expression of the mutant

p53 target, SERPINA1. Furthermore, we have demonstrated that p63 is co-recruited by

mutant p53 to these binding sites and depletion of p63 significantly reduces the ability of

p53 to bind at the identified sites of SERPINA1. It is also possible that p63 may have different

binding affinities to the identified REs or other co-factors may be involved in the recruitment

of mutant p53 or p63 to different bindings sites, which has not been investigated to-date.

It has been shown that mutant p53 can regulate an independent set of genes compared to

wild-type p53 (152, 291). However, using expression array analysis our laboratory has

184
previously reported that the majority of transcriptional targets of mutant p53 are nested

within a small subset of wild-type p53 responsive genes (166). In fact, this chapter

demonstrates that SERPINA1 expression is responsive to both mutant p53 expression as well

as wild-type p53. However, investigation into the possible role of SERPINA1 in tumour

suppression identified that SERPINA1 has no effect on wild-type p53 mediated cell cycle

but has an anchorage independent growth promoting function. Although further

investigation is required to explore the possible tumour suppressive or oncogenic role of

SERPINA1 in wild-type p53 activated cell lines. These results were obtained in wild-type

expressing cancer cell lines, the role of SERPINA1 in normal cells needs further

investigation.

The expression and activity of wild-type p53 protein is tightly controlled, with activation

and protein stabilization resulting in response to varying cellular stresses (218). In normal

unstressed cells, p53 proteins are maintained at very low levels (287), and the basal

expression of SERPINA1 is also low. However, when p53 protein is stabilized by stress of

an exogenous factor, it drives expression of a multitude of genes including SERPINA1. A

small subset of wild-type p53 transactivated targets are also the targets that drive mutant p53

GOF. Questions remain as to whether the tumour suppressive targets of wild-type p53 in

p53 wild-type tumours possess any masking effect on this small subset of overlapping p53

target; an effect which is otherwise absent in p53 mutant tumours. For example, apoptotic

genes activated by wild-type p53 are not activated by mutant p53 but are activated by wild-

type p53 resulting in cell death. Alternatively in wild-type p53 tumours, the expression of

small subset of overlapping mutant p53 targets may favor p53 to select against tumour
185
suppressive function and promote cancer development as evident through tumours with high

level of wild-type p53 (228, 292).

In addition to its role in tumour suppression, wild-type p53 protein has also been implicated

in a number of pro-survival pathways (293, 294). The activation of wild-type p53 targets

using chemotherapeutic treatment has been reported to prolong G2 arrest and support anti-

apoptotic function (295). Previous studies have speculated that the overlapping gene

activated by wild-type and mutant p53 may represent an oncogenic ‘dark side’ of p53 (166).

We show that SERPINA1 knockdown inhibits the anchorage independent growth potential

of lung cancer cell lines. The anchorage independent growth is a crucial step in malignancy,

as it potentiates the cancer cells to migrate throughout circulation, colonize distant sites and

grow metastastically (296). These findings support the idea of an “oncogenic dark side of

p53” and demonstrate SERPINA1 is an oncogenic direct target of both wild-type p53 and

mutant p53. These results are consistent with previous findings that shows (1) p63 is a

critical molecular chaperone for mutant p53 (2) a subset of wild-type p53 transactivated

targets are also the targets that drive mutant p53 gain-of function (3) wild-type p53 engages

pro-survival pathways by transcriptionally activating multitude of genes that are also

represented as an oncogenic ‘dark side’ of p53 (294).

Whether different p53 mutations with distinct structures exert GOF to the same extent and

through similar mechanism or whether tissue specific expression of cofactors determines the

fate of mutant p53 GOF, remains unclear. Our studies show that both conformational (e.g.,

186
R175H and R282W) and structural mutants (e.g., R248Q and R273L) are capable of binding

to the p53/p63 binding sites of the SERPINA1 gene. Taken together, our findings

demonstrate that mutant p53 co-locates with p63 to potentiate its binding to specific REs on

SERPINA1 gene in lung cancer.

187
Chapter 7: Role of Alpha-1 Antitrypsin (A1AT) in breast
cancer

Preface
The work presented in chapters 3-6 of this thesis identifies A1AT as a novel secreted

mediator of mutant p53 GOF in lung cancer. This chapter investigates the role of A1AT in

breast cancer. It is identified that the expression of A1AT in breast cancer is specific to

tumour sub-types. A1AT is shown to be significantly higher in the luminal A subtypes of

breast cancer than in luminal B and triple negative breast cancer (TNBC) subtypes. The

expression of A1AT is further analyzed in a panel of TNBC cell lines with different p53

status. The expression of A1AT is found to be significantly higher in TNBC cell lines with

p53 missense mutation, than those cell lines cells with intact or non-functional p53 alleles.

Similar to lung cancer, A1AT is a secreted mediator of mutant p53 GOF in TNBC cell lines.

Both anti-A1AT blocking antibody and hairpin mediated gene knockdown approaches are

further shown to ablate the invasive ability of a TNBC cell line. These results demonstrate

that A1AT is a likely oncogenic target of mutant p53 expressing breast cancer and provide

a rationale to investigate the development of antibody-based therapies targeting A1AT. This

chapter provides supporting evidence on the application of A1AT targeted therapies in other

cancer types, warranting further exploration beyond its regulation of p53.

188
 Introduction
Breast cancer is the leading cause of cancer –related deaths among women. Breast cancer is

derived from the epithelial (carcinoma) or stromal (sarcoma) tissues, with the majority

derived from the epithelium lining of the ducts or lobules, which are classified as ductal or

lobular carcinoma. The leading hypothesis to describe breast cancer development involves

progression from atypical hyperplasia to ductal carcinoma in situ (DCIS). There pre-invasive

lesions may then evolve to invasive breast cancer (297).

Breast cancer is a heterogeneous disease primarily categorized on the basis of several

pathological features. Invasive ductal carcinoma is the most common morphological subtype

that represent 80% of breast cancers while invasive lobular carcinoma represents

approximately 10% (298, 299). These morphological subtypes of breast cancer can be

further classified on the basis of hormonal and molecular signatures. Clinically, expression

of hormone receptors such as the estrogen receptor (ER) and progesterone receptor (PR),

and the human epidermal growth receptor 2 (HER2) provide a basis for the classification of

breast cancer. Various cytokeratins (such as CK5/6) can also be used in clinical classification

of breast cancers (300). Estrogen receptor is expressed in approximately 70% of all human

breast cancers (301). ER expression serves as a prognostic factor and therapeutic treatment

such as anti-estrogen strategy for a large group of breast cancer patients (302). Selective

estrogen receptor modulators (SERMs), such as tamoxifen are the most widely used

therapeutic and preventive agent for ER+ breast cancer (303-305).

189
Based on studies using DNA profiling, the currently recognized molecular subtypes of breast

cancer are: (i) luminal A (ER+), (ii) luminal B (ER+/HER2-enriched), (iii) HER2+ (HER2-

enriched), (iv) triple negative breast cancer (TNBC) which includes basal like and claudin

low, and (v) normal-like (297, 306-309). These molecular subtypes are associated with

different clinical outcomes and serve as references for prognosis and treatment options (310-

313). Luminal A breast cancer is the most common subtype, and is ER+, progesterone

receptor positive (PR+) and HER2- and has the best prognosis (314). Luminal B breast

cancers occurs less frequently and is characterized by ER+, PR+ accompanied by

amplification and/or overexpression of the HER2 and KI-67 (315). Patients with luminal A

and luminal B cancers are responsive to anti-estrogen treatment while HER2 targeted

therapy can also be used in the luminal B subtype (316, 317). The HER2+ enriched subtype

represent 17% of all breast cancers, has poor clinical outcome and predicts a positive

therapeutic response to the anti-HER2 antibody, Trastuzumab (318). Triple negative breast

cancers include basal-like and claudin low subtypes that lack the expression of ER, PR and

HER2. TNBC represents approximately 20% of all breast cancer and has the poorest clinical

outcomes. Due to a lack of validated receptor expression, chemotherapy is the only current

treatment option for this group (319).

The p53 protein, encoded by the TP53 tumour suppressor gene, is the main molecular

decision maker of stress responses in human cells (320). p53 plays a critical role in the

prevention of oncogenic transformation through the elimination, or permanent growth arrest,

of potentially malignant cells. Upon cellular stresses such as DNA damage, p53 is activated

and drives various tumour suppressor pathways, including cell-cycle arrest, apoptosis, DNA
190
repair and senescence (217, 218). The importance of p53 in the prevention of cancer

development is highlighted by the fact that approximately 50% of all human cancers contain

a mutation in TP53 (219). Studies using next generation sequencing confirm that the p53

mutation is the most frequent in breast carcinoma, present in up to 30% of cases (321).

However, the distribution of p53 mutations in breast cancer is specific to tumour subtypes

(322). p53 mutations are found in 26% of luminal tumours with 15% in luminal A and 14%

in luminal B, while in 88% of TNBC and 50% of HER2 amplified subtypes. In general,

about 70-80% of ER+ luminal breast cancers express wild-type p53 while most ER- TNBC

express mutant p53 (323, 324).

Mutations in p53 are often found in the early invasive stage of breast carcinoma. However

the consequences of p53 mutation may vary depending on the breast tumour subtype. The

majority of TNBC are of basal-like molecular subtype that represents a population of

particularly aggressive breast lesions associated with poor prognosis (325). Due to the lack

of therapeutic options, the treatment of TNBC is limited to conventional chemotherapy.

Despite the investigation of agents such as PARP or EGFR inhibitors, the clinical efficacies

of such agents have been quite disappointing (326, 327). Hence, there is a need to identify

alternative targets for such groups of breast cancers. Since, p53 mutations are reported in

over 80% of TNBCs, targeting mutant p53 or its downstream effectors may provide new

therapeutic options for the treatment of this aggressive disease.

191
In previous chapters, we identified Alpha-1 Antitrypsin (A1AT) as a critical effector of

mutant p53 GOF in lung cancer. This chapter studies the role of A1AT in breast cancer. It is

shown that the expression of A1AT in breast cancer is specific to tumour sub-types. Further,

it is demonstrated for the first time that A1AT is a key secreted mediator of mutant p53 GOF

in TNBC and has the potential to serve as a therapeutic target.

192
 Results

Analysis of A1AT expression in breast tumours

Previous chapters identified A1AT as a target of wild-type and mutant p53 in lung cancer.

Since the expression of p53 is highly specific to subtypes of breast cancer, we first examined

the expression of A1AT levels in different subtypes of breast cancer tissues. The expression

levels of A1AT in a TCGA cohort of 426 breast cancer patient tumour samples were

analyzed. The cohort consists of 223 luminal A, 122 luminal B and 81 basal-like TNBC

breast tumour samples. Interestingly, A1AT mRNA expression levels were on average

higher by 24% and 27% in luminal A subtypes compared against luminal B and basal-like

TNBC tumour subtypes (Figure 7.1A).

The luminal A and luminal B subtypes, represent the majority of ER positive breast cancer

and are characterized by the expression of ER, PR and other genes associated with ER

activation (314, 315). Hence it is possible that the regulation of A1AT may also involve the

estrogen receptor. To examine this possibility, we initially determined the expression of

A1AT in a panel of ER+ and ER- breast cancer cell lines. This was achieved through the

analysis of A1AT expression in the expression profiling data from cancer cell line

encyclopedia consisting of a panel of 37 different human breast cancer cell lines. The panel

consisted of 20 ER+ cell lines and 17 ER- cell lines. Interestingly, the expression of A1AT

was significantly higher in ER+ breast cancer cell lines than in ER- breast cancer cell lines

(Figure 7.1B). About 70-80% of ER+ luminal breast cancers express wild-type p53 while

193
most ER- basal-like breast tumours express mutant p53 (323, 324). The crosstalk between

p53 and ER has been demonstrated at both molecular and clinical levels (328).

In previous chapters, we have shown that A1AT is a target of wild-type p53 in lung cancer.

This led us to speculate whether the expression of wild-type p53 was associated with A1AT

expression in breast cancer. To test this, we analyzed the expression of A1AT in a cohort of

426 breast tumour samples that consisted of 289 p53 wild-type tumours and 171 p53 mutant

tumours (including missense and frameshift/stop non-functional). Interestingly, A1AT

expression was on average much higher by (by 123%) in breast tumours expressing wild-

type p53 than in those tumours expressing mutant p53 (Figure 7.1C). However further

stratification of these tumours based on p53 status, showed no significant difference in the

expression of A1AT between tumours with p53 wild-type, frameshift (fs) and missense (ms)

mutations (Figure 7.1C; right). Consistent with these findings, the stratification of breast

cancer cell lines based on p53 status also showed no difference in A1AT mRNA expression

between cell lines expressing p53 wild-type (wt), frameshift (fs) and missense (ms)

mutations (Figure 7.1D and Appendix III). These observations were also validated in

selected breast cancer cell lines using real-time PCR (Figure 7.1D). Consistent with the

finding from affymetrix data, the ER+ cell lines MDA-MB-361, T47D and ZR75-1

expressing p53 frameshift, missense and wild-type p53 showed the highest A1AT

expression. These findings indicate that in breast cancer, p53 status does not significantly

influence A1AT expression but the presence of ER could possibly affect the regulation of

A1AT.

194
A B

D E

195
Figure 7.1 Analysis of A1AT expressions in breast cancer

(A) A1AT mRNA in TCGA human breast tumours classified as: luminal A (n=223), luminal

B (n=122) and basal like TNBC (n=81), as obtained from cBio Portal (266, 267). **P <

0.005 and *P < 0.05.

(B) The mRNA levels for A1AT in 37 human breast cancer cell lines with different ER

status. Affymetrix dataset were obtained from Cancer Cell Line Encyclopedia. **P < 0.005.

(C) A1AT mRNA expression in TCGA breast tumours stratified as p53 wild-type tumours

(n=289) and p53 mutant (n=171). Further stratification of tumours as p53 wild-type (wt),

frameshift (fs) and missense (ms) (right). **P < 0.005. “ns” denotes not significant.

(E) The mRNA levels for A1AT in 37 human breast cancer cell lines with various p53 status:

wild-type (wt), frameshift (fs) and missense (ms). Affymetrix dataset were obtained from

Cancer Cell Line Encyclopedia. “ns” denotes not significant.

(D) qRT-PCR analysis of A1AT mRNA expression in a panel of breast cancer cell lines

expressing different p53 status: wild-type (wt), frameshift (fs) and missense (ms). Data

presented as a fold change in expression relative to MCF-7 cell line, which has been set at

1.

196
 A1AT is a target of mutant p53 GOF in TNBC

In previous chapters, we identified A1AT as a critical mediator of missense mutant p53 in

lung cancer, which prompted us to investigate whether in breast cancer the regulation of

A1AT is also driven by p53. Since, TNBC exhibits a high rate of somatic mutation in p53,

we initially examined the expression of A1AT in a panel of TNBC cell lines with different

p53 status. The panel consisted of 10 TNBC cancer cell lines with p53 missense mutations,

5 with frameshift or deletion and 1 with wild-type p53. A1AT mRNA expression was

significantly (P < 0.05) higher, on average by 27% in TNBC cell lines expressing p53

missense mutations, compared to cell lines with an intact or non-functional p53 allele (Figure

7.2A). We then tested whether an endogenous mutant p53 can constitutively regulate the

expression of A1AT. The mesenchymal breast cancer cell line MDA-MB-231 expressing an

endogenous p53 missense mutation, R280K possessed the highest of A1AT expression of

those tested cell lines (Figure 7.2A). Knockdown of this endogenous mutant p53 in MDA-

MB-231 cells resulted in a 4-fold reduction in A1AT mRNA expression (Figure 7.2B),

suggesting a possible role for mutant p53 in aberrant activation of A1AT.

197
 A B

Figure 7.2 A1AT is a target of missense mutant p53 in TNBC

(A) The mRNA levels for A1AT in a panel of 16 ER negative-TNBC cancer cell lines.

Affymetrix dataset was obtained from Cancer Cell Line Encyclopedia. Missense versus

other. *P < 0.05.

(B) qRT-PCR for A1AT and western blot analysis for p53 in MDA-MB-231 cells with p53

siRNA (si.p53) or control (si.Ctrl). β-tubulin was used as a loading control. Data presented

as mean ± standard error of mean (SEM) from three replicates. **P < 0.005.

198
 A1AT induces the invasive phenotype in the p53 mutant TNBC cell line MDA-
MB-231 in vitro and in vivo

Mutant p53 has been shown to promote invasion in breast cancer cell lines (329, 330), which

prompted us to investigate whether A1AT functions as a secreted mediator of mutant p53

gain of function (GOF) in breast cancer. To test the invasive ability of A1AT, we stably

knocked down A1AT in the mesenchymal TNBC cell line MDA-MB-231 that expresses the

endogenous mutant p53 R280K (Figure 7.4A). Knockdown of A1AT significantly reduced

the ability of MDA-MB-231 cells to invade through matrigel by 1.9 fold, indicating a role

for A1AT in driving invasion (Figure 7.3A). This was further confirmed using a scratch

wound assay where wound closure, reflecting cellular migration was significantly decreased

by 2.6 fold in A1AT knockdown cells compared to its control (Figure 7.3B).

Next, the Chick Chorio-allantoic Membrane (CAM) invasion assay was used to investigate

whether A1AT expression was associated with invasion of basal/TNBC cell in vivo. MDA-

MB-231 cells with stable knockdown of A1AT or control were mixed with matrigel and

placed onto the CAM of 11-day old chick embryos. The invasion of cells through the

ectoderm into the mesoderm was assessed by immunohistochemical analysis using a pan-

cytokeratin antibody. Consistent with our in vitro observation, A1AT knockdown

significantly reduced the invasive potential of MDA-MB-231 cells by 2.2 fold (Figure 7.3C).

Collectively, these findings are consistent with A1AT being a key downstream target of

mutant p53 that promotes cellular invasion in the MDA-MB-231 TNBC cell line.

199
 A B C

Figure 7.3 A1AT induces cell invasion and migration

(A) The invasion of MDA-MB-231 cells stably expressing control (sh.ctrl) or a shRNA

against A1AT (sh.A1AT) was measured and quantified. Data presented as means ± standard

error of mean (SEM) from three biological replicates. **P < 0.005.

(B) Quantification of wound confluence in scratch wound assays at 0 and 24 hr after

wounding of human MDA-MB-231 cells stably expressing a non targeting control (sh.ctrl)

or a shRNA targeting A1AT (sh.A1AT) (right). Data presented as mean ± SEM. **P <

0.005.

(C) CAM invasion assay was performed using MDA-MB-231 cells expressing sh.Ctrl or

sh.A1AT. Quantification analysis of invasion of MDA-MB-231 cells with sh.Ctrl or

sh.A1AT into the CAM (right). Data presented as means ± standard deviation (SD) from

indicated replicates. **P < 0.005.

200
 A1AT alters Epithelial-Mesenchymal Transition (EMT) marker expression and
supports cell survival function

Loss of p53 function has been linked to the induction of EMT through its direct involvement

in modulating key transcriptional regulators of this process including TWIST1 (233), SLUG

(234) and ZEB1 (75). EMT is a key program in embryonic development, the aberrant

activation of which may induce invasion, tumour cell dissemination and metastasis in cancer

cells. Therefore, we examined whether silencing of A1AT resulted in alteration in expression

of key drivers of mesenchymal transformation. Indeed, silencing of A1AT expression in the

MDA-MB-231 cell line resulted in significant repression of several key target genes,

including TGFB1, TGFBR2, SNAI1, SNAI2, ZEB1, FN, VIM and TNC (P < 0.05; Figure

7.4A).

The mutant p53 GOFs also involves the ability to promote anchorage independent cell

growth (202). Thus we examined whether A1AT supports the anchorage independent growth

potential of MDA-MB-231 TNBC cells. Indeed, MDA-MB-231 cells, which expresses an

endogenous p53 R280K mutant, clearly promoted anchorage independent growth of cells on

soft agar, whereas knockdown of A1AT in MDA-MB-231 cells significantly reduced the

anchorage independent growth of the cells (Figure 7.4), indicating a role for A1AT in pro-

survival function. Knockdown of A1AT had no effect on the proliferation of MDA-MB-231

cells. Collectively, these findings indicate that A1AT promotes invasion of the TNBC cell

line MDA-MB-231, likely by altering the network of EMT genes and supporting a pro-

survival function.

201
 A

Figure 7.4 A1AT alters epithelial-mesenchymal transition (EMT) marker expression

and supports anchorage independent growth.

(A) qRT-PCR analysis of mesenchymal marker expression in MDA-MB-231 expressing

sh.Ctrl or sh.A1AT (right). Data presented as fold change in expression relative to cells

expressing scrambled RNA sequence (sh.Ctrl), which has been set at 1. The protein level of

A1AT and vimentin was determined by western blotting (left).

(B) Anchorage independent growth potential of MDA-MB-231 cells stably expressing

sh.Ctrl or sh.A1AT as measured using soft agar assay (right). Data presented as mean ±

standard error of mean (SEM) of triplicate replicates. ** P <0.005. Representative

photographs of the colonies (left), note the reduced number and size of cells transfected with

sh.A1AT.
202
 Secreted A1AT enhances the invasive ability of the TNBC cell line MDA-MB-
231 while A1AT neutralization reduces invasion

In order to determine whether secreted A1AT was a driving factor of invasion in p53 mutant

TNBC, MDA-MB-231-sh.A1AT cells were incubated with the conditioned media from

MDA-MB-231-sh.Control cells and the degree of invasion was assessed using an inverted

invasion assay. Conditioned media harvested from MB231-sh.Control moderately increased

the invasion of MDA-MB-231-sh.A1AT cell line by 1.6 fold (Figure 7.5A).

Interestingly, treatment of MDA-MB-231 cells with an A1AT-blocking antibody strongly

attenuated the invasion of cells into the matrigel, by 4.8 fold (Figure 7.5B). In addition,

wound closure reflecting cellular migration in a scratch wound, was significantly decreased

in MDA-MB-231 cells treated with A1AT neutralizing antibody by 3.7 fold compared to

IgG control treated cells (Figure 7.5C). These observations confirm A1AT functions as a

pro-invasive secreted target of mutant p53.

203
 A

B C

Figure 7.5 Secreted A1AT drives cellular migration and invasion

(A) Invasion assay analysis following incubation of MDA-MB-231-sh.A1AT cells with the

conditioned media from MDA-MB-231-sh.Ctrl or sh.A1AT transfected cells. Data

presented as mean ± standard error of mean (SEM) from triplicate experiments. *P < 0.05.

204
Western blot analysis of A1AT secreted protein in conditioned medium from MDA-MB-

231 cells expressing sh.Ctrl or sh.A1AT (top).

(B) Invasion assay analysis following incubation of MDA-MB-231 cells with the A1AT1-

blocking antibody (40 μg/ml A1AT IgG) or control IgG. Data presented as mean ± standard

error of mean (SEM) from triplicate experiments. **P < 0.005.

(C) Migration assay analysis following incubation of MDA-MB-231 cells with the A1AT-

blocking antibody (40 μg/ml A1AT IgG) or control IgG. Data presented as mean ± standard

error of mean (SEM) from triplicate experiments. ***P < 0.0005.

205
 Discussion
In the previous chapters, we identified A1AT as a critical secreted mediator of mutant p53

GOF in lung cancer. This chapter examined the role of A1AT in breast cancer. We show

that the expression of A1AT in breast cancer is not significantly influenced by p53 status

but is specific to tumour sub-types. The analysis of the cohort of breast tumours identified

that the expression of A1AT is significantly higher in luminal A subtypes than in luminal B

or basal like TNBC subtypes. In addition, the expression of A1AT is found to be significantly

higher in ER+ breast cancer cell lines than in ER- cell lines, indicating a possible role for ER

signaling in A1AT expression. About 70-80% of ER+ breast cancers express wild-type p53,

in particular, the ER+ luminal A subtype mostly expresses wild-type p53 (323, 324). Our

analyses further show that the expression of A1AT is higher in tumours expressing wild-

type p53 than in tumours with mutant p53. These findings indicate a possible role of ER and

p53 in the regulation of A1AT. In luminal subtypes, mutation in p53 or inactivation of p53

signaling is likely to cause luminal B phenotype and endocrine therapy resistance (331). Our

findings show that A1AT is highly expressed in luminal A subtype and those expressing

wild-type p53 tumours. Hence, it is likely that A1AT may be involved in disease progression

and endocrine therapy resistance. In fact, previous studies have shown that the expression of

A1AT is higher in endocrine resistant (LTEDaro) cells than in endocrine responsive MCF-

7 cells (332). Further studies will be required to explore this possibility.

Mutations in p53 are often found in the early invasive stage of breast carcinoma. Our

findings suggest that the expression of A1AT is significantly higher in TNBC cell lines

expressing missense mutation than other intact or non-functional p53 allele. In addition,
206
missense mutant p53 (R280K) is shown to constitutively regulate the expression of A1AT

in the MDA-MB-231 TNBC cell line. The functional role of A1AT was further explored in

MDA-MB-231 TNBC cells using in vitro and in vivo models. Our results show that mutant

p53 mediates the invasive phenotype in MDA-MB-231 TNBC cells by inducing the

secretion of A1AT, and the depletion of secreted A1AT can completely ablate mutant p53

driven invasion. Our findings were also confirmed using an in vivo CAM model, which

shows that knockdown of A1AT significantly ablates the invasive ability of the p53 mutant

MDA-MB-231 TNBC cell line.

Mutant p53 is known to regulate Epithelial-mesenchymal transition (EMT) phenotype and

stem cell properties in triple negative breast cancers (TNBCs) (333, 334). Epithelial-

mesenchymal transition (EMT) potentiates tumour cells to disseminate from the primary

tumour by migrating through the local microenvironment, and hence invade local tissues

(231, 232). Our studies also show that A1AT alters the expression of several EMT related

genes: TGFB1, TGFBR2, SNAI1, SNAI2, ZEB1, FN, VIM and TNC. This finding indicates a

role for A1AT in intravasation and dissemination of tumour cells throughout the body by the

circulatory system. Furthermore, the tissue microenvironment is critical to the spread of

metastatic disease, as the vast majority of disseminated tumour cells fail to establish a

metastasis (255). Our study shows that secreted A1AT has the potential to alter the ability

of surrounding cells to become highly invasive, indicating a crucial role of A1AT in several

stages of metastatic processes.

207
The majority of TNBC are of basal-like molecular subtypes that represents a population of

particularly aggressive breast lesions associated with poor prognosis (325). Due to the lack

of therapeutic options, the treatment of TNBC or basal-like breast cancers are limited to

conventional chemotherapy. We have demonstrated that the antibodies targeting secreted

A1AT can significantly ablate the migration and invasion in MDA-MB-231 TNBC cells.

Thus our findings suggest that antibody mediated A1AT therapies may provide an attractive

approach to treat mutant p53 expressing TNBC tumours.

This study provides a new insight into the invasive behavior of p53 mutant TNBCs that are

manifested through an aberrant secretion of extracellular proteins and offers a potential

therapeutic target for treatment of mutant p53 expressing TNBCs. These results are

preliminary and are based on findings from one cell line. Hence further studies will be

required to support the findings presented in this chapter. In addition, it will be essential to

determine the clinical significance of A1AT in p53 mutant TNBCs to benefit the patients

with A1AT targeted therapies. In addition, the effects of mutant p53 may be over-ridden by

the effects of the ER axis in breast cancer. Hence, future studies will be required to explore

the role of A1AT in the presence of ER axis and p53 signaling.

Overall, this chapter supports the evidence that A1AT targeted therapies may be applicable

in other cancer types and suggests to further explore its regulation beyond p53

208
CONCLUSIONS

Among the various genetic alterations in human cancer, mutations in the TP53 (which

encodes p53) tumour suppressor gene represent the most common, occurring in

approximately 50% of all human cancers. The normal function of wild-type p53 is to

suppress tumour development, however mutations in p53 in cancer result in loss of this

normal tumour suppressive function. Mutated p53 protein also can acquire additional

oncogenic properties by a gain-of-function (GOF) mechanism that contributes to tumour

progression, and metastasis. The identification of key downstream targets or signaling

pathways that mediate mutant p53 gain of function provide an approach for the development

of new cancer therapeutic approach targeting tumours that express p53 mutations.

This thesis has, for the first time, described the global influence of missense mutant p53 on

the cancer cell secretome of a lung cancer cell line. It is evident that the expression of mutant

p53 in a p53 null background drives the release of a number of oncogenic secreted factors

involved in cancer generally. Through transcriptomic analyses of mutant p53 induced gene

networks, a new mechanism for mutant p53 GOF was identified whereby mutant p53 drives

oncogenic pathways through modulation of the expression of numerous gene targets. The

encoded proteins are subsequently secreted from the cells. This addresses a key area in

current research: to identify the mutant p53 driven secreted factors that may serve as a new

approaches to therapeutically target p53 mutant tumours.

209
Using iTRAQ based secretome analysis, Alpha-1 Antitrypsin (A1AT) was identified as a

potential secreted effector of mutant p53 GOF. A1AT expression was shown to be driven by

mutant p53 via interaction with p63. A1AT expression promoted lung cancer cell invasion

in vitro and in vivo. Results from A1AT ablation using antibodies lead to significant

inhibition of mutant p53 GOF, hence there is substantial evidence that this is a new avenue

to therapeutically target mutant p53 expressing lung adenocarcinoma in particular and

probably cancer in general. Our results from analysis of human lung adenocarcinoma

microarrays suggest that A1AT is a prognostic predictor of progression and patient survival.

Future work will be focused towards the significance of A1AT levels in diagnosis, and the

potential role of A1AT levels in predicting prognosis of lung adenocarcinoma patients. In

addition, preliminary findings on the oncogenic role of A1AT in TNBC breast cancer is

presented.

Collectively, our findings provide new insights into the gain of function mechanism of

mutant p53 that are manifested through aberrant secretion of extracellular proteins. The

identification of A1AT as a critical and indispensable protein that mediates the mutant p53

gain-of-function by driving invasive properties enhances our understanding of mutant p53

regulated pathways. In addition, these findings offer new therapeutic options for treatment

of p53 mutant tumours.

210
APPENDIX 1

Lung Cancer Cell Lines

p53 Missense A1AT mRNA (log2)
NCIH854_LUNG 11.5463
BEN_LUNG 11.19603
EPLC272H_LUNG 11.01636
NCIH1435_LUNG 10.3457
COLO668_LUNG 10.29929
NCIH1373_LUNG 10.20574
NCIH2405_LUNG 10.18425
CALU3_LUNG 10.14292
DMS454_LUNG 10.09822
SKMES1_LUNG 9.91435
NCIH2291_LUNG 9.775582
NCIH2444_LUNG 9.590585
HCC4006_LUNG 9.40785
NCIH2009_LUNG 9.394369
NCIH2087_LUNG 8.954386
SHP77_LUNG 8.789792
RERFLCAD1_LUNG 8.779838
HCC1171_LUNG 8.515052
NCIH441_LUNG 8.460277
VMRCLCD_LUNG 8.407555
CORL23_LUNG 8.125742
NCIH1869_LUNG 8.076021
HCC78_LUNG 7.927492
NCIH1755_LUNG 7.627481
CAL12T_LUNG 7.029966
DMS53_LUNG 6.681834
NCIH1734_LUNG 6.437277
HCC366_LUNG 6.339082
HCC2935_LUNG 6.25675
HCC15_LUNG 6.175968

211
NCIH1838_LUNG 6.174672
NCIH650_LUNG 6.04458
HCC44_LUNG 5.907047
NCIH2122_LUNG 5.643279
SW1271_LUNG 5.594501
CHAGOK1_LUNG 5.585867
NCIH2085_LUNG 5.435255
RERFLCMS_LUNG 5.304396
SQ1_LUNG 5.30078
CALU1_LUNG 5.280921
CORL95_LUNG 5.158329
NCIH596_LUNG 5.078168
HCC2279_LUNG 4.98157
LXF289_LUNG 4.692877
NCIH226_LUNG 4.593313
NCIH1573_LUNG 4.580623
LCLC103H_LUNG 4.535668
KNS62_LUNG 4.494915
CPCN_LUNG 4.466936
LU65_LUNG 4.445452
NCIH841_LUNG 4.394514
DMS273_LUNG 4.354343
NCIH23_LUNG 4.321364
NCIH2029_LUNG 4.311772
LOUNH91_LUNG 4.287937
NCIH2110_LUNG 4.257609
HARA_LUNG 4.255431
NCIH2066_LUNG 4.207786
NCIH661_LUNG 4.193421
NCIH1623_LUNG 4.193305
NCIH1930_LUNG 4.17737
ABC1_LUNG 4.170137
NCIH2286_LUNG 4.169683
NCIH1437_LUNG 4.168499
SKLU1_LUNG 4.167037

212
DMS153_LUNG 4.166673
NCIH322_LUNG 4.162771
LC1SQSF_LUNG 4.151793
NCIH196_LUNG 4.148472
NCIH1184_LUNG 4.144424
LK2_LUNG 4.143081
NCIH211_LUNG 4.123537
NCIH1651_LUNG 4.12044
NCIH1355_LUNG 4.11182
NCIH1781_LUNG 4.085548
NCIH1963_LUNG 4.069661
NCIH2196_LUNG 4.055746
NCIH1836_LUNG 4.052015
PC14_LUNG 4.045478
SBC5_LUNG 4.041957
NCIH889_LUNG 4.037525
NCIH1155_LUNG 4.033628
SW1573_LUNG 4.029022
HCC33_LUNG 4.02798
NCIH1618_LUNG 4.020534
LUDLU1_LUNG 4.019638
NCIH510_LUNG 4.018528
NCIH1703_LUNG 4.011755
NCIH82_LUNG 3.96835
NCIH1436_LUNG 3.944058
NCIH1876_LUNG 3.923724
SCLC21H_LUNG 3.920553
NCIH2106_LUNG 3.787749
NCIH1105_LUNG 3.704248
RERFLCAD2_LUNG 6.440211
COLO699_LUNG 3.909934
CORL88_LUNG 4.072001

213
Lung Cancer Cell Lines
Other (Frameshift/wild-type) A1AT mRNA (log2)
NCIH727_LUNG 10.95126
LCLC97TM1_LUNG 10.07005
EBC1_LUNG 10.01093
NCIH2228_LUNG 9.765573
NCIH1975_LUNG 9.363314
HCC827_LUNG 8.100686
NCIH2347_LUNG 7.924886
NCIH3255_LUNG 7.603151
NCIH1339_LUNG 6.993201
NCIH1666_LUNG 6.663026
NCIH647_LUNG 6.442608
SW900_LUNG 6.393565
CORL105_LUNG 6.207224
NCIH1648_LUNG 6.170392
NCIH1299_LUNG 5.899814
NCIH1563_LUNG 5.336479
NCIH1944_LUNG 5.173536
NCIH1650_LUNG 4.915148
DV90_LUNG 4.707686
NCIH1694_LUNG 4.69129
NCIH1395_LUNG 4.508361
NCIH1385_LUNG 4.478873
RERFLCKJ_LUNG 4.436651
NCIH292_LUNG 4.399559
NCIH1568_LUNG 4.373628
NCIH1693_LUNG 4.330725
LC1F_LUNG 4.270693
DMS79_LUNG 4.265398
NCIH1048_LUNG 4.264524
NCIH358_LUNG 4.254733
NCIH69_LUNG 4.234011
NCIH1793_LUNG 4.233998

214
NCIH2172_LUNG 4.232191
NCIH2170_LUNG 4.211351
NCIH2227_LUNG 4.204162
NCIH2126_LUNG 4.201006
NCIH520_LUNG 4.157533
A549_LUNG 4.153844
CORL311_LUNG 4.123568
NCIH1915_LUNG 4.10165
CALU6_LUNG 4.095781
NCIH526_LUNG 4.095733
LU99_LUNG 4.09017
NCIH522_LUNG 4.085988
NCIH446_LUNG 4.063186
NCIH460_LUNG 4.060239
NCIH146_LUNG 4.055847
NCIH2342_LUNG 4.032582
NCIH2141_LUNG 4.024861
NCIH1581_LUNG 4.018694
NCIH2171_LUNG 4.003478
NCIH2081_LUNG 4.00342
NCIH810_LUNG 3.992729
CORL51_LUNG 3.986568
NCIH838_LUNG 3.981843
NCIH2023_LUNG 3.947953
DMS114_LUNG 3.914135
NCIH1792_LUNG 3.909959
NCIH2030_LUNG 3.88747
NCIH209_LUNG 3.881207
NCIH524_LUNG 3.878649
CORL279_LUNG 3.830653
CORL47_LUNG 4.348583
HCC1195_LUNG 4.559091
IALM_LUNG 4.166784

215
APPENDIX II

Breast cancer cell lines (based on ER status)

ER+ (n=20) A1AT mNRA (log2) ER- (n=17) A1AT mRNA (log2)
HCC1500 10.60062 DU4475 4.344294
ZR751 7.171445 HCC1937 4.611935
ZR7530 6.462903 HCC1806 4.255222
MCF7 5.291248 MDAMB157 4.172452
UACC812 4.938249 HCC1569 4.170843
MDAMB175VII 4.443096 HCC1187 3.988901
KPL1 4.36776 MDAMB231 7.323196
BT483 8.08224 MDAMB468 6.400454
MDAMB361 7.996508 CAL851 6.093788
EFM192A 7.691661 HCC70 5.286228
UACC893 5.27796 HCC1143 5.202704
HCC1428 4.923209 HCC1395 5.017156
HCC1419 4.315574 MDAMB436 4.999233
HCC202 4.20447 HCC1954 4.990881
T47D 9.748843 BT549 4.654241
HCC2218 8.44313 HS578T 3.980157
EFM19 7.239474 SKBR3 4.905814
BT474 6.617919
MDAMB415 5.630863
CAMA1 4.283051

216
 Breast cancer cell lines (based on p53 status)
A1AT
Wild-type mRNA Fs/stop A1AT mRNA Missesnse A1AT mRNA
(n=8) (log2) (n=12) (log2) (n=17) (log2)
HCC1500 10.60062 BT483 8.08224 T47D 9.748843
ZR751 7.171445 MDAMB361 7.996508 HCC2218 8.44313
ZR7530 6.462903 EFM192A 7.691661 EFM19 7.239474
MCF7 5.291248 UACC893 5.27796 BT474 6.617919
UACC812 4.938249 HCC1428 4.923209 MDAMB415 5.630863
MDAMB175VII 4.443096 HCC1419 4.315574 CAMA1 4.283051
KPL1 4.36776 HCC202 4.20447 MDAMB231 7.323196
DU4475 4.344294 HCC1937 4.611935 MDAMB468 6.400454
HCC1806 4.255222 CAL851 6.093788
MDAMB157 4.172452 HCC70 5.286228
HCC1569 4.170843 HCC1143 5.202704
HCC1187 3.988901 HCC1395 5.017156
MDAMB436 4.999233
HCC1954 4.990881
BT549 4.654241
HS578T 3.980157
SKBR3 4.905814

217
REFERENCES

1. Lane DP, Crawford LV. T antigen is bound to a host protein in SV40-transformed

cells. Nature. 1979;278(5701):261-3.
2. DeLeo AB, Jay G, Appella E, Dubois GC, Law LW, Old LJ. Detection of a
transformation-related antigen in chemically induced sarcomas and other transformed cells
of the mouse. Proceedings of the National Academy of Sciences of the United States of
America. 1979;76(5):2420-4.
3. Dippold WG, Jay G, DeLeo AB, Khoury G, Old LJ. p53 transformation-related
protein: detection by monoclonal antibody in mouse and human cells. Proceedings of the
National Academy of Sciences of the United States of America. 1981;78(3):1695-9.
4. Baker SJ, Fearon ER, Nigro JM, Hamilton SR, Preisinger AC, Jessup JM, et al.
Chromosome 17 Deletions and p53 Gene Mutations in Colorectal Carcinomas. Science.
1989;244(4901):217-21.
5. Finlay CA, Hinds PW, Levine AJ. The p53 proto-oncogene can act as a suppressor
of transformation. Cell. 1989;57(7):1083-93.
6. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, et al.
Mutations in the p53 gene occur in diverse human tumour types. Nature.
1989;342(6250):705-8.
7. Baker SJ, Markowitz S, Fearon ER, Willson JKV, Vogelstein B. Suppression of
Human Colorectal Carcinoma Cell Growth by Wild-Type p53. Science.
1990;249(4971):912-5.
8. Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Jr., Butel
JS, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous
tumours. Nature. 1992;356(6366):215-21.
9. Malkin D, Li FP, Strong LC, Fraumeni JF, Jr., Nelson CE, Kim DH, et al. Germ line
p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Science. 1990;250(4985):1233-8.
10. Srivastava S, Zou ZQ, Pirollo K, Blattner W, Chang EH. Germ-line transmission of
a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature.
1990;348(6303):747-9.
11. Lane DP. Cancer. p53, guardian of the genome. Nature. 1992;358(6381):15-6.
12. Oren M, Rotter V. Introduction: p53--the first twenty years. Cellular and molecular
life sciences : CMLS. 1999;55(1):9-11.
13. Vousden KH, Lu X. Live or let die: the cell's response to p53. Nature reviews Cancer.
2002;2(8):594-604.
14. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers.
Science. 1991;253(5015):49-53.
15. Kastan MB, Bartek J. Cell-cycle checkpoints and cancer. Nature.
2004;432(7015):316-23.
16. Hussain SP, Hofseth LJ, Harris CC. Tumor suppressor genes: at the crossroads of
molecular carcinogenesis, molecular epidemiology and human risk assessment. Lung cancer
(Amsterdam, Netherlands). 2001;34 Suppl 2:S7-15.
218
17. Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers: origins,
consequences, and clinical use. Cold Spring Harbor perspectives in biology.
2010;2(1):a001008.
18. Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV, Hainaut P, et al. Impact of
mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons
from recent developments in the IARC TP53 database. Human mutation. 2007;28(6):622-9.
19. Slee EA, O'Connor DJ, Lu X. To die or not to die: how does p53 decide? Oncogene.
2004;23(16):2809-18.
20. Prives C, Hall PA. The p53 pathway. The Journal of pathology. 1999;187(1):112-26.
21. Kato S, Han SY, Liu W, Otsuka K, Shibata H, Kanamaru R, et al. Understanding the
function-structure and function-mutation relationships of p53 tumor suppressor protein by
high-resolution missense mutation analysis. Proceedings of the National Academy of
Sciences of the United States of America. 2003;100(14):8424-9.
22. Milner J, Medcalf EA. Cotranslation of activated mutant p53 with wild type drives
the wild-type p53 protein into the mutant conformation. Cell. 1991;65(5):765-74.
23. Schuijer M, Berns EM. TP53 and ovarian cancer. Human mutation. 2003;21(3):285-
91.
24. Sigal A, Rotter V. Oncogenic mutations of the p53 tumor suppressor: the demons of
the guardian of the genome. Cancer research. 2000;60(24):6788-93.
25. Dittmer D, Pati S, Zambetti G, Chu S, Teresky AK, Moore M, et al. Gain of function
mutations in p53. Nature genetics. 1993;4(1):42-6.
26. Shaulsky G, Goldfinger N, Rotter V. Alterations in tumor development in vivo
mediated by expression of wild type or mutant p53 proteins. Cancer research.
1991;51(19):5232-7.
27. Khromova NV, Kopnin PB, Stepanova EV, Agapova LS, Kopnin BP. p53 hot-spot
mutants increase tumor vascularization <em>via</em> ROS-mediated activation of the
HIF1/VEGF-A pathway. Cancer Letters. 2009;276(2):143-51.
28. Bossi G, Lapi E, Strano S, Rinaldo C, Blandino G, Sacchi A. Mutant p53 gain of
function: reduction of tumor malignancy of human cancer cell lines through abrogation of
mutant p53 expression. Oncogene. 2006;25(2):304-9.
29. Bossi G, Marampon F, Maor-Aloni R, Zani B, Rotter V, Oren M, et al. Conditional
RNA interference in vivo to study mutant p53 oncogenic gain of function on tumor
malignancy. Cell Cycle. 2008;7(12):1870-9.
30. Alexandrova EM, Yallowitz AR, Li D, Xu S, Schulz R, Proia DA, et al. Improving
survival by exploiting tumour dependence on stabilized mutant p53 for treatment. Nature.
2015;523(7560):352-6.
31. Olivier M, Goldgar De Fau - Sodha N, Sodha N Fau - Ohgaki H, Ohgaki H Fau -
Kleihues P, Kleihues P Fau - Hainaut P, Hainaut P Fau - Eeles RA, et al. Li-Fraumeni and
related syndromes: correlation between tumor type, family structure, and TP53 genotype.
2003(0008-5472 (Print)).
32. Whibley C, Pharoah Pd Fau - Hollstein M, Hollstein M. p53 polymorphisms: cancer
implications. 2009(1474-1768 (Electronic)).
33. Clore GM, Omichinski JG, Sakaguchi K, Zambrano N, Sakamoto H, Appella E, et
al. High-resolution structure of the oligomerization domain of p53 by multidimensional
NMR. Science. 1994;265(5170):386-91.

219
34. Speidel D, Helmbold H, Deppert W. Dissection of transcriptional and non-
transcriptional p53 activities in the response to genotoxic stress. Oncogene. 2006;25(6):940-
53.
35. Nakamura Y. Isolation of p53-target genes and their functional analysis. Cancer
science. 2004;95(1):7-11.
36. Oren M, Rotter V. Mutant p53 Gain-of-Function in Cancer. Cold Spring Harbor
perspectives in biology. 2010;2(2).
37. Wolf D, Harris N, Rotter V. Reconstitution of p53 expression in a nonproducer Ab-
MuLV-transformed cell line by transfection of a functional p53 gene. Cell. 1984;38(1):119-
26.
38. Quante T, Otto B Fau - Brazdova M, Brazdova M Fau - Kejnovska I, Kejnovska I
Fau - Deppert W, Deppert W Fau - Tolstonog GV, Tolstonog GV. Mutant p53 is a
transcriptional co-factor that binds to G-rich regulatory regions of active genes and generates
transcriptional plasticity. 2012(1551-4005 (Electronic)).
39. Göhler T, Jäger S, Warnecke G, Yasuda H, Kim E, Deppert W. Mutant p53 proteins
bind DNA in a DNA structure-selective mode. Nucleic Acids Research. 2005;33(3):1087-
100.
40. Walter K, Warnecke G, Bowater R, Deppert W, Kim E. Tumor Suppressor p53 Binds
with High Affinity to CTG·CAG Trinucleotide Repeats and Induces Topological Alterations
in Mismatched Duplexes. Journal of Biological Chemistry. 2005;280(52):42497-507.
41. Zalcenstein A, Stambolsky P, Weisz L, Muller M, Wallach D, Goncharov TM, et al.
Mutant p53 gain of function: repression of CD95(Fas/APO-1) gene expression by tumor-
associated p53 mutants. Oncogene. 2003;22(36):5667-76.
42. Chicas A, Molina P, Bargonetti J. Mutant p53 forms a complex with Sp1 on HIV-
LTR DNA. Biochem Biophys Res Commun. 2000;279(2):383-90.
43. Strano S, Dell'Orso S, Di Agostino S, Fontemaggi G, Sacchi A, Blandino G. Mutant
p53: an oncogenic transcription factor. Oncogene. 2007;26(15):2212-9.
44. Kim E, Deppert W. Transcriptional activities of mutant p53: when mutations are
more than a loss. Journal of cellular biochemistry. 2004;93(5):878-86.
45. Bargonetti J, Chicas A, White D, Prives C. p53 represses Sp1 DNA binding and HIV-
LTR directed transcription. Cell Mol Biol (Noisy-le-grand). 1997;43(7):935-49.
46. Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro LH, et al. Mutant p53
Cooperates with ETS and Selectively Up-regulates Human MDR1 Not MRP1. Journal of
Biological Chemistry. 2001;276(42):39359-67.
47. Do PM, Varanasi L, Fan SQ, Li CY, Kubacka I, Newman V, et al. Mutant p53
cooperates with ETS2 to promote etoposide resistance. Genes Dev. 2012;26(8):830-45.
48. Stambolsky P, Tabach Y, Fontemaggi G, Weisz L, Maor-Aloni R, Siegfried Z, et al.
Modulation of the Vitamin D3 Response by Cancer-Associated Mutant p53 (vol 17, pg 273,
2010). Cancer Cell. 2010;17(5):523-.
49. Fontemaggi G, Dell'Orso S, Trisciuoglio D, Shay T, Melucci E, Fazi F, et al. The
execution of the transcriptional axis mutant p53, E2F1 and ID4 promotes tumor neo-
angiogenesis. Nat Struct Mol Biol. 2009;16(10):1086-93.
50. Lee CW, Ferreon Jc Fau - Ferreon ACM, Ferreon Ac Fau - Arai M, Arai M Fau -
Wright PE, Wright PE. Graded enhancement of p53 binding to CREB-binding protein (CBP)
by multisite phosphorylation. 2010(1091-6490 (Electronic)).

220
51. Liu K, Ling SY, Lin WC. TopBP1 Mediates Mutant p53 Gain of Function through
NF-Y and p63/p73. Mol Cell Biol. 2011;31(22):4464-81.
52. Martynova E, Pozzi S, Basile V, Dolfini D, Zambelli F, Imbriano C, et al. Gain-of-
function p53 mutants have widespread genomic locations partially overlapping with p63.
Oncotarget. 2012;3(2):132-43.
53. Neilsen PM, Noll JE, Suetani RJ, Schulz RB, Al-Ejeh F, Evdokiou A, et al. Mutant
p53 uses p63 as a molecular chaperone to alter gene expression and induce a pro-invasive
secretome. Oncotarget. 2011;2(12):1203-17.
54. Gaiddon C, Lokshin M, Ahn J, Zhang T, Prives C. A subset of tumor-derived mutant
forms of p53 down-regulate p63 and p73 through a direct interaction with the p53 core
domain. Mol Cell Biol. 2001;21(5):1874-87.
55. Strano S, Fontemaggi G, Costanzo A, Rizzo MG, Monti O, Baccarini A, et al.
Physical interaction with human tumor-derived p53 mutants inhibits p63 activities. Journal
of Biological Chemistry. 2002;277(21):18817-26.
56. Schmale H, Bamberger C. A novel protein with strong homology to the tumor
suppressor p53. Oncogene. 1997;15(11):1363-7.
57. Kaghad M, Bonnet H, Yang A, Creancier L, Biscan J-C, Valent A, et al.
Monoallelically Expressed Gene Related to p53 at 1p36, a Region Frequently Deleted in
Neuroblastoma and Other Human Cancers. Cell. 1997;90(4):809-19.
58. Dotsch V, Bernassola F, Coutandin D, Candi E, Melino G. p63 and p73, the ancestors
of p53. Cold Spring Harbor perspectives in biology. 2010;2(9):a004887.
59. Collavin L, Lunardi A, Del Sal G. p53-family proteins and their regulators: hubs and
spokes in tumor suppression. Cell death and differentiation. 2010;17(6):901-11.
60. Harms K, Nozell S, Chen X. The common and distinct target genes of the p53 family
transcription factors. Cellular and Molecular Life Sciences CMLS. 2004;61(7):822-42.
61. Flores ER, Sengupta S, Miller JB, Newman JJ, Bronson R, Crowley D, et al. Tumor
predisposition in mice mutant for <em>p63</em> and <em>p73</em>: Evidence for
broader tumor suppressor functions for the <em>p53</em> family. Cancer Cell.
2005;7(4):363-73.
62. Irwin MS, Kaelin WG. p53 family update: p73 and p63 develop their own identities.
Cell growth & differentiation : the molecular biology journal of the American Association
for Cancer Research. 2001;12(7):337-49.
63. DeYoung MP, Ellisen LW. p63 and p73 in human cancer: defining the network.
Oncogene. 2007;26(36):5169-83.
64. Di Como CJ, Gaiddon C, Prives C. p73 function is inhibited by tumor-derived p53
mutants in mammalian cells. Mol Cell Biol. 1999;19(2):1438-49.
65. Muller PAJ, Vousden KH. p53 mutations in cancer. Nat Cell Biol. 2013;15(1):2-8.
66. Moskovits N, Kalinkovich A, Bar J, Lapidot T, Oren M. p53 Attenuates Cancer Cell
Migration and Invasion through Repression of SDF-1/CXCL12 Expression in Stromal
Fibroblasts. Cancer research. 2006;66(22):10671-6.
67. Adorno M, Cordenonsi M, Montagner M, Dupont S, Wong C, Hann B, et al. A
Mutant-p53/Smad complex opposes p63 to empower TGFbeta-induced metastasis. Cell.
2009;137(1):87-98.
68. Muller PAJ, Caswell PT, Doyle B, Iwanicki MP, Tan EH, Karim S, et al. Mutant p53
Drives Invasion by Promoting Integrin Recycling. Cell. 2009;139(7):1327-41.

221
69. Chaffer CL, Weinberg RA. A Perspective on Cancer Cell Metastasis. Science.
2011;331(6024):1559-64.
70. Micalizzi DS, Ford HL. Epithelial-mesenchymal transition in development and
cancer. Future Oncol. 2009;5(8):1129-43.
71. Wang S-P, Wang W-L, Chang Y-L, Wu C-T, Chao Y-C, Kao S-H, et al. p53 controls
cancer cell invasion by inducing the MDM2-mediated degradation of Slug. Nat Cell Biol.
2009;11(6):694-704.
72. Shiota M, Izumi H, Onitsuka T, Miyamoto N, Kashiwagi E, Kidani A, et al. Twist
and p53 reciprocally regulate target genes via direct interaction. Oncogene.
2008;27(42):5543-53.
73. Shih J-Y, Tsai M-F, Chang T-H, Chang Y-L, Yuan A, Yu C-J, et al. Transcription
Repressor Slug Promotes Carcinoma Invasion and Predicts Outcome of Patients with Lung
Adenocarcinoma. Clinical Cancer Research. 2005;11(22):8070-8.
74. Alves CC, Rosivatz E, Schott C, Hollweck R, Becker I, Sarbia M, et al. Slug is
overexpressed in gastric carcinomas and may act synergistically with SIP1 and Snail in the
down-regulation of E-cadherin. The Journal of pathology. 2007;211(5):507-15.
75. Dong P, Karaayvaz M Fau - Jia N, Jia N Fau - Kaneuchi M, Kaneuchi M Fau -
Hamada J, Hamada J Fau - Watari H, Watari H Fau - Sudo S, et al. Mutant p53 gain-of-
function induces epithelial-mesenchymal transition through modulation of the miR-130b-
ZEB1 axis. 2013(1476-5594 (Electronic)).
76. Muller PA, Caswell PT, Doyle B, Iwanicki MP, Tan EH, Karim S, et al. Mutant p53
drives invasion by promoting integrin recycling. Cell. 2009;139(7):1327-41.
77. Song H, Hollstein M, Xu Y. P53 gain-of-function cancer mutants induce genetic
instability by inactivating ATM. Nat Cell Biol. 2007;9(5):573-U166.
78. Li R, Sutphin Pd Fau - Schwartz D, Schwartz D Fau - Matas D, Matas D Fau - Almog
N, Almog N Fau - Wolkowicz R, Wolkowicz R Fau - Goldfinger N, et al. Mutant p53 protein
expression interferes with p53-independent apoptotic pathways. 1988(0950-9232 (Print)).
79. Gurtner A, Starace G Fau - Norelli G, Norelli G Fau - Piaggio G, Piaggio G Fau -
Sacchi A, Sacchi A Fau - Bossi G, Bossi G. Mutant p53-induced up-regulation of mitogen-
activated protein kinase kinase 3 contributes to gain of function. 2010(1083-351X
(Electronic)).
80. Liu DP, Song H Fau - Xu Y, Xu Y. A common gain of function of p53 cancer mutants
in inducing genetic instability. 2010(1476-5594 (Electronic)).
81. Sarig R, Rivlin N Fau - Brosh R, Brosh R Fau - Bornstein C, Bornstein C Fau -
Kamer I, Kamer I Fau - Ezra O, Ezra O Fau - Molchadsky A, et al. Mutant p53 facilitates
somatic cell reprogramming and augments the malignant potential of reprogrammed cells.
2010(1540-9538 (Electronic)).
82. Lang GA, Iwakuma T, Suh Y-A, Liu G, Rao VA, Parant JM, et al. Gain of Function
of a p53 Hot Spot Mutation in a Mouse Model of Li-Fraumeni Syndrome. Cell.
2004;119(6):861-72.
83. Olive KP, Tuveson DA, Ruhe ZC, Yin B, Willis NA, Bronson RT, et al. Mutant p53
Gain of Function in Two Mouse Models of Li-Fraumeni Syndrome. Cell. 2004;119(6):847-
60.
84. Hanel W, Marchenko N, Xu S, Xiaofeng Yu S, Weng W, Moll U. Two hot spot
mutant p53 mouse models display differential gain of function in tumorigenesis. Cell Death
Differ. 2013;20(7):898-909.
222
85. Petitjean A, Achatz MIW, Borresen-Dale AL, Hainaut P, Olivier M. TP53 mutations
in human cancers: functional selection and impact on cancer prognosis and outcomes.
Oncogene. 2007;26(15):2157-65.
86. Baker L, Quinlan PR, Patten N, Ashfield A, Birse-Stewart-Bell LJ, McCowan C, et
al. p53 mutation, deprivation and poor prognosis in primary breast cancer. British Journal of
Cancer. 2010;102(4):719-26.
87. Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H, et al. Prognostic
Significance of p53 Codon 72 Polymorphism Differs with Race in Colorectal
Adenocarcinoma. Clinical cancer research : an official journal of the American Association
for Cancer Research. 2009;15(7):2406-16.
88. Samowitz WS, Curtin K, Ma K-n, Edwards S, Schaffer D, Leppert MF, et al.
Prognostic significance of p53 mutations in colon cancer at the population level.
International Journal of Cancer. 2002;99(4):597-602.
89. Ahrendt SA, Hu Y, Buta M, McDermott MP, Benoit N, Yang SC, et al. p53
Mutations and Survival in Stage I Non-Small-Cell Lung Cancer: Results of a Prospective
Study. Journal of the National Cancer Institute. 2003;95(13):961-70.
90. Skaug V, Ryberg D, Arab EHKMO, Stangeland L, Myking AO, Haugen A. p53
Mutations in Defined Structural and Functional Domains Are Related to Poor Clinical
Outcome in Non-Small Cell Lung Cancer Patients. Clinical Cancer Research.
2000;6(3):1031-7.
91. Lehmann BD, Pietenpol JA. Targeting Mutant p53 in Human Tumors. Journal of
Clinical Oncology. 2012;30(29):3648-50.
92. Maslon MM, Hupp TR. Drug discovery and mutant p53. Trends in Cell Biology.
2010;20(9):542-55.
93. Wiman KG. Pharmacological reactivation of mutant p53: from protein structure to
the cancer patient. Oncogene. 2010;29(30):4245-52.
94. Parrales A, Iwakuma T. Targeting Oncogenic Mutant p53 for Cancer Therapy.
Frontiers in Oncology. 2015;5:288.
95. Foster BA, Coffey Ha Fau - Morin MJ, Morin Mj Fau - Rastinejad F, Rastinejad F.
Pharmacological rescue of mutant p53 conformation and function. 1999(0036-8075 (Print)).
96. Demma MJ, Wong S Fau - Maxwell E, Maxwell E Fau - Dasmahapatra B,
Dasmahapatra B. CP-31398 restores DNA-binding activity to mutant p53 in vitro but does
not affect p53 homologs p63 and p73. 2004(0021-9258 (Print)).
97. He X, Kong X Fau - Yan J, Yan J Fau - Yan J, Yan J Fau - Zhang Y, Zhang Y Fau -
Wu Q, Wu Q Fau - Chang Y, et al. CP-31398 prevents the growth of p53-mutated colorectal
cancer cells in vitro and in vivo. 2015(1423-0380 (Electronic)).
98. Rippin TM, Bykov Vj Fau - Freund SMV, Freund Sm Fau - Selivanova G,
Selivanova G Fau - Wiman KG, Wiman Kg Fau - Fersht AR, Fersht AR. Characterization
of the p53-rescue drug CP-31398 in vitro and in living cells. 2002(0950-9232 (Print)).
99. Zache N, Lambert Jm Fau - Rokaeus N, Rokaeus N Fau - Shen J, Shen J Fau -
Hainaut P, Hainaut P Fau - Bergman J, Bergman J Fau - Wiman KG, et al. Mutant p53
targeting by the low molecular weight compound STIMA-1. 2008(1878-0261 (Electronic)).
100. Bykov VJ, Issaeva N Fau - Zache N, Zache N Fau - Shilov A, Shilov A Fau -
Hultcrantz M, Hultcrantz M Fau - Bergman J, Bergman J Fau - Selivanova G, et al.
Reactivation of mutant p53 and induction of apoptosis in human tumor cells by maleimide
analogs. 2005(0021-9258 (Print)).
223
101. Saha MN, Chen Y, Chen MH, Chen G, Chang H. Small molecule MIRA-1 induces
in vitro and in vivo anti-myeloma activity and synergizes with current anti-myeloma agents.
2014(1532-1827 (Electronic)).
102. Bykov VJ, Issaeva N Fau - Shilov A, Shilov A Fau - Hultcrantz M, Hultcrantz M
Fau - Pugacheva E, Pugacheva E Fau - Chumakov P, Chumakov P Fau - Bergman J, et al.
Restoration of the tumor suppressor function to mutant p53 by a low-molecular-weight
compound. 2002(1078-8956 (Print)).
103. Li Y, Mao Y, Brandt-Rauf PW, Williams AC, Fine RL. Selective induction of
apoptosis in mutant p53 premalignant and malignant cancer cells by PRIMA-1 through the
c-Jun-NH2-kinase pathway. Molecular Cancer Therapeutics. 2005;4(6):901-9.
104. Lambert JM, Gorzov P Fau - Veprintsev DB, Veprintsev Db Fau - Soderqvist M,
Soderqvist M Fau - Segerback D, Segerback D Fau - Bergman J, Bergman J Fau - Fersht
AR, et al. PRIMA-1 reactivates mutant p53 by covalent binding to the core domain.
2009(1878-3686 (Electronic)).
105. Bykov VJ, Zache N Fau - Stridh H, Stridh H Fau - Westman J, Westman J Fau -
Bergman J, Bergman J Fau - Selivanova G, Selivanova G Fau - Wiman KG, et al. PRIMA-
1(MET) synergizes with cisplatin to induce tumor cell apoptosis. 2005(0950-9232 (Print)).
106. Bykov VJ, Issaeva N Fau - Selivanova G, Selivanova G Fau - Wiman KG, Wiman
KG. Mutant p53-dependent growth suppression distinguishes PRIMA-1 from known
anticancer drugs: a statistical analysis of information in the National Cancer Institute
database. 2002(0143-3334 (Print)).
107. Zandi R, Selivanova G, Christensen CL, Gerds TA, Willumsen BM, Poulsen HS.
PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer
expressing mutant p53. Clin Cancer Res. 2011;17.
108. Zache N, Lambert Jm Fau - Wiman KG, Wiman Kg Fau - Bykov VJN, Bykov VJ.
PRIMA-1MET inhibits growth of mouse tumors carrying mutant p53. 2008(1570-5870
(Print)).
109. Liang Y, Besch-Williford C Fau - Benakanakere I, Benakanakere I Fau - Hyder SM,
Hyder SM. Re-activation of the p53 pathway inhibits in vivo and in vitro growth of hormone-
dependent human breast cancer cells. 2007(1019-6439 (Print)).
110. Saha MN, Jiang H Fau - Yang Y, Yang Y Fau - Reece D, Reece D Fau - Chang H,
Chang H. PRIMA-1Met/APR-246 displays high antitumor activity in multiple myeloma by
induction of p73 and Noxa. 2013(1538-8514 (Electronic)).
111. Lambert JM, Moshfegh A Fau - Hainaut P, Hainaut P Fau - Wiman KG, Wiman Kg
Fau - Bykov VJN, Bykov VJ. Mutant p53 reactivation by PRIMA-1MET induces multiple
signaling pathways converging on apoptosis. 2010(1476-5594 (Electronic)).
112. Bao W, Chen M Fau - Zhao X, Zhao X Fau - Kumar R, Kumar R Fau - Spinnler C,
Spinnler C Fau - Thullberg M, Thullberg M Fau - Issaeva N, et al. PRIMA-1Met/APR-246
induces wild-type p53-dependent suppression of malignant melanoma tumor growth in 3D
culture and in vivo. 2011(1551-4005 (Electronic)).
113. Aryee DN, Niedan S Fau - Ban J, Ban J Fau - Schwentner R, Schwentner R Fau -
Muehlbacher K, Muehlbacher K Fau - Kauer M, Kauer M Fau - Kofler R, et al. Variability
in functional p53 reactivation by PRIMA-1(Met)/APR-246 in Ewing sarcoma. 2013(1532-
1827 (Electronic)).

224
114. Rokaeus N, Shen J Fau - Eckhardt I, Eckhardt I Fau - Bykov VJN, Bykov Vj Fau -
Wiman KG, Wiman Kg Fau - Wilhelm MT, Wilhelm MT. PRIMA-1(MET)/APR-246
targets mutant forms of p53 family members p63 and p73. 2010(1476-5594 (Electronic)).
115. Lehmann S, Bykov Vj Fau - Ali D, Ali D Fau - Andren O, Andren O Fau - Cherif H,
Cherif H Fau - Tidefelt U, Tidefelt U Fau - Uggla B, et al. Targeting p53 in vivo: a first-in-
human study with p53-targeting compound APR-246 in refractory hematologic
malignancies and prostate cancer. 2012(1527-7755 (Electronic)).
116.
http://www.karolinskadevelopment.com/?cID=551&pid=748979&did=604750&y=2014&
m=04. 2014.
117. Friedler A, Hansson Lo Fau - Veprintsev DB, Veprintsev Db Fau - Freund SMV,
Freund Sm Fau - Rippin TM, Rippin Tm Fau - Nikolova PV, Nikolova Pv Fau - Proctor MR,
et al. A peptide that binds and stabilizes p53 core domain: chaperone strategy for rescue of
oncogenic mutants. 2002(0027-8424 (Print)).
118. Issaeva N, Friedler A Fau - Bozko P, Bozko P Fau - Wiman KG, Wiman Kg Fau -
Fersht AR, Fersht Ar Fau - Selivanova G, Selivanova G. Rescue of mutants of the tumor
suppressor p53 in cancer cells by a designed peptide. 2003(0027-8424 (Print)).
119. Selivanova G, Iotsova V Fau - Okan I, Okan I Fau - Fritsche M, Fritsche M Fau -
Strom M, Strom M Fau - Groner B, Groner B Fau - Grafstrom RC, et al. Restoration of the
growth suppression function of mutant p53 by a synthetic peptide derived from the p53 C-
terminal domain. 1997(1078-8956 (Print)).
120. Kim AL, Raffo Aj Fau - Brandt-Rauf PW, Brandt-Rauf Pw Fau - Pincus MR, Pincus
Mr Fau - Monaco R, Monaco R Fau - Abarzua P, Abarzua P Fau - Fine RL, et al.
Conformational and molecular basis for induction of apoptosis by a p53 C-terminal peptide
in human cancer cells. 1999(0021-9258 (Print)).
121. Snyder EL, Meade Br Fau - Saenz CC, Saenz Cc Fau - Dowdy SF, Dowdy SF.
Treatment of terminal peritoneal carcinomatosis by a transducible p53-activating peptide.
2004(1545-7885 (Electronic)).
122. Hamard PJ, Barthelery N Fau - Hogstad B, Hogstad B Fau - Mungamuri SK,
Mungamuri Sk Fau - Tonnessen CA, Tonnessen Ca Fau - Carvajal LA, Carvajal La Fau -
Senturk E, et al. The C terminus of p53 regulates gene expression by multiple mechanisms
in a target- and tissue-specific manner in vivo. 2013(1549-5477 (Electronic)).
123. Soragni A, Janzen Deanna M, Johnson Lisa M, Lindgren Anne G, Thai-
Quynh Nguyen A, Tiourin E, et al. A Designed Inhibitor of p53 Aggregation Rescues p53
Tumor Suppression in Ovarian Carcinomas. Cancer Cell.29(1):90-103.
124. Boeckler FM, Joerger AC, Jaggi G, Rutherford TJ, Veprintsev DB, Fersht AR.
Targeted rescue of a destabilized mutant of p53 by an in silico screened drug. Proceedings
of the National Academy of Sciences of the United States of America. 2008;105(30):10360-
5.
125. Liu X, Wilcken R Fau - Joerger AC, Joerger Ac Fau - Chuckowree IS, Chuckowree
Is Fau - Amin J, Amin J Fau - Spencer J, Spencer J Fau - Fersht AR, et al. Small molecule
induced reactivation of mutant p53 in cancer cells. 2013(1362-4962 (Electronic)).
126. Yu X, Vazquez A Fau - Levine AJ, Levine Aj Fau - Carpizo DR, Carpizo DR. Allele-
specific p53 mutant reactivation. 2012(1878-3686 (Electronic)).

225
127. Yu X, Blanden AR, Narayanan S, Jayakumar L, Lubin D, Augeri D, et al. Small
molecule restoration of wildtype structure and function of mutant p53 using a novel zinc-
metallochaperone based mechanism. 2014(1949-2553 (Electronic)).
128. Esser C, Scheffner M Fau - Hohfeld J, Hohfeld J. The chaperone-associated ubiquitin
ligase CHIP is able to target p53 for proteasomal degradation. 2005(0021-9258 (Print)).
129. Lukashchuk N, Vousden KH. Ubiquitination and Degradation of Mutant p53.
Molecular and cellular biology. 2007;27(23):8284-95.
130. Moll UM, Petrenko O. The MDM2-p53 interaction. 2003(1541-7786 (Print)).
131. Li D, Marchenko Nd Fau - Schulz R, Schulz R Fau - Fischer V, Fischer V Fau -
Velasco-Hernandez T, Velasco-Hernandez T Fau - Talos F, Talos F Fau - Moll UM, et al.
Functional inactivation of endogenous MDM2 and CHIP by HSP90 causes aberrant
stabilization of mutant p53 in human cancer cells. 2011(1557-3125 (Electronic)).
132. Blagosklonny MV, Toretsky J Fau - Neckers L, Neckers L. Geldanamycin
selectively destabilizes and conformationally alters mutated p53. 1995(0950-9232 (Print)).
133. Jhaveri K, Chandarlapaty S, Lake D, Gilewski T, Robson M, Goldfarb S, et al. A
phase II open-label study of ganetespib, a novel heat shock protein 90 inhibitor for patients
with metastatic breast cancer. 2014(1938-0666 (Electronic)).
134. Goyal L, Wadlow Rc Fau - Blaszkowsky LS, Blaszkowsky Ls Fau - Wolpin BM,
Wolpin Bm Fau - Abrams TA, Abrams Ta Fau - McCleary NJ, McCleary Nj Fau - Sheehan
S, et al. A phase I and pharmacokinetic study of ganetespib (STA-9090) in advanced
hepatocellular carcinoma. 2015(1573-0646 (Electronic)).
135. Ramalingam S, Goss G, Rosell R, Schmid-Bindert G, Zaric B, Andric Z, et al. A
randomized phase II study of ganetespib, a heat shock protein 90 inhibitor, in combination
with docetaxel in second-line therapy of advanced non-small cell lung cancer (GALAXY-
1). 2015(1569-8041 (Electronic)).
136. Egorin MJ, Rosen DM, Wolff JH, Callery PS, Musser SM, Eiseman JL. Metabolism
of 17-(Allylamino)-17-demethoxygeldanamycin (NSC 330507) by Murine and Human
Hepatic Preparations. Cancer research. 1998;58(11):2385-96.
137. Whitesell L, Sutphin Pd Fau - Pulcini EJ, Pulcini Ej Fau - Martinez JD, Martinez Jd
Fau - Cook PH, Cook PH. The physical association of multiple molecular chaperone proteins
with mutant p53 is altered by geldanamycin, an hsp90-binding agent. 1998(0270-7306
(Print)).
138. Li D, Marchenko Nd Fau - Moll UM, Moll UM. SAHA shows preferential
cytotoxicity in mutant p53 cancer cells by destabilizing mutant p53 through inhibition of the
HDAC6-Hsp90 chaperone axis. 2011(1476-5403 (Electronic)).
139. Marks PA. Discovery and development of SAHA as an anticancer agent. 2007(0950-
9232 (Print)).
140. Yan W, Liu S, Xu E, Zhang J, Zhang Y, Chen X, et al. Histone deacetylase inhibitors
suppress mutant p53 transcription via histone deacetylase 8. Oncogene. 2013;32(5):599-609.
141. Yi YW, Kang Hj Fau - Kim HJ, Kim Hj Fau - Kong Y, Kong Y Fau - Brown ML,
Brown Ml Fau - Bae I, Bae I. Targeting mutant p53 by a SIRT1 activator YK-3-237 inhibits
the proliferation of triple-negative breast cancer cells. 2013(1949-2553 (Electronic)).
142. Freed-Pastor WA, Mizuno H, Zhao X, Langerød A, Moon S-H, Rodriguez-Barrueco
R, et al. Mutant p53 Disrupts Mammary Acinar Morphogenesis via the Mevalonate Pathway.
Cell. 2012;148(1-2):244-58.

226
143. Weissmueller S, Manchado E, Saborowski M, Morris JP, Wagenblast E, Davis CA,
et al. Mutant p53 drives pancreatic cancer metastasis through cell-autonomous PDGF
receptor beta signaling. Cell. 2014;157(2):382-94.
144. Polotskaia A, Xiao G, Reynoso K, Martin C, Qiu W-G, Hendrickson RC, et al.
Proteome-wide analysis of mutant p53 targets in breast cancer identifies new levels of gain-
of-function that influence PARP, PCNA, and MCM4. Proceedings of the National Academy
of Sciences. 2015;112(11):E1220-E9.
145. Zhang C, Liu J, Liang Y, Wu R, Zhao Y, Hong X, et al. Tumor-Associated Mutant
p53 Drives the Warburg Effect. Nature communications. 2013;4:2935-.
146. Di Agostino S, Cortese G Fau - Monti O, Monti O Fau - Dell'Orso S, Dell'Orso S
Fau - Sacchi A, Sacchi A Fau - Eisenstein M, Eisenstein M Fau - Citro G, et al. The
disruption of the protein complex mutantp53/p73 increases selectively the response of tumor
cells to anticancer drugs. 2008(1551-4005 (Electronic)).
147. Morton JP, Timpson P, Karim SA, Ridgway RA, Athineos D, Doyle B, et al. Mutant
p53 drives metastasis and overcomes growth arrest/senescence in pancreatic cancer.
Proceedings of the National Academy of Sciences of the United States of America.
2010;107(1):246-51.
148. Dai Y. Platelet-derived growth factor receptor tyrosine kinase inhibitors: a review of
the recent patent literature. Expert Opinion on Therapeutic Patents. 2010;20(7):885-97.
149. Jones S, Zhang X, Parsons DW, Lin JC-H, Leary RJ, Angenendt P, et al. Core
Signaling Pathways in Human Pancreatic Cancers Revealed by Global Genomic Analyses.
Science (New York, NY). 2008;321(5897):1801-6.
150. Larsson O. HMG-CoA reductase inhibitors: role in normal and malignant cells.
Critical Reviews in Oncology / Hematology. 1996;22(3):197-212.
151. Zhu J, Sammons MA, Donahue G, Dou Z, Vedadi M, Getlik M, et al. Prevalent p53
mutants co-opt chromatin pathways to drive cancer growth. Nature. 2015;525(7568):206-
11.
152. Scian MJ, Stagliano KER, Anderson MAE, Hassan S, Bowman M, Miles MF, et al.
Tumor-Derived p53 Mutants Induce NF-κB2 Gene Expression. Molecular and cellular
biology. 2005;25(22):10097-110.
153. Wilkins MR, Sanchez JC, Gooley AA, Appel RD, Humphery-Smith I, Hochstrasser
DF, et al. Progress with proteome projects: why all proteins expressed by a genome should
be identified and how to do it. Biotechnol Genet Eng Rev. 1996;13:19-50.
154. Mann M, Hendrickson RC, Pandey A. Analysis of Proteins and Proteomes by Mass
Spectrometry. Annual Review of Biochemistry. 2001;70(1):437-73.
155. Walerych D, Lisek K, Del Sal G. Mutant p53 : One, No One and One Hundred
Thousand. Frontiers in Oncology. 2015;5.
156. Krishna RG, Wold F. Post-Translational Modification of Proteins. Advances in
Enzymology and Related Areas of Molecular Biology: John Wiley & Sons, Inc.; 1993. p.
265-98.
157. Dziembowski A, Séraphin B. Recent developments in the analysis of protein
complexes1. FEBS Letters. 2004;556(1–3):1-6.
158. Freed-Pastor WA, Prives C. Mutant p53: one name, many proteins. Genes Dev.
2012;26(12):1268-86.

227
159. Coffill CR, Muller PAJ, Oh HK, Neo SP, Hogue KA, Cheok CF, et al. Mutant p53
interactome identifies nardilysin as a p53R273H‐specific binding partner that promotes
invasion. EMBO reports. 2012;13(7):638-44.
160. Elenius K, Paul S, Allison G, Sun J, Klagsbrun M. Activation of HER4 by heparin-
binding EGF-like growth factor stimulates chemotaxis but not proliferation. The EMBO
Journal. 1997;16(6):1268-78.
161. Nishi E, Prat A, Hospital V, Elenius K, Klagsbrun M. N-arginine dibasic convertase
is a specific receptor for heparin-binding EGF-like growth factor that mediates cell
migration. The EMBO Journal. 2001;20(13):3342-50.
162. Vyas S, Chesarone-Cataldo M, Todorova T, Huang Y-H, Chang P. A systematic
analysis of the PARP protein family identifies new functions critical for cell physiology.
Nature communications. 2013;4:2240-.
163. Trinidad AG, Muller Pa Fau - Cuellar J, Cuellar J Fau - Klejnot M, Klejnot M Fau -
Nobis M, Nobis M Fau - Valpuesta JM, Valpuesta Jm Fau - Vousden KH, et al. Interaction
of p53 with the CCT complex promotes protein folding and wild-type p53 activity.
2013(1097-4164 (Electronic)).
164. Rivlin N, Katz S, Doody M, Sheffer M, Horesh S, Molchadsky A, et al. Rescue of
embryonic stem cells from cellular transformation by proteomic stabilization of mutant p53
and conversion into WT conformation. Proceedings of the National Academy of Sciences.
2014;111(19):7006-11.
165. Cordani M, Pacchiana R, Butera G, D'Orazi G, Scarpa A, Donadelli M. Mutant p53
proteins alter cancer cell secretome and tumour microenvironment: Involvement in cancer
invasion and metastasis. Cancer Letters. 2016;376(2):303-9.
166. Neilsen PM, Noll JE, Suetani RJ, Schulz RB, Al-Ejeh F, Evdokiou A, et al. Mutant
p53 uses p63 as a molecular chaperone to alter gene expression and induce a pro-invasive
secretome. Oncotarget. 2011;12:1203-17.
167. Noll JE, Jeffery J, Al-Ejeh F, Kumar R, Khanna KK, Callen DF, et al. Mutant p53
drives multinucleation and invasion through a process that is suppressed by ANKRD11.
Oncogene. 2012;31(23):2836-48.
168. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT
method. Nat Protocols. 2008;3(6):1101-8.
169. Caswell PT, Chan M, Lindsay AJ, McCaffrey MW, Boettiger D, Norman JC. Rab-
coupling protein coordinates recycling of α5β1 integrin and EGFR1 to promote cell
migration in 3D microenvironments. The Journal of Cell Biology. 2008;183(1):143-55.
170. Selinger CI, Cooper WA, Al-Sohaily S, Mladenova DN, Pangon L, Kennedy CW, et
al. Loss of Special AT-Rich Binding Protein 1 Expression is a Marker of Poor Survival in
Lung Cancer. Journal of Thoracic Oncology. 2011;6(7):1179-89.
171. Mohammed H, Russell IA, Stark R, Rueda OM, Hickey TE, Tarulli GA, et al.
Progesterone receptor modulates ER[α] action in breast cancer. Nature.
2015;523(7560):313-7.
172. Smeenk L, van Heeringen SJ, Koeppel M, van Driel MA, Bartels SJJ, Akkers RC, et
al. Characterization of genome-wide p53-binding sites upon stress response. Nucleic Acids
Research. 2008;36(11):3639-54.
173. Pishas KI, Al-Ejeh F, Zinonos I, Kumar R, Evdokiou A, Brown MP, et al. Nutlin-3a
Is a Potential Therapeutic for Ewing Sarcoma. Clinical Cancer Research. 2011;17(3):494-
504.
228
174. Brosh R, Rotter V. When mutants gain new powers: news from the mutant p53 field.
Nat Rev Cancer. 2009;9(10):701-13.
175. Langley RR, Fidler IJ. The seed and soil hypothesis revisited - the role of tumor-
stroma interactions in metastasis to different organs. International journal of cancer Journal
international du cancer. 2011;128(11):2527-35.
176. Xue H, Lu B, Lai M. The cancer secretome: a reservoir of biomarkers. Journal of
Translational Medicine. 2008;6:52-.
177. Cordani M, Pacchiana R, Butera G, D'Orazi G, Scarpa A, Donadelli M. Mutant p53
proteins alter cancer cell secretome and tumour microenvironment: Involvement in cancer
invasion and metastasis. Cancer Letters. 2016.
178. Loging WT, Reisman D. Inhibition of the putative tumor suppressor gene TIMP-3
by tumor-derived p53 mutants and wild type p53. Oncogene. 1999;18(52):7608-15.
179. Ubertini V, Norelli G, D'Arcangelo D, Gurtner A, Cesareo E, Baldari S, et al. Mutant
p53 gains new function in promoting inflammatory signals by repression of the secreted
interleukin-1 receptor antagonist. Oncogene. 2015;34(19):2493-504.
180. Caccia D, Zanetti Domingues L, Miccichè F, De Bortoli M, Carniti C, Mondellini P,
et al. Secretome Compartment Is a Valuable Source of Biomarkers for Cancer-Relevant
Pathways. Journal of Proteome Research. 2011;10(9):4196-207.
181. Zhong L, Roybal J, Chaerkady R, Zhang W, Choi K, Alvarez CA, et al. Identification
of Secreted Proteins that Mediate Cell-Cell Interactions in an In Vitro Model of the Lung
Cancer Microenvironment. Cancer Research. 2008;68(17):7237-45.
182. Kashyap MK, Harsha HC, Renuse S, Pawar H, Sahasrabuddhe NA, Kim M-S, et al.
SILAC-based quantitative proteomic approach to identify potential biomarkers from the
esophageal squamous cell carcinoma secretome. Cancer Biology & Therapy.
2010;10(8):796-810.
183. Grønborg M, Kristiansen TZ, Iwahori A, Chang R, Reddy R, Sato N, et al. Biomarker
Discovery from Pancreatic Cancer Secretome Using a Differential Proteomic Approach.
Molecular & Cellular Proteomics. 2006;5(1):157-71.
184. Yu Y, Pan X, Ding Y, Liu X, Tang H, Shen C, et al. An iTRAQ based quantitative
proteomic strategy to explore novel secreted proteins in metastatic hepatocellular carcinoma
cell lines. Analyst. 2013;138(16):4505-11.
185. Wang H, Hanash S. Mass spectrometry based proteomics for absolute quantification
of proteins from tumor cells. Methods (San Diego, Calif). 2015;81:34-40.
186. Boehm AM, Pütz S, Altenhöfer D, Sickmann A, Falk M. Precise protein
quantification based on peptide quantification using iTRAQ™. BMC Bioinformatics.
2007;8:214-.
187. Chong PK, Gan CS, Pham TK, Wright PC. Isobaric Tags for Relative and Absolute
Quantitation (iTRAQ) Reproducibility:  Implication of Multiple Injections. Journal of
Proteome Research. 2006;5(5):1232-40.
188. Chen JT, Ho Wl Fau - Cheng YW, Cheng Yw Fau - Lee H, Lee H. Detection of p53
mutations in sputum smears precedes diagnosis of non-small cell lung carcinoma.
Anticancer Res. 2000;20(7):2687-90.
189. Scott RW, Crighton D, Olson MF. Modeling and Imaging 3-Dimensional Collective
Cell Invasion. Journal of Visualized Experiments : JoVE. 2011(58):3525.
190. Tao Y-M, Liu Z, Liu H-L. Dickkopf-1 (DKK1) promotes invasion and metastasis of
hepatocellular carcinoma. Digestive and Liver Disease. 2013;45(3):251-7.
229
191. Moon YW, Rao G, Kim JJ, Shim HS, Park KS, An SS, et al. LAMC2 enhances the
metastatic potential of lung adenocarcinoma. Cell Death Differ. 2015;22(8):1341-52.
192. Chang Y-H, Lee S-H, Liao IC, Huang S-H, Cheng H-C, Liao P-C. Secretomic
Analysis Identifies Alpha-1 Antitrypsin (A1AT) as a Required Protein in Cancer Cell
Migration, Invasion, and Pericellular Fibronectin Assembly for Facilitating Lung
Colonization of Lung Adenocarcinoma Cells. Molecular & Cellular Proteomics : MCP.
2012;11(11):1320-39.
193. Ma C, Rong Y, Radiloff DR, Datto MB, Centeno B, Bao S, et al. Extracellular matrix
protein βig-h3/TGFBI promotes metastasis of colon cancer by enhancing cell extravasation.
Genes & Development. 2008;22(3):308-21.
194. Kwon CH, Park HJ, Lee JR, Kim HK, Jeon TY, Jo HJ, et al. Serpin peptidase
inhibitor clade A member 1 is a biomarker of poor prognosis in gastric cancer. Br J Cancer.
2014;111(10):1993-2002.
195. Chang YH, Lee Sh Fau - Liao IC, Liao Ic Fau - Huang S-H, Huang Sh Fau - Cheng
H-C, Cheng Hc Fau - Liao P-C, Liao PC. Secretomic analysis identifies alpha-1 antitrypsin
(A1AT) as a required protein in cancer cell migration, invasion, and pericellular fibronectin
assembly for facilitating lung colonization of lung adenocarcinoma cells. 2012(1535-9484
(Electronic)).
196. Kwon CH, Park HJ, Choi JH, Lee JR, Kim HK, Jo H-j, et al. Snail and serpinA1
promote tumor progression and predict prognosis in colorectal cancer. Oncotarget.
2015;6(24):20312-26.
197. Lazarini M, Traina F, Machado-Neto JA, Barcellos KSA, Moreira YB, Brandão
MM, et al. ARHGAP21 is a RhoGAP for RhoA and RhoC with a role in proliferation and
migration of prostate adenocarcinoma cells. Biochimica et Biophysica Acta (BBA) -
Molecular Basis of Disease. 2013;1832(2):365-74.
198. Nalbant P, Chang Y-C, Birkenfeld J, Chang Z-F, Bokoch GM. Guanine Nucleotide
Exchange Factor-H1 Regulates Cell Migration via Localized Activation of RhoA at the
Leading Edge. Molecular Biology of the Cell. 2009;20(18):4070-82.
199. Timpson P, McGhee EJ, Morton JP, von Kriegsheim A, Schwarz JP, Karim SA, et
al. Spatial regulation of RhoA activity during pancreatic cancer cell invasion driven by
mutant p53. Cancer Research. 2011;71(3):747-57.
200. Bossi G, Marampon F Fau - Maor-Aloni R, Maor-Aloni R Fau - Zani B, Zani B Fau
- Rotter V, Rotter V Fau - Oren M, Oren M Fau - Strano S, et al. Conditional RNA
interference in vivo to study mutant p53 oncogenic gain of function on tumor malignancy.
Cell cycle. 2008;7(12):1870-9.
201. Mizuarai S, Yamanaka K, Kotani H. Mutant p53 Induces the GEF-H1 Oncogene, a
Guanine Nucleotide Exchange Factor-H1 for RhoA, Resulting in Accelerated Cell
Proliferation in Tumor Cells. Cancer Research. 2006;66(12):6319-26.
202. Zhang C, Liu J, Liang Y, Wu R, Zhao Y, Hong X, et al. Tumour-associated mutant
p53 drives the Warburg effect. Nat Commun. 2013;4.
203. Chang AC-M, Doherty J, Huschtscha LI, Redvers R, Restall C, Reddel RR, et al.
STC1 expression is associated with tumor growth and metastasis in breast cancer. Clinical
& Experimental Metastasis. 2014;32(1):15-27.
204. Tanaka J, Irié T, Yamamoto G, Yasuhara R, Isobe T, Hokazono C, et al. ANGPTL4
regulates the metastatic potential of oral squamous cell carcinoma. Journal of Oral Pathology
& Medicine. 2015;44(2):126-33.
230
205. Lee AS. GRP78 Induction in Cancer: Therapeutic and Prognostic Implications.
Cancer Research. 2007;67(8):3496-9.
206. Silverman EK, Sandhaus RA. Alpha1-Antitrypsin Deficiency. New England Journal
of Medicine. 2009;360(26):2749-57.
207. Gettins PGW. Serpin Structure, Mechanism, and Function. Chemical Reviews.
2002;102(12):4751-804.
208. Greene CM, McElvaney NG. Proteases and antiproteases in chronic neutrophilic
lung disease – relevance to drug discovery. British Journal of Pharmacology.
2009;158(4):1048-58.
209. Stoller JK, Aboussouan LS. a1-antitrypsin deficiency. The Lancet.
2005;365(9478):2225-36.
210. El-Akawi ZJ, Al-Hindawi Fk Fau - Bashir NA, Bashir NA. Alpha-1 antitrypsin
(alpha1-AT) plasma levels in lung, prostate and breast cancer patients. Neuroendocrinol
Lett. 2008;29(4):482-4.
211. Comunale MA, Rodemich-Betesh L, Hafner J, Wang M, Norton P, Di Bisceglie AM,
et al. Linkage Specific Fucosylation of Alpha-1-Antitrypsin in Liver Cirrhosis and Cancer
Patients: Implications for a Biomarker of Hepatocellular Carcinoma. PLoS ONE.
2010;5(8):e12419.
212. Pérez-Holanda S, Blanco I, Menéndez M, Rodrigo L. Serum concentration of alpha-
1 antitrypsin is significantly higher in colorectal cancer patients than in healthy controls.
BMC Cancer. 2014;14:355-.
213. Farshchian M, Kivisaari A, Ala-aho R, Riihilä P, Kallajoki M, Grénman R, et al.
Serpin Peptidase Inhibitor Clade A Member 1 (SerpinA1) Is a Novel Biomarker for
Progression of Cutaneous Squamous Cell Carcinoma. The American Journal of Pathology.
2011;179(3):1110-9.
214. Higashiyama M, Doi O, Kodama K, Yokouchi H, Tateishi R. An evaluation of the
prognostic significance of alpha-1-antitrypsin expression in adenocarcinomas of the lung:
an immunohistochemical analysis. British Journal of Cancer. 1992;65(2):300-2.
215. Sun Z, Yang P. Role of imbalance between neutrophil elastase and a1-antitrypsin in
cancer development and progression. The Lancet Oncology. 2004;5(3):182-90.
216. Huang H, Campbell SC, Nelius T, Bedford DF, Veliceasa D, Bouck NP, et al. α1-
antitrypsin inhibits angiogenesis and tumor growth. International Journal of Cancer.
2004;112(6):1042-8.
217. Fridman JS, Lowe SW. Control of apoptosis by p53. Oncogene. 2003;22(56):9030-
40.
218. Liu G, Chen X. Regulation of the p53 transcriptional activity. J Cell Biochem.
2006;97(3):448-58.
219. Olivier M, Hollstein M, Hainaut P. TP53 Mutations in Human Cancers: Origins,
Consequences, and Clinical Use. Cold Spring Harbor Perspectives in Biology.
2010;2(1):a001008.
220. Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor
suppressor-DNA complex: understanding tumorigenic mutations. Science.
1994;265(5170):346-55.
221. Oren M, Rotter V. Mutant p53 Gain-of-Function in Cancer. Cold Spring Harbor
Perspectives in Biology. 2010;2(2):a001107.

231
222. Girardini JE, Marotta C, Del Sal G. Disarming mutant p53 oncogenic function.
Pharmacological Research. 2014;79:75-87.
223. Grellety T, Laroche-Clary A, Chaire V, Lagarde P, Chibon F, Neuville A, et al.
PRIMA-1MET induces death in soft-tissue sarcomas cell independent of p53. BMC Cancer.
2015;15(1):1-8.
224. Aryee DNT, Niedan S, Ban J, Schwentner R, Muehlbacher K, Kauer M, et al.
Variability in functional p53 reactivation by PRIMA-1(Met)/APR-246 in Ewing sarcoma.
British Journal of Cancer. 2013;109(10):2696-704.
225. Russo D, Ottaggio L, Foggetti G, Masini M, Masiello P, Fronza G. PRIMA-1 induces
autophagy in cancer cells carrying mutant or wild type p53. Biochim Biophys Acta.
1833;2013.
226. Freed-Pastor William A, Mizuno H, Zhao X, Langerød A, Moon S-H, Rodriguez-
Barrueco R, et al. Mutant p53 Disrupts Mammary Tissue Architecture via the Mevalonate
Pathway. Cell. 2012;148(1):244-58.
227. Weissmueller S, Manchado E, Saborowski M, Morris John PIV, Wagenblast E,
Davis Carrie A, et al. Mutant p53 Drives Pancreatic Cancer Metastasis through Cell-
Autonomous PDGF Receptor &#x3b2; Signaling. Cell. 2014;157(2):382-94.
228. Trinidad Antonio G, Muller Patricia AJ, Cuellar J, Klejnot M, Nobis M, Valpuesta
José M, et al. Interaction of p53 with the CCT Complex Promotes Protein Folding and Wild-
Type p53 Activity. Molecular Cell. 2013;50(6):805-17.
229. Celis JE, Gromov P, Cabezón T, Moreira JMA, Ambartsumian N, Sandelin K, et al.
Proteomic Characterization of the Interstitial Fluid Perfusing the Breast Tumor
Microenvironment: A Novel Resource for Biomarker and Therapeutic Target Discovery.
Molecular & Cellular Proteomics. 2004;3(4):327-44.
230. Mitsudomi T, Hamajima N, Ogawa M, Takahashi T. Prognostic Significance of p53
Alterations in Patients with Non-Small Cell Lung Cancer: A Meta-Analysis. Clinical Cancer
Research. 2000;6(10):4055-63.
231. Piccolo S. p53 regulation orchestrates the TGF-beta response. (1097-4172
(Electronic)).
232. Cordenonsi M, Dupont S Fau - Maretto S, Maretto S Fau - Insinga A, Insinga A Fau
- Imbriano C, Imbriano C Fau - Piccolo S, Piccolo S. Links between tumor suppressors: p53
is required for TGF-beta gene responses by cooperating with Smads. (0092-8674 (Print)).
233. Kogan-Sakin I, Tabach Y Fau - Buganim Y, Buganim Y Fau - Molchadsky A,
Molchadsky A Fau - Solomon H, Solomon H Fau - Madar S, Madar S Fau - Kamer I, et al.
Mutant p53(R175H) upregulates Twist1 expression and promotes epithelial-mesenchymal
transition in immortalized prostate cells. (1476-5403 (Electronic)).
234. Wang SP, Wang Wl Fau - Chang Y-L, Chang Yl Fau - Wu C-T, Wu Ct Fau - Chao
Y-C, Chao Yc Fau - Kao S-H, Kao Sh Fau - Yuan A, et al. p53 controls cancer cell invasion
by inducing the MDM2-mediated degradation of Slug. (1476-4679 (Electronic)).
235. Parfrey H, Mahadeva R, Lomas DA. α1-Antitrypsin deficiency, liver disease and
emphysema. The International Journal of Biochemistry & Cell Biology. 2003;35(7):1009-
14.
236. Karashima S, Kataoka H, Itoh H, Maruyama R, Koono M. PROGNOSTIC-
SIGNIFICANCE OF ALPHA-1-ANTITRYPSIN IN EARLY STAGE OF COLORECTAL
CARCINOMAS. Int J Cancer. 1990;45(2):244-50.

232
237. Giannopoulou E, Katsoris P, Hatziapostolou M, Kardamakis D, Kotsaki E,
Polytarchou C, et al. X-rays modulate extracellular matrix in vivo. International Journal of
Cancer. 2001;94(5):690-8.
238. Strojnik T, Kavalar R, Barone TA, Plunkett RJ. Experimental Model and
Immunohistochemical Comparison of U87 Human Glioblastoma Cell Xenografts on the
Chicken Chorioallantoic Membrane and in Rat Brains. Anticancer Research.
2010;30(12):4851-60.
239. Hagedorn M, Javerzat S, Gilges D, Meyre A, de Lafarge B, Eichmann A, et al.
Accessing key steps of human tumor progression in vivo by using an avian embryo model.
Proc Natl Acad Sci U S A. 2005;102(5):1643-8.
240. Kobayashi T, Koshida K, Endo Y, Imao T, Uchibayashi T, Sasaki T, et al. A chick
embryo model for metastatic human prostate cancer. European urology. 1998;34(2):154-60.
241. Conn EM, Botkjaer KA, Kupriyanova TA, Andreasen PA, Deryugina EI, Quigley
JP. Comparative Analysis of Metastasis Variants Derived from Human Prostate Carcinoma
Cells : Roles in Intravasation of VEGF-Mediated Angiogenesis and uPA-Mediated Invasion.
The American Journal of Pathology. 2009;175(4):1638-52.
242. Taizi M, Deutsch VR, Leitner A, Ohana A, Goldstein RS. A novel and rapid in vivo
system for testing therapeutics on human leukemias. Experimental Hematology.
2006;34(12):1698-708.
243. Balke M, Neumann A, Kersting C, Agelopoulos K, Gebert C, Gosheger G, et al.
Morphologic characterization of osteosarcoma growth on the chick chorioallantoic
membrane. BMC Research Notes. 2010;3:58-.
244. Lokman NA, Elder ASF, Ricciardelli C, Oehler MK. Chick Chorioallantoic
Membrane (CAM) Assay as an In Vivo Model to Study the Effect of Newly Identified
Molecules on Ovarian Cancer Invasion and Metastasis. International Journal of Molecular
Sciences. 2012;13(8):9959-70.
245. Chang HL, Pieretti-Vanmarcke R, Nicolaou F, Li X, Wei X, MacLaughlin DT, et al.
Mullerian Inhibiting Substance inhibits invasion and migration of epithelial cancer cell lines.
Gynecologic oncology. 2011;120(1):128-34.
246. Petrache I, Fijalkowska I, Medler TR, Skirball J, Cruz P, Zhen L, et al. α-1
Antitrypsin Inhibits Caspase-3 Activity, Preventing Lung Endothelial Cell Apoptosis. The
American Journal of Pathology. 2006;169(4):1155-66.
247. Chen N, Karantza V. Autophagy as a therapeutic target in cancer. Cancer Biology &
Therapy. 2011;11(2):157-68.
248. Tseng IC, Chou F-P, Su S-F, Oberst M, Madayiputhiya N, Lee M-S, et al.
Purification from human milk of matriptase complexes with secreted serpins: mechanism
for inhibition of matriptase other than HAI-1. American Journal of Physiology - Cell
Physiology. 2008;295(2):C423-C31.
249. Yousef GM, Kapadia C, Polymeris M-E, Borgoňo C, Hutchinson S, Wasney GA, et
al. The human kallikrein protein 5 (hK5) is enzymatically active, glycosylated and forms
complexes with two protease inhibitors in ovarian cancer fluids. Biochimica et Biophysica
Acta (BBA) - Gene Structure and Expression. 2003;1628(2):88-96.
250. Laine A, Leroy A Fau - Hachulla E, Hachulla E Fau - Davril M, Davril M Fau -
Dessaint JP, Dessaint JP. Comparison of the effects of purified human alpha 1-
antichymotrypsin and alpha 1-proteinase inhibitor on NK cytotoxicity: only alpha 1-

233
proteinase inhibitor inhibits natural killing. Clinica Chimica Acta; international journal of
clinical chemistry. 1990;190(3):163-73.
251. Zelvyte I, Stevens T, Westin U, Janciauskiene S. α1-antitrypsin and its C-terminal
fragment attenuate effects of degranulated neutrophil-conditioned medium on lung cancer
HCC cells, in vitro. Cancer Cell International. 2004;4(1):1-10.
252. Taipale J, Lohi J, Saarinen J, Kovanen PT, Keski-Oja J. Human Mast Cell Chymase
and Leukocyte Elastase Release Latent Transforming Growth Factor-β1 from the
Extracellular Matrix of Cultured Human Epithelial and Endothelial Cells. Journal of
Biological Chemistry. 1995;270(9):4689-96.
253. Shapira MG, Khalfin B, Lewis EC, Parola AH, Nathan I. Regulation of Autophagy
by α(1)-Antitrypsin: “A Foe of a Foe Is a Friend”. Molecular Medicine. 2014;20(1):417-26.
254. Frenzel E, Wrenger S, Brugger B, Salipalli S, Immenschuh S, Aggarwal N, et al.
alpha1-Antitrypsin Combines with Plasma Fatty Acids and Induces Angiopoietin-like
Protein 4 Expression. Journal of Immunology. 2015;195(8):3605-16.
255. Peinado H, Lavotshkin S, Lyden D. The secreted factors responsible for pre-
metastatic niche formation: Old sayings and new thoughts. Seminars in Cancer Biology.
2011;21(2):139-46.
256. Mantovani A, Muzio M Fau - Garlanda C, Garlanda C Fau - Sozzani S, Sozzani S
Fau - Allavena P, Allavena P. Macrophage control of inflammation: negative pathways of
regulation of inflammatory cytokines. (1528-2511 (Print)).
257. Rogel A, Popliker M, Webb CG, Oren M. p53 cellular tumor antigen: analysis of
mRNA levels in normal adult tissues, embryos, and tumors. Molecular and Cellular Biology.
1985;5(10):2851-5.
258. Rivlin N, Brosh R, Oren M, Rotter V. Mutations in the p53 Tumor Suppressor Gene:
Important Milestones at the Various Steps of Tumorigenesis. Genes & Cancer.
2011;2(4):466-74.
259. Chang Y-L, Wu C-T, Shih J-Y, Lee Y-C. Comparison of p53 and Epidermal Growth
Factor Receptor Gene Status Between Primary Tumors and Lymph Node Metastases in Non-
Small Cell Lung Cancers. Annals of Surgical Oncology. 2010;18(2):543-50.
260. Molina JR, Yang P, Cassivi SD, Schild SE, Adjei AA. Non–Small Cell Lung Cancer:
Epidemiology, Risk Factors, Treatment, and Survivorship. Mayo Clinic proceedings Mayo
Clinic. 2008;83(5):584-94.
261. Bodner SM, Minna Jd Fau - Jensen SM, Jensen Sm Fau - D'Amico D, D'Amico D
Fau - Carbone D, Carbone D Fau - Mitsudomi T, Mitsudomi T Fau - Fedorko J, et al.
Expression of mutant p53 proteins in lung cancer correlates with the class of p53 gene
mutation. Oncogene. 1992;7(4):743-9.
262. Takahashi T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK, Vinocour M, et al. p53:
a frequent target for genetic abnormalities in lung cancer. Science. 1989;246(4929):491-4.
263. Fujita T, Kiyama M Fau - Tomizawa Y, Tomizawa Y Fau - Kohno T, Kohno T Fau
- Yokota J, Yokota J. Comprehensive analysis of p53 gene mutation characteristics in lung
carcinoma with special reference to histological subtypes. International Journal of Oncology.
1999;15(5):927-34.
264. Campling BG, el-Deiry WS. Clinical implications of p53 mutations in lung cancer.
Mol Biotechnol. 2003;24(2):141-56.

234
265. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S, et al.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug
sensitivity. Nature. 2012;483(7391):603-307.
266. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio
Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer
Genomics Data. Cancer Discovery. 2012;2(5):401-4.
267. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative
Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal. Science
Signaling. 2013;6(269):pl1-pl.
268. Wang Z, Sun Y. Targeting p53 for Novel Anticancer Therapy. Translational
Oncology. 2010;3(1):1-12.
269. El-Telbany A, Ma PC. Cancer Genes in Lung Cancer: Racial Disparities: Are There
Any? Genes & Cancer. 2012;3(7-8):467-80.
270. Gyorffy B, Surowiak P, Budczies J, Lanczky A. Online Survival Analysis Software
to Assess the Prognostic Value of Biomarkers Using Transcriptomic Data in Non-Small-
Cell Lung Cancer. PLoS ONE. 2013;8(12):e82241.
271. Martin HM, Filipe MI, Morris RW, Lane DP, Silvestre F. p53 expression and
prognosis in gastric carcinoma. International Journal of Cancer. 1992;50(6):859-62.
272. Tran Y, Benbatoul K Fau - Gorse K, Gorse K Fau - Rempel S, Rempel S Fau - Futreal
A, Futreal A Fau - Green M, Green M Fau - Newsham I, et al. Novel regions of allelic
deletion on chromosome 18p in tumors of the lung, brain and breast. Oncogene.
1998;17(26):3499-505.
273. Tahara E Fau - Ito H, Ito H Fau - Taniyama K, Taniyama K Fau - Yokozaki H,
Yokozaki H Fau - Hata J, Hata J. Alpha 1-antitrypsin, alpha 1-antichymotrypsin, and alpha
2-macroglobulin in human gastric carcinomas: a retrospective immunohistochemical study.
Human Pathology. 1984;15(10):957-64.
274. Karashima S, Kataoka H, Itoh H, Maruyama R, Koono M. Prognostic significance
of alpha-1-antitrypsin in early stage of colorectal carcinomas. International Journal of
Cancer. 1990;45(2):244-50.
275. Tsao M-S, Aviel-Ronen S, Ding K, Lau D, Liu N, Sakurada A, et al. Prognostic and
Predictive Importance of p53 and RAS for Adjuvant Chemotherapy in Non–Small-Cell
Lung Cancer. Journal of Clinical Oncology. 2007;25(33):5240-7.
276. Jin J, Sklar GE, Min Sen Oh V, Chuen Li S. Factors affecting therapeutic
compliance: A review from the patient’s perspective. Therapeutics and Clinical Risk
Management. 2008;4(1):269-86.
277. Zhang G, Gomes-Giacoia E, Dai Y, Lawton A, Miyake M, Furuya H, et al.
Validation and clinicopathologic associations of a urine-based bladder cancer biomarker
signature. Diagnostic Pathology. 2014;9:200.
278. Miyake M, Ross S, Lawton A, Chang M, Dai Y, Mengual L, et al. Investigation of
CCL18 and A1AT as potential urinary biomarkers for bladder cancer detection. BMC
Urology. 2013;13(1):1-10.
279. Frazier MW, He X, Wang J, Gu Z, Cleveland JL, Zambetti GP. Activation of c-myc
gene expression by tumor-derived p53 mutants requires a discrete C-terminal domain.
Molecular and cellular biology. 1998;18(7):3735-43.

235
280. Dell'Orso S, Fontemaggi G, Stambolsky P, Goeman F, Voellenkle C, Levrero M, et
al. ChIP-on-chip analysis of in vivo mutant p53 binding to selected gene promoters. Omics
: a journal of integrative biology. 2011;15(5):305-12.
281. Bargonetti J, Chicas A, White D, Prives C. p53 represses Sp1 DNA binding and HIV-
LTR directed transcription. Cell Mol Biol. 1997;43(7):935-49.
282. Harms KL, Chen X. The functional domains in p53 family proteins exhibit both
common and distinct properties. Cell Death Differ. 2006;13(6):890-7.
283. Osada M, Ohba M, Kawahara C, Ishioka C, Kanamaru R, Katoh I, et al. Cloning and
functional analysis of human p51, which structurally and functionally resembles p53. Nat
Med. 1998;4(7):839-43.
284. Shimada A, Kato S, Enjo K, Osada M, Ikawa Y, Kohno K, et al. The Transcriptional
Activities of p53 and Its Homologue p51/p63: Similaritiesand Differences. Cancer Research.
1999;59(12):2781-6.
285. Girardini JE, Napoli M, Piazza S, Rustighi A, Marotta C, Radaelli E, et al. A
Pin1/Mutant p53 Axis Promotes Aggressiveness in Breast Cancer. Cancer Cell.
2011;20(1):79-91.
286. Alamanova D, Stegmaier P Fau - Kel A, Kel A. Creating PWMs of transcription
factors using 3D structure-based computation of protein-DNA free binding energies. (1471-
2105 (Electronic)).
287. Wu L, Levine AJ. Differential regulation of the p21/WAF-1 and mdm2 genes after
high-dose UV irradiation: p53-dependent and p53-independent regulation of the mdm2
gene. 1997(1076-1551 (Print)).
288. Dohn M, Zhang S Fau - Chen X, Chen X. p63alpha and DeltaNp63alpha can induce
cell cycle arrest and apoptosis and differentially regulate p53 target genes. Oncogene.
2001;20(25):3193-205.
289. Attardi LD, Reczek EE, Cosmas C, Demicco EG, McCurrach ME, Lowe SW, et al.
PERP, an apoptosis-associated target of p53, is a novel member of the PMP-22/gas3 family.
Genes & Development. 2000;14(6):704-18.
290. Reczek EE, Flores ER, Tsay AS, Attardi LD, Jacks T. Multiple Response Elements
and Differential p53 Binding Control Perp Expression During Apoptosis1 1 Anna Fuller
Fund (E. E. R.), Leukemia and Lymphoma Society of America (E. R. F.), Damon Runyon
Cancer Research Foundation (L. D. A.), and NIH and Howard Hughes Medical Institute (T.
J.). Molecular Cancer Research. 2003;1(14):1048-57.
291. Scian MJ, Stagliano KER, Ellis MA, Hassan S, Bowman M, Miles MF, et al.
Modulation of Gene Expression by Tumor-Derived p53 Mutants. Cancer Research.
2004;64(20):7447-54.
292. Chee JLY, Saidin S, Lane DP, Leong SM, Noll JE, Neilsen PM, et al. Wild-type and
mutant p53 mediate cisplatin resistance through interaction and inhibition of active caspase-
9. Cell Cycle. 2013;12(2):278-88.
293. Garner E, Raj K. Protective mechanisms of p53-p21-pRb proteins against DNA
damage-induced cell death. Cell Cycle. 2008;7(3):277-82.
294. Janicke RU, Sohn D, Schulze-Osthoff K. The dark side of a tumor suppressor: anti-
apoptotic p53. Cell Death Differ. 2008;15(6):959-76.
295. Lin Y-C, Wang F-F. Mechanisms underlying the pro-survival pathway of p53 in
suppressing mitotic death induced by adriamycin. Cellular Signalling. 2008;20(1):258-67.

236
296. Gassmann P, Haier J. The tumor cell–host organ interface in the early onset of
metastatic organ colonisation. Clinical & Experimental Metastasis. 2007;25(2):171-81.
297. Wellings SR, Jensen HM. On the Origin and Progression of Ductal Carcinoma in the
Human Breast. Journal of the National Cancer Institute. 1973;50(5):1111-8.
298. Rosen PP. The pathological classification of human mammary carcinoma: past,
present and future. Annals of clinical and laboratory science. 1979;9(144-156).
299. van Bogaert LJ. Recent progress in the histological typing of human breast tumours.
Diagnostic Histopathology. 1981;4:349-53.
300. Hammond MEH, Hayes DF, Wolff AC, Mangu PB, Temin S. American Society of
Clinical Oncology/College of American Pathologists Guideline Recommendations for
Immunohistochemical Testing of Estrogen and Progesterone Receptors in Breast Cancer.
Journal of Oncology Practice. 2010;6(4):195-7.
301. Anderson WF, Chatterjee N Fau - Ershler WB, Ershler Wb Fau - Brawley OW,
Brawley OW. Estrogen receptor breast cancer phenotypes in the Surveillance,
Epidemiology, and End Results database. Breast cancer research and treatment.
2002;76(1):27-36.
302. Knight WA, Livingston RB, Gregory EJ, McGuire WL. Estrogen Receptor as an
Independent Prognostic Factor for Early Recurrence in Breast Cancer. Cancer Research.
1977;37(12):4669-71.
303. Tamoxifen for early breast cancer: an overview of the randomised trials. The Lancet.
1998;351(9114):1451-67.
304. Fisher B, Costantino JP, Wickerham DL, Redmond CK, Kavanah M, Cronin WM,
et al. Tamoxifen for Prevention of Breast Cancer: Report of the National Surgical Adjuvant
Breast and Bowel Project P-1 Study. Journal of the National Cancer Institute.
1998;90(18):1371-88.
305. Cuzick J, Sestak I, Cawthorn S, Hamed H, Holli K, Howell A, et al. Tamoxifen for
prevention of breast cancer: extended long-term follow-up of the IBIS-I breast cancer
prevention trial. The Lancet Oncology. 2015;16(1):67-75.
306. Rivenbark AG, Coleman WB. Field cancerization in mammary carcinogenesis —
Implications for prevention and treatment of breast cancer. Experimental and Molecular
Pathology. 2012;93(3):391-8.
307. Dabbs DJ, Chivukula M, Carter G, Bhargava R. Basal phenotype of ductal carcinoma
in situ: recognition and immunohistologic profile. Mod Pathol. 2006;19(11):1506-11.
308. Bryan BB, Schnitt SJ, Collins LC. Ductal carcinoma in situ with basal-like
phenotype: a possible precursor to invasive basal-like breast cancer. Mod Pathol.
2006;19(5):617-21.
309. Livasy CA, Perou CM, Karaca G, Cowan DW, Maia D, Jackson S, et al.
Identification of a basal-like subtype of breast ductal carcinoma in situ. Human Pathology.
2007;38(2):197-204.
310. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. Molecular
portraits of human breast tumours. Nature. 2000;406(6797):747-52.
311. Sotiriou C, Neo S-Y, McShane LM, Korn EL, Long PM, Jazaeri A, et al. Breast
cancer classification and prognosis based on gene expression profiles from a population-
based study. Proceedings of the National Academy of Sciences of the United States of
America. 2003;100(18):10393-8.

237
312. van de Vijver MJ, He YD, van 't Veer LJ, Dai H, Hart AAM, Voskuil DW, et al. A
Gene-Expression Signature as a Predictor of Survival in Breast Cancer. New England
Journal of Medicine. 2002;347(25):1999-2009.
313. Parker JS, Mullins M, Cheang MCU, Leung S, Voduc D, Vickery T, et al. Supervised
Risk Predictor of Breast Cancer Based on Intrinsic Subtypes. Journal of Clinical Oncology.
2009;27(8):1160-7.
314. Sotiriou C, Neo S-Y, McShane LM, Korn EL, Long PM, Jazaeri A, et al. Breast
cancer classification and prognosis based on gene expression profiles from a population-
based study. Proceedings of the National Academy of Sciences. 2003;100(18):10393-8.
315. Cheang MCU, Chia SK, Voduc D, Gao D, Leung S, Snider J, et al. Ki67 Index,
HER2 Status, and Prognosis of Patients With Luminal B Breast Cancer. Journal of the
National Cancer Institute. 2009;101(10):736-50.
316. Onitilo AA, Engel JM, Greenlee RT, Mukesh BN. Breast Cancer Subtypes Based on
ER/PR and Her2 Expression: Comparison of Clinicopathologic Features and Survival.
Clinical Medicine & Research. 2009;7(1-2):4-13.
317. Group TBIGB-C. A Comparison of Letrozole and Tamoxifen in Postmenopausal
Women with Early Breast Cancer. New England Journal of Medicine. 2005;353(26):2747-
57.
318. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L, et al.
Efficacy and Safety of Trastuzumab as a Single Agent in First-Line Treatment of HER2-
Overexpressing Metastatic Breast Cancer. Journal of Clinical Oncology. 2002;20(3):719-
26.
319. Aebi S, Davidson T, Gruber G, Cardoso F, On behalf of the EGWG. Primary breast
cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Annals
of Oncology. 2011;22(suppl 6):vi12-vi24.
320. Horn HF, Vousden KH. Coping with stress: multiple ways to activate p53.
Oncogene. 2007;26(9):1306-16.
321. Desmedt C, Voet T, Sotiriou C, Campbell PJ. Next generation sequencing in breast
cancer: first take home messages. Current opinion in oncology. 2012;24(6):597-604.
322. Dumay A, Feugeas J-P, Wittmer E, Lehmann-Che J, Bertheau P, Espié M, et al.
Distinct tumor protein p53 mutants in breast cancer subgroups. International Journal of
Cancer. 2013;132(5):1227-31.
323. Olivier M, Langer√∏d A, Carrieri P, Bergh J, Klaar S, Eyfjord J, et al. The clinical
value of somatic TP53 gene mutations in 1,794 patients with breast cancer. Clinical Cancer
Research. 2006;12(4):1157-67.
324. Miller LD, Smeds J, George J, Vega VB, Vergara L, Ploner A, et al. An expression
signature for p53 status in human breast cancer predicts mutation status, transcriptional
effects, and patient survival. Proceedings of the National Academy of Sciences of the United
States of America. 2005;102(38):13550-5.
325. Minami CA, Chung DU, Chang HR. Management Options in Triple-Negative Breast
Cancer. Breast Cancer : Basic and Clinical Research. 2011;5:175-99.
326. Gelmon KA, Tischkowitz M, Mackay H, Swenerton K, Robidoux A, Tonkin K, et
al. Olaparib in patients with recurrent high-grade serous or poorly differentiated ovarian
carcinoma or triple-negative breast cancer: a phase 2, multicentre, open-label, non-
randomised study. The Lancet Oncology. 2011;12(9):852-61.

238
327. Carey LA, Rugo HS, Marcom PK, Mayer EL, Esteva FJ, Ma CX, et al. TBCRC 001:
Randomized Phase II Study of Cetuximab in Combination With Carboplatin in Stage IV
Triple-Negative Breast Cancer. Journal of Clinical Oncology. 2012;30(21):2615-23.
328. Berger C, Qian Y, Chen X. The p53-Estrogen Receptor Loop in Cancer. Current
molecular medicine. 2013;13(8):1229-40.
329. Di Minin G, Bellazzo A, Dal Ferro M, Chiaruttini G, Nuzzo S, Bicciato S, et al.
Mutant p53 Reprograms TNF Signaling in Cancer Cells through Interaction with the Tumor
Suppressor DAB2IP. Molecular Cell. 2014;56(5):617-29.
330. Girardini Javier E, Napoli M, Piazza S, Rustighi A, Marotta C, Radaelli E, et al. A
Pin1/Mutant p53 Axis Promotes Aggressiveness in Breast Cancer. Cancer Cell.
2011;20(1):79-91.
331. Ellis MJ, Perou CM. The Genomic Landscape of Breast Cancer as a Therapeutic
Roadmap. Cancer Discovery. 2013;3(1):27-34.
332. Chan HJ, Li H, Liu Z, Yuan Y-C, Mortimer J, Chen S. SERPINA1 is a direct estrogen
receptor target gene and a predictor of survival in breast cancer patients. Oncotarget.
2015;6(28):25815-27.
333. Herschkowitz JI, Zhao W, Zhang M, Usary J, Murrow G, Edwards D, et al.
Comparative oncogenomics identifies breast tumors enriched in functional tumor-initiating
cells. Proceedings of the National Academy of Sciences of the United States of America.
2012;109(8):2778-83.
334. Coradini D, Fornili M, Ambrogi F, Boracchi P, Biganzoli E. TP53 Mutation,
Epithelial-Mesenchymal Transition, and Stemlike Features in Breast Cancer Subtypes.
Journal of Biomedicine and Biotechnology. 2012;2012:254085.

239