Science of the Total Environment 601–602 (2017) 1306–1314

Contents lists available at ScienceDirect

Science of the Total Environment

journal homepage: www.elsevier.com/locate/scitotenv

A next generation sequencing approach with a suitable bioinformatics

workflow to study fungal diversity in bioaerosols released from two
different types of composting plants
Hamza Mbareche a,e, Marc Veillette a, Laetitia Bonifait a, Marie-Eve Dubuis a,e, Yves Benard c,
Geneviève Marchand b, Guillaume J. Bilodeau d, Caroline Duchaine a,e,⁎
a
Centre de recherche de l'institut universitaire de cardiologie et de pneumologie de Québec, Quebec City, Qc, Canada
b
Institut de Recherche Robert-Sauvé en Santé et en Sécurité du travail (IRSST), Montreal, Qc, Canada
c
Centre de Recherche Industrielle du Québec (CRIQ), Quebec City, Qc, Canada
d
Pathogen Identification Research Lab, Canadian Food Inspection Agency (CFIA), Ottawa, Canada
e
Département de biochimie, de microbiologie et de bio-informatique, Faculté des sciences et de génie, Laval university, Quebec City, Qc, Canada

H I G H L I G H T S G R A P H I C A L A B S T R A C T

• ITS Next-generation sequencing ap-

proach to study fungal diversity in
bioaerosols released from composting
plants is presented
• A bioinformatics workflow is described
for the treatment of the raw sequencing
data and for the fungal diversity analy-
ses
• Differences in the fungal community in
bioaerosols from compost treating dif-
ferent raw materials were observed
• A number of pathogenic fungi newly
identified in compost bioaerosols
• This study suggests the need for creat-
ing guidelines addressing respiratory
protection of workers in composting
plants.

a r t i c l e i n f o a b s t r a c t

Article history: Composting is used all over the world to transform different types of organic matter through the actions of com-
Received 15 February 2017 plex microbial communities. Moving and handling composting material may lead to the emission of high concen-
Received in revised form 19 May 2017 trations of bioaerosols. High exposure levels are associated with adverse health effects among compost industry
Accepted 25 May 2017
workers. Fungal spores are suspected to play a role in many respiratory illnesses. There is a paucity of information
Available online xxxx
related to the detailed fungal diversity in compost as well as in the aerosols emitted through composting activi-
Editor: D. Barcelo ties. The aim of this study was to analyze the fungal diversity of both organic matter and aerosols present in fa-
cilities that process domestic compost and facilities that process pig carcasses. This was accomplished using a
Keywords: next generation sequencing approach that targets the ITS1 genomic region. Multivariate analyses revealed differ-
Fungal exposure ences in the fungal community present in samples coming from compost treating both raw materials. Further-
Bioaerosols more, results show that the compost type affects the fungal diversity of aerosols emitted. Although 8 classes
Composting plants were evenly distributed in all samples, Eurotiomycetes were more dominant in carcass compost while
Next generation sequencing Sordariomycetes were dominant in domestic compost. A large diversity profile was observed in bioaerosols

⁎ Corresponding author at: Centre de Recherche de l'Institut Universitaire de Cardiologie et de Pneumologie de Québec, 2725 Chemin Ste-Foy, Québec G1V 4G5, Canada.
E-mail address: Caroline.Duchaine@bcm.ulaval.ca (C. Duchaine).

http://dx.doi.org/10.1016/j.scitotenv.2017.05.235
0048-9697/© 2017 Elsevier B.V. All rights reserved.
 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314 1307

from both compost types showing the presence of a number of pathogenic fungi newly identified in bioaerosols
emitted from composting plants. Members of the family Herpotrichiellaceae and Gymnoascaceae which have been
shown to cause human diseases were detected in compost and air samples. Moreover, some fungi were identified
in higher proportion in air compared to compost. This is the first study to identify a high level of fungal diversity
in bioaerosols present in composting plants suggesting a potential exposure risk for workers. This study suggests
the need for creating guidelines that address human exposure to bioaerosols. The implementation of technical
and organizational measure should be a top priority. However, skin and respiratory protection for compost
workers could be used to reduce the exposure as a second resort.
© 2017 Elsevier B.V. All rights reserved.

1. Introduction diversity in bioaerosols (Peccia and Hernandez, 2006). More recent

Composting is one of the most promising techniques for managing
organic residues in future years (Sykes et al., 2007). The final product
can be used as soil amendment in agricultural practices and the quality
of that product is linked to the quality of the compost after the matura-
tion stages (Fuchs and Bieri, 2000).
The degradation of organic matter requires the presence of a com-
plex microbial community under aerobic conditions (Ryckeboer et al.,
2003). More specifically, filamentous fungi play a major role in
composting by releasing enzymes that break down complex molecules
present in organic matter that are not easily degraded by other microor-
ganisms (Anastasi et al., 2005; Hoorman, 2011; Floudas et al., 2012).
Previous studies have revealed that the fungal diversity present during
composting is influenced by changes in physico-chemical conditions
like temperature and moisture content during different stages of com-
post maturation (Hansgate et al., 2005; Langarica-Fuentes et al., 2014;
De Gannes et al., 2013).
Bioaerosols are released during composting activities. The type of or-
ganic matter being composted influences the microbial content of the
compost and, consequently, of the emitted bioaerosols. No matter the
composting procedure used, reactive or non-reactive, the compost is
subject to various actions including delivery, shredding, pile turning
and compost screening. High concentrations of bioaerosols are released
during those activities suggesting potential health impacts related to ex-
posure (Epstein et al., 2001; Sánchez-Monedero et al., 2005; Persoons
et al., 2010; Taha et al., 2005).
Occupational exposure to bioaerosols is associated with a wide
range of health effects including infectious diseases, toxic effects, aller-
gies and cancer (Douwes et al., 2003). Respiratory symptoms are
among the most prevalent bioaerosol-associated health effects
(Domingo and Nadal, 2009).
Heavy exposure to bioaerosols has led to a series of diseases, symp-
toms and complaints among compost workers. Health problems include
tracheobronchitis, mucosal irritations, sinusitis, eczema, dermatomy
cosis and gastro-intestinal problems (Bünger et al., 2000). Compared
to other industrial activities, composting sites represent a greater risk
to workers due to the presence of higher concentrations of actinomy-
cetes and thermophilic and/or thermo-tolerant fungi (Bünger et al.,
2007). Furthermore, fungi, their secondary metabolites, and other com-
ponents are believed to be associated with asthma, allergic alveolitis
and chronic bronchitis (Swan et al., 2003; Fung and Clark, 2004). Van
Kampen et al. affirmed the need for adequate monitoring of exposure
in order to reduce health risks (Van Kampen et al., 2014).
The fungal diversity of bioaerosols emitted from composting plants
has not been thoroughly investigated, and no previous studies have
compared the bioaerosol emissions from different compost types.
Most studies have used culture methods or the detection of specific fun-
gal species (Sanchez-Monedero and Stentiford, 2003; Taha et al., 2006;
Park et al., 2013; Schlosser et al., 2012). Other studies have focused
mainly on monitoring particles or microscopic spore counts in aerosols
(O'Connor et al., 2015; Vestlund et al., 2014). It is well known that only
1% of fungi recovered from air samples are cultivable therefore using
this technique may lead to an underestimation of the real fungal
studies using molecular tools to study bioaerosols in composting plants
focused on the 16S RNA region for bacteria and the 18S RNA for fungi.
The results showed limited fungal diversity compared to bacterial diver-
sity. However, the results from sequencing methods showed a higher
number of fungal species compared to the results from culture methods
(Le Goff et al., 2010; Bru-Adan et al., 2009). Moreover, molecular
methods have been used to target specific pathogens or to identify spe-
cific biomarkers for the study of bioaerosol dispersion from composting
sites. (Le Goff et al., 2011). To the best of our knowledge, the fungal di-
versity of bioaerosols released from composting plants has never been
fully examined.
The aim of this study was to analyze the fungal diversity in
composted organic matter and of the aerosols produced from two dif-
ferent compost activities (domestic composting bins and pig carcasses)
using a next generation sequencing approach targeting the ITS1 geno-
mic region.
2. Materials and methods
2.1. Field study
2.1.1. Site sampling
The two composting plants were located in the province of Quebec
(eastern Canada). Both were located in industrial areas and on agricul-
tural/farm lands away from urban areas. The type of organic matter
treated at the two plants was different. One plant treated domestic com-
post which we considered to be green waste and the other treated pig
carcasses with placenta, called animal compost. Composting piles
were followed over one year. The domestic composting process lasted
6 weeks and the animal composting took 24 weeks. The two main
steps of the domestic composting process were sorting and screening,
whereas filling and brewing were used to process animal compost.
The domestic composting plant was visited two times in the spring
and two times in the summer while the animal composting plant was
visited once in the summer and once during the fall. Outdoor tempera-
ture varied from 7 °C to 10 °C during spring visits, 19 °C to 28 °C during
summer and 1 °C to 5 °C during the fall visit.
2.1.2. Air sampling
Air samples were taken during composting activities where workers
were performing the tasks consisting of sorting, screening, filling and
brewing the compost piles. Air samples were collected using the liquid
cyclonic impactor Coriolis μ® (Bertin Technologies, Montigny-le-
Bretonneux, France) set at 300 l/min for 10 min and placed in the center
of the handling operations. Fifteen milliliters of sterile 50 mM
phosphate-buffered saline (pH 7.4) were used to fill the sampling
cone of the Coriolis.
At each visit, 3 samples were taken in the beginning, the middle and
the end of the working shifts. Additionally, 2 control samples were
taken: one prior to worker's activity to set the background and one
off-site upwind. Plus, field blank samples are always a part of the
protocols.
1308 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314
2.1.3. Compost sampling
During the composting process, both samples were collected con-
currently with air samples. The same sampling protocol was applied
to both types of composting plants. Three samples of both type of sam-
ples were collected from the compost piles or the excavator during
brewing activities. Both samples collection time was distributed such
that it coincides with the air sampling period. Each sample corresponds
to 1 l of organic matter.
After samples were homogenized through manual mixing, a 25 g
subsample was taken and homogenized again with 200 ml of phosphate
buffered saline containing 0,05% tween 20 using a sterile stomacher
Filtra-Bag (Labplas, Quebec, Canada) in a stomacher Mix 1 (Aes
Laboratoire, Bruz, France).
2.1.4. DNA extraction
A1.5 ml aliquots from the Coriolis air samples were centrifuged for
10 min at 14,000 ×g. The pellets were kept at −20 °C until the DNA ex-
traction. A Mixer Mill MM301 (Retsch, Düsseldorf, Germany) at a fre-
quency of 20 movements per seconds for 10 min was used for cell
mechanical damage with glass beads. Afterwards, a MoBio
PowerLyser® UltraClean® Microbial DNA kit (Carlsbad, CA, U.S.A) was
used to extract the total genomic DNA from the samples following the
manufacturer's instructions. After the DNA elution, it was stored at
−20 °C.
2.1.5. Miseq sequencing
Amplification of the fungal ITS1 gene, equimolar pooling and se-
quencing was performed at the Plateforme d'analyses génomiques
(IBIS, Université Laval, Quebec City, Canada). Briefly, amplification of
the ITS1 regions was performed using the sequence specific regions de-
scribed in Tedersoo et al. (2015) and references therein using a two-
step dual-indexed PCR approach specifically designed for Illumina in-
struments. In a first step, the gene specific sequence is fused to the
Illumina TruSeq sequencing primers and PCR was carried out in a total
volume of 25 μL that contains 1× Q5 buffer (NEB), 0.25 μM of each prim-
er, 200 μM of each dNTPs, 1 U of Q5 High-Fidelity DNA polymerase
(NEB) and 1 μL of template cDNA. The PCR started with an initial dena-
turation at 98 °C for 30 s followed by 35 cycles of denaturation at 98 °C
for 10 s, annealing at 55 °C for 10 s, extension at 72 °C for 30s and a final
extension at 72 °C for 2 min. The PCR reaction was purified using the
Axygen PCR cleanup kit (Axygen). Quality of the purified PCR product
were checked on a 1% agarose gel. Fifty to 100-fold dilution of this puri-
fied product was used as a template for a second PCR step with the goal
of adding barcodes (dual-indexed) and missing sequence required for
Illumina sequencing. Cycling for the second PCR were identical to the
first PCR but with 12 cycles. PCR reaction were purified as above,
checked for quality on a DNA7500 Bioanlayzer chip (Agilent) and then
quantified spectrophotometrically with the Nanodrop 1000 (Thermo
Fisher Scientific). Barcoded Amplicons were pooled in equimolar con-
centration for sequencing on the illumina Miseq.
The following oligonucleotide sequences were used for
amplification:
ITS1 region
ITS1Fngs: ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTCATTT
AGAGGAAGTAA
ITS2:
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTGCGTTCTTCATC
GATGC
generic forward second-PCR primer
AATGATACGGCGACCACCGAGATCTACAC[index1]ACACTCTTTCCCTA
CACGAC
and generic reverse second-PCR primer CAAGCAGAAGACGGCATAC
GAGAT[index2]GTGACTGGAGTTCAGACGTGT.
Please note that primers used in this work contain Illumina specific
sequences protected by intellectual property (Oligonucleotide se-
quences © 2007–2013 Illumina, Inc. All rights reserved. Derivative
works created by Illumina customers are authorized for use with
Illumina instruments and products only. All other uses are strictly
prohibitEd.)
2.1.6. Processing and analyzing of sequencing data
Fig. 1 describes the bioinformatics workflow and shows which pro-
grams were used for each step of the data treatment. After
demultiplexing the raw FASTQ files, the reads generated from the
paired-end sequencing using Mothur v 1.35.1 were combined (Schloss
et al., 2009). The quality filtering was also performed using Mothur
discarding reads with ambiguous sequences. Reads shorter than
100 bp and longer than 450 bp were also discarded. Similar sequences
were gathered together to reduce the computational burden and the
number of copies of the same sequence was displayed. This
dereplication step was performed using USEARCH (version 7.0.1090)
(Edgar, 2010). The selected region of fungal origin was then extracted
from the sequences with ITSx which uses HMMER3 (Mistry et al.,
2013) to compare input sequences against a set of models built from a
number of different ITS region sequences found in various organisms.
Only the sequences belonging to fungi were kept for further analyses.
Operational taxonomic units (OTUs) with 97% similarity cut-off were
clustered using UPARSE (VERSION 7.1) (Edgar, 2013). UCHIME was
used to identify and remove chimeric sequences (Edgar et al., 2011).
QIIME (version 1.9.0) (Caporaso et al., 2010) was used to assign taxon-
omy to OTUs based on UNITE fungal ITS reference training data set for
taxonomic assignment and to generate an OTU table.
All of the visualization analyses were performed using QIIME scripts
(version 1.9.0, Rarefaction curves, Principal coordinate analyses, Statis-
tical analyses and Taxonomic analyses).
3. Results
Fifty-four fastq files were generated and corresponded to the pair-
end (forward and reverse) sequencing of 27 compost and air samples.
The MiSeq sequencing led to the generation of 3,833,981 sequences.
After the quality filtering, dereplication and chimera checking, 855,172
sequences were clustered into 5255 OTUs.
Table 1 is a summary of the number of OTUs in each type of
composting (air and compost).
Rarefaction curves were constructed using the number of observed
OTUs in air and compost samples. As shown in Fig. 2, the maximum se-
quencing depth was approximately 40,000 sequences per sample. This
number was chosen based on the lowest-depth sample parameter,
which represents the lowest number of sequences in a sample. Samples
with a lower number than this would've been excluded from analyses.
The higher the number, the more accurate the results are. In the cur-
rently presented case, all the samples were included as they have N
40,000 counts per sample. The values shown in Fig. 2 were calculated
as follows: ten values from 10 to 40,000 sequences per sample were
randomly selected. For each of these values the corresponding number
of OTUs observed was noted for all of the samples. Then, the average
number of OTUs observed and the standard deviation were calculated
for each one of the ten values. The plateau shown on the graph indicates
effective sampling of the fungal diversity, as no more OTUs were ob-
served even with greater numbers of sequences per sample.
A multivariate analysis was conducted to determine the variation
between samples according to the raw material used in composting.
Using a Principal Coordinate Analysis (PCoA) samples from the two
types of composting plants were compared based on a Bray-Curtis dis-
similarity metric. A distance matrix was created containing the Bray-
Curtis index to evaluate the distance, taken pairwise, between the sam-
ples. This calculation incorporates information about the abundance of
the observed OTUs in each pair of samples. It is necessary to use a rare-
fied OTU table, in which samples have the same size, to calculate the
Bray-Curtis index. Indeed, the Bray-Curtis dissimilarity is based on the
absolute abundance of the different taxa present in a sample. This
 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314
Fig. 1. Overview of the bioinformatics pipeline for the processing of sequencing data before the visualization analyses.
method is widely used in microbial ecology to study the abundance of
the observed organisms and their variation from one sample to another.
As shown in Fig. 3, fungal communities varied according to the type of
raw material composted. The PC1 axis of the PCoA plot explained 38%
of the total variation and the PC2 axis explained 15% of the total varia-
tion between samples. These results suggest the possibility of a fungal
signature specific to the type of waste treated. To determine the statis-
tical significance of the variation observed, a permanova analyses was
performed on the Bray-Curtis distance matrix. This non-parametric
multivariate analysis of variance method separates the distance matrix
among sources of variation to describe the robustness and significance
that a variable has in explaining the variations between samples. It is
based on the ANOVA experimental design but analyses the variance
and determine the significance by permutations as it is a non-
parametric test (Anderson, 2005). The number of permutations used
to calculate the statistical significance is 999. The compost type variable
tested separates the samples in 2 groups (compost and animal) and the
p-value obtained corresponds to 0.001.
The taxa were examined in order to determine their relative abun-
dance in compost and air samples from the two types of composting
plants. Ascomycota and Basidiomycota were the two most abundant
phyla while Chytridiomycota, Rozellomycota and Zygomycota were
present at lower percentages. The distribution according to the common
features forming the classes of fungi from air and compost samples
show a dominance of 8 of the 11 classes that were most represented.
The overall similarity of the diversity profiles between air and compost
samples for both domestic and animal compost is an indication of the
influence of the source on detected bioaerosols (Fig. 4). Although
Eurotiomycetes, Saccharomycetes, Agaricomycetes, Sordariomycetes,
Pezizomycetes, Tremellomycetes, Dothideomyctes and Microbotryo
mycetes were present throughout all samples, Eurotiomycetes was
the most common fungal class in animal compost air samples while
Sordariomycetes prevailed in domestic compost air samples.
Sordariomycetes and Eurotiomycetes are both classes of fungi involved
in the decomposition of organic matter. Composting animal carcasses is
a recent practice used as an alternative to the expensive and non-
Table 1
Number of OTUs in each type of composting (air and compost).
Compost type Sample type Average OTU number Standard deviation
Domestic Air 218 80
Compost 167 94
Animal Air 195 44
Compost 141 37
1309
environmental friendly incineration approach. Table 2 presents the tax-
onomic rankings of the phyla belonging to the class Eurotiomycetes
found in animal compost.
When carefully analyzing the relative abundance, a large diversity
profile was observed below 1% of total relative abundance. The most
abundant taxa comprising the fungal communities were examined
more closely. Lists were created of the dominant genera identified in
the samples (Fig. 5) and were compared. Samples from domestic and
animal composting showed several similarities. However, differences
were observed in the less abundant phyla from both types of
composting, causing the observed variation between their respective
fungal communities. Some taxa were specific to the type of waste that
was treated. Those taxa included Trametes, Phelinus and Postia for do-
mestic composting and Rasamsonia, Piptoporus, Neurospora,
Talaromyces and Fusarium for animal composting (indicated by colored
text in Fig. 5). These signature taxa are found among the top 20 most
abundant fungi according to the type of waste treated as shown by
the multivariate analyses (Fig. 3). Penicillium was the most abundant
fungi in samples from both types of compost (20% to 30%). The rest of
the list showed some variation as Candida was the second most abun-
dant genera in domestic composting (N20% for air and b20% for com-
post) while Blastobotrys was the second most abundant genera (20%
for air and 10% for compost) present in animal composting. A globally
identical diversity profile was observed in compost and air samples,
for animal composting. The same is true for air and compost profiles
for domestic composting. These results are supported by the permanova
statistical analyses as described earlier in this manuscript. The variation
between air and compost samples is not significant as the p-values are
higher than 0.05 (p-value 0.06 for domestic compost and p-value 0.2
for animal compost). However, diversity profiles compared between
the two composting sources were different. This supports the theory
that the source influences the fungal diversity in bioaerosols. However,
three exceptions were noted in the animal composting samples. Three
genera from the list of abundant fungi were present in the air samples
but were not present in the compost. These were Neurospora, Fusarium
and Emericella. Two of these genera, Fusarium and Emericella, are associ-
ated with human diseases. Additionally, several of the fungal genera
were present in higher percentages in air compared to compost and
vice-versa. Fig. 6 and Fig. 7 illustrate the aerosolization behaviosr show-
ing that the relative abundance of each genera is greater in air samples
compared to compost samples in all cases, and in both domestic and an-
imal composting. The more obvious examples from domestic
composting included Acremonium, Sistotremastrum, Malassezia,
Leucosporidium, Capnobotryella and Davidiella. The more obvious exam-
ples from animal composting included Blastobotrys, Malassezia,
Leucosporidium, and Talaromyces.
1310 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314
Fig. 2. Rarefaction analysis of air and compost samples from the two types of composting plants. An average of the OTUs observed in each sample was calculated for all air and compost
samples respectively with a standard deviation (1SD).
4. Discussion
Using a next generation sequencing method, we aimed to do an in-
depth characterization of the fungal diversity found in compost and in
the bioaerosols emitted during composting in two different environ-
ments that treat different types of organic waste. There is a concern
that people working in composting plants are more likely to develop re-
spiratory illnesses than other working environments (Bünger et al.,
2007; Domingo and Nadal, 2009). Even though microbial diversity in
bioaerosols is getting more attention, there is a lack of information
about the total fungal diversity (Le Goff et al., 2010; Bru-Adan et al.,
2009). The methodology most often used to assess fungal diversity
has some weaknesses and there is a call for the reassessment of fungal
exposure in bioaerosols emitted from composting environments
Fig. 3. Principal coordinate analysis of air and compost samples combined from the two
types of composting facilities (domestic compost in blue and animal compost in red).
The plot was made using the Bray-Curtis measures from the Bray-Curtis distance matrix
that calculates the dissimilarity between each sample. The statistical analyses of the
variance using permanova indicate that communities in each composting type are
significantly different (p-value 0.001). (For interpretation of the references to color in
this figure legend, the reader is referred to the web version of this article.)
(Bonito et al., 2010). Our results show an unexpectedly high fungal di-
versity in the bioaerosols released from both composting environments
providing new insights into the fungal community present in organic
matter and those aerosolized from it, causing us to consider the poten-
tial health risks to workers.
The fact that the number of OTUs observed in air is higher than in
compost suggests that a certain heterogeneity of compost makes diffi-
cult the representativeness of the complete compost pile. Thus, it is
not quiet representative of the whole source, as it represents a specific
zone in the compost. Air is more homogenous as it captures different
sources at the same time making them into one. This hypothesis points
out the importance of air sampling in order to get a better view of the
microbial content of a contaminant source. The variation in fungal com-
munities corresponding to different stages of composting has been
asserted in previous studies (Hansgate et al., 2005; Langarica-Fuentes
et al., 2014; De Gannes et al., 2013). Those variations are explained by
changes in the physico-chemical characteristics of the compost, includ-
ing pH, temperature and moisture content (Ishii et al., 2000; Zhang
et al., 2010). Consequently, the type of raw material composted might
affect those characteristics, which could explain the variation of fungal
communities observed through the multivariate analyses used in this
study. Notably, decomposing an animal carcass requires more microbial
activity than conventional composting (Berge et al., 2009), which can
lead to higher temperatures and affect other physico-chemical charac-
teristics. The considerable presence of Eurotiomycetes in animal com-
post might be the consequence of those variations. However, since
composting animal carcasses is a very recent practice used as an alterna-
tive to current incineration methods, less is known about the microbial
community involved in this type of composting (Gwyther et al., 2011).
Further studies will help confirm the role of the Eurotiomycetes in ani-
mal composting. Because of the emergent nature of composting, this
study represents a valuable contribution of information about the
roles of fungi involved in this process. The variation observed between
the fungal communities according to the type of composting environ-
ment (air or compost) can be explained by the big differences in the di-
versity profile in the less abundant phyla. A large number of fungal
species was detected below 1% of all sequencing hits. It is evident that
the real fungal diversity was underestimated in the air examined from
waste related working environments.
On a taxonomic level, previous studies have reported that Ascomy-
cota and Basidiomycota are the most abundant phyla of fungi present
in composting facilities (Bru-Adan et al., 2009; De Gannes et al., 2013;
Langarica-Fuentes et al., 2014). This was confirmed in the current
study. However, we believe that this is the first study to illustrate such
high fungal diversity in compost and in bioaerosols released from
composting activities. Members of Sordariomycetes and
 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314 1311

Fig. 4. Relative abundance of the classification of fungi (class and phylum) identified in compost and air samples from the two types of composting plants.

Eurotiomycetes are known decomposers (Maharachchikumbura et al., composting animal carcasses. Another example illustrating the relation-
2015; Geiser et al., 2006). However, the higher proportion of ship between the fungal community and the source is the detection of
Sordariomycetes in domestic compost may be explained by the fact Sagenomella in animal composting samples. This fungus is associated
that they are also known particularly as insect and plant pathogens with systemic animal illnesses (Gené et al., 2003) supporting the postu-
(Zhang et al., 2006). As expected, domestic waste is linked with vegetal lation of the presence of fungal animal parasites in animal composting
products and may contain several plant pathogens. The fungal link be- environments and the bioaerosols emitted from them. It should also
tween the source (type of waste) and its decomposition (composting) be noted that, the allergen activity and/or the infectiousness of some
is hard to make for animal composting. As previously stated, not much of the fungi detected in this study have not been shown to pose any
is known about fungal activity in carcass decomposition. Nonetheless, human health risks.
this study highlights the bigger proportion of Eurotiomycetes in animal Because domestic compost likely includes decaying fruits and vege-
composting. This finding is supported by results from a previous study tables, it is logical that Penicillium is the most abundant genera, all sam-
in which the authors found the Eurotiomycetes to be the most abundant ples from both sources. Penicillium is ubiquitous in the environment and
eukaryote in the advanced stages of vertebrate decay (Lauber et al., plays an important role in natural food decomposition (Perrone and
2014). To the best of our knowledge, many of the fungi genera in Susca, 2016). Its decaying capacy might include vegetal and animal
Table 1 have never before been identified in a composting environment. products since Penicillium was the most abundant genera in animal
Thus, opening the door for new hypotheses about their specific role in composting as well (air and compost samples).
As indicated in the results (Fig. 4 and Fig. 5), airborne particles in
each environment are often linked to the source. In some cases, the pro-
portion of organisms present at that source may not be the same in the
Table 2 air. This is a phenomenon described as preferential aerosolization. The
The Eurotiomycetes found in animal composting (air and compost hypothesis suggests that some bacteria may be preferentially aerosol-
samples).
ized compared to others. Parker et al. introduced the idea that respirato-
Phyla Taxonomic rank ry pathogens such as Mycobacterium spp. and Legionella spp. could be
Penicillium Genus enriched in aerosols from the environment (Parker et al., 1983). In addi-
Thermomyces Genus tion, a study comparing the microbial composition of biogas and anaer-
Eurotiales Order obic digestors showed that some microbial phyla had higher
Talaromyces Genus
proportions in the air compared to the source (Moletta et al., 2007).
Trichocomaceae Family
Arachnomyces Genus This study showed that the proportions of Proteobacteria in compost
Emericella Genus piles differed compared to air samples in compost facilities. Some spe-
Cyphellophora Genus cies like Methylobacterium were higher in proportion in air samples
Capronia Genus than in compost (Veillette et al., 2016; Mbareche et al., 2015). To the
Cladophialophora Genus
Exophiala Genus
best of our knowledge, no other study has demonstrated this aerosoliza-
Phaecoccomyces Genus tion behavior in fungi. This study underscores the higher percentage of
Rhinocladiella Genus some fungi species found in air compared to compost. For Aspergillus,
Herpotrichiellaceae Family Malassezia, Leucosporidium and Resinicium, the air enrichment was
Coniosporium Genus
noted in both animal and domestic composting. It is important to con-
Chaetothyriales Order
Byssochlamys Genus sider the potential health risks for people with frequent exposure to
Paecilomyces Genus composting as some of these identified fungi are opportunistic patho-
Sagenomella Genus gens or allergenic and are undoubtedly inhaled by workers. The pres-
Monascus Genus ence of opportunistic pathogens in aerosols released from composting
Gymnoascaceae Family
environments has been previously reported (Wéry, 2014; Le Goff
1312 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314

Fig. 5. The most abundant fungal genera identified in domestic and animal composting facilities (air and compost). Fungi that were identified in only one type of composting facility are
written in colored text. For animal composting, genera found only in air are written in larger font and those only in compost are boxed.

et al., 2010; Bru-Adan et al., 2009) but, this is the first study to reveal the
presence of fungi in bioaerosols emitted from a composting environ-
ment known to cause health problems. This study identified several
members of the family Herpotrichiellaceae and Gymnoascaceae which
have been reported to cause diseases in humans (de Hoog et al., 2000;
Crous et al., 2007; Ghosh, 1985). Other opportunistic, potential patho-
gens were detected for the first time in composting air samples.
Coniosporium is an environmental fungal genus that forms black patches
on plants and rotten wood raising new dermatological concerns (Li
et al., 2008). Malassezia causes skin disorders and can lead to invasive
infections in immunocompetent individuals (Velegraki et al., 2015).
Emericella is a taxon of teleomorphs related to Aspergillus. Species of
this group are known agents of chronic granulomatous disease (CGD)
(Matsuzawa et al., 2010). Acremonium causes fungemia in immunosup-
pressed patients (Rodriguez and Ramos, 2014). Fusarium species are re-
sponsible for a broad range of health problems, from local and systemic
infections to allergy related diseases such as sinusitis, in
immunodepressed individuals (Nucci and Anaissie, 2007). Some of the
fungi were found at higher percentages in air compared to compost
which may be harmful to people constantly in contact with those
fungi. Indeed, the air enrichment of particular fungal spores makes
them more likely to be inhaled and therefor responsible of respiratory
health problems. These results indicate that protective measures should
be taken in order to minimize human exposure to these aerosols.
As composting becomes more important as an ecofriendly alterna-
tive for waste management, it is crucial to consider the harmful fungi re-
leased during composting processes. This study is the first to provide a
comprehensive analysis of fungal diversity from two different
composting environments and to identify the fungal diversity present
in bioaerosols including many known pathogenic fungi. The informa-
tion from this study will allow for better risk assessments for
composting workers.
5. Conclusion
This study highlights the importance of using the ITS1 region in the
high-throughput sequencing method for an in-depth characterization
of fungal diversity in bioaerosols with a bioinformatics workflow to fa-
cilitated the data analyses. Based on the results of this investigation,
the authors strongly recommend taking action to reduce the worker ex-
posure. Technical and organizational measure should be implemented
in composting facilities as a first resort. Such measures include building

Fig. 6. Aerosolization behavior of some of the most abundant fungi genera identified in domestic composting facilities. The y-axis represents the percentage of relative abundance
compared to the total most abundant fungi genera.
 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314
Fig. 7. Aerosolization behavior of some of the most abundant fungi genera identified in animal composting facilities. The y-axis represents the percentage of relative abundance compared
to the total most abundant fungi genera.
efficient ventilation systems, better confinement and capturing air con-
taminants from the source. If the first measure can't be taken, we rec-
ommend skin and respiratory protection for compost workers as a
means to reduce continuous exposure to harmful fungi present in
bioaerosols. The broad spectrum of fungi detected in this study includes
many know pathogenic agents and adequate monitoring of exposure is
necessary to diminish risks. Additional studies should be conducted to
further support the conclusion that there are fungal signatures associat-
ed with the type of waste treated.
Acknowledgements
We are grateful to all of the employees of the composting sites that
participated in this study. We are also grateful to Maude Talbot, Eric
Légaré and the members of the IRSST that were in the field for their
technical assistance. This work was supported by the Institut de
Recherche Robert-Sauvé en Santé et en Sécurité du Travail (grant num-
ber: 2014-0057). The authors are thankful to Amanda Kate Toperoff for
English revision of the manuscript.
References
Anastasi, A., Varese, G.C., Marchisio, V.F., 2005. Isolation and identification of fungal com-
munities in compost and vermicompost. Mycologia 97:33–44. http://dx.doi.org/10.
3852/mycologia.97.1.33.
Anderson, M.J., 2005. PERMANOVA: A FORTRAN Computer Program for Permutational
Multivariate Analysis of Variance. 24. Department of Statistics, University of Auck-
land, New Zealand.
Berge, A.C.B., Glanville, T.D., Millner, P.D., Klingborg, D.J., 2009. Methods and microbial
risks associated with composting of animal carcasses in the United States. J. Am.
Vet. Med. Assoc. 234 (1):47–56. http://dx.doi.org/10.2460/javma.234.
Bonito, G., Isikhuenmhen, O.S., Vilgalys, R., 2010. Identification of fungi associated with
municipal compost using DNA based techniques. Bioresour. Technol. 101:
1021–1027. http://dx.doi.org/10.1016/j.biortech.2009.08.109.
Bru-Adan, V., Wéry, N., Moletta-Denat, M., Boiron, P., Delgènes, J.P., Godon, J.J., 2009. Di-
versity of bacteria and fungi in aerosols during screening in a green waste
composting plant. Curr. Microbiol. 59 (3):326–335. http://dx.doi.org/10.1007/
s00284-009-9438-3 (Epub 2009 Jun 16).
Bünger, J., Antlauf-Lammers, M., Schulz, T.G., Westphal, A.G., Müller, M.M., Ruhnau, P.,
Hallier, E., 2000. Health complaints and immunological markers of exposure to
bioaerosols among biowaste collectors and compost workers. Occup. Environ. Med.
57, 458–464.
Bünger, J., Schappler-Scheele, B., Hilgers, R., Hallier, E., 2007. A 5-year follow-up study on
respiratory disorders and lung function in workers exposed to organic dust from
composting plants. Int. Arch. Occup. Environ. Health 80:306–312. http://dx.doi.org/
10.1007/s00420-006-0135-2.
Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fiere,
R.N., Gonzalez Pena, A., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights,
D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M.,
Reeder, J., Sevinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T.,
Zaneveld, J., Knight, R., 2010. QIIME allows analysis of high-throughput community
sequencing data. Nat. Methods 7 (5), 335–336.
Crous, P.W., Schubert, K., Braun, U., de Hoog, G.S., Hocking, A.D., Shin, H.-D., Groenewald,
J.Z., 2007. Opportunistic, human-pathogenic species in the Herpotrichiellaceae are
1313
phenotypically similar to saprobic or phytopathogenic species in the Venturiaceae.
Stud. Mycol. 58:185–217. http://dx.doi.org/10.3114/sim.2007.58.07.
De Gannes, V., Eudoxie, G., Hickey, William J., 2013. Insights into fungal communities in
composts revealed by 454-pyrosequencing: implications for human health and safe-
ty. Front. Microbiol. 4:164. http://dx.doi.org/10.3389/fmicb.2013.00164.
Domingo, J.L., Nadal, 2009. Domestic waste composting facilities: a review of human
health risks. Environ. Int. 35 (2), 382–389.
Douwes, J., Thorne, P., Pearce, N., Heederik, D., 2002. Bioaerosol health effects and expo-
sure assessment: progress and prospects. Ann. Occup. Hyg. 47 (3), 187–200 (2003).
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinfor-
matics 26 (19):2460–2461. http://dx.doi.org/10.1093/bioinformatics/btq461.
Edgar, R.C., 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads.
Nat. Methods http://dx.doi.org/10.1038/nmeth.2604 (Pubmed: 23955772).
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves sensi-
tivity and speed of chimera detection. Bioinformatics http://dx.doi.org/10.1093/
bioinformatics/btr381 (Pubmed 21700674).
Epstein, E., Wu, N., Youngberg, C., Croteau, G., 2001. Dust and bioaerosols at a biosolids
composting facility. Compost Sci. Util. 9 (3), 250–255.
Floudas, D., et al., 2012. The Paleozoic origin of enzymatic lignin decomposition recon-
structed from 31 fungal genomes. Science 336:1715. http://dx.doi.org/10.1126/
science, 1221748.
Fuchs, J.G., Bieri, B., 2000. New biotests to measure the biological qualities of composts.
Agrarforschung 7, 314–319.
Fung, F., Clark, R.F., 2004. Health effects of mycotoxins: a toxicological overview. Journal of
toxicology. Clin. Toxicol. 42 (2), 217–234.
Geiser, D.M., Gueidan, C., Miadlikowska, J., Lutzoni, F., Kauff, F., Hofstetter, V., Fraker, E.,
2006. Eurotiomycetes: Eurotiomycetidae and Chaetothyriomycetidae. Mycologia 98
(6):1053–1064. http://dx.doi.org/10.3852/mycologia.98.6.1053.
Gené, J., Blanco, J.L., Cano, J., García, M.E., Guarro, J., 2003. New filamentous fungus
Sagenomella chlamydospora responsible for a disseminated infection in a dog. J. Clin.
Microbiol. 41 (4):1722–1725. http://dx.doi.org/10.1128/JCM.41.4.1722-1725.2003.
Ghosh, R.R., 1985. Physiological studies of the Gymnoascaceae with an overview on their
ecology. Indian Acad. Sci. (Plant Sci.) 94:197. http://dx.doi.org/10.1007/BF03053137
(1985).
Gwyther, C.L., Williams, P., Golyshin, P.N., Edwards-Jones, G., Jones, D.L., 2011. The envi-
ronmental and biosecurity characteristics of livestock carcass disposal methods: a re-
view. Waste Manag. 31 (4), 767–778.
Hansgate, A.M., Schloss, P.D., Hay, A.G., Walker, L.P., 2005. Molecular characterization of
fungal community dynamics in the initial stages of composting. FEMS Microbiol.
Ecol. 51:209–214. http://dx.doi.org/10.1016/j.femsec.2004.08.009.
de Hoog, G.S., Guarro, J., Gené, J., Figueras, M.J., 2000. Atlas of Clinical Fungi. Utrecht/Reus:
Centraalbureau voor Schimmelcultures/Universitat Rovira i Virgili. second ed. p. 1126.
Hoorman, J.J., 2011. The role of soil fungus. Fact sheet. Agricultural and Natural Resources.
Ohio State University (SAG-14-11).
Ishii, K., Fukui, M., Takii, S., 2000. Microbial succession during a composting process as
evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 89
(5), 768–777.
Langarica-Fuentes, A., Zafar, U., Heyworth, A., Brown, T., Fox, G., Robson, D.G., 2014. Fun-
gal succession in an in-vessel composting system characterized using 454 pyrose-
quencing. FEMS Microbiol. Ecol. 88:296–308. http://dx.doi.org/10.1111/1574-6941.
12293.
Lauber, C.L., Metcalf, J.L., Keerpers, K., Ackermann, G., Carter, D.O., Knight, R., 2014. Verte-
brate decomposition is accelerated by soil microbes. Appl. Environ. Microbiol. 80
(16):4920–4929. http://dx.doi.org/10.1128/AEM.00957-14 (August 2014).
Le Goff, O., Bru-Adan, V., Bacheley, H., Godon, J.J., Wéry, N., 2010. The microbial signature
of aerosols produced during the thermophilic phase of composting. J. Appl. Microbiol.
108 (1):325–340. http://dx.doi.org/10.1111/j.1365-2672.2009.04427.x (2010 Jan).
Le Goff, O., Godon, J.J., Steyer, J.P., Wéry, N., 2011. New specific indicators for qPCR mon-
itoring of airborne microorganisms emitted by composting plants. Atmos. Environ. 45
(2011), 5342–5350.
Li, D.M., de Hoog, G.S., Saunte, D.M.L., van den Ende, A.H.G.G., Chen, X.R., 2008.
Coniosporium epidermidis sp. nov., a new species from human skin. Stud. Mycol. 61:
131–136. http://dx.doi.org/10.3114/sim.2008.61.13.
1314 H. Mbareche et al. / Science of the Total Environment 601–602 (2017) 1306–1314
Maharachchikumbura, S.S., Hyde, K.D., Jones, E.G., McKenzie, E.H., Huang, S.K., Abdel-
Wahab, M.A., Hongsanan, S., 2015. Towards a natural classification and backbone
tree for Sordariomycetes. Fungal Divers. 72.1.
Matsuzawa, T., Tanka, R., Horie, Y., Gonoi, T., Yaguchi, T., 2010. Development of rapid and
specific molecular discrimination methods for pathogenic Emericella species. Jpn.
J. Med. Mycol. 51 (109–116), 2010 (ISSN 0916-4804).
Mbareche, H., Veillette, M., Bonifait, L., Bernard, Y., Marchand, G., Duchaine, C., 2015. Pref-
erential aerosolization of bacteria in the air of different composting plants. 4th Inter-
national Conference and Exhibition on Occupational Health & Safety August 24–25,
2015 Toronto, Canada.
Mistry, J., Finn, R.D., Eddy, S.R., Bateman, A., Punta, M., 2013. Challenges in homology
search: HMMER3 and convergent evolution of coiled-coil regions. Nucleic Acids
Res. 41 (e121), 2013.
Moletta, M., Delgenes, J., Godon, J., 2007. Differences in the aerosolization behavior of mi-
croorganisms as revealed through their transport by biogas. Sci. Total Environ. 379
(1), 75–88.
Nucci, M., Anaissie, E., 2007. Fusarium infections in immunocomprised patients. Clin.
Microbiol. Rev. 20 (4):695–704. http://dx.doi.org/10.1128/CMR.00014-07.
O'Connor, J.D., Daly, S.M., Sodeau, J.R., 2015. On-line monitoring or airborne bioaerosols
released from a composting/green waste site. Waste Manag. 42 (2015), 23–30.
Park, D., Ryu, S., Kim, S., Byun, H., Yoon, C., Lee, K., 2013. Airborne bacteria and fungi asso-
ciated with waste-handling work. Int. J. Occup. Environ. Health 19 (4), 313–317.
Parker, B.C., Ford, M.A., Gruft, H., Falkinham, J.O., 1983. Epidemiology of infection by
nontuberculous mycobacteria. IV. Preferential aerosolization of Mycobacterium
intracellulare from natural waters. Am. Rev. Respir. Dis. 128 (4), 652–656.
Peccia, J., Hernandez, M., 2006. Incorporating polymerase chain reaction-based identifica-
tion, population characterization, and quantification of microorganisms into aerosol
science: a review. Atmos. Environ. 40 (21), 3941–3961.
Perrone, G., Susca, A., 2016. Penicillium species and their associated mycotoxins. Methods
Mol. Biol. 1542, 107–119.
Persoons, R., Parat, S., Stoklov, M., Perdrix, A., Maitre, A., 2010. Critical working tasks and
determinants of exposure to bioaerosols and MVOC at composting facilities. Int.
J. Hyg. Environ. Health 213, 338-247.
Rodriguez, Z.C., Ramos, M.G., 2014. Acremonium species associated fungemia: a novel
pathogen in the immunosuppressed patient. Bol. Asoc. Med. P. R. 106 (3), 29–31
(2014).
Ryckeboer, J., Mergaert, J., Vaes, K., Klammer, S., De Clercq, D., Coosemans, J., et al., 2003. A
survey of bacteria and fungi occurring during composting and self-heating processes.
Ann. Microbiol. 53, 349–410.
Sanchez-Monedero, M.A., Stentiford, E.I., 2003. Generation and dispersion of airborne mi-
croorganisms from composting facilities. Trans IChem. 81 (B), 166–170.
Sánchez-Monedero, Miguel A., Stentiford, Edward I., Urpilainen, Sari T., 2005. Bioaerosol
generation at large-scale green waste composting plants. J. Air Waste Manage.
Assoc. 55 (5):612–618. http://dx.doi.org/10.1080/10473289.2005.10464652.
Schloss, P.D., et al., 2009. Introducing mother: open-source, platform-independent,
community-supported software for describing and comparing microbial communi-
ties. Appl. Environ. Microbiol. 75 (23), 7537–7541.
Schlosser, O., Huyard, A., Rybacki, D., Do Quang, Z., 2012. Protection of the vehicle cab en-
vironment against bacteria, fungi and endotoxins in composting facilities. Waste
Manag. 32, 1106–1115.
Swan, J.R.M., Kelsey, A., Crook, B., 2003. Occupational and environmental exposure to
bioaerosols from composts and potential health effects - a critical review of published
data. Research report 130. Health & Safety Executive. The Composting Association
(ISBN 0 7176 2707 1).
Sykes, P., Jones, K., Wildsmith, J.D., 2007. Managing the potential public health risks from
bioaerosol liberation at commercial composting sites in the UK: an analysis of the ev-
idence base. Resour. Conserv. Recycl. 52:410. http://dx.doi.org/10.1016/j.resconrec.
2007.05.005.
Taha, P.M.P., Pollard, S.J.T., Sarkar, U., Longhurst, P., 2005. Estimating fugitive bioaerosol
releases from static compost windrows: feasibility of a portable wind tunnel ap-
proach. Waste Manag. 25, 445–450.
Taha, M.P.M., Drew, G.H., Longhurst, P.J., Smith, R., Pollard, S.J.T., 2006. Bioaerosol releases
from compost facilities: evaluating passive and active source terms at a green waste
facility for improved risk assessments. Atmos. Environ. 40 (6), 1159–1169.
Tedersoo, L., Anslan, S., Bahram, M., Põlme, S., Riit, T., Liiv, I., Kõljalg, U., Kisand, V., Nilsson,
R.H., Hildebrand, F., Bork, P., Abarenkov, K., 2015. Shotgun metagenomes and multi-
ple primer pairbarcode combinations of amplicons reveal biases in metabarcoding
analyses of fungi. MycoKeys 10, 1–43.
Van Kampen, V., Sander, I., Liebers, V., Deckert, A., Neumann, H.D., Buxtrup, M., Willer, E.,
Felten, C., Jackel, U., Klug, K., Bruning, T., Raulf, M., Bunger, J., 2014. Concentration of
bioaerosols in composting plants using different quantification methods. Ann.
Occup. Hyg. 58 (6), 693–706.
Veillette, M., Bonifait, M., Marchand, G., Duchaine, C., 2016. Bioaerosols exposure in in-
door composting installations: classical and molecular approaches and preferential
aerosolization. 4th Workplace and Indoor Aerosols Conference 20–22 April 2016 Bar-
celona, Spain.
Velegraki, A., Cafarchia, C., Gaitanis, G., Iatta, R., Boekhou, T., 2015. Malassezia infections in
humans and animals: pathophysiology, detection, and treatment. PLoS Pathog. 11
(1), e1004523. http://dx.doi.org/10.1371/journal.ppat.1004523.
Vestlund, A.T., Al-Ashaab, R., Tyrrel, S.F., Longhurst, P.J., Pollard, S.J.T., Drew, G.H., 2014.
Morphological classification of bioaerosols from composting using scanning electron
microscopy. Waste Manag. 34, 1101–1108.
Wéry, N., 2014. Bioaerosols from composting facilities – a review. Front. Cell. Infect.
Microbiol. 4. http://dx.doi.org/10.3389/fcimb.2014.00042 (article 42).
Zhang, N., Castlebury, L.A., Miller, A.N., Huhndorf, S.M., Schoch, C.L., Seifert, K.A., Rossman,
A.Y., Rogers, J.D., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Sung, J.H., 2006. An over-
view of the systematics of the Sordariomycetes based on a four-gene phylogeny.
Mycologia 98 (6):1076–1087. http://dx.doi.org/10.3852/mycologia.98.6.1076.
Zhang, J., Zeng, G., Chen, Y., Yu, M., Yu, Z., Li, H., Yu, Y., Huang, H., 2010. Effects of physico-
chemical parameters on the bacterial and fungal communities during agricultural
waste composting. Bioresour. Technol. 102, 2950–2956.