FEMS Yeast Research, 15, 2015, fov010

doi: 10.1093/femsyr/fov010
Advance Access Publication Date: 3 March 2015
Research Article

RESEARCH ARTICLE

A series of conditional shuttle vectors for targeted

genomic integration in budding yeast
Chia-Ching Chou, Michael T. Patel1 and Marc R. Gartenberg∗,2
Department of Biochemistry and Molecular Biology, Robert Wood Johnson Medical School, Rutgers University
Piscataway, NJ 08854, USA
∗ Corresponding author: Department of Biochemistry and Molecular Biology, Robert Wood Johnson Medical School, Rutgers University Piscataway,
NJ 08854, USA. Tel: +732-235-5800; E-mail: marc.gartenberg@rutgers.edu
1
Present address: University of North Carolina, Eshelman School of Pharmacy, Chapel Hill, NC 27514, USA.
2
Member of The Cancer Institute of New Jersey, New Brunswick, NJ 08901, USA.
One sentence summary: The authors describe a series of conditional shuttle vectors, each with CEN/ARS flanked by loxP sites, that can be used for both
plasmid assembly in yeast and targeted genomic integrations.
Editor: Pascale Daran-Lapujade

ABSTRACT
The capacity of Saccharomyces cerevisiae to repair exposed DNA ends by homologous recombination has long been used by
experimentalists to assemble plasmids from DNA fragments in vivo. While this approach works well for engineering
extrachromosomal vectors, it is not well suited to the generation, recovery and reuse of integrative vectors. Here, we
describe the creation of a series of conditional centromeric shuttle vectors, termed pXR vectors, that can be used for both
plasmid assembly in vivo and targeted genomic integration. The defining feature of pXR vectors is that the DNA segment
bearing the centromere and origin of replication, termed CEN/ARS, is flanked by a pair of loxP sites. Passaging the vectors
through bacteria that express Cre recombinase reduces the loxP-CEN/ARS-loxP module to a single loxP site, thereby
eliminating the ability to replicate autonomously in yeast. Each vector also contains a selectable marker gene, as well as a
fragment of the HO locus, which permits targeted integration at a neutral genomic site. The pXR vectors provide a
convenient and robust method to assemble DNAs for targeted genomic modifications.

Keywords: CEN; ARS; Cre; loxP; shuttle vector; plasmid

INTRODUCTION Homologous recombination has also been used widely to as-

semble or alter plasmids in yeast (Ma et al. 1987). Typically, a
An attractive feature of budding yeast Saccharomyces cerevisiae as
shuttle vector is recombined with one or more DNA fragments
a model organism is the remarkable proficiency that the genome
to yield a plasmid that is subsequently recovered in bacteria
can be modified by homologous recombination. Genes can be
for confirmation, amplification and storage. The interchange-
deleted, inserted and modified quickly and precisely. The ability
able components of the pRS series of shuttle vectors are ide-
to generate alterations solely with PCR products, thereby skip-
ally suited for this purpose (Sikorski and Hieter 1989). Each pRS
ping traditional cloning in bacteria, has made yeast genomic
plasmid differs from the others by the identity of the selectable
modifications even more convenient. In these applications, a
marker gene and/or by their mode of propagation in yeast. The
DNA segment with flanking regions of genomic homology rang-
extrachromosomal members of the series carry an autonomous
ing from 35–50 bps recombines with the chromosome via double
replicating sequence (ARS) and either a centromere (CEN) or a
crossovers (Oldenburg et al. 1997). The chromosomal DNA be-
2 μM stability element that maintain the plasmids at low or
tween the flanking homology regions is replaced by a gene con-
high copy, respectively. Nevertheless, copy number of both types
version event.

Received: 5 December 2014; Accepted: 26 February 2015


C FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

1
 2 FEMS Yeast Research, 2015, Vol. 15, No. 3

of plasmids can vary considerably between populations of cells

NdeI, BsgI, SbfI, BspMI, XcmI, NcoI, BstBI, BsmI, StuI, NsiI
and between single cells of a given population. Furthermore,
spontaneous plasmid loss events yield a fraction of plasmid-free

Partial list of unique RE sites in the marker gene

cells in every population, even under selective growth conditions
(Murray and Szostak 1983).
The integrative members of the pRS series lack both ARSs and
stability elements. Instead they attain heritability by recombin-

HpaI, BstEII, AgeI, XcmI, BspMI, BsrGI

ing into a chromosome. The fixed copy number of an integrative
vector in every cell of a population is an attractive if not essential
feature for a variety of genetic analyses and single cell studies.

AatII, HpaI, StuI, NdeI, BsrGI

NdeI, MscI, BsmI, NheI, NsiI
However, the greater challenge of assembling integrative vectors

SnaBI, MfeI, BsgI, BspMI

NcoI, BspMI, NsiI, SnaBI

by homologous recombination in vivo represents a bottleneck in

StuI, HpaI, NruI, BglII

their broader application. While it is possible to join DNA frag-
ments together efficiently during the integration process, the re-
sulting DNA products cannot be recovered, further modified and
reused because they have integrated (for example, see Kuijpers
et al. 2013).

N/A
N/A
N/A
We sought a method to harness the power of homologous
recombination to assemble extrachromosomal plasmids that
could ultimately be used for integration. To this end, we made
a series of conditional shuttle vectors, each with a CEN/ARS el-

KpnI, ApaI, XhoI, SalI, ClaI, EcoRI, PstI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI

KpnI, ApaI, XhoI, SalI, ClaI, EcoRI, PstI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI
ement flanked by loxP target sites for the Cre site-specific re-
combinase. The extrachromosomal forms of the vectors facili-

KpnI, ApaI, XhoI, SalI, ClaI, PstI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI
tate the assembly of constructs by homologous recombination in

KpnI, ApaI, XhoI, SalI, EcoRI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI
yeast. Following isolation from yeast, the vectors are converted

ApaI, XhoI, SalI, ClaI, EcoRI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI

KpnI, XhoI, SalI, ClaI, EcoRI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI
to their integrating forms by passaging through a bacterial strain
that expresses Cre recombinase. A fragment of the HO locus

ApaI, XhoI, SalI, PstI, SmaI/XmaI, BamHI, SpeI, EagI/NotI, SacII, SacI
was included in each vector to permit targeted integration at a

KpnI, ApaI, XhoI, SalI, ClaI, SmaI/XmaI, BamHI, SpeI, NotI, SacI
ApaI, XhoI, SalI, ClaI, EcoRI, BamHI, SpeI, EagI/NotI, SacII, SacI
neutral genomic site. This report documents the creation and
application of conditional CEN/ARS shuttle vectors known as
pXR vectors.

ApaI, SalI, ClaI, EcoRI, PstI, SmaI/XmaI, EagI/NotI, SacI

MATERIALS AND METHODS
Plasmid and strain construction
Partial list of unique RE sites in MCS

The first plasmid of the pXR series, pXRL2 (Table 1), was as-
sembled in the following steps. A loxP-CEN6/ARSH4-loxP frag-
ment of plasmid pDS163 (Sinclair and Guarente 1997) was am-
plified by PCR (primers 1 and 2; Table 2) and joined to AatII-
linearized plasmid pRS405 by homologous recombination in
yeast. The resulting plasmid pMTP1 was opened by partial di-
gestion with HindIII and SalI, filled-in and reclosed to generate
pMTP2. This plasmid was linearized with enzyme BsmBI and
joined to three overlapping PCR products by homologous recom-
bination in yeast to yield pXRL2. Two of the PCR products (am-
plified from strain W303-1A genomic DNA with primer combi-
nations 5/6 and 7/8) recombined with one another to regener-
ate a 650 bp segment of the HO promoter with an AscI diges-
tion site added to the center of the element (Fig. 1). The third
PCR product (amplified from pMTP1 with primers 3 and 4) con-
Length

6725
5653
5471
6705
5581
6091
9270
5827
6046
5589

tained a replacement loxP site that lacked several redundant re-

striction sites. The remaining plasmids of the pXR series were
generated by swapping the LEU2 marker of pXRL2 with ADE2,
HIS3, TRP1, URA3, MET15 and LYS2 from other pRS vectors us-
Table 1. pXR shuttle vectors.

ing PCR products generated with primers 9 and 10 (Sikorski and

Marker

hphMX
kanMX
MET15

natMX
URA3
ADE2

LEU2

Hieter 1989; Brachmann et al. 1998; Eriksson et al. 2004). Addi-

TRP1

LYS2
HIS3

tional pXR plasmids were generated by swapping LEU2 of pXRL2

with PCR products bearing drug-resistance marker genes kanMX
from pNJ418K and hphMX from pNJ418H (gifts from Steve Brill)
using primers 10 and 11. A final pXR plasmid was generated by
pXRM15
pXRLy2

pXRhX
pXRnX
pXRH3

pXRU3
pXRA2

pXRkX

swapping the kanMX marker of pXRkX with a natMX PCR product

pXRT1
pXRL2
Name

generated from plasmid pAG25 using primers 12 and 13 (Gold-

stein and McCusker 1999). Plasmid constructs were confirmed by
 Chou et al. 3

Table 2. Oligonucleotides.

Name Sequence (5 -to-3 ) Application

1 tgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttcagctgaagcttcgtacgc Amplification of loxP-CEN6-ARSH4-loxP

2 tataggttaatgtcatgataataatggtttcttaggcataggccactagtggatctg Amplification of loxP-CEN6-ARSH4-loxP
3 ccatcattaaaagatacgaggcgcgtgtaagttacaggcaagcgatgcgagaacccttaatataacttcg New loxP
4 gtgccgcttactcgtgagaatatcaaccttatagctagtggatctgatatcacctaataacttcg New loxP
5 gctataaggttgatattctcacgag Amplification of 5 -HOp-AscI
6 ggcgcgccatccagtacaatgcgaaacgctaccgataatggcaccgtcttttg Amplification of 5 -HOp-AscI
7 tcggtagcgtttcgcattgtactggatggcgcgccttcagaaatttcacagttgatgaatc Amplification of 3 -HOp-AscI
8 ctcccggcatccgcttacagacaagctgtgaccgtctccgggagatttctttgccagtaagaactac Amplification of 3 -HOp-AscI
9 tatcacgaggccctttcgtc pRS marker swap
10 acagttgcgcagcctgaatg pRS marker swap
11 tatgcggcatcagagcagattgtactgagagtgcaccatagacatggaggcccagaatac MX marker swap
12 ccttgacagtcttgacgtgc Amplification of AgTEF2 promoter
13 cgcacttaacttcgcatctg Amplification of AgTEF2 terminator
14 gtgtagaattgcagattcccttt Confirm genomic integration at LEU2
15 gacggtcacagcttgtctgtaa Confirm integration of marker gene
16 aaccctatctcggtctattcttttg Identify multiple integrations at marker gene
17 gttcatgtgtacaatgttcattatctc Confirm genomic integration at HO
18 cagacaagctgtgaccgtct Confirm genomic integration at HO
19 attaggtgatatcagatccactagc Identify multiple integrations at HO

restriction digestion and sequencing of new junctions. The pXR
vectors and their annotated sequence files are available from
Addgene.
Plasmid YCp-NLS-mCherry(LEU2) was generated in yeast
strain GCY16 (W303–1A sir2::kanMX) by cotransformation with
AlwNI and DraIII digested pXRL2 and ScaI and NdeI digested
pBT054 (Timney et al. 2006). The sir2 strain was used on the pre-
sumption that the pseudo-diploid state, which promotes homol-
ogous recombination over end joining, would favor plasmid as-
sembly (Åström, Okamura and Rine 1999). In vivo assembly of
clones, however, should work well in most common, wild-type,
laboratory strains.
YIp-NLS-mCherry was targeted for integration at HOp in
yeast strain W303–1A by digestion with AscI. The same plas-
mid was targeted to leu2–3,112 in strain MRG5572 by di-
gestion with ClaI to generate strain MRG5604. In each case,
nine transformants were evaluated by PCR and found to con-
tain YIP-NLS-mCherry at the intended target locus. Strain
MRG5572 [MATa tS(CGA)C-BUD31::256lacop -TRP1 ADE2::HIS3p-
GFPlacI::ade2-1 leu2-3,112 lys2 (pWJ1327, CEN/URA3/NOP1-CFP)]
was derived from strains described previously (Chen and
Gartenberg 2014). The genotype of strain W303-1A is MATa ade2-
1 can1-100 his3-11, 15 leu2-3, 112 trp1-1 ura3-1.
General procedures for using pXR plasmids
Yeast were transformed with DNA by the LiOAc/DMSO method
and individual transformants were isolated on selective agar
plates (Soni, Carmichael and Murray 1993). Yeast plasmids were
harvested from overnight cultures by glass bead lysis (Hoffman
and Winston 1987) and introduced into either BNN132 or DH5α
by electroporation using less than 1 μg of yeast genomic DNA
extract/1 × 109 cfu of electrocompetent BNN132. We have found
that lowering the DNA/BNN132 ratio reduces recovery of unre-
combined material. When SwaI digestion was employed, DNA
was desalted by ethanol precipitation before electroporation.
BNN132 and DH5α transformants were grown at 37◦ C in LB me-
dia with 50 μg/ml ampicillin to select for plasmids.
Plasmid integrations in yeast were confirmed by fluorescence
microscopy and/or by PCR. For integration at leu2, primer 14,
which binds adjacent to the chromosomal LEU2 locus, was com-
bined with primer 15 that binds to a site downstream of the
marker gene in all pXR vectors. PCR with primers 15 and 16 that
bind pXR plasmids on both sides of the marker genes was used
to identify tandem integration events. For integration at HOp,
primer 17, which binds the genome upstream of the HOp homol-
ogy segment, was combined with primer 18 that binds all pXR
vectors downstream of the HOp homology segment. PCR with
primers 18 and 19 that bind the plasmid on both sides of the
HOp homology segment was used to identify tandem integration
events.
Microscopy
Two milliliter cultures were grown overnight in selective SC-leu
media with aeration and then back-diluted to 0.05–0.1 OD in
3 ml of fresh SC-leu for outgrowth to mid-log (0.4–0.6 OD). Cells
were concentrated by microcentrifugation for two minutes at
6000 rpm and resuspended in 10–20 μl of water. Two micro-
liters of cell suspension was pipetted onto 1.3% agarose plugs
on microscope slides with depression wells (Fischer 50-949-458)
and then sealed with a cover slip and nail polish (Rines et al.
2011). The agarose plugs contained SC media composed of syn-
thetic nitrogen base that has negligible autofluorescence (Sheff
and Thorn 2004). Z-stacks consisting of sequential images sep-
arated by 275 nm were collected with a Zeiss Axioplan II Flu-
orescence Microscope (100 × 1.4 NA objective). For costaining
with 4 ,6-diamidino-2-phenylindole (DAPI), cells were fixed with
formaldehyde (Chang et al. 2005) and then washed sequentially
with 70% EtOH and H2 O before resuspending in PBS buffer con-
taining 50 ng/ml DAPI. The images provided were composed
from maximum intensity projections of several sequential
layers.
 4 FEMS Yeast Research, 2015, Vol. 15, No. 3
Figure 1. pXR vectors. Details of each vector are listed in Table 1. PCR primers for confirmation of integration (small numbered arrows) are listed in Table 2 and described
in the section ‘Materials and Methods’.
Flow cytometry
Cultures were grown to mid-log in selective media supple-
mented with 40 mg/L adenine sulfate. Samples were fixed with
4% paraformaldehyde (Chang et al. 2005) before resuspending in
PBS. Flow cytometry was performed at the Rutgers EOHSI core
facility on a Beckman Coulter Gallios flow cytometer (488 nm
excitation laser, 620/30 nm emission filter) and analyzed with
Kaluza software. Data were smoothed with a 5-point moving av-
erage using Microsoft Excel.
RESULTS AND DISCUSSION
The pXR series of shuttle vectors
The centerpiece of each pXR vector is a CEN6/ARSH4 element
flanked by 34 bp loxP target sites for Cre recombinase from bac-
teriophage P1 (Sinclair and Guarente 1997). The loxP sites are ori-
ented tandemly such that reaction with Cre results in excision of
the intervening DNA. Like other CEN/ARS plasmids, members of
the pXR series propagate stably in yeast as low-copy extrachro-
mosomal elements prior to Cre-mediated recombination. They
serve as convenient backbones for plasmid manipulation by in
vivo recombination, as described below. Following recombina-
tion to remove the loxP-CEN6/ARSH4-loxP element, the plasmids
no longer replicate autonomously. However, regions of chromo-
somal homology within the plasmid permit targeted genomic
integration.
Each plasmid of the pXR series contains either a nutritional
marker from S. cerevisiae or a dominant drug selection marker
from bacteria (Fig. 1). Dominant drug selection markers offer the
advantage that they do not change the biosynthetic profile of
the recipient yeast strain (Pronk 2002). Nutritional markers, on
the other hand, provide sequence homology for integration in
appropriate auxotrophic strains. Some popular strains lack cor-
responding regions of homology to these genes. For example,
the BY474 lineage bears deletions encompassing all of LEU2 and

URA3 among other useful marker genes (Brachmann et al. 1998).
To permit integrations that do not rely on sequence homology
of a nutritional marker, a segment of the HO promoter was in-
cluded in each pXR vector. In most laboratory strain lineages, HO
is non-functional and therefore provides a generic, neutral site
for integrating foreign DNA and sequence tags (see example in
Yan et al. 2008). Linearization of the pXR vectors with AscI, which
recognizes an 8 bp site engineered within the HO promoter frag-
ment, targets integration of the vectors upstream of the HO gene
on chromosome IV.
The pXR plasmids were derived from the earlier pRS series
of shuttle vectors. Thus, they also contain a bacterial origin of
replication, a β-lactamase gene for selective growth in bacte-
ria and other features of the pBLUESCRIPT precursor (Sikorski
and Hieter 1989). A partial list of the unique restriction sites
within the multiple cloning site (MCS) of each vector is provided
in Table 1.
Cre recombinase-mediated conversion of pXR vectors
To achieve Cre-mediated recombination, we passage pXR vec-
tors through E. coli strain BNN132, which expresses Cre con-
stitutively from a lysogenized λ phage (ATTC #47059; Elledge
et al. 1991). After assembling a new pXR derivative in yeast,
we prepare DNA extracts and introduce the extracts directly
into BNN132 by electroporation. In our hands, 20% or more of
the BNN132 transformants yield pure recombined plasmids that
lack the CEN/ARS element. Typically, we screen 2–5 colonies. The
remaining transformants contain mixtures of Cre-recombined
and unrecombined plasmids, as shown below. The basis for this
mosaicism is not clear but it has been reported by others (Stew-
art and Behringer 2010). To increase recovery of pure recombined
plasmids, we digest yeast DNA extracts with SwaI, a restriction
endonuclease that cuts within the CEN/ARS segment (Fig. 1).
Cre-mediated recombination of the linearized vectors causes
recircularization of the desired DNA and elimination of the
CEN/ARS. After SwaI treatment, nearly 100% of BNN132 transfor-
mants contain pure recombined plasmids (see example below).
Application of the pXR shuttle vectors
To demonstrate the utility of pXR vectors, we describe the as-
sembly of an integrating vector that expresses mCherry fused
to the nuclear localization signal of yeast Nab2 (Timney et al.
2006). In fluorescence microscopy studies of live cells, the NLS-
mCherry chimera provides an attractive alternative to DNA
staining dyes like DAPI, which may sensitize DNA to UV damage
and work best only after cell fixation (Hayashi et al. 1998). The
NLS-mCherry expression cassette was released from its pRS-
based parent vector with restriction endonucleases that pre-
serve at least 30 bp of overlapping homology with a linearized
pXR vector (pXRL2 with the LEU2 marker). In Fig. 2, the ho-
mology domains are labeled a and b (see the section ‘Materials
and Methods’ for details). Transformation of yeast with both di-
gests yielded more colonies on SC-leu plates than transforma-
tion with either digest alone.
DNA isolated from the yeast transformants was passaged
through either the Cre-expressing BNN132 strain or the tra-
ditional bacterial cloning strain DH5α. Restriction digestion
patterns of plasmids recovered from DH5α confirmed that
the NLS-mCherry cassette was transferred to pXRL2 (Fig. 3A,
lane 2). Importantly, the digestion patterns of plasmids recov-
ered from BNN132 showed that the loxP-CEN6/ARSH4-loxP el-
ement was removed from the construct in three out of five
Chou et al. 5
transformants (lanes 3–5). The remaining transformants con-
tained mixtures of recombined and unrecombined plasmids
(lanes with mixtures are highlighted with a circled lane num-
ber). Three additional independent transformations of BNN132
yielded similar results with 40–100% of the transformants bear-
ing pure recombined product (Fig. 3B). Importantly, digesting
the yeast extracts with SwaI before BNN132 transformation in-
creased the recovery of pure recombined plasmids to 100% in
each trial. The new CEN/ARS and integrating plasmids were
named YCp-NLS-mCherry (LEU2) and YIp-NLS-mCherry (LEU2),
respectively.
YIp-NLS-mCherry (LEU2) was integrated at the HO promoter
of strain W303–1A. Microscopy of fixed cells detected a fluores-
cent mCherry signal that broadly overlapped nuclear staining by
DAPI (Fig. 4A). In the figure, spots of extra-nuclear DAPI fluores-
cence correspond to mitochondria where the DNA dye localized
but NLS-mCherry did not (Shadel and Seidel-Rogol 2007). Con-
versely, nuclear regions with NLS-mCherry but not DAPI fluo-
rescence correspond to nucleoli, where the DNA dye has been
shown to fluoresce poorly (Shaw and McKeown 2011). To vali-
date that NLS-mCherry reaches nucleoli, YIP-NLS-mCherry was
integrated at the leu2 locus of a strain that expresses the nucleo-
lar marker Nop1-CFP. Fig. 4B shows that the NLS-mCherry signal
spans regions of the nucleus that also contain Nop1-CFP.
Fluorescence microscopy of cells bearing YCp-NLS-mCherry
(LEU2), the extrachromosomal CEN/ARS variant, yielded strik-
ingly different results despite growth under selection for the
plasmid. Nuclear mCherry fluorescence intensity varied from
one cell to the next with some cells completely devoid of
the signal (Fig. 4C). Similar results were obtained with a cen-
tromeric pXR derivative bearing the URA3 selectable marker
(data not shown). Flow cytometry of the cultures confirmed
that cells with YCp-NLS-mCherry (LEU2) yielded a broad dis-
tribution of fluorescence intensities (red trace; Fig 4D). Some
cells with the CEN/ARS plasmid were brighter than cells with
the integrated plasmid whereas others displayed background
fluorescence no greater than cells that contained no plasmid.
This cell-to-cell variation is one of the central disadvantages
of using plasmid-borne expression vectors over their integrated
counterparts.
Considerations and potential caveats
We envision that the pXR vectors will benefit the yeast com-
munity by providing the convenience of in vivo recombination
when assembling vectors for targeted genomic integrations.
Typical applications might include the assembly of vectors for
the stable expression of foreign genes, vectors for expression
of endogenous genes at elevated copy number or traditional
pop-in/pop-out vectors for scar-less genome modifications. The
vectors should also be useful for assembling, confirming and
then integrating chimeric genes and mutant alleles. Addition-
ally and as shown here in Fig. 3, the pXR vectors provide a sim-
ple, ligase-free means to create integrative derivatives of cen-
tromeric plasmids that already exist in the laboratory. One lim-
itation worth noting is that ARS elements sometimes reside
within cloned yeast DNA (there are over 400 in the S. cerevisiae
genome), as well as in DNA from other organisms (Siow et al.
2012; Liachko and Dunham 2014). Addition of these DNAs to pXR
vectors will support autonomous plasmid replication even in the
absence of a formal CEN/ARS element.
We have maintained recombined plasmids in BNN132 as
frozen glycerol stocks for several months. We know of no
reason why longer-term storage in this strain would be problem-
 6 FEMS Yeast Research, 2015, Vol. 15, No. 3

Figure 2. Flow chart for using pXR vectors. (Step 1) Transformation of yeast with a linearized pXR vector and one or more DNA fragments that contain domains of
overlapping homology of at least 30 bp (labeled as a and b). Homologous recombination within yeast joins the fragments to form a hybrid plasmid. (Step 2) Preparation of
yeast DNA extracts by glass bead lysis and recovery of the assembled plasmids in a bacterial strain that expresses Cre constitutively by electroporation. Cre reduces the
loxP-CEN6/ARSH4-loxP module to a single loxP site. Optional step: digestion of yeast extracts with SwaI before transformation of Cre-expressing bacteria increases the
recovery of pure recombined plasmids. (Step 3) Linearization of the resulting plasmid within regions bearing genomic homology promotes integration by homologous
recombination. Targeting depends on where the double strand break is created. In this figure, breaks were created in either the HOp segment or the marker gene.
 Chou et al. 7

Figure 3. Cre recombination of pXR derivatives in bacterial strain BNN132. (A) YCp-NLS-mCherry (LEU2) was generated from pXRL2 by in vivo recombination in yeast.
After passaging through bacteria, isolated DNA was cut with XbaI. rec = YIp-NLS-mCherry (LEU2); unrec = YCp-NLS-mCherry (LEU2). Lane 1—pXRL2 isolated from
DH5α; Lane 2—YCp-NLS-mCherry (LEU2) isolated from DH5α; Lane 3 through 7—Plasmid DNA isolated from BNN132 after transformation with yeast extracts bearing
YCp-NLS-mCherry. Circled lane numbers correspond to isolates bearing mixtures of both YIp-NLS-mCherry (LEU2) and YCp-NLS-mCherry (LEU2). The 8 and 3 kb
bands of an NEB 1 kb ladder are marked with single and double asterisks, respectively. (B) Three additional trials of BNN132 transformation with yeast extract bearing
YCp-NLS-mCherry. Pre-digestion of extract with SwaI was compared to no pre-digestion.

atic. In practice, it is often desirable to obtain both the integrative
version of a pXR vector, as well as the unrecombined pXR pro-
genitor. Therefore, we typically recover a newly assembled vec-
tor from yeast with a traditional bacterial strain that lacks Cre,
like DH5α, in addition to BNN132. Since individual yeast trans-
formants can contain more than one plasmid species (Scanlon,
Gray and Griswold 2009), care must be exercised when using
parallel bacterial transformations to recover such related pXR
derivatives.
In our experience, off target events do not typically occur
when using AscI linearization to direct integration of pXR vec-
tors at HOp. In the event that a cloned insert contains an ad-
ditional 8 bp AscI recognition sequence, partial digestion with
the enzyme would be required. Note that the HOp element of
pXR vectors is situated within a common pRS backbone. Prior
genomic modifications with pRS vectors or other pBLUESCRIPT
vectors thus provide decoy target sites for integration. Confir-
mation of clones by PCR with appropriate primers distinguishes
integration at intended sites from integration elsewhere (see the
section ‘Materials and Methods’).
ACKNOWLEDGEMENTS
We thank Leonard Guarente, Mike Rout, David Stillman
and Steve Brill for reagents and Derek Chen for technical
assistance.
FUNDING
This work was funded by the National Institutes of Health
(GM51402 to MRG) and a summer fellowship from the New Jersey
Commission on Cancer Research to MTP.
Conflict of interest. None declared.
 8 FEMS Yeast Research, 2015, Vol. 15, No. 3

Figure 4. Comparison of integrated and extrachromosomal pXR vectors bearing the NLS-mCherry expression cassette. (A) Strain W303–1A with integrated YIp-NLS-
mCherry (LEU2) after fixation and staining with DAPI. (B) Live cell images of strain MRG5604 with integrated YIp-NLS-mCherry and a plasmid expressing Nop1-CFP.
(C) Strain W303–1A bearing YCp-NLS-mCherry (LEU2) after fixation and staining with DAPI. (D) Flow cytometry of strain W303–1A bearing YCp-NLS-mCherry (LEU2)
or YIp-NLS-mCherry (LEU2) integrated at HOp after growth in SC-leu. W303–1A without an NLS-mCherry vector was included as a negative control after growth in SC
media.

REFERENCES Kuijpers NG, Chroumpi S, Vos T, et al. One-step assembly and tar-
geted integration of multigene constructs assisted by the I-
Åström SU, Okamura SM, Rine J. Yeast cell-type regulation of
SceI meganuclease in Saccharomyces cerevisiae. FEMS Yeast Res
DNA repair. Nature 1999;397:310.
2013;13:769–81.
Brachmann CB, Davies A, Cost GJ, et al. Designer deletion strains
Liachko I, Dunham MJ. An autonomously replicating sequence
derived from Saccharomyces cerevisiae S288C: a useful set of
for use in a wide range of budding yeasts. FEMS Yeast Res
strains and plasmids for PCR-mediated gene disruption and
2014;14:364–7.
other applications. Yeast 1998;14:115–32.
Ma H, Kunes S, Schatz PJ, et al. Plasmid construction by homolo-
Chang CR, Wu CS, Hom Y, et al. Targeting of cohesin by transcrip-
gous recombination in yeast. Gene 1987;58:201–16.
tionally silent chromatin. Gene Dev 2005;19:3031–42.
Murray AW, Szostak JW. Pedigree analysis of plasmid segrega-
Chen M, Gartenberg MR. Coordination of tRNA transcription
tion in yeast. Cell 1983;34:961–70.
with export at nuclear pore complexes in budding yeast. Gene
Oldenburg KR, Vo KT, Michaelis S, et al. Recombination-mediated
Dev 2014;28:959–70.
PCR-directed plasmid construction in vivo in yeast. Nucleic
Elledge SJ, Mulligan JT, Ramer SW, et al. λYES: a multifunctional
Acids Res 1997;25:451–2.
cDNA expression vector for the isolation of genes by comple-
Pronk JT. Auxotrophic yeast strains in fundamental and applied
mentation of yeast and E. coli mutations. P Natl Acad Sci USA
research. Appl Environ Microb 2002;68:2095–100.
1991;88:1731–5.
Rines DR, Thomann D, Dorn JF, et al. Live cell imaging of yeast.
Eriksson P, Thomas LR, Thorburn A, et al. pRS yeast vectors with
Cold Spring Harb Protoc 2011;2011, doi:10.1101/pdb.top065482.
a LYS2 marker. Biotechniques 2004;36:212–3.
Scanlon TC, Gray EC, Griswold KE. Quantifying and resolving
Goldstein AL, McCusker JH. Three new dominant drug resistance
multiple vector transformants in S. cerevisiae plasmid li-
cassettes for gene disruption in Saccharomyces cerevisiae. Yeast
braries. BMC Biotechnol 2009;9:95.
1999;15:1541–53.
Shadel GS, Seidel-Rogol BL. Diagnostic assays for defects in
Hayashi A, Ogawa H, Kohno K, et al. Meiotic behavior of chromo-
mtDNA replication and transcription in yeast and humans.
somes and microtubules in budding yeast: relocalization of
Method Cell Biol 2007;80:465–79.
centromeres and telomeres during meiotic prophase. Genes
Shaw PJ, McKeown PC. The structure of rDNA chromatin.
Cells 1998;3:587–601.
In: Olson M (ed). The Nucleolus. New York: Springer, 2011,
Hoffman CS, Winston F. A ten-minute DNA preparation from
43–56.
yeast efficiently releases autonomous plasmids for transfor-
Sheff MA, Thorn KS. Optimized cassettes for fluorescent protein
mation of Escherichia coli. Gene 1987;57:267–72.
tagging in Saccharomyces cerevisiae. Yeast 2004;21:661–70.

Sikorski RS, Hieter P. A system of shuttle vectors and yeast host
strains designed for efficient manipulation of DNA in Saccha-
romyces cerevisiae. Genetics 1989;122:19–27.
Sinclair DA, Guarente L. Extrachromosomal rDNA circles: a cause
of aging in yeast. Cell 1997;7:1033–42.
Siow CC, Nieduszynska SR, Muller CA, et al. OriDB, the DNA repli-
cation origin database updated and extended. Nucleic Acids
Res 2012;40:D682–6.
Soni R, Carmichael JP, Murray JA. Parameters affecting lithium
acetate-mediated transformation of Saccharomyces cerevisiae
and development of a rapid and simplified procedure. Curr
Genet 1993;24:455–9.
Chou et al. 9
Stewart MD, Behringer RR. Confirmation of recombina-
tion site functionality in gene targeting vectors using
recombinase-expressing bacteria. Method Enzymol 2010;477:
145–51.
Timney BL, Tetenbaum-Novatt J, Agate DS, et al. Simple
kinetic relationships and non-specific competition gov-
ern nuclear import rates in vivo. J Cell Biol 2006;175:
579–93.
Yan Z, Costanzo M, Heisler LE, et al. Yeast barcoders: a
chemogenomic application of a universal donor-strain col-
lection carrying bar-code identifiers. Nat Methods 2008;5:
719–25.