Aquaculture 501 (2019) 416–429

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Glucose and lipid metabolic adaptations during postprandial starvation of T

Japanese flounder Paralichthys olivaceus previously fed different levels of
dietary carbohydrates
Mengxi Yanga, Kangyu Denga, Mingzhu Pana, Zhixiang Gua, Dong Liua, Yue Zhanga,
⁎
Wenbing Zhanga,b, , Kangsen Maia,b
a
The Key Laboratory of Aquaculture Nutrition and Feeds (Ministry of Agriculture), The Key Laboratory of Mariculture (Ministry of Education), Ocean University of China,
Qingdao 266003, China
b
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Wen Hai Road, Qingdao
266237, China

A R T I C LE I N FO A B S T R A C T

Keywords: Exogenous glucose loading is generally used to assess the capacity of glucose utilization in carnivorous fish.
Japanese flounder Examining the use of endogenous glucose during fasting provides a new perspective on assessing glucose me-
Glucose tabolism in fish. Japanese flounder Paralichthys olivaceus, a marine carnivorous fish species, were starved for 3, 9,
Lipid 24, 48 h, and 3, 7, 14, 21, 28 days, respectively, after a 10-week feeding trial with 12% (C12: 49.49% crude
Postprandial starvation
protein, 9.65% crude lipid and gross energy of 18.98 kJ g−1) and 20% (C20: 49.99% crude protein, 9.75% crude
Metabolism
lipid and gross energy of 19.11 kJ g−1) of dietary carbohydrates (alpha-starch and corn starch). After feeding
trial, fish fed different diets showed similar specific growth rate (3.62 vs 3.61) (P > .05). During starvation
period, compared with 3 h, plasma glucose and insulin concentration increased at 9 h in both groups. A similar
trend was found for the glycogen content and the mRNA levels of genes involved in glycolysis and pentose
phosphate pathway in liver. And the gluconeogenic genes mRNA levels significantly increased since 9 h in C12
and 24 h in C20 (P < .05). Subsequently, liver glycogen in C12 fell significantly on the 3 d compared with 48 h
and was depleted on the 7 d (P < .05). It significantly decreased on the 7 d compared with 3 d and was
minimized on the 14 d in C20 (P < .05). Plasma glucose peaked at 48 h and 7 d in both groups. As for lipid
metabolism, high levels of plasma triglyceride, cholesterol concentration and lipogenetic genes mRNA levels
were observed within 9 h. Compared with 3 h, liver lipid significantly decreased on the 14 d in both groups
(P < .05). The mRNA levels of genes related to beta-oxidation and ketogenesis was enhanced in later stages in
both groups. In addition, in C20, greater changes of mRNA levels of genes involved in gluconeogenesis and
lipolysis in liver were observed. It was concluded that primary substrate of energy sources switched from gly-
cogen to lipid occurring on the 3 d-7 d in C12 and 7 d-14 d in C20. Besides, high dietary carbohydrate (C20)
feeding activated greater gluconeogenesis and lipolysis during starvation. These observations demonstrated
glucose and lipid metabolic responses of Japanese flounder during starvation were influenced by previous
feeding with different levels of dietary carbohydrates.

1. Introduction
Glucose plays a key role as energy and carbon source. Herbivorous
and omnivorous fish tend to be more efficient in glucose utilization
compared to carnivorous species (Hemre et al., 2002; Jobling, 2012).
Feeding fish with different levels of dietary carbohydrates had been
primarily studied and provided many literatures in cultured species
(Hemre et al., 2002; Wilson, 1994; Panserat, 2009; Nie et al., 2015).
Until now, the physiological basis of such apparent glucose intolerance
in carnivorous fish has not been fully understood. Previous studies were
based essentially on the way of loading exogenous glucose, proving that
fish had limited abilities in glucose utilization when nutrients (espe-
cially protein and lipid) were sufficient (Enes et al., 2011; Plisetskaya
and Mommsen, 1996). It is assumed that carnivorous fish have an

⁎
Corresponding author at: The Key Laboratory of Aquaculture Nutrition and Feeds (Ministry of Agriculture), The Key Laboratory of Mariculture (Ministry of
Education), Ocean University of China, Qingdao 266003, China.
E-mail address: wzhang@ouc.edu.cn (W. Zhang).

https://doi.org/10.1016/j.aquaculture.2018.12.003
Received 6 July 2018; Received in revised form 29 November 2018; Accepted 2 December 2018
Available online 03 December 2018
0044-8486/ © 2018 Published by Elsevier B.V.
M. Yang et al. Aquaculture 501 (2019) 416–429

intense desire and possess potential flexibilities in glucose utilization
for their demands in the absence of energy sources, such as lipid and
protein. From this perspective, special attention is given to the glucose
metabolism without feed intake, which helps to understand the utili-
zation of glucose in fish comprehensively. These understandings could
help to formulate fish feeds with more carbohydrates. Compared with
those with high level of fish meal and fish oil, feeds with relatively
higher level of carbohydrates are relatively low cost for increasing
protein and lipid retention and can reduce nitrogen load in the farm
discharge, which imply major economic and environmental implica-
tions.
Postprandial period is a stage involved in the processing of a meal,
which is most studied as the physiological response of nutrients in-
gestion (McCue, 2006; Secor, 2009). Starvation represents an extreme
condition without food that many fish species undergo and tolerate
both naturally and artificially (Hinch et al., 2005; Miller et al., 2009;
Navarro and Gutiérrez, 1995). Effects of starvation on growth, beha-
vior, biochemical compositions, plasma performances, metabolic phy-
siology and compensatory growth of fish were investigated (Bar and
Volkoff, 2012; Morshedi et al., 2013; Yarmohammadi et al., 2012).
However, emphasis of these works had been laid on the ecological
strategies and provided guidance for fishery resources management. To
survive in these conditions, fish reduced energy expenditures (Salem
et al., 2007) and mobilized endogenous reserves (Furné et al., 2012;
Navarro and Gutiérrez, 1995) to maintain vital processes. Diverse me-
chanisms of metabolic regulation reflect various levels of carbohydrate
utilization capacities (Leandro et al., 2014; Rito et al., 2018). Up to
now, there are few reports on the metabolic processes for the purpose of
understanding the glucose metabolism in fish during postprandial
starvation.
A close link between glucose and lipid metabolism is indicated by
their convert mechanisms and roles on energy supply. Exogenous glu-
cose provides nicotinamide adenine dinucleotide phosphate, or carbon
backbones for lipogenesis that stored as lipid in vertebrates (Hellerstein
et al., 1996), which has also been proved to exist in fish (Sargent et al.,
2002; Amirkolaie et al., 2006; Hemre et al., 2002). Moreover, glucose
and lipid flux into and out of the Krebs cycle, which heavily regulated
by related enzymes, such as G6PDH (glucose-6-phosphate dehy-
drogenase) (Lin et al., 1977), and hormones like insulin and glucagon
been fed with different levels of dietary carbohydrates, are not well
known.
Japanese flounder (Paralichthys olivaceus) is a kind of economically
important, marine carnivorous fish species. There are some studies fo-
cusing on the effects of starvation on growth, morphology, hematolo-
gical, body compositions and cell ultrastructure in this species (Cho,
2009; Hur et al., 2006; Kim et al., 2014; Park et al., 2007; Shim et al.,
2012). In present study, Japanese flounder were fed two diets with 12%
and 20% of carbohydrates, respectively, for 10 weeks. After that, they
were fasted for 28 days. During the 28-day starvation, time course of
changes in biochemical compositions, plasma parameters including
hormones, and gene mRNA levels of the key enzymes involved in glu-
cose and lipid metabolism in liver were evaluated. The present study
had two aims. The first was to investigate metabolic changes with the
postprandial starvation time prolonged, and find the key time point of
switching from glucose to lipid metabolism to provide main energy. The
second was to understand how the glucose and lipid metabolic reg-
ulation can be affected by previous feeding with different levels of
dietary carbohydrates.
2. Materials and methods
2.1. Experimental diets
Ingredients and proximate compositions of two isonitrogenous and
isolipidic experimental diets are given in Table 1. The experimental
diets were formulated with 12% and 20% levels of dietary carbohy-
drates, respectively (C12 and C20, respectively). All ingredients were
ground through an 80 mesh sieve mesh, well mixed, and dry extruded
in a laboratory pellet mill (EL220, Shandong Haiyang, China). The
diameters of the diets were 3 mm and 5 mm. The diets were dried in a
forced air oven at 50 °C for 8 h and stored in a refrigerator (−20 °C)
until used.
Table 1
Formulations and proximate chemical compositions of diets.
Ingredients (%) Diets

(Jones, 2016). Meanwhile, lipids are energy sources for bodily meta- C12 C20
bolic activities and maintain overall homoeostasis of fish (Liao et al.,
2017). There was plenty of evidence that fatty acids could inhibit Fish meal 57 57
glucose uptake, glucose oxidation and glycogen synthesis, and enhance Wheat gluten 13 13
Alpha-starch 5 5
gluconeogenesis (Randle, 1998). Thereby, it's essential to note lipid Corn starch 5.7 13.7
metabolism which can provide references for glucose metabolism in Soybean lecithin 1 1
fish. Fish oil 3.5 3.5
Metabolic responses to postprandial starvation were directly re- Choline chloride 0.4 0.4
Ethoxyquin 0.05 0.05
levant to food deprivation length (Navarro and Gutiérrez, 1995). The
Mold inhibitor 0.1 0.1
literatures that evaluated the dynamic metabolic changes adapting to Monocalcium phosphate 0.5 0.5
fed-to-starvation transition in fish were scarce. Previous studies showed Vitamin premixa 0.6 0.6
that different levels of dietary carbohydrates had influence on the Mineral premixb 0.5 0.5
glucose and lipid metabolism in fish. For instance, the mRNA levels of Carboxymethyl cellulose 12.65 4.65

hepatic glycolytic genes were found to increase proportionately with Proximate analysis
dietary starch contents in rainbow trout (Oncorhynchus mykiss), sea bass Dry matter (DM), % diet 97.02 97.14
Crude protein, % DM 49.49 49.99
(Dicentrarchus labrax) and turbot (Scophthalmus maximus) (Capilla et al.,
Crude lipid, % DM 9.65 9.75
2003; Enes et al., 2006; Nie et al., 2015). In several fish species, dietary Reducing sugar, % DM 11.06 19.96
carbohydrate intake induced lipogenesis through lipid deposition and Ash, % DM 11.72 11.93
elevated activities of lipogenic enzymes (Brauge et al., 1995; Dias et al., Gross energy (GE), kJ g−1 18.98 19.11
2004). Nevertheless, inclusion beyond tolerable limits caused post- a
Vitamin premix (g kg−1 of mixture): microcrystalline cellulose, 16.473; VA,
prandial hyperglycemia and changes in intermediary metabolism
0.032; VB1, 0.025; VB2, 0.045; VB6, 0.02; VB12, 0.01; VD, 0.035; VE, 0.24; VK,
(Amoah et al., 2008; Kaushik, 2001), as a result, poor utilization of
0.01; calcium pantothenate, 0.06; nicotinic acid, 0.; folic acid, 0.02; biotin,
glucose. In addition, metabolic changes during starvation period are 0.06; inositol, 0.8; VC phosphate, 2.
likely to be dependent upon previous feeding, as in tilapia (Oreochromis b
Mineral premix (g kg−1 of mixture): MgSO4•7H2O, 1.2; CuSO4•5H2O, 0.01;
niloticus × O. aureus) and Siberian sturgeon (Acipenser baerii) (Hsieh FeSO4•H2O, 0.08; ZnSO4•H2O, 0.05; MnSO4•H2O, 1.2; CuSO4•5H2O, 0.01;
and Shiau, 2000; Liang et al., 2017). However, glucose and lipid me- FeSO4•H2O, 0.08; ZnSO4•H2O, 0.045; CoCl2•6H2O (1%), 0.050 Na2SeO3 (1%),
tabolic responses during postprandial starvation in fish which have 0.02; calcium iodate, 0.06; zeolite powder, 8.485.

417
M. Yang et al. Aquaculture 501 (2019) 416–429

2.2. Animals and feeding trial Standards or samples were added to the appropriate microtiter plate
wells with Biotin-conjugated INS. After being washed, avidin con-
The feeding trial was conducted at Haiyang, Shandong Province, jugated Horseradish Peroxidase (HRP) was added to the wells.
China. Japanese flounder (Paralichthys olivaceus) were obtained from a Substrate solution was added to the wells and the color developed in
commercial hatchery. Prior to the feeding trial, fish were fed a com- opposite to the amount of INS in the sample. Color development was
mercial diet (Great Seven Bio-Tech, Qingdao, China) for two weeks to stopped and the intensity of the color was measured. All these kits were
acclimate to the experimental conditions. At the start of the feeding developed using antigenic regions completely conserved in fish.
trial, fish were fasted for 24 h and weighed. Fish in similar sizes (initial
body weight: 7.15 ± 0.20 g) were randomly distributed into 12 tanks. 2.6. Identification of targeted genes
Six tanks were used for one treatment (80 fish /tank). The feeding trial
was conducted in a flow-through water system supplied with sand fil- Targeted genes involved in glucose metabolism included glycogenic
tered seawater at a flow rate of 2.5 l min−1. Fish were hand-fed to glycogen synthase (gys2), glycogenolytic glycogen phosphorylase (pygl:
apparent satiation twice daily at 8:00 and 18:00 for 10 weeks. liver type), glycolytic glucokinase (gck) and phosphofructokinase (pfkl:
Throughout the feeding trial, water temperature naturally ranged from liver type), gluconeogenic phosphoenolpyruvate carboxykinase (pck1:
21 °C to 24 °C. The dissolved oxygen concentration was approximately cytoplasmic type), fructose-1, 6-bisphosphatase (fbp2: liver type) and
7.4 mg l−1. The photoperiod was maintained at intervals of 13-h light: glucose-6-phosphatase catalytic subunit (g6pc), glucose-6-phosphate-1-
11-h dark. dehydrogenase (g6pdh) in pentose phosphate pathway (PPP). Targeted
gene relating to citric acid cycle was citrate synthase (cs). Targeted
2.3. Sampling genes involved in lipid metabolism included lipogenetic acetyl-CoA
carboxylase alpha (acaca), lipolytic lipoprotein lipase (lpl) and glycerol
At the end of the feeding trial, fish were fasted for 24 h. Fish in each kinase (gk), fatty acid β-oxidative carnitine O-palmitoyltransferase 1A
tank were weighed. Before sampling, fish were anaesthetized with MS- (cpt1a) and hydroxyacyl-CoA dehydrogenase (hadh), Targeted gene
222 (Sigma, 50 mg l−1 water) and sacrificed by a sharp blow to the relating to ketogenesis was 3-hydroxybutyrate dehydrogenase 2 (bdh2).
head. Three fish per tank were randomly sampled and stored at −80 °C
for the whole body proximate analysis. The remaining fish were re-fed 2.7. Real-time PCR analysis
to satiation for 3 days to recover. After the last meal, Japanese flounder
finished feeding within half an hour and residuals were removed. Fish Total RNA from 0.1 g of liver tissue was extracted with Trizol
were deprived of food for 28 d (No died fish during this period). During Reagent (Invitrogen, USA). Its quantity and purity were determined by
the 28-day starvation, fish were sampled at 3 h, 9 h, 24 h, 48 h, 3 d, 7 d, spectrophotometry. The 260: 280 ratios were 1.8–2.0. Hepatic com-
14 d, 21 d and 28 d, respectively. At each time point, after being plementary DNA (cDNA) was obtained from 1 mg of total RNA using
weighed, three fish per tank were sampled and stored at −80 °C for the PrimeScript® RT reagent Kit with gDNA Eraser (Takara, Japan).
whole body proximate analysis. Another three fish were collected blood Real-time PCR was performed with an ABI 7500 instrument
from caudal vertebra vein with heparinized sterile syringes. Prior to (Applied Biosystems) using SYBR Green PCR (Takara). The primers
blood sampling and dissection, body weight (g) was recorded for each used are shown in Table 2 for detecting the mRNA levels of target genes
individual. Then, plasma was separated and stored at −80 °C until in liver. The Reaction mixtures (SYBR® Premix Ex Taq™ II (2×) 10.0 μl,
analysis. The liver and muscle were sampled, immediately frozen in Forward Primer (10 μM) 0.8 μl, Reverse Prime (10 μM) 0.8 μl, DNA
liquid nitrogen, and then transferred to −80 °C for subsequently ana- template 2.0 μl and ddH2O 6.4 μl) were programmed for 30 s at 95 °C,
lysis. All procedures performed strictly according to the recommenda- followed by 40 cycles of 5 s at 95 °C, 30 s at 58 °C, 30 s at 72 °C, and
tions in the Guide for the Use of Experimental Animals of Ocean finally 15 s at 95 °C, 1 min at 60 °C and 15 s at 95 °C. For each mRNA,
University of China. The protocols for animal care and handing used in gene mRNA levels were corrected by β-actin in each sample. The data
this study were approved by the Institutional Animal Care and Use were analyzed by the ΔΔCt method. The mRNA levels of target genes at
Committee of Ocean University of China. other sampling time points were normalized to that at 3 h. The primers
used are shown in Table 2.
2.4. Proximate analysis of diets and tissues
2.8. Calculations and statistical analyses
The experimental diets and whole fish were analyzed for crude
protein, crude lipid, moisture and ash using standard methods (AOAC, The following parameters were calculated as:
1995). Reducing sugars in diets was analyzed by the 3, 5-dinitro sal-
icylic acid method (Yu et al., 1997). Glycogen, lipid and moisture were Table 2
measured in liver and muscle. Glycogen content was carried out by List of the primers used for the real-time PCR analysis.
spectrophotometric assay using commercial kits from Jiancheng Genes 5′/3′ Forward primer 5′/3′ Reverse primer
Bioengineering Institute, Nanjing, China (Liver/Muscle glycogen assay
kit, A043). Lipid content was measured by chloroform-methanol gys2 AGCAACGGTGTTCACGAC TCACATTCAGCCCATTCG
method (Folch-Pi, 1957). pygl CCAAAGCTCCTTTCGTAC CAGATTGTTTCCCACCAG
gck TCCTGTCATCCCTGGGTGTT CTGCGTCGCTCCCTCATT
pfkl TTGTAATCGGAGGGTTCG ATTGTTGCTGATGGTGGC
2.5. Plasma biochemical parameters pck1 ACCAGGGACCAGAAGGACA TGGCGACCACGTAGGGAGA
fbp2 GGTTTGTTCTGGAGGAGGG GGTCATTGGACAGGATGTC
The concentration of plasma glucose, triglyceride (TG), total cho- g6pc TACCCCGTGACCTGTGAGAC TTGGTGGATTTCTTGCTTCC
g6pdh CACTACCTGGGCAAAGAG GTCATCAAAGTATCCTCCAC
lesterol (TC) and free fatty acid (FFA) were analyzed by the automatic
cs CTGAGGGCGTCCACAAGA CGATGGCTCCGATACTGC
biochemical analyzer (AU5400, Beckman). Plasma insulin, glucagon acaca ACGGCGGACACGTCTTCT GCACTCTGCTCGGGTCAT
and leptin concentration were determined using a double antibody lpl TAATGTGATTGTGGTGGACTG TGTAACCCAGCAGGTGAAT
sandwich enzyme-linked immunosorbent assay. Kits were purchased gk GACAATCTCGGAATCATCG GAAGTAGCAACCGTAGGAAG
from Cusabio, China. Plasma insulin was assayed by fish insulin ELISA cpt1a TGCTCTACAGGAGGAAACT TGTGCTGGAGGATGTCTG
hadh ATACACCAGGGTTCATTG CTTGTTCAGCAGCTCACT
kit (catalog Num. CSB-E12123Fh). The assay employs the competitive
bdh2 GGTGGTGGATGTGACGAA TCAAGATGGAGCCGTGGT
inhibition enzyme immunoassay technique. The microtiter plate pro- β-actin GGAAATCGTGCGTGACATTAAG CCTCTGGACAACGGAACCTCT
vided in this kit was pre-coated with an antibody specific to INS.

418
M. Yang et al. Aquaculture 501 (2019) 416–429

Table 3
Survival and growth performance of Japanese flounder after feeding trial.
Diets Initial weight (g) Final weight (g) SR (%) FER PER SGR (% /d) FI

C12 7.15 ± 0.03 90.33 ± 1.32 93.33 ± 0.67 1.41 ± 0.02 2.64 ± 0.02 3.62 ± 0.06 1.86 ± 0.07
C20 7.15 ± 0.04 89.98 ± 1.38 95.11 ± 1.74 1.39 ± 0.03 2.61 ± 0.04 3.61 ± 0.06 1.77 ± 0.07

All data were expressed as mean ± SE, n = 6. Significant differences between C12 and C20 are indicated by asterisks (*P < .05; t-test). SR: Survival rate; FER: Feed
efficiency ratio; PER: Protein efficiency ratio; SGR: Specific growth rate; FI: Feed intake.

Table 4
Whole body compositions of Japanese flounder after 10-week feeding trial and 28d of starvation (% wet weight).
Treatments Crude protein Crude lipid Ash Moisture

C12 After feeding trial 17.83 ± 0.09a 3.67 ± 0.12a,B 3.45 ± 0.05b 74.89 ± 0.06b
After starvation 17.42 ± 0.03b,A 2.28 ± 0.09b 3.87 ± 0.06a 75.92 ± 0.12a
C20 After feeding trial 17.76 ± 0.12a 4.26 ± 0.09a,A 3.53 ± 0.04b 74.24 ± 0.26b
After starvation 17.05 ± 0.02b,B 2.42 ± 0.07b 3.80 ± 0.06a 76.36 ± 0.24a

Two-way ANOVA
T 0.000 0.000 0.000 0.000
C 0.008 0.003 0.894 0.584
T×C 0.046 0.040 0.193 0.019

All data were expressed as mean ± SE, n = 6. Means in the same column with different upper and lower case letters indicate significant differences (P < .05)
between the two diets and two time points, respectively. Means with no letters are not significantly different (P > .05). T: time points; C: diets; T × C: interaction
between time and diets.

Survival rate (SR, %) = 100 × final amount of fish/initial amount of
fish
Feed efficiency ratio (FER) = wet weight gain (g)/dry feed fed (g)
Protein efficiency ratio (PER) = wet weight gain (g)/crude protein
intake (g)
Specific growth rate (SGR, % day−1) = 100 × (ln final body weight
- ln initial body weight)/days
Feed intake (FI, % day−1) = 100 × dry feed intake (g) / [(initial
body weight + final body weight)/2] / days
All data were presented as means ± standard error and analyzed
using the software SPSS 21.0. The growth parameters after the feeding
trial were analyzed using Student t-test. For biochemical compositions,
plasma parameters, the effects of time and diets and their interactions
during the starvation were analyzed by two-way ANOVA. Tukey's
multiple range tests were used to examine treatment differences among
the interactions. When a significant effect was found within a factor,
one-way ANOVA and Turkey's multiple range tests or Student t-test was
carried out. For the mRNA levels of genes, one-way ANOVA and
Turkey's multiple range tests was carried out among sampling times
within a diet. No analysis was made between diets because of their
different normalized control. In case unequal variance was determined
by Levene's test, the data were square root-transformed before statis-
tical analysis. Differences were regarded as significant when P < .05.
3. Results
What's more, starvation resulted in sharply decrease in crude protein
and lipid in both groups (P < .05). And ash and moisture content in-
creased significantly at the end of starvation compared with that after
feeding trial (P < .05).
3.3. Biochemical compositions during the starvation
3.3.1. Liver
As shown in Fig. 1A, compared with 3 h (66.16 mg/g), liver gly-
cogen in C12 group increased significantly and reached the highest
value of 136.66 mg/g at 48 h after feeding (P < .05). It returned to the
basal level on the 3 d and then was depleted after 7 d (P < .05). In C20
group, liver glycogen increased significantly at 48 h (P < .05) and
reached the maximum of 173.89 mg/g on the 3 d (P < .05). On the 7 d
after feeding, it sharply decreased and was minimized on the 14 d
(P < .05). Within the 7 days of starvation, liver glycogen in C20 group
was higher than that in C12 group (P < .05).
Liver lipid in both groups had been increasing and reached the
maximum on the 14 d (P < .05) (Fig. 1B). It declined sharply after that
and resulted in 44.69% and 44.15% decrease in C12 and C20, respec-
tively (P < .05). Moreover, fish in C20 group showed higher liver lipid
content than that in C12 group during postprandial starvation period.
Liver moisture had been increasing with the increase of starvation
time (Fig. 1C). It rose significantly on the 3 d (P < .05) and reached the
maximum on the 21 d in C12 group. In C20 group, it trended to increase
and reached the highest value on the 21 d (P > .05).

3.1. Survival and growth after the feeding trial
Survival and growth performance are shown in Table 3. After the
10-week feeding trial, no significant difference was observed in final
weight, SR, FER, PER, SGR and FI between the two groups (C12 and
C20) (P > .05).
3.2. Body compositions after feeding trial and starvation
As shown in Table 4, after the feeding trial, fish in C20 showed
higher level of crude lipid content than that in C12 (P < .05). There
was no significant difference in crude protein, ash and moisture be-
tween the two groups (P > .05). After 28 d of starvation, crude protein
content in C20 was significantly lower than that in C12 (P < .05).
3.3.2. Muscle
In muscle, all parameters are presented in Fig. 2. Glycogen content
in C12 group kept declining with the starvation time prolonged
(Fig. 2A). It fell sharply compared with 3 h and reached the value of
0.1506 mg/g on the 3 d (P < .05), with the level remaining low for the
rest of starvation period (P > .05). Compared with 3 h (0.4935 mg/g),
in C20 group, it increased significantly and reached maximum value of
0.7622 mg/g at 48 h (P < .05). Then it fell to the value of 0.5706 mg/g
on the 3 d (P < .05) and maintained stable after that (P > .05). Be-
sides, fish in C20 showed higher muscle glycogen content than that in
C12 during postprandial starvation period.
Lipid content in both groups remained relatively stable within 48 h
(P > .05) (Fig. 2B). It reached the peak on the 3 d (P < .05), and then
fell drastically until 28 d (P < .05). In C20 group, lipid in muscle

419
M. Yang et al.
Fig. 1. Contents of glycogen (A), lipid (B) and moisture (C) in liver of Japanese
flounder during postprandial starvation period. All data were expressed as
mean ± SE, n = 6 (3 fish/replicate). Lower case letters represent significant
difference among sampling times within C12 diet, while upper case letters
denote the significant difference among sampling times within C20 diet
(P < .05). Asterisks (*) denote a significant difference between C12 and C20
diet at a same sampling time point (P < .05). T: time points; C: diets; T × C:
interaction between time and diets.
showed higher content before 7 d and lower content after 7 d than that
in C12 group. On the 28 d, there is no difference in lipid content be-
tween the two groups (P > .05).
Muscle moisture remained relatively stable within 21 d in both
groups (Fig. 2C). On the 28 d, it increased significantly and reached the
highest value of 76.80% in C12 group and 76.93% in C20 group
(P < .05).
420
Aquaculture 501 (2019) 416–429
Fig. 2. Contents of glycogen (A), lipid (B) and moisture (C) in muscle of
Japanese flounder during postprandial starvation period. All data were ex-
pressed as mean ± SE, n = 6 (3 fish/replicate). Lower case letters represent
significant difference among sampling times within C12 diet, while upper case
letters denote the significant difference among sampling times within C20 diet
(P < .05). Asterisks (*) denote a significant difference between C12 and C20
diet at a same sampling time point (P < .05). T: time points; C: diets; T × C:
interaction between time and diets.
3.3.3. Whole fish
Comparing with 3 h, crude protein content of whole fish sig-
nificantly decreased at the end of starvation in C12 (Fig. 3) (P < .05).
In C20 group, crude protein content tended to decrease after 28 d of
starvation (P > .05).
M. Yang et al.
Fig. 3. Content of crude protein of whole fish during postprandial starvation
period. All data were expressed as mean ± SE, n = 6 (3 fish/replicate). Lower
case letters represent significant difference among sampling times within C12
diet, while upper case letters denote the significant difference among sampling
times within C20 diet (P < .05). Asterisks (*) denote a significant difference
between C12 and C20 diet at a same sampling time point (P < .05). T: time
points; C: diets; T × C: interaction between time and diets.
3.4. Plasma parameters during the starvation
As showed in Fig. 4A, plasma glucose concentration reached the
maximum of 2.59 mM l−1 at 9 h in C12 group and trended to decline
since then. In C20 group, it significantly increased at 9 h (1.73 mM l−1)
but peaked at 48 h (4.06 mM l−1) (P < .05). Besides, it was higher in
C20 group than that in C12 group during postprandial starvation
period.
Plasma TG concentration in C12 group had been decreasing with the
increase of starvation time (Fig. 4B). In C20 group, it reached the
highest value of 15.20 mM l−1 at 9 h (P < .05) and kept declining since
then. Additionally, fish in C20 group had higher level of plasma TG
concentration than that in C12 group during starvation.
Plasma TC concentration in the two groups showed a downward
trend with the starvation time prolonged (Fig. 4C). Its maximum oc-
curred at 3 h (6.57 mM l−1) in C12 group and 9 h (6.55 mM l−1) in C20
group.
Plasma FFA concentration in both groups kept declining with the
increase of the starvation time (Fig. 4D). It remained relatively stable
within 24 h and showed a downward trend since then. Besides, it was
lower within 24 h in C20 group but higher after 24 h than that in C12
group.
Plasma hormone parameters are shown in Fig. 4E, F and G. Plasma
insulin concentration in C12 group trended to increase at 9 h and de-
creased to the lowest value of 14.66 (mIU l−1) at 48 h. It showed an
upward trend since then and increased significantly on the 21 d
(P < .05). On the 28 d, it reached the maximum value of 27.60 (mIU
l−1). In C20 group, it rose at 9 h and decreased to the value of 16.17
(mIU l−1) at 24 h (P > .05). After that, it trended to rise and then
reached the maximum of 30.72 (mIU l−1) on the 28 d.
Plasma glucagon concentration in C12 group increased at 9 h
(P > .05) and sharply decreased at 24 h (P < .05). Then it kept an
upward trend and reached the maximum of 101.67 (pg ml−1) on the 21
d. In C20 group, it decreased at 9 h, recovered to the basal level at 24 h
and trended to decline until 14 d (P > .05). Since then, it increased
and reached the highest value of 105.37 (pg ml−1) on the 28d.
Moreover, plasma leptin concentration declined significantly at 48 h
(P < .05) and remained stable until 14 d in C12 group. It markedly
rose on the 21 d (P < .05) and reached the highest value of 12.94
(ng ml−1) on the 28 d. In C20 group, it maintained a relatively stable
level within 14 d and increased significantly on the 21d (P < .05). And
then it reached the maximum of 12.51 (ng ml−1) on the 28 d.
421
Aquaculture 501 (2019) 416–429
3.5. The mRNA levels of genes in glucose metabolism
As shown in Fig. 5A, in C12 group, the gys2 mRNA level markedly
increased at 9 h and was 8.99 times higher than that at 3 h (P < .05). It
sharply decreased at 48 h (P < .05) and further declined until the end
of starvation. In C20 group, it decreased significantly at 9 h and reached
the maximum at 48 h (P < .05). Then it kept declining after that time.
The mRNA level of pygl in C12 group was markedly up-regulated at
48 h and 1.52 times higher than that at 3 h (P < .05) (Fig. 5B). And
then it significantly declined on the 3 d (P < .05) and trended to de-
cline until 28 d (P > .05). In C20 group, compared with 3 h, the pygl
mRNA level increased about 2.91 times at 48 h (P < .05) and main-
tained a relatively high level until 7 d. It sharply decreased on the 14 d
(P < .05) and remained stable since then.
The mRNA levels of glycolytic genes gck (Fig. 5C) and pfkl (Fig. 5D)
were significantly up-regulated and reached maximum at 9 h in C12
group (P < .05). After that, they showed downward trends until the
end. In C20 group, the gck mRNA level was markedly up-regulated at
9 h and about 2.34 times higher than that at 3 h in this group
(P < .05). It significantly decreased at 24 h (P < .05) and remained a
low level for the rest of starvation period. The mRNA level of pfkl sig-
nificantly increased at 48 h and was 3.33 times higher than that at 3 h
(P < .05). It showed a downward trend after 3 d.
The mRNA levels of genes involved in gluconeogenesis were pre-
sented in Fig. 5E, F and G. In C12 group, the pck1 mRNA level had been
increasing and reached the peak at 48 h (P < .05). At that time, it was
about 4.68 times higher than that at 3 h. It was down-regulated sharply
on the 3 d (P < .05) and kept declining since then. In C20 group, it
significantly rose at 24 h and was 5.99 times higher at 48 h than that at
3 h (P < .05). It kept declining after 48 h for the rest of starvation
period. In C12 group, the fbp2 mRNA level increased significantly at
24 h and peaked at 48 h (P < .05). It sharply declined on the 7 d and
was up-regulated again on the 21 d (P < .05). In C20 group, it mark-
edly rose at 48 d and reached the maximum on the 21 d (P < .05).
Then it sharply declined on the 28 d (P < .05). The mRNA level of g6pc
in C12 group significantly increased at 9 h (P < .05). It peaked at 24 h
and was about 2.78 times higher than that at 3 h (P < .05). And then it
showed a downward trend until 21 d and significantly increased on the
28 d. In C20 group, it remained relatively stable within 24 h (P > .05).
It was 7.54 times higher at 48 h than that at 3 h and then sharply de-
clined until 28 d.
As showed in Fig. 5H, the g6pdh mRNA level in PPP in C12 group
reached the highest value at 9 h and was about 1.52 times higher than
that at 3 h (P < .05). It significantly decreased at 24 h (P < .05) and
remained relatively low for the rest of starvation period. In C20 group,
it was markedly down-regulated at 24 h and rose markedly at 48 h
(P < .05). Then it maintained high level until 21 d and declined
sharply on the 28 d.
3.6. The mRNA levels of gene in citric acid cycle
The mRNA level of cs was markedly up-regulated at 48 h and
reached the highest value on the 7 d in C12 group (P < .05) (Fig. 6).
And then it decreased until the end of starvation. In C20 group, it
markedly increased since 48 h and peaked on the 3 d (P < .05). After
that, it kept declining with the increase of starvation time.
3.7. The mRNA levels of genes in lipid metabolism
As shown in Fig. 7A, the mRNA level of acaca involved in lipo-
genesis in C12 group increased 3.53 times at 9 h compared with 3 h and
sharply decreased at 24 h (P < .05). And then it kept rising with the
increase of starvation time. In C20 group, it rose 2.30 times at 9 h
compared with 3 h (P < .05). After that, it declined and reached the
minimum on the 3 d. And then it kept rising until 21 d and decreased
significantly on the 28 d.
M. Yang et al. Aquaculture 501 (2019) 416–429

(caption on next page)

422
M. Yang et al.
Fig. 4. Plasma parameters of Japanese flounder during postprandial starvation period. (A) Plasma glucose (B) Plasma triglyceride (C) Plasma total cholesterol (D)
Plasma free fatty acids (E) Plasma insulin (F) Plasma glucagon (G) Plasma leptin. All data were expressed as mean ± SE, n = 6 (3 fish/replicate). Lower case letters
represent significant difference among sampling times within C12 diet, while upper case letters denote the significant difference among sampling times within C20
diet (P < .05). Asterisks (*) denote a significant difference between C12 and C20 diet at a same sampling time point (P < .05). T: time points; C: diets; T × C:
interaction between time and diets.
The mRNA level of lpl involved in lipolysis in C12 group peaked at
48 h and was 2.22 times higher than that at 3 h (P < .05) (Fig. 7B). It
was markedly down-regulated on the 7 d (P < .05) and maintained
stable since then (P > .05). In C20 group, it increased significantly at
24 h and reached the maximum at 48 h (P < .05). It was 4.81 times at
48 h higher than that at 3 h and kept declining after that time. The
mRNA level of gk at 9 h was significantly lower than that at 3 h and
reached the highest value at 48 h in C12 group (P < .05) (Fig. 7C). And
then it remained relatively stable until 21 d and declined on the 28 d
(P < .05). In C20 group, it increased 2.92 times at 48 h compared with
3 h. And then it kept declining until the end of starvation.
The mRNA levels of cpt1a and hadh involved in β-oxidation of fatty
acids is showed in Fig. 7D and E. The mRNA level of cpt1a in C12 group
was significantly down-regulated at 9 h and declined to the minimum at
48 h (P < .05). And then it increased significantly on the 14 d
(P < .05) and declined after that. In C20 group, it significantly de-
creased at 9 h and reversed at 24 h (P < .05). And it markedly in-
creased at 48 h (P < .05). Then it declined on the 7 d and peaked on
the 14 d (P < .05). And then it sharply decreased until 28 d (P < .05).
The hadh mRNA level had been increasing and reached the maximum
on the 14 d in C12 group. The highest value was 2.75 times compared
with 3 h. And then it sharply declined until the end of starvation
(P < .05). In C20 group, it had been increasing and was 8.35 times on
the 21 d higher than that at 3 h. And then it declined on the 28 d
(P < .05).
As shown in Fig. 7F, in C12 group, the mRNA level of bdh2 involved
in ketogenesis had been rising with the increase of starvation time. In
C20 group, it increased drastically at 24 h and reached the highest value
on the 21 d. And then it was down-regulated at the end of starvation
(P < .05).
4. Discussion
4.1. The transition from exogenous to endogenous glucose
In present study, compared to 3 h, plasma glucose concentration
increased at 9 h and declined at 24 h in both groups. A similar trend was
found for the mRNA levels of gck, pfkl and g6pdh, and glycogen content
in liver. It is suggested that the process of glycolysis, PPP and glyco-
genesis appeared to be activated within 24 h, which means exogenous
dietary glucose was the primary source for demands once upon feeding
in Japanese flounder. Meanwhile, the mRNA levels of pck1, fbp2 and
g6pc involved in gluconeogenesis increased significantly since 9 h in
C12 group and 24 h in C20 group, and further increased afterwards.
Liver glycogen in C12 group peaked at 48 h, fell on the 3 d and was
depleted on the 7 d. In C20, it peaked on the 3 d, decreased on the 7 d
and was minimized on the 14 d. However, muscle glycogen decreased
on the 3 d and remained stable since then in the two groups.
Additionally, plasma glucose peaked at 48 h and 7 d in both groups.
These results indicated that, since 9 h in C12 and 24 h in C20, glucose
requirements began to be met by endogenous glucose through gluco-
neogenesis and glycogenolysis. As in zebra fish (Danio rerio), fasting
activated the mRNA levels of genes relating to glycogenesis and PPP in
early stages, when fasting is prolonged, the mRNA levels of genes in-
volved in glycolysis and PPP decreased (Tian et al., 2015). Hexokinase
and G6PDH activities decreased while glucose-6-phosphatase (G6Pase)
increased with days of starvation in rohu (Labeo rohita) fingerlings (Dar
et al., 2018). In mammals, feeding a carbohydrate containing meal
stimulates glycolysis and increases glycogen stores (Moore et al., 2012),
423
Aquaculture 501 (2019) 416–429
whereas prolonged fasting induces hepatic glucose production and
glycogen depletion (Yoon et al., 2001; Geisler et al., 2016).
In human, the switch time of glucose supply changes from exo-
genous to endogenous was about 12 h after feeding (Haller and Bines,
2013). In mouse, glycogenolysis was the primary source to maintain
glucose during the first 8 h of fasting, while gluconeogenesis was the
primary thereafter (Geisler et al., 2016). Studies on meadow voles also
showed the depletion of liver glycogen content was observed after 6 h
of fasting (Mosin, 1982; Mosin, 1984; Nagy and Pistole, 1988). Com-
pared with the mammals, in present study, the time of fish beginning to
mobilize glycogen might be postponed. However, the process of glu-
coneogenesis was activated since 9 h in C12 group and 24 h in C20
group. It was suggested that Japanese flounder began to turn the supply
of glucose from exogenous (feeding) to endogenous (gluconeogenesis
and glycogenolysis) at this moment.
A great utilization of endogenous glucose for metabolism in
Japanese flounder is supported by depleted liver glycogen. In most fish
species, liver glycogen is mobilized firstly during starvation but the
degree of depletion varies greatly (Perezjimenez et al., 2007; Metón
et al., 2003; Moon, 1983; Sheridan and Mommsen, 1991). Fish like
tench (Tinca tinca), sturgeon (Acipenser naccarii) and coho salmon
(Oncorhynchus kisutch), lowered liver glycogen by 50% to 75% for
several days of fasting (Pedro et al., 2003; Furné et al., 2012; Sheridan
and Mommsen, 1991). Liver glycogen was apparently spared by other
fish, and it was significantly depleted only after several months of
starvation (Janssens, 1964; Larsson and Lewander, 1973). Whether the
use of liver glycogen depends on species is still unknown. In mouse,
hepatic glycogen stores were depleted after 16 h of fasting (Geisler
et al., 2016). Birds and mammals tended to rapidly minimize their
glycogen stores early in a fast (Didier et al., 1983; Parrilla, 1978).
Carnivorous fish are regarded as glucose-intolerant and similar to type
2 diabetes because of their poor capacities of glucose utilization
(Polakof et al., 2012). For fasted diabetic subjects, there is evidence that
large glycogen stores were still in the liver (Clore et al., 1992). It was
inferred that Japanese flounder possess the abilities in glucose utiliza-
tion for their demands during starvation because of its efficient utili-
zation of liver glycogen.
In present study, in C20 group, greater changes of the mRNA levels
of genes involved in gluconeogenesis in liver than that in C12 were
observed during postprandial starvation period. Hepatic gluconeogen-
esis during prolonged starvation has been reported by previous studies
in teleost fishes (Moon et al., 1989; Foster and Moon, 1991) and
mammals (Hanson and Reshef, 1997; Mosin, 1984). In fish, it was found
that non-carnivorous have great capacities to inhibit hepatic gluco-
neogenesis after a carbohydrate-rich meal (Panserat et al., 2002;
Polakof et al., 2012; Figueiredo-Silva et al., 2013), but carnivorous
species such as gilthead sea bream (Sparus aurata) and European sea
bass (Dicentrarchus labrax) showed poor inhibition of hepatic gluco-
neogenesis after feeding a high-carbohydrate diet (Enes et al., 2008;
Enes et al., 2006). It was also found that high glucose intake during the
early stage has long term, even life-span interference on gluconeogen-
esis, as in Siberian sturgeon (Acipenser baerii) (Gong et al., 2015). The
present study found that even fed with higher level of dietary carbo-
hydrate (20%), Japanese flounder had stronger gluconeogenesis in liver
during postprandial starvation period. It is showing that, fish experi-
enced long-term enriched carbohydrate adaptation increased glucose
requirement for maintaining body energy retention during starvation.
As in the study of Liang (Liang et al., 2017), the activity of PEPCK-C
during starvation phase was enhanced by previous a high-carbohydrate
M. Yang et al. Aquaculture 501 (2019) 416–429

(caption on next page)

424
M. Yang et al.
Fig. 5. The mRNA levels of glucose metabolism related genes in liver of Japanese flounder during postprandial starvation period. (A) gys2, glycogen synthase (B) pygl,
glycogen phosphorylase (liver type) (C) gck, glucokinase (D) pfkl, phosphofructokinase (liver type) (E) pck1, phosphoenolpyruvate carboxykinase (cytoplasmic type)
(F) fbp2, fructose-1, 6-bisphosphatase (liver type) (G) g6pc, glucose-6-phosphatase catalytic subunit (H) g6pdh, glucose-6-phosphate-1-dehydrogenase. All data were
expressed as mean ± SE, n = 6 (3 fish/replicate). Lower case letters represent significant difference among sampling times within C12 diet, while upper case letters
denote the significant difference among sampling times within C20 diet (P < .05).
Fig. 6. The mRNA levels of gene related to citric acid cycle in liver of Japanese
flounder during postprandial starvation period. cs, citrate synthase. All data
were expressed as mean ± SE, n = 6 (3 fish/replicate). Lower case letters re-
present significant difference among sampling times within C12 diet, while
upper case letters denote the significant difference among sampling times
within C20 diet (P < .05).
diet in fish, although FBPase and G6Pase were not always consistent
with this result. Alpha-starch is not only an economical energy source,
but also a very important component for the manufacturing of fish feeds
due to its binding properties. Although the combinations of alpha-
starch and corn starch in the two diets were different, in the present
study, the same levels of alpha-starch in the diets were maintained and
only the levels of dietary corn starch were changed. The difference in
carbohydrate levels between the two experimental diets was only made
by corn starch, which led to the different response between the two
groups.
4.2. Lipogenesis and lipid mobilization
As for lipid metabolism, high levels of plasma TG and TC con-
centration were observed during 3 h - 9 h. On the one hand, the increase
of plasma TG may be resulted from feeding depending of the feed type
and feeding amount. Besides, the mRNA level of acaca also increased,
showed that the process of lipogenesis was activated. This pathway
plays an important role in glucose homeostasis (Polakof et al., 2012). In
present study, liver lipid content in percent appeared to increase within
14 d and sharply decreased after that. Actually, the absolute weight of
liver lipid had been declining with the increase of starvation time be-
cause the liver weight showed a downward trend (Table S1). Mean-
while, the fish weight had been decreasing during starvation as well
(Fig. S2). What's more, it was found that liver lipid was mobilized more
rapidly in C20 group than that in C12. Besides, although plasma
parameters relating to the lipid metabolism showed a steady decline in
values, FFA level rose or fluctuated slightly during the later starvation
period. It was also a sign of lipolysis (Figueiredo-Garutti et al., 2002;
Fuentes et al., 2012). Furthermore, the process of β-oxidation of fatty
acids in liver was activated since 48 h in C12 and 24 h in C20 and en-
hanced after that, which was supported by the mRNA levels of cpt1a
and hadh. The bdh2 mRNA level reveals the increased capacity to
synthesize ketone bodies with the starvation time prolonged. Fish and
mammals have general rule of activation in lipolysis, β-oxidation of
fatty acids and ketogenesis in the later stage of starvation (Geisler et al.,
2016; Liang et al., 2002; Tian et al., 2013). These processes serve to
protect against excessive erosion of protein mass in animals (Soeters
et al., 2012).
425
Aquaculture 501 (2019) 416–429
However, differences existed in lipid metabolism between the two
groups in present study as well. Fish in C20 group had higher levels of
lipid in liver and muscle after the feeding trial. Previous studies also
showed that liver lipid content rose with the increase of dietary car-
bohydrates levels, such as in juvenile cobia (Rachycentron canadum)
(Ren et al., 2011). It has shown that the induction of lipogenesis in liver
and muscle may indicate the improved utilization of dietary carbohy-
drates (Skibacassy et al., 2009; Panserat et al., 2009). Besides, it should
be noted, more reduction of lipid content both in liver and muscle of
fish in C20 group were observed. Greater changes of lipolytic genes
mRNA levels in this group might support it. Moreover, the higher
concentration of plasma FFA was observed in C20 group, suggesting a
higher rate of lipolysis during the later stages. In addition, studies
showed that the control of hepatic gluconeogenesis by the products of
lipolysis (glycerol and non-esterified fatty acids) involves the conver-
sion of glycerol to glucose and the activation of pyruvate carboxylase by
acetyl-CoA produced by fatty acids (Perry et al., 2014; Perry et al.,
2015). This fact indicated that, the previous carbohydrate-enriched diet
activated lipolysis during starvation in present study, which possibly
was an attempt to yield fatty acid and glycerol for gluconeogenesis.
Further study in this regard is needed.
Overall, after 48 h in C12 group and 24 h in C20 group, lipid mo-
bilization including lipolysis, β-oxidation of fatty acids and ketogenesis
were activated. These processes were enhanced during the later stage of
starvation. Data strongly suggested that, fish fed with high levels of
dietary carbohydrates induced the large deposition of lipid in liver and
muscle, and increased lipolysis during starvation.
4.3. The mobilization of energy stores from glycogen to lipid
Animals have their own strategies on energy stores mobilization in
response to starvation. In present study, fish in two groups firstly uti-
lized liver and muscle glycogen, and then preserved muscle glycogen at
a stable level while liver glycogen was declining. With the large de-
pletion of liver glycogen, Japanese flounder turned to rely on liver and
muscle lipid as energy source. Significant decrease of muscle glycogen
during prolonged starvation was also observed in several carnivorous
fish species, such as Channa punctatus and Northern Pike (Esox lucius)
(Ince and Thorpe, 1976; Sunnap Namrata and Pallavi, 2011). The gly-
cogen in muscle was not obviously changed for several weeks or months
of starvation in the omnivorous Siberian sturgeon (Acipenser baerii),
carp (Cyprinus carpio) and Jundia (Rhamdia quelen) (Barcellos et al.,
2010; Liang et al., 2017; Blasco et al., 1992). Liver is the main storage
site for glycogen (per unit of tissue). Nevertheless, on a whole fish basis,
total muscle glycogen may be higher than liver glycogen (Kamalam
et al., 2017). Glycogen in liver serves as a universal reserve of glucose
which can contribute directly to homeostasis of blood glucose (Hemre
et al., 2002; Kaushik, 2001; Jobling, 2012), while muscle glycogen is
metabolized by anaerobic glycolysis to form pyruvate and lactate due to
a lack of G6Pase, lactate then acts as a precursor or is for gluconeo-
genesis in liver, which is called Cori cycle (Hanson, 1974; Tappy, 1995;
Corssmit et al., 2001; Haller and Bines, 2013). Likewise, in fish, Cori
cycle apparently occurs as it does in mammals (Batty and Wardle, 1979;
Cornish and Moon, 1985; Milligan and McDonald, 1988). In present
study, muscle glycogen decreased on the 3 d in the two groups. Sub-
sequently, high levels of gluconeogenic genes mRNA levels and plasma
glucose concentration were observed. It can be concluded that the
utilization of muscle glycogen during starvation has something to do
with gluconeogenesis in liver. Nevertheless, muscle glycogen will not
M. Yang et al. Aquaculture 501 (2019) 416–429

Fig. 7. The mRNA levels of lipid metabolism related genes in liver of Japanese flounder during postprandial starvation period. (A) acaca, acetyl-CoA carboxylase
alpha (B) lpl, lipoprotein lipase (C) gk, glycerol kinase (D) cpt1a, carnitine O-palmitoyltransferase 1A (E) hadh, hydroxyacyl-CoA dehydrogenase (F) bdh2, 3-hy-
droxybutyrate dehydrogenase 2. All data were expressed as mean ± SE, n = 6 (3 fish/replicate). Lower case letters represent significant difference among sampling
times within C12 diet, while upper case letters denote the significant difference among sampling times within C20 diet (P < .05).

be used up in the fasting process because of its immediate involvement
in muscular activity (Navarro and Gutiérrez, 1995).
In human, fuel oxidation gradually shifts from carbohydrates to
mainly lipids as oxidative source during fasting, which is a hallmark of
fasting physiology (Soeters et al., 2012). The present study indicated
that the primary substrate of energy sources switching from glycogen to
lipid occurred on the 3 d-7 d in C12 group and 7 d-14 d in C20 group. A
major content of liver glycogen of fish in the latter group would explain
this fact. In present study, fish fed more enriched carbohydrates diet
had higher level of glycogen. As in other reports, increasing dietary
carbohydrate would increase the deposition of glycogen in liver (Hilton
and Atkinson, 1982; Wang, 2004) and muscle (Boonanuntanasarn et al.,
2018) of fish. The conversion from glucose to glycogen in liver is a key
process to define the capacity of dietary glucose utilization (Rito et al.,
2018). The larger glycogen stores wound cover energy demands longer.
It was similar to the utilization of other endogenous energy stores (e.g.,
lipids and protein), which has a certain relationship with their reserves
(Navarro and Gutiérrez, 1995; Cai et al., 2003; Secor and Carey, 2016).

426
M. Yang et al.
Fig. 8. The glucose and lipid metabolic adaptations at the molecular level in liver of Japanese flounder during postprandial starvation. PPP, Pentose phosphate
pathway.
4.4. Hormonal regulation for glucose and lipid metabolism
Hormones play a critical role in glucose and lipid metabolism in
fish. In present study, plasma insulin concentration increased at 9 h in
both groups and had a similar trend with plasma glucose. As an ana-
bolic hormone, insulin enhances glucose uptake after feeding (Haller
and Bines, 2013; Navarro et al., 2006). Besides, glucagon increases liver
glycogen breakdown and gluconeogenesis in fish. It decreases after
carbohydrate feeding (Hemre et al., 2002; Plisetskaya and Mommsen,
1996). However, in present study, plasma glucagon concentration
trended to increase at 9 h in C12 group and decrease in C20 group.
Previous different levels of carbohydrates intake leading to the different
initiation time of glucose supply from exogenous to endogenous might
account for these results. Then gluconeogenesis was activated and
contributed to the increase of plasma glucose at the 48 h. What's more,
in C20 group, the peak value of plasma glucose at 48 h displayed even
higher concentration than that at 9 h. These results in Japanese
flounder are in agreement with those in some other animals, such as
mice, Japanese quail (Coturnix japonica) and goldfish (Carassius aur-
atus), showing overcompensation which was probably due to gluco-
neogenesis and glycogenolysis (Lamo et al., 2004; Cartañà et al., 1989;
Chavin and Young, 1970; McCue, 2010). With the depletion of liver
glycogen, the glucose for energy demands was mainly supplied by
gluconeogenesis. Therefore, the plasma glucose peaked again on the 7 d
in the two groups. However, plasma insulin and glucagon concentration
remained relatively stable at this moment.
With the starvation prolonged, the primary substrate of energy
sources switched from glycogen to lipid. Lipid mobilization in liver was
markedly induced in the later stage. Meanwhile, plasma glucagon and
leptin concentration increased to accelerate this process (Navarro and
Gutiérrez, 1995). In addition, plasma insulin concentration rose notably
at the end of starvation. Previous studies showed that the circulating
level of insulin generally decreases with fasting in most fish species
(Hemre et al., 1990; Navarro and Gutiérrez, 1995). Except during un-
ique starvation period of spawning migration, plasma level of insulin in
pink salmon (Oncorhynchus gorbusha) was elevated in order to preserve
sufficient metabolic reserves (Mommsen, 1991). Insulin also stimulates
the rates of lipogenesis in fish (Cowley and Sheridan, 1993). The mRNA
levels of lipogenetic gene showed an upward trend after 7 d, inferring
that the increase of insulin in later stage of starvation might be used for
lipogenesis in liver. Another possible explanation was that, fatty acids
427
Aquaculture 501 (2019) 416–429
and their derivatives from lipolysis may exert inhibitory roles on insulin
signaling (Holland et al., 2007; Samuel and Shulman, 2012). Moreover,
ketone body or downstream intermediates like acetyl-CoA will inhibit
terminal glucose oxidation and interfere with insulin signaling (Sugden
and Holness, 2006; Webber et al., 1994). Thus, it was speculated that
fatty acids and ketone bodies provided by strongly lipolysis during the
later stage of starvation, which decreased terminal glucose oxidation
and interfered with insulin signaling, contributes to the accumulation of
insulin unused. Though the regulation mechanisms of these hormones
are not well documented, it is evident that all these hormones may have
a helper role or even greater relevance in regulating glucose metabo-
lism and utilization in Japanese flounder.
5. Conclusion
In summary, the glucose and lipid metabolic adaptations at the
molecular level in liver of Japanese flounder during postprandial star-
vation were concluded in Fig. 8. According to the mRNA levels of re-
lated genes and biochemical compositions of tissues, the processes of
glycogenesis, glycolysis, PPP and lipogenesis in liver were activated
once after feeding. Subsequently, the process of gluconeogenesis was
induced (C12: 9 h; C20: 24 h). After that, the supply of glucose needed
by the body's energy metabolism gradually changes from exogenous
(feeding) to endogenous (gluconeogenesis and glycogenolysis). With
the starvation prolonged, primary substrate of energy sources in Japa-
nese flounder switched from glycogen to lipid (C12: 3 d-7 d; C20: 7 d-14
d). Furthermore, lipid mobilization in liver was activated (C12: 48 h;
C20: 24 h) and markedly enhanced in the later stage. Besides, during
starvation, intake of a carbohydrate-enriched diet previously was found
to greatly activate gluconeogenesis and lipolysis. These observations
demonstrated glucose and lipid metabolic responses of Japanese
flounder during starvation were influenced by previous feeding with
different levels of dietary carbohydrates.
Acknowledgments
The authors thank the participants who contribute to this trial.
This work was financially supported by the National Natural Science
Foundation of China (Grant No. 31572628), the National Basic
Research Program of China (973 program, Grant No. 2014CB138600),
and Key R&D Program of Shandong Province, China (2016CYJS04A01,
M. Yang et al.
2017CXGC0105).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.aquaculture.2018.12.003.
References
Amirkolaie, A.K., Verreth, J.A.J., Schrama, J.W., 2006. Effect of gelatinization degree and
inclusion level of dietary starch on the characteristics of digesta and faeces in Nile
tilapia (Oreochromis niloticus (L.)). Aquaculture 260, 194–205.
Amoah, A., Coyle, S.D., Webster, C.D., Durborow, R.M., Bright, L.A., Tidwell, J.H., 2008.
Effects of graded levels of carbohydrate on growth and survival of largemouth bass,
Micropterus salmoides. J. World Aquacult. Soc. 39, 397–405.
AOAC, 1995. Official Methods of Analysis of Official Analytical Chemists International,
16th ed. Association of Official Analytical Chemists, Arlington, VA, USA.
Bar, N., Volkoff, H., 2012. Adaptation of the physiological, endocrine, and digestive
system functions to prolonged food deprivation in fish. In: McCue, M.D. (Ed.),
Comparative Physiology of Fasting, Starvation, and Food Limitation. Springer, Berlin,
pp. 69–89.
Barcellos, L.J.G., Marqueze, A., Trapp, M., Quevedo, R.M., Ferreira, D., 2010. The effects
of fasting on cortisol, blood glucose and liver and muscle glycogen in adult jundia
Rhamdia quelen. Aquaculture 300, 231–236.
Batty, R.S., Wardle, C.S., 1979. Restoration of glycogen from lactic acid in the anaerobic
swimming muscle of plaice, Pleuronectes platessa L. J. Fish Biol. 15, 509–519.
Blasco, J., Fernández, J., Gutiérrez, J., 1992. Fasting and refeeding in carp, Cyprinus
carpio L.: the mobilization of reserves and plasma metabolite and hormone variations.
J. Comp. Physiol. B. 162, 539–546.
Boonanuntanasarn, S., Kumkhong, S., Yoohat, K., Plagnes-Juan, E., Burel, C., Marandel,
L., Panserat, S., 2018. Molecular responses of Nile tilapia (Oreochromis niloticus) to
different levels of dietary carbohydrates. Aquaculture 482, 117–123.
Brauge, C., Corraze, G., Médale, F., 1995. Effects of dietary levels of carbohydrate and
lipid on glucose oxidation and lipogenesis from glucose in rainbow trout,
Oncorhynchus mykiss, reared in freshwater or in seawater. Compar. Biochem. Physiol.
A 111, 117–124.
Cai, C.F., Chen, L.Q., Ping, W.U., Ding, L., Song, X.H., 2003. Effects of types and levels of
dietary carbohydrate on liver glycogen metabolism of allogynogenetic silver crucian
carp. J. Fish. Sci. China 10, 55–59.
Capilla, E., Médale, F., Navarro, I., Panserat, S., Vachot, C., Kaushik, S., Gutiérrez, J.,
2003. Muscle insulin binding and plasma levels in relation to liver glucokinase ac-
tivity, glucose metabolism and dietary carbohydrates in rainbow trout. Regul. Pept.
110, 123–132.
Cartañà, J., Huget, J., Arola, L., Alemany, M., 1989. Effects of a high lipidic diet on
murine energetic reserves in food deprivation. Hormone Metab. Res. 21, 606–611.
Chavin, W., Young, J.E., 1970. Factors in the determination of normal serum glucose
levels of goldfish, Carassius auratus L. Compar. Biochem. Physiol. 33, 629–653.
Cho, S.H., 2009. Effect of fasting and refeeding on growth and blood chemistry in juvenile
olive flounder Paralichthys olivaceus L. Compar. Biochem. Physiol. 22, 11–15.
Clore, J.N., Post, E.P., Bailey, D.J., Nestler, J.E., Blackard, W.G., 1992. Evidence for in-
creased liver glycogen in patients with noninsulin-dependent diabetes mellitus after a
3-day fast. J. Clin. Endocrinol. Metab. 74, 660–666.
Cornish, I., Moon, T.W., 1985. Glucose and lactate kinetics in American eel Anguilla
rostrata. Am. J. Phys. 249, 67–72.
Corssmit, E.P.M., Romijn, J.A., Sauerwein, H.P., 2001. Regulation of glucose production
with special attention to nonclassical regulatory mechanisms: a review[J]. Metab.
Clin. Exp. 50, 742–755.
Cowley, D., Sheridan, M., 1993. Insulin stimulates hepatic lipogenesis in rainbow trout,
Oncorhynchus mykiss. Fish Physiol. Biochem. 11, 421–428.
Dar, S.A., Srivastava, P.P., Varghese, T., Gupta, S., Gireeshbabu, P., Krishna, G., 2018.
Effects of starvation and refeeding on expression of ghrelin and leptin gene with
variations in metabolic parameters in Labeo rohita fingerlings. Aquaculture 484,
219–227.
Dias, J., Rueda-Jasso, R., Panserat, S., Conceição, L.E.C.D., Gomes, E.F., Dinis, M.T., 2004.
Effect of dietary carbohydrate-to-lipid ratios on growth, lipid deposition and meta-
bolic hepatic enzymes in juvenile Senegalese sole (Solea senegalensis, Kaup). Aquac.
Res. 35, 1122–1130.
Didier, R., Remesy, C., Demigne, C., 1983. Changes in glucose and lipid metabolism in
starved or starved-refed Japanese quail (coturnix coturnix japonica) in relation to fine
structure of liver cells. Comp. Biochem. Physiol. A Comp. Physiol. 74, 839–848.
Enes, P., Panserat, S., Kaushik, S., Olivateles, A., 2006. Effect of normal and waxy maize
starch on growth, food utilization and hepatic glucose metabolism in European sea
bass (Dicentrarchus labrax) juveniles. Comp. Biochem. Physiol. A Mol. Integr. Physiol.
143, 89–96.
Enes, P., Panserat, S., Kaushik, S., Olivateles, A., 2008. Hepatic glucokinase and glucose-
6-phosphatase responses to dietary glucose and starch in gilthead sea bream (Sparus
aurata) juveniles reared at two temperatures. Comp. Biochem. Physiol. A Mol. Integr.
Physiol. 149, 80–86.
Enes, P., Panserat, S., Kaushik, S., Oliva-Teles, A., 2011. Dietary Carbohydrate utilization
by European Sea Bass (Dicentrarchus labrax L.) and Gilthead Sea Bream (Sparus aurata
L.) Juveniles. Rev. Fish. Sci. 19, 201–215.
Figueiredo-Garutti, M.L., Navarro, I., Capilla, E., Souza, R.H.S., Moraes, G., Gutiérrez, J.,
Vicentini-Paulino, M.L.M., 2002. Metabolic changes in Brycon cephalus (Teleostei,
428
Aquaculture 501 (2019) 416–429
Characidae) during post-feeding and fasting. Comp. Biochem. Physiol. A Mol. Integ.
Physiol. 132, 467–476.
Figueiredo-Silva, A.C., Saravanan, S., Schrama, J.W., Panserat, S., Kaushik, S., Geurden,
I., 2013. A comparative study of the metabolic response in rainbow trout and Nile
tilapia to changes in dietary macronutrient composition. Br. J. Nutr. 109, 816–826.
Folch-Pi, J., 1957. A simple method for the isolation and purification of total lipids from
animal tissues. J. Biol. Chem. 226, 497–509.
Foster, G.D., Moon, T.W., 1991. Hypometabolism with fasting in the yellow perch (Perca
flavescens): a study of enzymes, hepatocyte metabolism, and tissue size. Physiol. Zool.
64, 259–275.
Fuentes, E.N., Kling, P., Einarsdottir, I.E., Alvarez, M., Valdés, J.A., Molina, A., Björnsson,
B.T., 2012. Plasma leptin and growth hormone levels in the fine flounder
(Paralichthys adspersus) increase gradually during fasting and decline rapidly after
refeeding. Gen. Comp. Endocrinol. 177, 120–127.
Furné, M., Morales, A.E., Trenzado, C.E., Garcíagallego, M., Carmen, H.M., Domezain, A.,
Sanz, R.A., 2012. The metabolic effects of prolonged starvation and refeeding in
sturgeon and rainbow trout. J. Comp. Physiol. B. 182, 63–76.
Geisler, C.E., Hepler, C., Higgins, M.R., Renquist, B.J., 2016. Hepatic adaptations to
maintain metabolic homeostasis in response to fasting and refeeding in mice. Nutr.
Metab. 13, 1–13.
Gong, G., Xue, M., Wang, J., Wu, X.F., Zheng, Y.H., Han, F., Liang, X.F., Su, X.O., 2015.
The regulation of gluconeogenesis in the Siberian sturgeon (Acipenser baerii) affected
later in life by a short-term high-glucose programming during early life. Aquaculture
436, 127–136.
Haller, W., Bines, J.E., 2013. Starvation and Fasting: Biochemical Aspects. Encyclopedia
of Human Nutrition. pp. 209–218.
Hanson, R.W., 1974. The choice of animal species for studies of metabolic regulation.
Nutr. Rev. 32, 1–8.
Hanson, R.W., Reshef, L., 1997. Regulation of phosphoenolpyruvate carboxykinase (GTP)
gene expression. Annu. Rev. Biochem. 66, 581–611.
Hellerstein, M.K., Schwarz, J.M., Neese, R.A., 1996. Regulation of hepatic de novo lipo-
genesis in humans. Annu. Rev. Nutr. 16, 523–557.
Hemre, G.I., Lie, Ø., Lambertsen, G., Sundby, A., 1990. Dietary carbohydrate utilization in
cod (Gadus morhua). Hormonal response of insulin, glucagon and glucagon-like-
peptide to diet and starvation. Comp. Biochem. Physiol. A Physiol. 97, 41–44.
Hemre, G.I., Mommsen, T.P., Krogdahl, Å., 2002. Carbohydrates in fish nutrition: effects
on growth, glucose metabolism and hepatic enzymes. Aquac. Nutr. 8, 175–194.
Hilton, J.W., Atkinson, J.L., 1982. Response of rainbow trout (Salmo gairdneri) to in-
creased levels of available carbohydrate in practical trout diets. Br. J. Nutr. 47,
597–607.
Hinch, S.G., Cooke, S.J., Healey, M.C., Farrell, A.P., 2005. Behavioural physiology of fish
migrations: salmon as a model approach. Fish Physiol. 24, 239–295.
Holland, W.L., Knotts, T.A., Chavez, J.A., Wang, L.P., Hoehn, K.L., Summers, S.A., 2007.
Lipid mediators of insulin resistance. Nutr. Rev. 65, S39–S46.
Hsieh, S.L., Shiau, S.Y., 2000. Effects of diets containing different carbohydrates on
starved condition in juvenile tilapia Oreochromis niloticus×O. aureus. Fish. Sci. 66,
32–37.
Hur, J.W., Jin, H.J., Park, I.S., 2006. Effects of long-term starvation on hepatocyte ul-
trastructure of olive flounder Paralichthys olivaceus. Ichthyol. Res. 53, 306–310.
Ince, B.W., Thorpe, A., 1976. The effects of starvation and force-feeding on the meta-
bolism of the Northern pike, Esox lucius L. J. Fish Biol. 8, 79–88.
Janssens, P.A., 1964. The metabolism of the aestivating African lungfish. Comp. Biochem.
Physiol. 11, 105–117.
Jobling, M., 2012. National Research Council (NRC): Nutrient requirements of fish and
shrimp. Aquac. Int. 20, 601–602.
Jones, J.G., 2016. Hepatic glucose and lipid metabolism. Diabetologia 59, 1098–1103.
Kamalam, B.S., Medale, F., Panserat, S., 2017. Utilisation of dietary carbohydrates in
farmed fishes: New insights on influencing factors, biological limitations and future
strategies. Aquaculture 467, 3–27.
Kaushik, S., 2001. Carbohydrate nutrition: importance and limits of carbohydrate sup-
plies. In: Guillaume, J., Kaushik, S., Bergot, P., Metailler, R. (Eds.), Nutrition and
Feeding of Fish and Crustaceans. Praxis Publishing Ltd., Chichester, pp. 131–144.
Kim, J.H., Min, H.J., Jun, J.C., Kim, T.I., 2014. Changes in hematological, biochemical
and non-specific immune parameters of olive flounder, Paralichthys olivaceus, fol-
lowing starvation. Asian Australas. J. Anim. Sci. 27, 1360–1367.
Lamo, D., Máâajová, M., Zeman, M., 2004. Effects of short-term fasting on selected
physiological functions in adult male and female Japanese quail. Acta Vet. Brno 73,
9–16.
Larsson, Å., Lewander, K., 1973. Metabolic effects of starvation in the eel, Anguilla an-
guilla L. Comp. Biochem. Physiol. A 44, 367–374.
Leandro, R.V., Erick, P., Antonio, C., Rolando, P.M., Odilia, G., Idania, S., Olimpia, C.,
Martos-Sitcha, J.A., Tsai, G.G., Miguel, M.J., 2014. A holistic view of dietary car-
bohydrate utilization in lobster: digestion, postprandial nutrient flux, and metabo-
lism. PLoS One 9, e108875.
Liang, X.F., Oku, H., Ogata, H.Y., 2002. The effects of feeding condition and dietary lipid
level on lipoprotein lipase gene expression in liver and visceral adipose tissue of red
sea bream Pagrus major. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 131,
335–342.
Liang, X., Wang, J., Gong, G., Xue, M., Dong, Y., Wu, X., Wang, X., Chen, C., Liang, X.,
Qin, Y., 2017. Gluconeogenesisduring starvation and refeeding phase is affected by
previous dietary carbohydrates levels and a glucose stimuli during early life in
Siberian sturgeon (Acipenser baerii). Animal Nutr. 3, 284–294.
Liao, K., Meng, R., Ran, Z., Cheng, G., Wang, Y., Xu, J., Xu, S., Yan, X., 2017. Short-term
starvation in silver pomfret (Pampus argenteus): molecular effects on lipid mobiliza-
tion and utilization. Aquac. Res. 48, 4874–4885.
Lin, H., Romsos, D.R., Tack, P.I., Leveille, G.A., 1977. Influence of diet on in vitro and in
M. Yang et al.
vivo rates of fatty acid synthesis in coho salmon [Oncorhynchus kisutch (Walbaum)].
J. Nutr. 107, 1677–1682.
McCue, M.D., 2006. Specific dynamic action: a century of investigation. Comp. Biochem.
Physiol. A Mol. Integr. Physiol. 144, 381–394.
McCue, M.D., 2010. Starvation physiology: reviewing the different strategies animals use
to survive a common challenge. Comp. Biochem. Physiol. Part A 156, 1–18.
Metón, I., Fernández, F., Baanante, I.V., 2003. Short- and long-term effects of refeeding on
key enzyme activities in glycolysis–gluconeogenesis in the liver of gilthead seabream
(Sparus aurata). Aquaculture 225, 99–107.
Miller, K.M., Schulze, A.D., Ginther, N., Li, S., Patterson, D.A., Farrell, A.P., Hinch, S.G.,
2009. Salmon spawning migration: metabolic shifts and environmental triggers.
Comp. Biochem. Physiol. Part D 4, 75–89.
Milligan, C.L., McDonald, D.G., 1988. In vivo lactate kinetics at rest and during recovery
from exhaustive exercise in coho salmon (Oncorhynchus kisutch) and starry flounder
(Platichthys stellatus). J. Exp. Biol. 135, 119–131.
Mommsen, T.P., 1991. Insulin in fishes and agnathans: history, structure and metabolic
regulation. Rev. Aqua. Sci. 4, 225–259.
Moon, T.W., 1983. Changes in tissue ion contents and ultrastructure of food-deprived
immature American eels, Anguilla rostrata (LeSueur). Rev. Canad. Zool. 61, 812–821.
Moon, T.W., Foster, G.D., Plisetskaya, E.M., 1989. Changes in peptide hormones and liver
enzymes in the rainbow trout dep. Can. J. Zool. 67, 2189–2193.
Moore, M.C., Coate, K.C., Winnick, J.J., An, Z., Cherrington, A.D., 2012. Regulation of
hepatic glucose uptake and storage in vivo. Adv. Nutr. 3, 286–294.
Morshedi, V., Kochanian, P., Bahmani, M., Yazdani-Sadati, M.A., Pourali, H.R., Ashouri,
G., Pasha-Zanoosi, H., Azodi, M., 2013. Compensatory growth in sub-yearling
Siberian sturgeon, Acipenser baerii Brandt, 1869: Effects of starvation and refeeding
on growth, feed utilization and body composition. J. Appl. Ichthyol. 29, 978–983.
Mosin, A.F., 1982. Some physiological and biochemical features of starvation and re-
feeding in small wild rodents (Microtinae). Comp. Biochem. Physiol. A 71, 461–464.
Mosin, A.F., 1984. On the energy fuel in voles during their starvation. Comp. Biochem.
Physiol. A 77, 563–565.
Nagy, T.R., Pistole, D.H., 1988. The effects of fasting on some physiological parameters in
the meadow vole, Microtus pennsylvanicus. Comp. Biochem. Physiol. A 91, 679–684.
Navarro, I., Gutiérrez, J., 1995. Fasting and Starvation. Biochemistry and Molecular
Biology of Fishes. Vol. 4. pp. 393–434.
Navarro, I., Capilla, E., Castillo, J., Albalat, A., Diaz, M., Gallardo, M.A., Blasco, J., Planas,
J.V., Gutiérrez, J., 2006. Insulin Metabolic Effects in Fish Tissues. 1. pp. 15–45.
Nie, Q., Miao, H., Miao, S., Zhou, H., Zhang, Y., Zhang, W., Mai, K., 2015. Effects of
dietary glucose and dextrin on activity and gene expression of glucokinase and
fructose-1,6-bisphosphatase in liver of turbot Scophthalmus maximus. Fish Physiol.
Biochem. 41, 819–832.
Panserat, S., Gatlin, D.M., Craig, S., 2009. Nutritional regulation of gene expression for
proteins involved in metabolism in cultured fish: focus on dietary carbohydrates. In:
Young, G., Thorgaard, G.H. (Eds.), Current Status of Molecular Research in
Aquaculture. Wiley-Blackwell, USA.
Panserat, S., Plagnesjuan, E., Kaushik, S., 2002. Gluconeogenic enzyme gene expression is
decreased by dietary carbohydrates in common carp (Cyprinus carpio) and gilthead
seabream (Sparus aurata). Biochim. Biophys. Acta 1579, 35–42.
Panserat, S., Skiba-Cassy, S., Seiliez, I., Lansard, M., Plagnes-Juan, E., Vachot, C., Aguirre,
P., Larroquet, L., Chavernac, G., Medale, F., 2009. Metformin improves postprandial
glucose homeostasis in rainbow trout fed dietary carbohydrates: a link with the in-
duction of hepatic lipogenic capacities? Am. J. Physiol. Regul. Integr. Comp. Physiol.
297, R707–R715.
Park, I.S., Woo, S.R., Song, Y.C., Cho, S.H., 2007. Effects of starvation on morphometric
characteristics of olive flounder, Paralichthys olivaceus. Ichthyol. Res. 54, 297–302.
Parrilla, R., 1978. Flux of metabolic fuels during starvation in the rat. Pflügers Archiv.
Eur. J. Physiol. 374, 3–7.
Pedro, N.D., Delgado, M.J., Gancedo, B., Alonso-Bedate, M., 2003. Changes in glucose,
glycogen, thyroid activity and hypothalamic catecholamines in tench by starvation
and refeeding. J. Comp. Physiol. B 173, 475–481.
Perezjimenez, A., Guedes, M.J., Morales, A.E., Olivateles, A., 2007. Metabolic responses
to short starvation and refeeding in Dicentrarchus labrax. Effect of dietary composi-
tion. Aquaculture 265, 325–335.
Perry, R.J., Zhang, X.M., Zhang, D., Kumashiro, N., Camporez, J.P., Cline, G.W.,
Rothman, D.L., Shulman, G.I., 2014. Leptin reverses diabetes by suppression of the
hypothalamic-pituitary-adrenal axis. Nat. Med. 20, 759.
Perry, R.J., Camporez, J.P., Kursawe, R., Titchenell, P.M., Zhang, D., Perry, C.J., Jurczak,
M.J., Abudukadier, A., Han, M.S., Zhang, X.M., 2015. Hepatic acetyl CoA links adi-
pose tissue inflammation to hepatic insulin resistance and type 2 diabetes. Cell 160,
745–758.
429
Aquaculture 501 (2019) 416–429
Plisetskaya, E.M., Mommsen, T.P., 1996. Glucagon and glucagon-like peptides in fishes.
Int. Rev. Cytol. 168, 187–257.
Polakof, S., Panserat, S., Soengas, J.L., Moon, T.W., 2012. Glucose metabolism in fish: a
review. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 182, 1015–1045.
Randle, P.J., 1998. Regulatory interactions between lipids and carbohydrates: the glucose
fatty acid cycle after 35 years. Diabetes Metab. Rev. 14, 263–283.
Ren, M., Ai, Q., Mai, K., Ma, H., Wang, X., 2011. Effect of dietary carbohydrate level on
growth performance, body composition, apparent digestibility coefficient and di-
gestive enzyme activities of juvenile cobia, Rachycentron canadum L. Aquac. Res. 42,
1467–1475.
Rito, J., Viegas, I., Pardal, M.A., Metón, I., Baanante, I.V., Jones, J.G., 2018. Disposition of
a glucose load into hepatic glycogen by direct and indirect pathways in juvenile
seabass and seabream. Sci. Rep. 8, 464.
Salem, M., Silverstein, J., Rexroad, C.E., Yao, J., 2007. Effect of starvation on global gene
expression and proteolysis in rainbow trout (Oncorhynchus mykiss). BMC Genomics 8,
328–343.
Samuel, V.T., Shulman, G.I., 2012. Mechanisms for insulin resistance: common threads
and missing links. Cell 148, 852–871.
Sargent, J.R., Tocher, D.R., Bell, J.G., 2002. The lipids. In: Halver, J.E., Hardy, R.W.
(Eds.), Fish Nutrition, 3rd edition. Academic Press, Elsevier Inc., California, pp.
181–257.
Secor, S.M., 2009. Specific dynamic action: a review of the postprandial metabolic re-
sponse. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 179, 1–56.
Secor, S.M., Carey, H.V., 2016. Integrative physiology of fasting. Compr. Physiol. 6,
773–825.
Sheridan, M.A., Mommsen, T.P., 1991. Effects of nutritional state on in vivo lipid and
carbohydrate metabolism of coho salmon, Oncorhynchus kisutch. Gen. Compar.
Endocrinol. 81, 473–483.
Shim, K.B., Lee, S.J., Yoon, H.D., Chi, W.L., Yun, K.S., Min, H.J., Dong, G.L., Park, T.I.,
2012. Effects of low temperature and starvation on the physicochemical character-
istics of muscle of the olive flounder Paralichthys olivaceus. J. Fish Pathol. 45,
430–437.
Skibacassy, S., Lansard, M., Panserat, S., Médale, F., 2009. Rainbow trout genetically
selected for greater muscle fat content display increased activation of liver TOR
signaling and lipogenic gene expression. Am. J. Physiol. Regul. Integr. Compar.
Physiol. 297, R1421–R1429.
Soeters, M.R., Soeters, P.B., Schooneman, M.G., Houten, S.M., Romijn, J.A., 2012.
Adaptive reciprocity of lipid and glucose metabolism in human short-term starvation.
Am. J. Physiol. Endocrinol. Metab. 303, E1397–E1407.
Sugden, M.C., Holness, M.J., 2006. Mechanisms underlying regulation of the expression
and activities of the mammalian pyruvate dehydrogenase kinases. Archiv. Int.
Physiol. 112, 139–149.
Sunnap Namrata, N.S., Pallavi, C., 2011. Effect of starvation on the biochemical com-
position of freshwater fish Channa punctatus. Rec. Res. Sci. Technol. 3, 17–19.
Tappy, L., 1995. Regulation of hepatic glucose production in healthy subjects and patients
with non-insulin-dependent diabetes mellitus. Diabèt. Métabol. 21, 233–240.
Tian, J., Wen, H., Zeng, L.B., Jiang, M., Wu, F., Liu, W., Yang, C.G., 2013. Changes in the
activities and mRNA expression levels of lipoprotein lipase (LPL), hormone-sensitive
lipase (HSL) and fatty acid synthetase (FAS) of Nile tilapia (Oreochromis niloticus)
during fasting and re-feeding. Aquaculture 400-401, 29–35.
Tian, J., He, G., Mai, K., Liu, C., 2015. Effects of postprandial starvation on mRNA ex-
pression of endocrine-, amino acid and peptide transporter-, and metabolic enzyme-
related genes in zebrafish (Danio rerio). Fish Physiol. Biochem. 41, 773–787.
Wang, J.B., 2004. Effects of different dietary carbohydrate levels on growth, feed utili-
zation and body composition of juvenile grouper Epinephelus akaara. Aquaculture
459, 143–147.
Webber, J., Simpson, E., Parkin, H., MacDonald, I.A., 1994. Metabolic effects of acute
hyperketonaemia in man before and during an hyperinsulinaemic euglycaemic
clamp. Clin. Sci. 86, 677–687.
Wilson, R.P., 1994. Utilization of dietary carbohydrate by fish. Aquaculture 124, 67–80.
Yarmohammadi, M., Shabani, A., Pourkazemi, M., Soltanloo, H., Imanpour, M.R., 2012.
Effect of starvation and re-feeding on growth performance and content of plasma
lipids, glucose and insulin in cultured juvenile Persian sturgeon (Acipenser persicus
Borodin, 1897). J. Appl. Ichthyol. 28, 692–696.
Yoon, J.C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford,
J., Kahn, C.R., Granner, D.K., 2001. Control of hepatic gluconeogenesis through the
transcriptional coactivator PGC-1. Nature 413, 131–138.
Yu, S., Olsen, C.E., Marcussen, J., 1997. Methods for the assay of 1, 5-anhydro-D-fructose
and α-1, 4-glucan lyase. Carbohydr. Res. 305, 73–82.