Supplementary Information

Cellular Resistance Mechanisms to Targeted Protein

Degradation Converge Toward Impairment of the Engaged
Ubiquitin Transfer Pathway
Philipp Ottis1, Chiara Palladino1, Phillip Thienger1, Adrian Britschgi1, Christian Heichinger2,
Marco Berrera2, Alice Julien-Laferriere2, Filip Roudnicky3, Tony Kam-Thong2, James R.
Bischoff1, Bruno Martoglio1, Piergiorgio Pettazzoni1*
1 Molecular Targeted Therapy - Discovery Oncology; 2 Pharmaceutical Sciences; 3 Lead Discovery, Therapeutic
Modalities. Roche Pharma Research and Early Development – Roche Innovation Center Basel, F. Hoffmann – La
Roche Ltd; Grenzacherstrasse 124, 4070 Basel, Switzerland.
*
piergiorgio.pettazzoni@roche.com

Extended Methods and references…………………………………………..….….…...2-4

Table 1: siRNAs and gene targets of the loss-of-function screen………………….….…5
Table2: IC50s of cell viability assay displayed in Figure 3…………………………..….6
Supplementary figure 1: compounds utilized in this study……………………….….…..7
Supplementary figures 2,3,4: extended data relative to the loss-of-function
siRNA screen…………………………………………………………………….……8-10

Supplementary figures 5,6,7: extended characterization of the degrader

resistant models ………………………………………………………………………11-13

Supplementary figures 8,9,10,11,12: extended data on cell

panel profiling ………………………………………………………………………..14-18

1
CRISPR/Cas9-Mediated Tagging of Endogenous BRD4.

N-terminal tagging of endogenous BRD4 with HiBit-tag in HEK293A cells was performed
according to1. Briefly, sgRNA (guide sequence 5’-ATCCCATCACATTCT-TCACC-3’) was
prepared by annealing equimolar amounts of crRNA and tracrRNA in Nuclease-Free Duplex
Buffer (Integrated DNA Technologies, IDT) by heating the mixed oligonucleotides to 95 °C for
5 min and then letting the mix cool down to room temperature. Next, 12 pmol of the sgRNA
duplex were incubated with 10.4 pmol of Alt-R Cas9 (IDT), dissolved in NEON Resuspension
Buffer R (Thermofisher Scientific), for 20 min. 5.2 pmol of loaded Cas9 were transferred into a
PCR-tube, mixed with 1.5 x 105 HEK293A cells resuspended in Neon Resuspension Buffer R
(17.6 x 1010 cells per mL), Alt-R Cas9 Electroporation Enhancer (1.8 μM final concentration;
IDT)
and 3.3 pmol of linear homology DNA insert (5’-
catctgctgactgatatctcacgggggctcttctcttcctttgtagagtgcctgg
tgaagaatgtgatgggatcactacATGGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCtctgcggagag
cggccctgggacgagattgagaaatctgccagtaatgggggatggactagaaacttcccaaatgtctac-3’; capitalized
letters indicate the HiBit insert sequence) to yield a final volume of 12 μL. The suspension was
then subjected to transfection by electroporation using the NEON Transfection System with a
10 μL tip and applying 3 pulses of 10 ms each at 1,245 V. Subsequently, transfected cells were
seeded into 24-well plates at 6 x 104 cells per well for recovery. After 2 days of outgrowth, cells
were subcloned by plating into 96-well plates. Monoclonal subclones were tested for HiBit-signal
(see Cell Viability and Protein Quantification Assays) and the clone with the strongest signal was
chosen to serve for all upcoming experiments.

RNA Interference
.
siRNAs were purchased as ON-TARGETplus SMARTpools for COPS7A (L-020873-01-0005),
COPS8 (L-015831-02-0005), CRBN (L-021086-00-0005), CUL2 (L-007277-00-0005), DCUN1D4
(L-014118-01-0005), DDB1(L-012890-00-0005), ELOB (L-012376-00-0005), ELOC (L-010541-
00-0005), RBX1 (L-004087-00-0005), UBA3 (L-005249-00-0005), UBE2D3 (L-008478-00-0005),
UBE2G1 (L-010154-00-0005), UBE2NL (L-031625-00-0005), UBE2R2 (L-009700-00-0005),
VHL (L-003936-00-0005), and scrambled control non-targeting siRNA (D-001810-10-05) or as
individual siRNAs targeting UBE2G1 (J-010154-06-0005), UBE2D3 (J-008478-10-0005), and
CUL4A (5' GCAAAGCAUGUGGAUUCA AUUUU 3') (Horizon Discovery LTD, UK), as well as
control PLK1 siRNA (5347 – siPOOL-5; siTOOLs Biotech, Germany).

Databases and Statistical Processing.

For CRISPR-screen dependency-data derived from the depmap.org database, gene

dependency scores had been assigned applying the CERES method.2 As described in the
database, a lower score is indicative of a gene being more likely to be dependent in the tested
cell line with a score of 0 indicating non-essentiality and -1 representing the median score value
of all common essential genes.3 A gene investigated in a large, pan-cancer cell line screen is
considered common essential if it ranks within the “ranks in the top X most depleting genes in at
least 90% of cell lines. X is chosen empirically using the minimum of the distribution of gene
ranks in their 90th percentile least depleting lines” (depmap.org3).
For the RNAi-screening, HiBit-BRD4 luminescence-readout data were subjected to one-way
ANOVA analyses using GraphPad Prism 7.04 software, followed by Dunnett’s multiple
comparison testing against the non-targeting scrambled control siRNA-treated group and
correction for multiple testing.
2
Immuno-Blotting.

Following separation via SDS-polyacrylamide gel electrophoresis, protein samples were

transferred to 0.2 μm nitrocellulose membranes using a Trans-Blot Turbo Tranfer System
(BioRad, USA). After blocking with 1x Animal-Free Blocking Solution (15019; Cell Signaling,
Switzerland), the membrane was incubated in primary antibody at 4 ºC over night. All primary
antibodies applied derived from rabbit hosts. Antibodies targeting BRD4 (13440), GAPDH
(4174), Hif1α (14179), RIPK2 (4142) and VHL (2738) were purchased from Cell Signaling
(Switzerland), antibodies recognizing UBE2G1 (ab101371), CUL2 (ab240149) and c-MYC
(ab32072) were purchased from Abcam (UK), and anti-CRBN (NBP1-91810) was purchased
from Novus Biologicals (Switzerland). Following a three times 10 minutes wash with TBS
supplemented with 0.05% Tween-20, membranes were incubated 1 h at room temperature with
HRP-conjugated anti-rabbit secondary antibody (7074; Cell Signaling, Switzerland). Following
another washing, protein signals were detected using enhanced chemical luminescence.

RNA/DNA Co-Extraction from Cells.

The Qiagen AllPrep DNA/RNA Mini Kit (Cat.No. 80204) was used to co-extract DNA and RNA
from cells. Briefly, ~ 4 x 106 cells were pelleted and lysed in 350 μL Qiagen RLT Plus buffer,
supplemented with 10 μL / mL beta-mercaptoethanol. The lysate was homogenized by transfer
to a QIAShredder column and centrifuged for 2 min at 20 817 x g at room temperature,
transferred to an AllPrep DNA spin column and centrifuged for 30 secs at 8 000 x g rpm at room
temperature. The flow-through containing the total RNA was transferred into a new tube for
RNA-isolation. The standard Qiagen AllPrep DNA/RNA co-extraction protocol was then followed
for purification of total RNA and genomic DNA.

Whole Exome Sequencing.

Genomic DNA was used for whole exome sequencing. The quality of DNA was assessed on the
Agilent Tapestation (DNA Screen Tape, Cat.No. 5067-5366) using the DIN score (DNA Integrity
Number). The NimbleGen SeqCap EZ Library SR User Guide V5.1 was followed using the
SeqCap EZ Exome + UTR Library (cat. No. 06740294001) to enrich for human exome
sequences. DNA was fragmented with the Covaris E210 system to an average size of 200 bp.
DNA sequencing libraries were prepared following the instructions in the KAPA Library
Preparation Kit Illumina Platform (Cat.No. KK8250) with 1 μg DNA input amount and 7 cycles of
PCR amplification. Two to three whole genome sequencing samples were multiplexed (total of
1 μg input amount) before hybridization to the SeqCap EZ Exome library and PCR amplification
(14 cycles) for enrichment in exome sequences. The exome sequencing library yield and quality
were assessed using the DNA1000 Bioanalyzer assay. Exome enrichment for all exome libraries
met QC requirements as assessed by the qPCR assays suggested in the SeqCap protocol
(NSC-0237, NSC-0268). Libraries were normalized for sequencing using the Qubit dsDNA HS
Assay Kit (Cat.No. Q33231) and sequenced on the Illumina HiSeq4000 system, paired-end 2 x
151 cycles. Between 88.7 and 121 Million paired-end reads were generated and mapped to the
human genome.
Reads were mapped on the human genome draft using the program BWA4 and duplicate reads
were removed using the program Picard (Broad Institute). Genomic variants were called using
the program FreeBayes and annotated using the program SnpEff5.

Whole Transcriptome RNA Sequencing.

3
Total RNA was used for whole transcriptome sequencing. The quality of RNA was assessed on
the Agilent Bioanalyzer using the RIN score (RNA Integrity Number) given by the RNA Nano
assay (Cat.No. 5067-1511). The TruSeq Stranded mRNA Sample Preparation Guide (library
preparation kit Cat.No. RS-122-2101/2102) was followed using 500 ng total RNA input amount
and 12 PCR cycles for RNA sequencing library amplification. The RNA sequencing library yield
and quality were assessed using the DNA1000 Bioanalyzer assay. Library concentrations were
normalized for sequencing using the Qubit dsDNA HS Assay Kit (Cat.No. Q33231) and
sequenced on the Illumina HiSeq4000 system, paired-end 2 x 151 cycles. Between 33 and 71.6
Million paired-end reads were generated and mapped.
Reads were mapped on the human genome draft hg38 using the program STAR6 and the
ENSEMBL gene models GRCh38.91. Gene counts were evaluated using the featureCounts
method7 from the Rsubread R8 library and processed using the edgeR package9 with the
weighted trimmed mean of M-values (TMM) for normalization method10 in the R environment
(Rproject.org).

Primers used in Quantitative Real-Time PCR

Taqman Gene Expression Assays: BRD4 (Hs04188087_m1), COPS8 (Hs00991301_g1), CRBN

(Hs00372266_m1), CUL2 (Hs00180203_m1), CUL4A (Hs00757716_m1), DDB1
(Hs01096550_m1), GAPDH (Hs02786624_g1), RBX1 (Hs00360273_m1), UBE2D3
(Hs00704312_s1), UBE2G1 (Hs00163320_m1), UBE2NL (Hs04184810_s1), UBE2R2
(Hs00215107_m1), VHL (Hs03046964_s1).

References for Extended Methods:

1. Schwinn, M. K., Machleidt, T., Zimmerman, K., Eggers, C. T., Dixon, A. S., Hurst, R., Hall, M. P.,
Encell, L. P., Binkowski, B. F., and Wood, K. V. (2018) CRISPR-Mediated Tagging of Endogenous
Proteins with a Luminescent Peptide, ACS Chem Biol 13, 467-474.
2. Meyers, R. M., Bryan, J. G., McFarland, J. M., Weir, B. A., Sizemore, A. E., Xu, H., Dharia, N. V.,
Montgomery, P. G., Cowley, G. S., Pantel, S., Goodale, A., Lee, Y., Ali, L. D., Jiang, G., Lubonja, R.,
Harrington, W. F., Strickland, M., Wu, T., Hawes, D. C., Zhivich, V. A., Wyatt, M. R., Kalani, Z., Chang, J.
J., Okamoto, M., Stegmaier, K., Golub, T. R., Boehm, J. S., Vazquez, F., Root, D. E., Hahn, W. C., and
Tsherniak, A. (2017) Computational correction of copy number effect improves specificity of CRISPRCas9
essentiality screens in cancer cells, Nat Genet 49, 1779-1784.
3. Tsherniak, A., Vazquez, F., Montgomery, P. G., Weir, B. A., Kryukov, G., Cowley, G. S., Gill, S.,
Harrington, W. F., Pantel, S., Krill-Burger, J. M., Meyers, R. M., Ali, L., Goodale, A., Lee, Y., Jiang, G.,
Hsiao, J., Gerath, W. F. J., Howell, S., Merkel, E., Ghandi, M., Garraway, L. A., Root, D. E., Golub, T. R.,
Boehm, J. S., and Hahn, W. C. (2017) Defining a Cancer Dependency Map, Cell 170, 564-576 e516.
4. Li, H. (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM, arXiv
preprint arXiv:1303.3997.
5. Cingolani, P., Platts, A., Wang le, L., Coon, M., Nguyen, T., Wang, L., Land, S. J., Lu, X., and Ruden,
D. M. (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms,
SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3, Fly (Austin) 6, 80-92.
6. Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and
Gingeras, T. R. (2013) STAR: ultrafast universal RNA-seq aligner, Bioinformatics 29, 15-21.
7. Liao, Y., Smyth, G. K., and Shi, W. (2014) featureCounts: an efficient general purpose program for
assigning sequence reads to genomic features, Bioinformatics 30, 923-930.
8. Liao, Y., Smyth, G. K., and Shi, W. (2019) The R package Rsubread is easier, faster, cheaper and
better for alignment and quantification of RNA sequencing reads, Nucleic Acids Res 47, e47.
9. Robinson, M. D., McCarthy, D. J., and Smyth, G. K. (2010) edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data, Bioinformatics 26, 139-140.
10. Robinson, M. D., and Oshlack, A. (2010) A scaling normalization method for differential expression
analysis of RNA-seq data, Genome Biol 11, R25.

4
5
6
Structures of BRD4 degraders, inhibitor JQ1 and E3 ligase binding moieties.

7
Luminescent detection of HiBit-BRD4 levels upon degrader treatment in HEK293A cells
transfected with indicated siRNAs.

8
Luminescent detection of HiBit-BRD4 levels upon degrader treatment in HEK293A cells
transfected with indicated siRNAs.

9
Distribution of the cell lines tested in the Public Avana 19Q1 CRISPR Knockout
Dependency Screen, available at “depmap.org”.

10
Immuno-blots of the degrader resistant MV4-11 cell lines.
A: Drug-naïve parental and CRBN-degrader resistant cells treated for 6 h with CRBN
degraders dBet1 and dBet6, or VHL-degrader MZ1. B: VHL-degrader resistant cells
treated for 6 h with VHL-degraders MZ1 and Arv-771, or CRBN-degrader dBet1. C: Drug naïve
parental and CRBN-degrader resistant cells treated for 24 h with CRBN degraders
dBet1, or VHL-degrader MZ1 and blotted for c-MYC.

11
UBE2G1 expression levels in parental MV4-11 and dBet1-R1 as determined by A:
RNASequencing or B: Quantitative Real-Time PCR.

12
Quantitative Real-Time PCR on indicated gene transcripts in drug-naïve parental MV4-11
and the degrader resistant cell lines.

13
Grouped Z-Score plot for cancer cell line screening for growth inhibition by MZ1 and
dBet6.

14
Sorted and grouped Z-Score plot for cancer cell line screening for growth inhibition by
JQ1.

15
Immuno-blots of 11 cell lines manifesting various degrader efficiencies.
Cells were treated with either MZ1, dBet6, or DMSO control at indicated concentrations
for 5 h.

16
cell-viability of 11 cancer cell lines from Suppl figure 10 upon BRD4 inhibition or
degradation. Cells were treated with indicated compounds for 72 h.

17
A: cell-viability of 11 cancer cell lines from Suppl figure 10 upon BRD4 degrader treatment. Cells
were treated with indicated compounds for 72 h.
B: Log(IC50 [M]) values from cell models in the panel A

18