Comparison and Diagnosis of Trisomy 18 and 21 in Pakistani Population Through Choronic Villus Sampling Technique

Table of Contents
Number Title Pg. No

* Acknowledgments 10
* List of abbreviations 11
* List of figures 14
* List of tables 17
* Abstract 18
1. INTRODUCTION 19
1.1 Trisomy 20
1.1.1 Classification of Trisomy on the basis of Type of Chromosome 21
1.2 Trisomy 21 21
1.2.1 Health Problems 22
1.2.2 Symptoms 23
1.2.3 Physical features 23
1.2.4 Health issues 24
1.2.5 Diagnosis 24
1.2.6 Treatment 25
1.3 Trismoy 18 26
1.3.1 Epidemiology 26
1.3.2 Clinical Diagnosis 28
1.3.3 Genetic Diagnosis 29
1.3.4 Prognosis 29
1.4 Chorionic Villus Sampling 30
Comparison and Diagnosis of Trisomy 18 and 21 in Pakistani Population through Choronic Villus Sampling Technique
Page 1
1.4.1 CVS diagnosis 31
1.4.2 CVS or amniocentesis? 32
1.6 Aims and Objectives 33
2. MATERIALS AND METHODS 34
2.1 CVS Sampling 35
2.2 Extraction of genomic DNA 38
2.2.1 From Blood samples of mother/ father 39
2.2.2 From CVS Sample 43
2.3 Polymerase Chain Reaction 44
2.3.1 Procedure 44
2.3.2 Markers 45
2.4 Gel Electrophoresis 48
2.4.1 Types of gels 48
2.4.2 Apparatus for Gel Electrophoresis 48
2.4.3 Preparation of 6% poly-acryl-amide Gel 49
2.4.4 Running Acryl Amide Gel 50
2.4.5 Staining of gel 51
3. RESULTS AND DISCUSSION 53
3.1 Demographic data and Discussion 54
* CONCLUSION AND FUTURE WORK 88
* REFERENCES 90
* APPENDIX 96
Page 2
ACKNOWLEDGEMENTS
All acclamations and appreciation are for “Almighty Allah “The merciful, the
beneficent, who has given me the wisdom and perseverance for completing this write up.
Countless solutions be upon the Holy Prophet Muhammad (Peace Be upon Him), for
enlightening with essence of faith in Allah and guiding the mankind for the true path of life.
We would like to express our appreciation to our supervisor Assistant Professor Dr.Sumbul
Khalid for her consistent encouragement, inspiring guidance, sympathetic attitude and
constructive criticism during the conduct of research and completion of this thesis.
We are highly grateful to General Dr. Suhaib Ahmed, Head of G.R.C (Genetic Resource Centre)
lab for providing us opportunity to work in his lab and guiding us throughout this study.
Last but not the least we thankuful to our loving parents for their moral support and prayers for
our achievement which enabled us to accomplish this goal. May Allah shower His Countless
Blessings on them.
Page 3
LIST OF ABBREVIATIONS
ABBREVIATION DESCRIPTION
APS Ammonium persulfate
CVS Chronic Villus Sampling
DNA Deoxyribonucleic acid
dNTPs Deoxynucleotides triphosphates
D21 Chromosome 21
D18 Chromosome 18
DD_S11 Disomic Diallelic with S11 as informative site
DD_MBP Disomic Diallelic with SMBP as informative site
Page 4
EDTA Ethylene Diamine Tetra Acetic Acid
Ic Inconclusive
MD Monoallelic Disomic
ml Milliliter
NI Not Informative
NoT21 Fetus does not have trisomy 21
NoT18 Fetus does not have trisomy 18
NoT18&21 Fetus does not have trisomy 18 and 21
NT Not Tested
PCR Polymerase Chain Reaction
PND Prenatal Diagnosis
Rpm Revolution per minute
TD_S535 TrisomicDiallelic with S535 as informative site
TD_MBP TrisomicDiallelic with SMBP as informative site
TEMED Tetramethylethylenediamine
Page 5
TT_S11 TrisomicTriallelic with S11 as informative site
TT_MBP TrisomicTriallelic with SMBP as informative site
T21 Trisomy 21
T18 Trisomy 18
µl Microliter
Page 6
LIST OF FIGURES
Figures Descriptions Pg. No.

Figure 1.1 Infant with characteristic features of Trisomy 18 – squeeze hand 27
with finger overlap.
Figure 1.2 Classic appearance of clenched hand with overlapping 2nd and 5th 28
fingers in a newborn.
Figure 2.1 CVS Sample for observing under a microscope. 32
Figure 2.2 CVS Sample on petri plate. 37
Figure 2.3 Diagrammatic representation of CVS Sampling procedure. 38
Figure 2.4 Blood Sample of Mother 39
Figure 2.5 DNA Collected in eppendrof tube 41
Figure 2.6 DNA Thermal Cycler 42
Figure 2.7 PCR Amplification system 47
Figure 2.8 Vertical poly-acryl-amide gel electrophoresis 52
Figure 3.1 Ethnicity of Patients 57
Figure 3.4 (a) Silver stained Polyacrylamide gel electrophoresis showing Fetal 60
chromosome 21 to be disomic diallelic both at S11 and S1411
marker sites
Figure 3.4 (b) Silver stained Polyacrylamide gel electrophoresis showing 61
Fetalchromosome 21 to be Trisomicdiallelic at S11 marker site
Page 7
Figure 3.4 (c) Silver stained Polyacrylamide gel electrophoresis showing Fetal 62
chromosome 21 to be Trisomictriallelic with S11 as informative
site
Figure 3.4 (d) The bands on silver stained Polyacrylamide gel (after 63
electrophoresis) depicts that fetus is having Trisomy 21 with
S1411 as informative site
Figure 3.5 (a) Silver stained polyacrylamide gel electrophoresis result showing 64
Fetal chromosome 18 (D18) to be Disomic diallelic with S51 as
informative site
Figure 3.5 (b) Silver stained polyacrylamide gel electrophoresis result showing 65
Fetal chromosome 18 (D18) to be Trisomicdiallelic with S386 as
informative site
Figure 3.5 (c) Silver stained polyacrylamide gel electrophoresis result showing 66
Fetal chromosome 18 (D18) to be monoallelic
Page 8
LIST OF TABLES
Table Description Pg. No

Number
Table 3.1 Ethnicity of no. of individuals tested for Trisomy 13,18 and 21 57
Table 3.2 a Table of Patients showing mother’s age and consanguinity of 78
parents for Trisomy 21 (Down Syndrome)
Table 3.2 b Table of Patients showing mother’s age and consanguinity of 79
parents for Trisomy 18 (Edwards syndrome)
Table 3.3 Numerical Analysis of patients for CVS record 80
Table 3.4 a Numerical analysis for trisomy 21 80
Table 3.4 b Numerical Analysis for diagnostic results of trisomy 21 80
Table 3.5 a Numerical analysis for trisomy 18 81
Table 3.5 b Numerical Analysis for diagnostic results of trisomy 18 82
Table 3.7 Numerical Analysis of Complete Diagnosis 83
Table 3.8 Numerical Results Of Patients for Trisomy 13,18 and 21 84
Page 9
ABSTRACT
Aneuploidy is the presence of an abnormal number of chromosomes in a cell, for example a human
cell having 45 or 47 chromosomes instead of the usual 46.Chromosomal aneuploidy due to non-
disjunction at meiosis is one of the most significant and common cause of miscarriages in Pakistan.
An extra or missing chromosome is a common cause of genetic disorders, including some human
birth defects.Around 50% of the spontaneous abortions before 15 weeks of gestation are
chromosomally aneuploid, with trisomies accounting for 50% of the abnormal abortions.
Trisomy,although uncommon but is among the widespread genetic disorders in Pakistan.A
technique for its pre-natal diagnosis termed as Chronic Villus Sampling (CVS) was introduced in
Pakistan in 1994. Using this technique, individuals are diagnosed for Trisomy 18 (Edward
syndrome) and 21(Down syndrome) before 13 weeks of gestational age. (E.B,1999).Then their
DNA is examine via polymerase chain reaction and polyacrylamide gel electrophoresis. The
results obtained on the gel verify the presence or absence of an extra chromosome.. After the study
it was found that out of 600 patients 9.01% of patients were having trismoy 21, 0.8% of patients
were positive for trisomy 18. It was found that trisomy 21 is the most common trisomy.
Our findings not only provides a basis for carrying out CVS for Trisomies ( 18 and 21) but also
explains about its pattern of prevalence in Pakistani population.(A.H,2002)
Page 10
CHAPTER 1
INTRODUCTION
Page 11
Chapter 1 Introduction
INTRODUCTION
Trisomy is a form of polysomy which consist of three copies of chromosome. This
aneuploidy (abnormality in chromosome number) is a result of error in meiotic disjunction. In
order to determine the origin and cause of chromosome abnormality in human many research
group work in DNA polymeric studies starting from 1980,s. Due to spontaneous abortions of
monosomies, scientists began to focus on trisomies especially in cases of borned infants. Based on
their repetitive analysis, three general priniciples of chromosomal non-disjunction were
recognized. Firstly, most trisomies are appeared during oogenesis, regardless of the specific
chromosome. Secondly, maternal meiotic I errors are more common than that of meiotic II errors.
Thirdly, the prevalence of maternal origin cases increases with aging. Nevertheless chromosome
specific differences also exist for non-disjunction such as in Trisomy 21 maternal meiotic I errors
predominate whereas maternal meiotic II errors are particularly more prominent in case of
Edwards syndrome.
Trisomy can occur with any chromosome in people, frequently result in premature deliveries.
The most well-known trisomy in human pregnancies is Trisomy and results in unconstrained fetus
removal in first trimester. The quantity of chromosomes in the cell where trisomy occur is spoken
to as, in the event that one chromosome indicates trisomy at that point there is 2n+1 and if there
are two trisomy then it demonstrates 2n+1+1 ,and so on.
1. "Full trisomy", also called "primary trisomy", means that an entire extra
chromosome has been copied.
2. Halfway trisomy" implies that there is an additional duplicate or part of a
chromosome.
3. "Secondary trisomy" - extra chromosome has quadruplicated arms (the arms are
indistinguishable; it is an "iso chromosome").
4. "Tertiary trisomy" – the extra chromosome is made up of copies of arms from
two other chromosomes.
Page 12
1.1 Classification of chromosomal abnormality:

•Sex- body Trisomy:
Trisomy in sex-chromosomes is named as sex-chromosomal chrosomal abnormality.
Examples. (XXX) Triple X disorder, (XXY) painter felter disorder .
• Chromosome Trisomy:
Trisomy in chromosome is termed as autosomal chrosomal abnormality.
In our gift study, following three important varieties of Trisomies,have been thought of .forexample,
• subnormality (Downdisorder)
• chrosomal abnormality eighteen (Edward disorder)
1.2 Trisomy 21 (Down syndrome)

Chromosome 21 involves in the most common trisomy also called Down syndrome due to
name of physician John Langdon Down.It is a genetic disorder caused by the presence of all or
part of third copy of chromosome21.It is associated with physical growth delay ,mild to intellectual
disability and characterstics of facial features.
Down syndrome (DS) occurs because of the trisomy of human chromosome 21(Hsa21).
Approximately 0.45% of human conceptions are trisomic for Hsa21.(Hassold et;al1996). The
occurance of trisomy depends on the age of the mother and it can differ among
populations(between 1 in 319 and 1 in 1000 live births are trisomic for Hsa21)(Carotahers
et;al,1999;Canfiled;et;al;2006;Wahab;et;al.,2006;Murthy;et;al;2007;O’Nullain;et;al;2007)Miscar
riages can be common in trisomic fetuses and people with DS have an increased risk of developing
several medical conditions Recent advances in medical treatment and social inclusion have
significantly increased the life expectancy of people with DS. The average life span of people in
economically developed countries who are trisomic for Has 21 is now greater than 55
years(Glasson;et;al;2002)
Trisomy of Hsa21 has show significant effect on the development of many tissues, most
notably the brain and the heart. A recent paper has suggested that trisomy of the Hsa21 genes, dual
specificity tyrosine-(Y)-phosphorylation-regulated kinase 1A (DYRK1A) and regulator of
calcineurin 1 (RCAN1), may have an impact on the development of multiple tissues
Page 13
The disease is characterized by invariant features that are common to all individuals, including
mild to moderate learning abilities, craniofacial abnormalities, hypotonia. Such an individual is at
a higher risk of health issues.As Down syndrome is caused meiotic non-disjunction error.
Previously or at origination, this leaves an egg or sperm with an additional duplicate of 21
chromosome. This mutant records for 95 percent of Down disorder cases.The remaining 5 percent
of Down disorder cases are because of conditions called mosaicism and translocation.
(Glasson;et;al;2002)
1.2.1 Medical Issues
As a toddler with mongolianism ,he is at giant risk surely medical issues and will develop:
(Carothers et al., 1999; Canfield et al., 2006; Wahab et al., 2006; Murthy et al., 2007;
O’Nuallain et al., 2007
• Sleeping disorder
• Feeding drawback
• Endocrinologic disorders
• Channel abnormalities
• Organic process abnormalities
• Hearing impairment
• Movement drawback
• Heart defects
1.2.2 Symptoms
Down syndrome is not a disorder thus it's going to be additional correct to refer
characteristics instead of symptoms.
Down disorder patients ofttimes have all around characterised physical highlights, special
medical issues, and changes in subjective advancement(Morris et al., 1999).
Page 14
1.2.3 Physical characteristics
Physical characteristics include:
 Decreased or poor muscle tone

 Flattened facial profile and nose
 Protruding tounge
 Small head ,ears and nose
 Large space amongst extensive and second toe
 Short neck
 Low muscle tone
1.2.4 Medical Problems
Some broad medical issues can influence any organ framework or capacity of the body. Around
half surprisingly with Down disorder have an innate heart imperfection.(Hassold et al.,
1996).There may likewise be a higher danger of:
 Hearing issue
 Leukemia
 Thyroid conditions
 Heart defects
 Dementia
1.2.5 Diagnosis and Tests
Ladies with a higher shot of having a kid with Down disorder may get screening and dignostic
tests.Screening tests can indicate the likelihood or chances that a mother is carrying a baby with
Down syndrome. While some dignostic tests tells whether the baby has Down
Syndrome.Indicative tests are more suitable in identifying Down disorder and different issues.
They are typically performed inside the placenta, and they increment the danger of unnatural
birth cycle, fetal damage, or preterm work. Analytic tests include: s
Page 15
• Chorionic villus testing: At 8 to 12 weeks, a modest example of placenta is gotten for

examination, utilizing a needle embedded into the cervix or the guts.
• Amniocentesis: At 15 to 20 weeks, a little measure of amniotic liquid is gotten for

investigation, utilizing a needle embedded into the belly.
Paralogous sequence quantification (PSQ) is a new method that used for the detection and analysis
of targeted chromosomal abnormalities.There is a greater chance in paralogous sequences to more
sequences that are identical.
1.2.6 Treatment
There is no particular treatment for down disorder. Individuals with the disorder will get tend
to medical issues, similarly as other individuals do. In any case, extra wellbeing screening for
normal issues might be suggested.
Early intercession can enable the person to amplify their potential and set them up to play a
functioning part in the network.Beside specialists, social worker, dialect instructors, word
related guides, physical masters, and educators would all have the ability to help. The National
Institute for Child Health and Human Development (NICHHD) request that all individuals give
fondness and reassurance.
1.3 Trisomy 18
1.3.1 Epidemiology
Trisomy 18 is the second most basic trysomy behind Down disorder.Trysomy also known as
Edward syndrome.Many parts of the body are effected .Babies are often born small and have heart
defects.
This disorder has a frequency of between 1 out of 3000 and 1 out of 8000, with a 3:1 Female.
Male predominance.90 percent of cases of trisomy 18 are due to maternal nondisjunction and 10
Page 16
percent cases are due to mosaicism and less than 1 percent of cases are due to
translocation. (spelling ,1994)
1.3.2 Clinical Diagnosis
Trisomy 18 typically presents with some combination of the following features:
 Clenched hand, with cover of the second and fifth fingers, over the third and fourth
 Intrauterine development impediment (IUGR)
 Low set ears sssss
 Rocker base feet
 Strawberry formed caldarium
 Mental hindrance
 Renal variations from the norms
 Overlapping fingers
Figure 1.1: Infant with characteristic features of Trisomy 18 – squeeze hand with finger overlap
Page 17
Figure 1.2: Classic appearance of clenched hand with overlapping 2nd and 5th fingers in a
newborn.
1.3.3Genetic Diagnosis
Trisomy 18 is affirmed by cerotype with FISH examination. FISH, or Fluorescence In Situ

Hybridization, is an indicative pre-birth test which searches for a couple of regular chromosomal
abnormalities. A fluorescent color is utilized to picture and guide the hereditary cosmetics in cells.
FISH is typically performed with the same hereditary material gathered for testing amid CVS.
1.3.4 Prognosis
Trisomy 18 is associated with severe mental retardation and severe failure to thrive. 90
percent of patients die by one year of life while 50 percent of patients die by one week of life.
1.4 Chorionic Villus Sampling
Chorionic villus examining (CVS) is a pre-birth test that judgments chromosomal

disarranges, for example, Down disorder, and additionally a large group of other hereditary
disorders. The specialist takes the chorionic villa from your placenta which is a figure like
projection and sends them to a lab for hereditary investigation.
Page 18
Amniocentesis and CVS create a photo of your child's chromosomes, so your buddy can check
whether there is any issue. Both of these tests are obtrusive and convey a little danger of
premature delivery.
Between the 10 and 13 weeks of pregnancy you can have it done in the case of CVS test.
But for amino, you’ll have to wait until you are at least 16 weeks pregnant.
1.6 Aims and Objectives:
The developed countries(America,Japan.China) with high prevalence of genetic disorders, have

almost completely controlled the new births of affected children. Unfortunately many high risk
countries with limited resources continue to face an ever increasing numbers of children affected
by these disorders. Trisomy is a mammoth problem in Pakistan. The facilities for diagnosis and
treatment are suboptimal and the importance of prevention is only beginning to be realized.
Besides Many other challenges,the lack of credible information on epidemiology, diagnosis,
treatment strategies, and prevention is a significant contributory factor.(Hassold,1980).
The objective of the study was to find the prevalence of trisomy 18 and 21 . Also the contributing
factors were studied which were responsible for the occurrence of trisomy in the fetus.
Page 19
CHAPTER 2
MATERIALS AND METHODS
Page 20
Chapter 2Materials and Methods
MATERIALS AND METHODS
In this study, different trisomies (13, 18 and 21) in Pakistani population were studied
through transabdominal chorionic Villus Sampling (CVS). The research was carried out in GRC
(Genetic Resource Centre Laboratory).Under kind supervision of Dr .Sohaib.
A total of 600 blood samples were collected from different regions of Pakistan. Before
sample collection,informed written consents were obtained from the participants of the study.
The sequence of genetic analysis is as follows:
 DNA Extraction First of all DNA is extracted from blood/CVS sample taken from
patients.
 PCR is performed to amplify the DNA so that DNA is not lost during the experiment.
 From the amplified product (DNA) Gel Electrophoresis is performed.(To check the
presence of extra band/allele or to check whether the fetus had trisomy or not)
2.1 CVS Sampling
Before the procedure, a written consent was obtained from all couples. A preliminary ultrasound
scan was done to determine the fetal viability, gestational age, number and placental position.
When the gestational age was 10 weeks or more, CVS was carried out immediately. Otherwise,
the procedure was deferred till a date corresponding to about 12 weeks’ gestation. The size and
position of placenta was ascertained and a suitable site for introducing the needle on the anterior
abdominal wall was selected. The abdominal skin in a radius of about 10 cm was cleaned with
plodding. The CVS needle was introduced from the puncture site of the local anesthetic. After
piercing the Uterine wall , the needle was pushed with a jerky movement to enter the placenta, it
was sufficiently advanced to leave at least 2 cm of the placental tissue ahead of the needle tip. A
30 ml disposable syringe was attached to the CVS inner needle. The syringe and the inner needle
Page 21
in the locked position were jiggled to and fro for about 10-12 times. This caused localized
damage to the placenta and with the simultaneous suction force the disrupted villa were sucked
into the needle. The sample was flushed into a sterile Petri dish containing normal saline. Finally,
the outer needle was removed and the puncture mark was sealed with a sterile elastic bandage
(Ahmed, 2016).
FIGURE 2.1: CVS Sample for observing under a microscope
Page 22
FIGURE 2.2: CVS Sample on Petri plate
Page 23
FIGURE 2.3: Diagrammatic representation of CVS Sampling procedure
2.2 Extraction of genomic DNA
Genomic DNA was extracted from the blood samples of father and mother and CVS sample by
using the Chile method.
Page 24
2.2.1 From Blood sample of Mother/Father
In order to find the trisomy of father and mother, we carried out the extraction of DNA from the
blood samples of father and mother. The protocol is as follows:
1. Take 1000 micro-liter of distilled water by micropipette and place it in the tube which is
placed in tray.
2. Take the blood sample tube and mix the blood properly by shaking.
FIGURE 2.4: Blood Sample of Mother
3. Add 250 micro-liter of blood in tube containing water with the help of micropipette
4. Vortex for 2 minutes for proper mixing
5. Incubate for 1 minute at room temperature invert gently 10 times during the incubation
(for fresh blood collected within 01 hour increase incubation time to 03 minutes)
Page 25
6. Centrifuge for 20 seconds at 5000 rpm.(revolution per minute). Remove as much
supernatant as possible with a pipette leaving behind the visible white cell pellet and
about 10-20 up of residual liquid.
7. Remove supernatant, now first washing is complete.
Second Washing:
8. Repeat the steps again from 1.
 Add distilled water (in blood containing tubes)
 Do vortex
 Do Centrifuge(here for 2 minutes)
 Separate supernatant (by micro-pipette)
Second was his complete, in it the supernatant will be lighter in color.
Third Washing:
9. Repeat the steps again from 1.
 Add distilled water (in blood containing tubes)
 Do vortex
 Do Centrifuge(here for 2 minutes)
 Separate supernatant (by micro-pipette)
Third wash is complete, in it the supernatant will be white in color.
10. Add 200 µl telex 10%.
11. Vortex for 20 seconds and centrifuge for 13000-16000 rpm for 02 minutes.
12. Incubate at 95°C for 20 minutes.
13. Again vortex for 20 seconds and centrifuge for 13000-16000 rpm for 02 minutes.
Page 26
14. Separate the supernatant into the new eppendorf tube containing the DNA. Now DNA
becomes ready for use.
FIGURE 2.6: DNA Thermal Cycler
Page 27
2.2.2 DNA extraction from CVS Sample
DNA Extraction from CVS Sample is same as DNA Extraction from blood, but there are no 3
times washing in case of CVS Sample. From these cells, the DNA is extracted by the same
chelex method as described above.
1. Take CVS, Add chelex (40ul) in CVS tissues.
2. Do Vortex for 20 seconds.
3. Centrifuge for 01 minute at 13000 rpm at room temperature.
4. Keep in dry bath for 15 minutes at 94°C.
5. Do vortex for 20 seconds for mixing.
6. Separate the upper layer containing DNA from chelex.
7. Discard other things(as chelex will attract all other things) and settle at bottom.
8. Supernatant is collected in a separate tube, as DNA is present in the supernatant
2.3 Polymerase Chain Reaction
Polymerase chain reaction (PCR) is a molecular technique used for the amplification of small
fragments of DNA to create millions of copies of DNA. This technique was developed by Kary
Mullis in 1983 and now extensively used in clinical and research laboratories for a wide range of
applications (Bartlett &Stirling, 2003)
We used the Amplification Refractory Mutation System (ARMS) in which DNA is amplified by
allele specific primers. The ARMS PCR requires a pair of primers including a common control
and an ARMS primer

Page 28
2.3.1 Procedure
Following constituents and reagents were added in PCR tubes.
1. Extracted DNA (2 microliters in each tube)
2. Taq Polymerase (0.1 microliters in each tube)
3. PCR Mix containing buffer and dNTPs (20 microliters in each tube)
4. Primers (Both forward and reverse) for specific marker site on specific chromosome (1
microliter in each tube)
Firmly close the lids of the tubes and put these in thermal cycler (figure). Programme the PCR
machine and run it as follows.
a) Initial denaturation 94°C for 5 minutes
b) Run 30 cycles of PCR, each with denaturation at 94°C for 1 minute, annealing at 60°C for
1 minute and extension at 72°C for another 1 minute.
c) Final extension at 72°C for 3 minutes.
2.3.2 Indicators
Different markers are used for primer designing. The list of markers we used was provided by the
GRC lab. Besides the references are given for the markers used.
For Chromosome 18: (52)
D18-S551
D18-S386
D18-S535
Page 29
D18-MBP
For Chromosome 21: (52)
D21-S11
D21-S1411
D21-S1412
D21-S1414
Different primers are used, the markers are for different portions of chromosomes, the markers
which give bands are used. The sequences of all the markers used are given at the end in the
appendix.
Page 30
FIGURE 2.7: PCR Amplification system
Page 31
2.4 Gel Electrophoresis
Electrophoresis is used for the separation of DNA, RNA, or other charged molecule like proteins
by an electric current applied to a gel matrix. In PCR amplification it is usually done for separation
and visualization of DNA after PCR or sequencing.
2.4.1 Types of Gels
 SDS PAGE: Sodium Dodecyl sulfate PAGE. This type of gel is used in the gel
electrophoresis where the separation of proteins is required.
 PAGE: Poly-acryl-amide Gel Electrophoresis. This type of gel is used in the gel
electrophoresis where the separation of DNA is required.
o We used PAGE in our research as the separation of DNA was required in the
experiment.
2.4.2 Apparatus for Gel Electrophoresis:
The following apparatus was used for gel electrophoresis: (Uses?)
1. Poly-acryl-amide (6%)
2. APS (Ammonium per sulphate)
3. Temed
4. Vertical Gel Electrophoresis assembly
5. Micropipette
6. Agarose Gel
Page 32
7. Glass slides
8. Spacers
9. Comb
10. Syringe
11. Beaker
12. Ethanol
13. Glass pipette
14. Buffer
15. Gel Tank (Horizontal Gel Assembly)
16. Sample
17. Dye (Bromophenol blue)
18. Mixture of NaOH (100ml) + formaldehyde (70 ml)
2.4.3 Preparation of 6% poly-acryl-amide Gel
1. Take 10ml 6% acrylamide in a small beaker.
2. Add 100ul 10% ammonium phosphate (APS) not older than one week.
3. Add 20ul Temed.
4. Gently mix and fill the polymer in a 10ml syringe.
5. Attach a 21 gauge butterfly needle set and gently push the plunger to fill the polymer in
the tubing. Remove bubbles in the tube if necessary.
6. Gently pour the acrylamide between the plates before the gel polymerization starts (within
2-3 minutes).
7. Remove bubbles if any by gently tapping the plates.

Page 33
8. Placed the appropriate sample comb in the gel tray.
9. Allow up to 30 minutes for complete polymerization to occur.
2.4.4 Running Acryl Amide Gel
 Chemicals for base preparation
i) Acryl-amide 6%
ii) APS – 60 ul
iii) Temed – 12 ul
 Chemicals for Layer Preparation
i) Acryl-amide 6ml
ii) APS – 60ul
iii) Temed – 12ul
Steps:
1. Clean the apparatus (Glass slides + spacers etc) using ethanol, and set the apparatus for
use.
2. Prepare base in a beaker and mix instantly by syringe. Mix by air suction in and out.
3. Pour the liquid base in the prepared glass slides and leave it.
4. Leave the base for 10 minutes so that it can solidify and prevent the leakage of layer.
5. Meanwhile, prepare the layer in a beaker, taking the ingredients mentioned above. Pour the
layer in the prepared glass slides.
Page 34
6. Place the combs in the layer so that wells are formed till the gel is drying. Leave it for 5-
10 minutes to solidify. Combs can be of different sizes depending on the number of teeth
or the size of the apparatus.
7. Leave the combs for 10 minutes, Remove the combs and wash the formed wells with buffer
(EDTA). Washing is important to prevent contamination.
8. Load 3ul dye + 3ul sample DNA in sample plate, mix the dye and DNA properly.
9. Load the mixture of dye + sample DNA(6ul) in the formed wells of the gel.
10. Place the prepared slides in the gel tank and run on 150 voltage for 30 minutes.
11. Progress of electrophoresis can be monitored by movement of the blue coloured loading
dye.
2.4.5 Staining of gel
Remove the gel from casting assembly. Put the gel in 0.1% silver nitrate solution for 15-20
minutes. Discard the stain and wash the gel in plenty of tap water. The stain may be reused if kept
in dark brown bottles. Submerge the gel completely in 1.5% silver nitrate solution. In
approximately 5-10 minutes the bands of amplified DNA can be seen on the gel. The background
of the gel also becomes light yellowish brown. Discard the solution and wash the gel in plenty of
water when the DNA bands are clearly seen. Cut a piece of filter paper slightly larger than the gel
itself and lay it flat on the gel surface. Gently pick the filter paper along with the gel that sticks to
its surface. Place the gel and the filter paper on a gel dryer making sure that the gel faces towards
the front. Dry the gel under vacuum for 20-30 minutes at 80°C.
Page 35
FIGURE 2.8: Vertical poly-acryl-amide gel electrophoresis
Page 36
Chapter 3Results and Discussion
CHAPTER 3
RESULTS
AND
DISCUSSION
Page 37
RESULTS AND DISCUSSION

Chromosome abnormality is considered as one of the most crucial and common cause of
miscarriages in humans. Almost 50% of the spontaneous abortions before 15 weeks of pregnancy
are chromosomal aneuploidy, with trisomies accounting 50% of the abnormal abortions (Hassold
et al., 1980). In our research project, our main objective was to know the prevalence of three
significant types of trisomies i.e. Trisomy 18 (Edwards syndrome) and Trisomy 21 (Down
syndrome) in Pakistani population and their comparison. From the complete genetic analysis, CVS
diagnosis at Genetic Resource Centre (GRC Labs) and computational analysis via R language we
came to know that percentage of Down syndrome in Pakistan is 5.614%, Edwards syndrome is
0.41% .From these results we can conclude that although all above mentioned chromosomal
abnormalities are extremely rare in Pakistan but still there is a considerable need to eradicate them.
The risk of these trisomies is directly proportional to mother’s age and consanguinity of parents.
Another point worth mentioning is that the low frequency of band visibility (via gel
electrophoresis) of D21-S1412, D21-S1414, D18-S386, D18-S535, D18-MBPs chromosome
marker sites does not mean that they are less informative. This is just because they are not tested
very frequently. This whole study was formally approved by the Ethical and research committee
of IIUI.
3.1 Demographic Data and Discussion

After the collection of demographic data of patients, results were analysed on the basis of
ethnic groups, gestational age, mother’s age and consanguinity of parents. The ethnic groups
observed were Punjabi, Sindhi, Baluch, Pathan, Saraiki, Hindku, Potohari, Afghani, Kashmiri and
Urdu Speaking with highest number of patients observed in Punjab (Figure 3.1). Most of the
patients had their CVS done before 13 weeks of gestation period but some of them also had gone
through this test in later weeks (Figure 3.2). The age group distribution of mothers’s age is shown
Figure 3.3. The results of silver stained gel electrophoresis confirms the presence of chromosomal
aneuploidy in patients. As Figure 3.4 (a, b, c and d) shows different results for the individuals
tested for the presence of Down syndrome. Similarly Figure 3.5(a, b and c) and Figure 3.6 (a, b)
Page 38
shows multiple types of gel results that are obtained, when tested for the confirmation of Edwards
syndrome (Trisomy 18)
Out of total 600 patients analysed, total 32 individual fetuses were diagnosed with Down
Syndrome with 25 mothers more than 35 years of age (Table 3.1) and the two women with fetus
having Edwards syndrome and Patau syndrome were at the age of 41 and 38 years respectively
(Table 3.2 and 3.3). Out of 60 Down Syndromefetuses, only 8 had their parents unrelated while
the rest of the couples were either 1ST cousins or belong to the same family tree. Similarly, the and
18 fetuses were also related. According to our observation and R analysis there is a very
unpredictable relationship between mother’s age, consanguinity of parents and Chromosomal
abnormalities. From the Table 3.1 it can be seen that there are two ladies with just 26 years of age
which are expecting fetuses with Trisomy 21; whereas there are number of ladies with more than
40 years of age but still have normal fetuses (Appendix).
Figure 3.10 (a,b,c and d) shows individual boxplots with multiple diagnostic results for Trisomy
21,18,and final report corresponding to mother’s age respectively. It can be seen that in most of
the trisomy cases the mother’s age is more than 30. Certain variations occurs in the results.
Page 39
Figure 3.1: Ethnicity of Patients
Table 3.1: Ethnicity of no. of individuals tested for Trisomy 13,18 and 21
ETHNICITY NO. OF INDIVIDUALS

Punjabi 192
Pathan 72
Urdu 23
Hindko 1
Kashmiri 6
Saraiki 2
Baloch 1
Hindu 1
Afghani 1
Unknown 68
Page 40
FIGURE 3.2: Bar plot depicting the gestational age of fetus (weeks) versus the total number of
individuals assessed for Trisomy, 18 and 21.
Page 41
Figure 3.3: Bar plot of Mother’s age verses number of individual patients assessed for Trisomy
18 and 21.
Page 42
Figure 3.4 (a): Silver stained Polyacrylamide gel electrophoresis showing Fetal chromosome 21
to be disomic diallelic both at S11 and S1411 marker sites.
Page 43
Figure 3.4 (b): Silver stained Polyacrylamide gel electrophoresis showing Fetal chromosome 21
to be Trisomicdiallelic at S11 marker site.
Page 44
Figure 3.4 (c): Silver stained Polyacrylamide gel electrophoresis showing Fetal chromosome 21
to be Trisomictriallelic with S11 as informative site
Figure 3.5 (a): Silver stained polyacrylamide gel electrophoresis result showing Fetal
chromosome 18 (D18) to be Disomic diallelic with S51 as informative site.
Page 45
Figure 3.4 (d): The bands on silver stained Polyacrylamide gel (after electrophoresis) depicts
that fetus is having Trisomy 21 with S1411 as informative site
Figure 3.5 (b): Silver stained polyacrylamide gel electrophoresis result showing Fetal
chromosome 18 (D18) to be Trisomicdiallelic with S386 as informative site.
Page 46
Figure 3.5 (c): Silver stained polyacrylamide gel electrophoresis result showing Fetal
chromosome 18 (D18) to be monoallelic.
Page 47
TABLE 3.2 a: Table of Patients showing mother’s age and consanguinity of parents for Trisomy
21 (Down Syndrome).
S.NO AGE OF MOTHER CONSANGUINITY ETHNICITY

OF PARENTS
1. 40 1st cousion Punjabi
2. 35 Related Punjabi
5. 44 Unrelated Punjabi
6. 32 1st cousion Pathan
11. 35 Related Pathan
12. 33 Unrelated Pathan
13. 38 Unrelated Pathan
14. 43 1st cousion Punjabi
17. 40 related Punjabi
Page 48

26. 33 related Urdu
27. 34 Its cousin Urdu
30. 25 Its cousin Punjabi
31. 27 Its cousin Punjabi
32. 22 Its cousin Shrike
37. 33 Its cousin Kashmir
41. 43 Unrelated Kashmir
46. 38 Unrelated Belch
47. 36 Unrelated Belch
48. 33 related Belch
49. 43 Related Belch
50. 43 related Hind
51. 22 related Hank
Page 49
52. 26 related Hind

53. 26 related Hindu
54. 28 related Hindu
55. 33 related Pathan
56. 38 related Pathan
57. 37 Its cousin Pathan
58. 46 Its cousin Pathan
59. 45 unrelated Afghani
60. 43 unrelated Afghani
Table 3.2 b: Table of Patients showing mother’s age and consanguinity of parents for Trisomy
18 (Edwards’s syndrome).
S.NO AGE OF MOTHER CONSANGUINITY OF PARENTS

01 41 Related
Table 3.2 c: Table of Patients showing mother’s age and consanguinity of parents for Trisomy
13 (Patio syndrome).
S.NO AGE OF MOTHER CONSANGUINITY OF PARENTS

01 38 Related
Page 50
Calculations
Table 3.3 Numerical Analysis of patients for CVS Record
Previous CVS Record No. of patients (600)
With Previous CVS 40
Without Previous CVS 300
Uncertain 260
Table 3.4a Numerical analysis for trisomy 21
Chromosomes with marker sites No. Of Patients

D21S11 380
D21S1411 160
D21S1412 20
D21S1414 10
Not Tested 30
Total 600
Observed frequency of particular genetic markers is mentioned as numerical analysis in table
3.4a
Table 3.4 b Numerical Analysis for diagnostic results of trisomy 21
Disomic Diallelic with S11 (as informative site 204

Trisomicdiallelic with S11 (as informative site) 9
TrisomicTriallelic with S11 (as informative site) 3
Monoallelic with S11 (as informative site) 1
Inconclusive with S11 (as informative site) 1
Page 51
Total 218/218
Disomic Diallelic with S1411 (as informative site) 103
Inconclusive S1411 0
Non-informative S1411 0
Total 126/126
TrisomicDiallelic with S1412 (as informative site) 1
Trisomictriallelic with S1412 (as informative site) 0
Total 11/11
Inconclusive with S1414 1
Total 8/8
Table 3.5 a Numerical analysis for trisomy 18
D18S51 127
D18S386 7
D18S535 04
D18MBP 10
Not tested 219
Page 52
Total 148+219= 367

Monoallelic disomic with S51 (as informative site) 2
Non-informative with S51 18
Total 127/127
Inconclusive S386 0
Total 7/7
Total 4/4
Disomic Diallelic with MBP (as informative site) 10
TrisomicDiallelic with MBP (as informative site) 0
TrisomicTriallelic with MBP (as informative site) 0
Page 53
Monoallelic with MBP (as informative site) 0

Non-informative with MBP 0
Inconclusive with MBP 0
Total 10/10
Table 3.6 a Numerical analysis for trisomy 13
D13S317 130
D13S258 6
D13S631 9
D13S634 3
NOT TESTED 219
Total 148+219=367

Page 54
Monoallelic disomic with S317 (as informative site) 0

Total 130/130
Inconclusive S258 0
Total 6/6
Total 9/9
Total 3/3
Table 3.7 Numerical Analysis of Complete Diagnosis
Result No. of patients
Page 55
Fetus does not have Trisomies 13,18 & 21 94

Fetus does not have Trisomy 21 199
Fetus does not have Trisomies 13 & 18 1
Fetus has Trisomy 21 32
Inconclusive result 3
Table 3.8 Numerical Results Of Patients for Trisomy 13,18 and 21
Results Of patients (600)

D21 D18 D13
Disomic Diallelic 323 119 127
TrisomicDiallelic 26 1 1
TrisomicTriallelic 6 0 0
Total Trisomy 60 1 1
Monoallelic+NI+Ic 8 28 20
Not tested 4 219 219
Percentage of Trisomy 21
We calculated the percentage of patients having trisomy 21 out of 367 patients and found that
9.01% patients were positive for the trisomy.
Total no. of patients = 600
Not tested for D21 = 10

Page 56
Inconclusive = 20
= 570
Percentage = Total trisomy 21/ Total no. of patients tested for D21 x 100
= (60/570) x 100 = 10.526%
Percentage of Trisomy 18
For trisomy 18 also, the percentage was calculated and it was found that 0.83% of patients were
positive for trisomy 18. It means that trisomy 21 is more common than trisomy 18 in Pakistani
population.
Total no. of patients = 600
Not tested for D18 = 300
Inconclusive = 60
= 240
Percentage = Total trisomy 18/ Total no. of patients tested for D18 x 100
= (1/240) x 100 = 0.412%
Page 57
Chapter 4Conclusion and Future Work
CHAPTER 4
CONCLUSION
AND
FUTURE WORK
Page 58
Chapter 4Conclusion and Future Work
CONCLUSION AND FUTURE WORK

One of the most common and crucial cause of miscarriages in the world is chromosomal
aneuploidy. In the present study, we tried to calculate the prevalence of Trisomy 13, 18 and 21 in
Pakistan and analyze its risk factors. It was observed that age of mother, delayed conception and
family marriages are the contributory factors for this problem. However, presence of above
mentioned factors can never confirm chromosomal aneuploidy. Secondly, the prevalence of
Trisomy 21 (Down syndrome) in Pakistani population is far greater as compared to and Trisomy
18 (Edwards syndrome).
Pre-natal diagnosis using CVS before 13 weeks of gestation period provides a very
promising solution to prevent its spread in the country. The problem in Pakistani population is the
lack of awareness about the problem and how to deal with it. Certain labs like GRC lab is providing
the cost-effective techniques for pre-natal diagnosis. Normally in hospitals the cost of CVS and
pre-natal diagnosis is around 50,000 PKR. which is reduced to 10,000 in GRC lab. We should try
to make this expensive treatment cost effective for the general population. Also there is a need to
make people aware about the consequences of cousin marriages if there is a prevailing disorder
running in the family history because in many cases cousin marriages and the age of mother were
contributing factors. Awareness campaigns can be held for trisomies as it is not commonly known
by the general population of Pakistan. Awareness is the key factor to make any society progressive.
Future work should be done to answer the reason behind the influence of maternal age on
chromosomal non-disjunction. Similarly, is there any influence of paternal age and genetic
susceptibility factors on chromosomal aneuploidy ? Do environmental factors affect cell division
?Lastly, how does consanguinity among parents contribute towards chromosomal non-disjunction.
Page 59
Chapter 5 References
CHAPTER 5
REFERENCES
Page 60
REFERENCES
Arron, J. R., Winslow, M. M., Polleri, A., Chang, C. P., Wu, H., Gao, X., ... & Yamasaki,
N. (2006). NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on
chromosome 21. Nature, 441(7093), 595.
Adayev, T., Chen-Hwang, M. C., Murakami, N., Wang, R., & Hwang, Y. W. (2006).
MNB/DYRK1A phosphorylation regulates the interactions of synaptojanin 1 with
endocytic accessory proteins. Biochemical and biophysical research
communications, 351(4), 1060-1065.
Aranda, S., Alvarez, M., Turró, S., Laguna, A., & de la Luna, S. (2008). Sprouty2-
mediated inhibition of fibroblast growth factor signaling is modulated by the protein
kinase DYRK1A. Molecular and cellular biology, 28(19), 5899-5911.
Altafaj, X., Dierssen, M., Baamonde, C., Martí, E., Visa, J., Guimerà, J., ... & Estivill,
X. (2001). Neurodevelopmental delay, motor abnormalities and cognitive deficits in
transgenic mice overexpressing Dyrk1A (minibrain), a murine model of Down’s
syndrome. Human molecular genetics, 10(18), 1915-1923.
Ahn, K. J., Jeong, H. K., Choi, H. S., Ryoo, S. R., Kim, Y. J., Goo, J. S., ... & Song, W.
J. (2006). DYRK1A BAC transgenic mice show altered synaptic plasticity with learning
and memory defects. Neurobiology of disease, 22(3), 463-472.
Antonarakis, S. E., Lyle, R., Dermitzakis, E. T., Reymond, A., & Deutsch, S. (2004).
Chromosome 21 and down syndrome: from genomics to pathophysiology. Nature
reviews genetics, 5(10), 725.
Page 61
Avramopoulos, D., Grigoriadou, M., Petersen, M. B., Mikkelsen, M., & Vassilopoulos,
D. (1996). Apolipoprotein E allele distribution in parents of Down's syndrome
children. The Lancet, 347(9005), 862-865.
Allen, E. G., Freeman, S. B., Druschel, C., Hobbs, C. A., O’Leary, L. A., Romitti, P. A.,
... & Sherman, S. L. (2009). Maternal age and risk for trisomy 21 assessed by the
origin of chromosome nondisjunction: a report from the Atlanta and National Down
Syndrome Projects. Human genetics, 125(1), 41-52.
Carothers, A. D., Hecht, C. A., & Hook, E. B. (1999). International variation in reported
livebirth prevalence rates of Down syndrome, adjusted for maternal age. Journal of
medical genetics, 36(5), 386-393.
Canzonetta, C., Mulligan, C., Deutsch, S., Ruf, S., O'Doherty, A., Lyle, R., ... &
Schnappauf, F. (2008). DYRK1A-dosage imbalance perturbs NRSF/REST levels,
deregulating pluripotency and embryonic stem cell fate in Down syndrome. The
American Journal of Human Genetics, 83(3), 388-400.
Canzonetta, C., Mulligan, C., Deutsch, S., Ruf, S., O'Doherty, A., Lyle, R., ... &
Schnappauf, F. (2008). DYRK1A-dosage imbalance perturbs NRSF/REST levels,
deregulating pluripotency and embryonic stem cell fate in Down syndrome. The
American Journal of Human Genetics, 83(3), 388-400.
Dowjat, W. K., Adayev, T., Kuchna, I., Nowicki, K., Palminiello, S., Hwang, Y. W., &
Wegiel, J. (2007). Trisomy-driven overexpression of DYRK1A kinase in the brain of
subjects with Down syndrome. Neuroscience letters, 413(1), 77-81.
De Lagrán, M. M., Altafaj, X., Gallego, X., Martı, E., Estivill, X., Sahun, I., ... & Dierssen,
M. (2004). Motor phenotypic alterations in TgDyrk1a transgenic mice implicate
Page 62
DYRK1A in Down syndrome motor dysfunction. Neurobiology of disease, 15(1), 132-
142.
Devilee, P., Cremer, T., Slagboom, P., Bakker, E., Scholl, H. P., Hager, H. D., ... &
Pearson, P. L. (1986). Two subsets of human alphoid repetitive DNA show distinct
preferential localization in the pericentric regions of chromosomes 13, 18, and
21. Cytogenetic and Genome Research, 41(4), 193-201.
Dowjat, W. K., Adayev, T., Kuchna, I., Nowicki, K., Palminiello, S., Hwang, Y. W., &
Wegiel, J. (2007). Trisomy-driven overexpression of DYRK1A kinase in the brain of
subjects with Down syndrome. Neuroscience letters, 413(1), 77-81.
De. Lagrán, M. M., Altafaj, X., Gallego, X., Martı, E., Estivill, X., Sahun, I., ... &
Dierssen, M. (2004). Motor phenotypic alterations in TgDyrk1a transgenic mice
implicate DYRK1A in Down syndrome motor dysfunction. Neurobiology of
disease, 15(1), 132-142.
Deutsch, U Choudhury, SE Antonarakis. Detection of trisomy 21 and other
aneuploidies by paralogous gene quantification. J Med Genet (in the press).
de Graaf, K., Hekerman, P., Spelten, O., Herrmann, A., Packman, L. C., Büssow, K.
& Becker, W. (2004). Characterization of Cyclin L2, a novel cyclin with an
arginine/serine-rich domain phosphorylation by DYRK1A and colocalization with
splicing factors. Journal of Biological Chemistry, 279(6), 4612-4624.
de Graaf, K., Czajkowska, H., Rottmann, S., Packman, L. C., Lilischkis, R., Lüscher,
B., & Becker, W. (2006). The protein kinase DYRK1A phosphorylates the splicing
factor SF3b1/SAP155 at Thr434, a novel in vivo phosphorylation site. BMC
biochemistry, 7(1), 7
Page 63
Fuentes, J. J., Genescà, L., Kingsbury, T. J., Cunningham, K. W., Pérez-Riba, M.,
Estivill, X., & Luna, S. D. L. (2000). DSCR1, overexpressed in Down syndrome, is an
inhibitor of calcineurin-mediated signaling pathways. Human molecular
genetics, 9(11), 1681-1690.
Gwack, Y., Sharma, S., Nardone, J., Tanasa, B., Iuga, A., Srikanth, S., ... & Rao, A.
(2006). A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as
regulators of NFAT. Nature, 441(7093), 646.
Gwack, Y., Sharma, S., Nardone, J., Tanasa, B., Iuga, A., Srikanth, S., ... & Rao, A.
(2006). A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as
regulators of NFAT. Nature, 441(7093), 646.
Glasson, E. J., Sullivan, S. G., Hussain, R., Petterson, B. A., Montgomery, P. D., &
Bittles, A. H. (2002). The changing survival profile of people with Down's syndrome:
implications for genetic counselling. Clinical genetics, 62(5), 390-393.
Hassold, T., Chen, N., Funkhouser, J., Jooss, T., Manuel, B., Matsuura, J., ... &
Jacobs, P. A. (1980). A cytogenetic study of 1000 spontaneous abortions. Annals of
human genetics, 44(2), 151-164
Huang, Y., Chen-Hwang, M. C., Dolios, G., Murakami, N., Padovan, J. C., Wang, R.,
& Hwang, Y. W. (2004). Mnb/Dyrk1A phosphorylation regulates the interaction of
dynamin 1 with SH3 domain-containing proteins. Biochemistry, 43(31), 10173-10185.
Ishkanian, A. S., Malloff, C. A., Watson, S. K., Chi, B., Coe, B. P., Snijders, A., ... &
MacAulay, C. (2004). A tiling resolution DNA microarray with complete coverage of
the human genome. Nature genetics, 36(3), 299.
Page 64
Kim, E. J., Sung, J. Y., Lee, H. J., Rhim, H., Hasegawa, M., Iwatsubo, T., ... & Chung,
K. C. (2006). Dyrk1A phosphorylates α-synuclein and enhances intracellular inclusion
formation. Journal of Biological Chemistry, 281(44), 33250-33257.
Liu, F., Liang, Z., Wegiel, J., Hwang, Y. W., Iqbal, K., Grundke-Iqbal, I., ... & Gong, C.
X. (2008). Overexpression of Dyrk1A contributes to neurofibrillary degeneration in
Down syndrome. The FASEB Journal, 22(9), 3224-3233.
Martinez, D.L., Altafaj, X., Gallego, X., Marti, E., Estivill, X., Sahun, I., Fillat, C. and
Dierssen, M. (2004) Motor phenotypic alterations in TgDyrk1a transgenic mice
implicate DYRK1A in Down syndrome motor dysfunction. Neurobiol. Dis., 15, 132–
142.
Murthy, S. K., Malhotra, A. K., Mani, S., Shara, M. E. A., Al-Rowaished, E. E. M.,
Naveed, S., ... & AlAli, M. T. (2007). Incidence of Down syndrome in Dubai,
UAE. Medical Principles and Practice, 16(1), 25-28.
Morris, J. K., Wald, N. J., & Watt, H. C. (1999). Fetal loss in Down syndrome
pregnancies. Prenatal Diagnosis: Published in Affiliation With the International Society for
Prenatal Diagnosis, 19(2), 142-145
Olson, L. E., Richtsmeier, J. T., Leszl, J., & Reeves, R. H. (2004). A chromosome 21
critical region does not cause specific Down syndrome
phenotypes. Science, 306(5696), 687-690.
O'nuallain, S., Flanagan, O., Raffat, I., Avalos, G., & Dineen, B. (2007). The
prevalence of Down syndrome in County Galway. Irish medical journal, 100(1), 329-
331.
Page 65
Ryoo, S. R., Jeong, H. K., Radnaabazar, C., Yoo, J. J., Cho, H. J., Lee, H. W., ... &
Song, W. J. (2007). DYRK1A-mediated hyperphosphorylation of Tau A functional link
between Down syndrome and Alzheimer disease. Journal of Biological
Chemistry, 282(48), 34850-34857.
Ryoo, S. R., Cho, H. J., Lee, H. W., Jeong, H. K., Radnaabazar, C., Kim, Y. S., ... &
Song, W. J. (2008). Dual‐specificity tyrosine (Y)‐phosphorylation regulated kinase A‐
mediated phosphorylation of amyloid precursor protein: evidence for a functional link
between Down syndrome and Alzheimer’s disease. Journal of
neurochemistry, 104(5), 1333-1344.
Radonova, L., Svobodova, T., & Anger, M. (2019). Regulation of the cell cycle in early
mammalian embryos and its clinical implications. International Journal of
Developmental Biology.
Snijders AM, Nowak N, Segraves R, Blackwood S, Brown N, Conroy J et al. Assembly
of microarrays for genome- wide measurement of DNA copy number. Nature Genet.
2001;29:263–4
Sperling, K., Pelz, J., Wegner, R. D., Dorries, A., Gruters, A., & Mikkelsen, M. (1994).
Significant increase in trisomy 21 in Berlin nine months after the Chernobyl reactor
accident: temporal correlation or causal relation?. Bmj, 309(6948), 158-161.
Wahab, A. A., Bener, A., & Teebi, A. S. (2006). The incidence patterns of Down
syndrome in Qatar. Clinical genetics, 69(4), 360-362.
WOODS, Y. L., COHEN, P., BECKER, W., JAKES, R., GOEDERT, M., Xuemin, W. A.
N. G., & PROUD, C. G. (2001). The kinase DYRK phosphorylates protein-synthesis
initiation factor eIF2Bɛ at Ser539 and the microtubule-associated protein tau at

Page 66
Thr212: potential role for DYRK as a glycogen synthase kinase 3-priming
kinase. Biochemical Journal, 355(3), 609-615.
Page 67
APPENDIX
Page 68
Appendix
APPENDIX
Data of Trisomies
Ethnic Mother's
ID Group Consanguinity Age Gestation D21 D18 D13 Final Diagnosis
1 Punjabi Related 30 14 DD_S11 NT NT NoT21
2 Pathan 1st Cousin 35 DD_S11 NT NT NoT21
3 Punjabi Unrelated 34 DD_S11 NT NT NoT21
4 Related 37 DD_S11 NT NT NoT21
5 Unrelated 41 DD_S11 NT NT NoT21
6 1st Cousin 32 DD_S11 NT NT NoT21
9 Related 35 M_S1411 MD_S51 NT NoT18
13 Unrelated 26 DD_S11 NI_S51 DD_S317 NoT13&21
14 Related 34 NT DD_S51 NT NoT18
17 Unrelated 31 DD_S11 DD_S51 DD_S317 NoT13,18&21
18 Punjabi Unrelated 33 13 DD_S11 NT NT NoT21
19 Pathan Unrelated 29 DD_S11 NT NT NoT21
1029 Urdu Related 33 DD_S11 DD_S51 DD_S317 NoT13,18&21
1039 Urdu Unrelated 36 DD_S11 NT NT NoT21
1201 1st Cousin 40 TD_S1411 NT NT T21
1204 Punjabi Unrelated 27 DD_S11 DD_S51 DD_S317 NoT13,18&21
1223 Kashmiri Unrelated 26 DD_S11 NT NT NoT21
1250 Punjabi Unrelated 31 24 DD_S1411 DD_S51 DD_S317 NoT13,18&21
Page 69
Appendix

1533 Punjabi 1st Cousin 25 DD_S1411 NT NT NoT21
1583 Urdu 1st Cousin 40 13 DD_S11 DD_S51 DD_S317 NoT13,18&21
2021 Pathan Related 35 14 DD_S11 NT NT NoT21
2105 Related 30 DD_S1411 DD_S51 DD_S317 NoT13,18&21
2452 Pathan Related 36 DD_S11 NT DD_S317 NoT13&21
2535 Unrelated 41 M_S11 NT NT IR
2718 Related 32 15 DD_S11 NT NT NoT21
2731 Urdu Unrelated 41 17 DD_S11 DD_S51 DD_S317 NoT13,18&21
3639 1st Cousin 37 11 DD_S11 NT NT NoT21
3784 Punjabi Related 35 ` DD_S11 NT NT NoT21
4400 Urdu Unrelated 38 13 DD_S11 NT NT NoT21
4598 Punjabi Related 38 14 TD_S11 NT NT T21
4879 Unrelated 34 DD_S11 I_S51 DD_S317 NoT13&21
5024 Saraiki Related 36 13 M_S1411 NT NT IR
5406 Punjabi Unrelated 38 13 DD_S11 DD_S51 NI_S317 NoT18&21
5430 Pathan 1st Cousin 35 TD_S1411 NT NT T21
Page 70
Appendix

5541 Unrelated 37 DD_S11 DD_S51 NI_S317 NoT18&21
5614 Urdu Unrelated 27 13 DD_S11 NT NT NoT21
5676 Urdu Unrelated 37 20 DD_S11 MD_S51 DD_S317 NoT13&21
5989 Pathan Related 44 TD_S1411 DD_S51 DD_S317 T21
6257 Baluch 1st Cousin 33 16 DD_S11 NT NT NoT21
6360 Punjabi 1st Cousin 26 14 DD_S11 NT NT NoT21
6508 Punjabi Related 25 DD_S1411 NT NT NoT21
6511 Punjabi Unrelated 35 14 DD_S11 NT DD_S317 NoT13&21
6512 Punjabi Related 35 14 DD_S11 NT DD_S317 NoT13&21
6858 Pathan Related 34 DD_S11 NT NT NoT21
7827 Pathan 1st Cousin 29 DD_S11 DD_S51 DD_S317 NoT13,18&21
8288 Punjabi Unrelated 30 M_S1411 NT NT NoT21
8294 Unrelated 33 DD_S1411 I_S51 DD_S317 NoT13&21
8540 Unrelated 38 M_S1411 NT NT NoT21
8766 Pathan 1st Cousin 28 DD_S11 DD_S51 DD_S317 NoT13,18&21
8838 Punjabi Unrelated 27 16 DD_S11 DD_S51 NT NoT18&21
9193 Punjabi Related 41 20 TD_S1411 NT NT T21
9230 Punjabi Unrelated 38 TD_S1411 NT NT T21
Page 71
Appendix
9335 Potohari 1st Cousin 29 DD_S1411 NT NT NoT21

9699 Punjabi 1st Cousin 41 12 TD_S11 NT NT T21
9707 Unrelated 24 DD_S11 DD_S51 DD_S317 NoT21
9746 Kashmiri Related 40 16 DD_S1411 NT NT NoT21
9761 Pathan Unrelated 34 TD_S1411 NT NT T21
9811 Related 39 TD_S1411 NT NT T21
10332 Punjabi Related 26 DD_S1411 DD_S51 I_S317 NoT18&21
10393 Pathan Unrelated 31 22 DD_S1411 I_S51 I_S317 NoT21
10440 Punjabi 1st Cousin 34 24 DD_S11 I_S51 I_S317 NoT21
10441 Punjabi Related 29 DD_S1411 DD_S51 DD_S317 NoT13,18&21
10535 Punjabi 1st Cousin 34 DD_S11 DD_S51 DD_S317 NoT13,18&21
10555 Related 32 TD_S11 I_S51 DD_S317 T21
10606 Hindu Unrelated 34 18 NT DD_S51 NT NoT18
10651 Punjabi Related 31 DD_S11 DD_S51 I_S317 NoT13,18&21
10702 Punjabi Related 36 13 I_S1414 NT NT NoT21
10768 Related 29 DD_S11 NI_S51 NI_S317 NoT21
Page 72
Appendix

10812 Punjabi Related 28 DD_S11 NI_S51 NI_S317 NoT21
10895 Punjabi Related 35 13 TT_S11 NT NT T21
11058 Afghani Unrelated 35 DD_S11 NI_S51 DD_S317 NoT13&21
11071 Saraiki Related 27 12 DD_S11 NT NT NoT21
11243 Pathan Related 34 DD_S1411 I_S51 DD_S317 NoT13&21
11304 Punjabi Unrelated 35 DD_S1411 NI_S51 DD_S317 NoT13&21
11406 Unrelated 26 20 DD_S1411 NI_S51 NI_S317 NoT21
11735 Punjabi Related 30 12 DD_S1411 NI_S51 NI_S317 NoT21
11825 Pathan 1st Cousin 35 DD_S11 NI_S51 DD_S317 NoT13&21
11885 Punjabi Unrelated 34 DD_S1411 NI_S51 NI_S317 NoT21
11992 Pathan Related 28 DD_S1412 NI_S51 NI_S317 NoT21
12089 Punjabi Unrelated 32 DD_S11 DD_S51 NI_S317 NoT18&21
12195 Kashmiri Unrelated 30 DD_S1411 NI_S51 NI_S317 NoT21
12379 Pathan Unrelated 27 DD_S1411 DD_S51 NI_S317 NoT18&21
12780 Punjabi Unrelated 38 DD_S11 DD_S51 NI_S317 NoT18&21
12936 Punjabi Unrelated 35 12 TD_S11 NT NT T21
13840 Punjabi 1st Cousin 36 14 DD_S11 DD_S51 DD_S317 NoT13,18&21
14139 Punjabi Related 34 13 DD_S1411 NI_S51 DD_S317 NoT13&21
14304 Punjabi Related 33 13 DD_S1412 NI_S51 DD_S317 NoT13&21
14453 Punjabi Related 38 12 DD_S1411 DD_S51 DD_S317 NoT13,18&21
14488 Punjabi Unrelated 37 12 DD_S11 NI_S51 NI_S317 NoT21
Page 73
Appendix

14606 Unrelated 41 DD_S11 NI_S51 DD_S317 NoT13,18&21
14623 Pathan Unrelated 28 13 DD_S11 DD_S51 DD_S317 NoT13,18&21
14673 Punjabi 1st Cousin 26 DD_S11 DD_S51 DD_S317 NoT13,18&21
15142 Punjabi Unrelated 39 DD_S11 NI_S51 NI_S317 NoT13,18&21
15363 Punjabi Related 32 DD_S11 NT DD_S317 NoT13&21
15587 Unrelated 34 I_S11 DD_S51 DD_S317 NoT13,18&21
15776 Pathan 1st Cousin 26 17 DD_S1411 DD_S51 DD_S317 NoT13,18&21
15872 Unrelated 26 23 DD_S11 NT NT NoT21
16002 Punjabi 1st Cousin 42 TD_S11 NT NT T21
16115 Pathan Related 28 DD_S1411 DD_S386 DD_S317 NoT13,18&21
16589 Punjabi Related 40 14 TD_S1414 DD_S51 DD_S317 T21
16856 Unrelated 41 12 DD_S11 NT NT NoT21
16929 Related 26 13 DD_S11 DD_S51 DD_S317 NoT13,18&21
17283 Pathan 1st Cousin 28 13 DD_S1411 NT NT NoT21
17457 Urdu Related 30 12 DD_S1411 DD_S51 DD_S317 NoT13,18&21
Page 74
Appendix
18106 Punjabi Unrelated 33 12 DD_S11 DD_S51 NT NoT18&21

18208 Pathan 1st Cousin 41 12 DD_S1411 DD_MBP NI_S317 NoT13,18&21
18345 Kashmiri 1st Cousin 35 13 DD_S1411 NT NT NoT21
18410 Pathan Related 29 22 DD_S1411 DD_S51 DD_S317 NoT13,18&21
19589 Pathan Related 26 12 DD_S1411 DD_S386 DD_S258 NoT13,18&21
19742 Punjabi Unrelated 41 TD_S1411 NI_S386 DD_S258 T21
20469 hindko Related 33 11 DD_S1411 NT NT NoT21
20499 Urdu 1st Cousin 34 DD_S11 NT DD_S317 NoT13&21
20905 Kashmiri 1st Cousin 40 13 TD_S1411 NT NT T21
21744 Pathan 1st Cousin 33 12 NT DD_S51 DD_S317 NoT13&18
22203 1st Cousin 34 TT_S11 DD_S51 DD_S317 T21
22237 Pathan Unrelated 34 12 DD_S1411 NT NT NoT21
22318 Punjabi 1st Cousin 35 12 DD_S1411 NT DD_S317 NoT13&21
22448 Urdu Related 36 11 DD_S11 NT DD_S317 NoT13&21
22843 Pathan Related 30 DD_S11 DD_S51 DD_S317 NoT13,18&21
23484 Urdu Unrelated 33 14 DD_S11 DD_S51 DD_S631 NoT13,18&21
Page 75
Appendix

24255 Urdu Related 26 DD_S11 DD_MBP DD_S317 NoT13,18&21
24353 Urdu Unrelated 33 DD_S1411 NT NT NoT21
24718 Urdu 1st Cousin 34 15 DD_S11 DD_S51 DD_S317 NoT13,18&21
24787 Urdu Related 38 14 DD_S11 NT NT NoT21
24802 Urdu Related 41 NT DD_S51 NT NoT18
24807 Urdu Related 35 12 DD_S1411 NT NT NoT21
24819 Urdu 1st Cousin 36 14 DD_S1414 NT NT NoT21
24904 Related 38 12 DD_S11 DD_S51 DD_S317 NoT13,18&21
25032 Punjabi Unrelated 39 24 TD_S1411 DD_S51 DD_S317 T21
25136 Punjabi Related 34 13 DD_S1411 DD_S51 NT NoT18&21
25137 Punjabi Related 31 12 DD_S1411 DD_S51 NT NoT18&21
25156 Pathan 1st Cousin 40 TD_S1412 NT NT T21
25183 Punjabi Related 44 12 DD_S11 NI_S51 NI_S317 NoT21
25247 Urdu 1st Cousin 27 16 DD_S1412 NT NT NoT21
25472 Pathan Related 26 13 TD_S1411 NT NT T21
26497 Punjabi 1st Cousin 27 DD_S1412 DD_MBP DD_S634 NoT13,18&21
26615 Punjabi Unrelated 31 28 TD_S1411 NT NT T21
26622 Punjabi Unrelated 28 13 DD_S1411 NT DD_S631 NoT13&21
26700 1st Cousin 31 12 DD_S1412 DD_S51 DD_S634 NoT13,18&21
26987 Punjabi Related 36 13 M_S1411 DD_S51 DD_S317 IR
Page 76
Appendix

27672 Punjabi Related 28 13 DD_S11 DD_MBP DD_S258 NoT13,18&21
27674 Pathan Related 27 12 DD_S11 DD_S51 NT NoT18&21
27871 Punjabi Related 41 13 DD_S1411 TD_S386 DD_S631 T18
28456 Pathan Related 39 TT_S1411 NT DD_S631 T21
28607 Punjabi Unrelated 44 TD_S11 DD_S51 DD_S631 T21
28626 Kashmiri Related 38 TD_S1411 DD_S51 DD_S317 T21
28670 Pathan Related 39 DD_S11 DD_MBP DD_S317 NoT13,18&21
28768 Urdu 1st Cousin 43 TT_S11 NT DD_S317 T21
28832 Related 28 DD_S1411 DD_S51 DD_S258 NoT13,18&21
28996 Punjabi Unrelated 25 14 DD_S11 DD_MBP DD_S317 NoT13,18&21
29057 Punjabi Related 32 TT_S1411 NT NT T21
29619 Punjabi Unrelated 37 DD_S11 NI_S386 DD_S317 NoT13&21
29621 Punjabi Related 38 DD_S1411 DD_MBP DD_S317 NoT13,18&21
29915 Punjabi Related 28 DD_S1411 DD_S51 NT NoT18&21
30081 1st Cousin 38 13 DD_S11 NT NT NoT21
30192 Urdu Related 38 TD_S1411 DD_S51 NT T21
Page 77
Appendix

30442 1st Cousin 39 TD_S11 NT NT T21
30570 Punjabi Unrelated 37 TD_S11 NT NT T21
30804 Punjabi Related 26 TD_S11 DD_S51 DD_S317 T21
31116 Punjabi Related 29 DD_S11 NI_S51 DD_S317 NoT13&21
31344 Punjabi Related 40 13 TD_S1411 DD_S51 DD_S317 T21
31402 Punjabi Unrelated 28 DD_S11 DD_MBP DD_S317 NoT13,18&21
31554 Pathan Unrelated 37 20 TT_S1411 NT NT T21
19914 Punjabi Related 38 13 DD_S1411 NT TD_S317 T13
3E+05 Punjabi Related 34 32 DD_S11 DD_S51 DD_S317 NoT13,18&21
Page 78
Appendix
List of Primers Used

1. D21 S11 (F) GTGAGTCAATTCCCCAAG
2. D21 S11 (R) GTTGTATTAGTCAATGTTCTCC
3. D21 S1411 (F) ATGATGAATGCATAGATGGATG
4. D21 S1411 (R) AATGTGTGTCCTTCCAGGC
5. D21 S1412 (F) CGGAGGTTGCAGTGAGTTG
6. D21 S1412 (R) GGGAAGGCTATGGAGGAGA
7. D21 S1414 (F) AAATTAGTGTCTGGCACCCAGTA
8. D21 S1414 (R) CAATTCCCCAAGTGAATTGCCTTC
9. D18 S51 (F CAAACCCGACTACCAGCAAC
10. D18 S51 (R) GAGCCATGTTCATGCCACTG
11. D18 S386 (F) TCAGGAGAATCACTTGGAAC
12. D18 S386 (R) TCCATGAAGTAGCTAAGCAG
13. D18 S535 (F) TCATGTGACAAAAGCCACAC
14. D18 S535 (R) AGACAGAAATATAGATGAGAATGCA
15. D18 MBP (F) GGACCTCGTGAATTACAATC
16. D18 MBP (R) ATTTACCTACCTGTTCATCC
17. D13S317 (F) ACAGAAGTCTGGGATGTGGA
18. D13S317 (R) GCCCAAAAAGACAGACAGAA
19. D13 S258 (F) ACCTGCCAAATTTTACCAGG
20. D13 S258 (R) GACAGAGAGAGGGAATAAACC
21. D13 S631 (F) GGCAACAAGAGCAAAACTCT
22. D13 S631 (R) TAGCCCTCACCATGATTGG
23. D13 S634 (F) TCCAGATAGGCAGATTCAAT
24. D13 S634 (R) CCTTCTTCTTCCCATTGATA
Page 79
Appendix
Page 80

Comparison and Diagnosis of Trisomy 18 and 21 in Pakistani Population Through Choronic Villus Sampling Technique

Hochgeladen von

Dokumentinformationen

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Comparison and Diagnosis of Trisomy 18 and 21 in Pakistani Population Through Choronic Villus Sampling Technique

Hochgeladen von

Copyright:

Verfügbare Formate

Table of Contents

Number Title Pg. No

APS Ammonium persulfate

CVS Chronic Villus Sampling

DNA Deoxyribonucleic acid

dNTPs Deoxynucleotides triphosphates

DD_S11 Disomic Diallelic with S11 as informative site

DD_S1411 Disomic Diallelic with S1411 as informative site

DD_S1412 Disomic Diallelic with S1412 as informative site

DD_S1414 Disomic Diallelic with S1414 as informative site

DD_S51 Disomic Diallelic with S51 as informative site

DD_S386 Disomic Diallelic with S386 as informative site

DD_S535 Disomic Diallelic with S535 as informative site

DD_MBP Disomic Diallelic with SMBP as informative site

DD_S317 Disomic Diallelic with S317 as informative site

DD_S631 Disomic Diallelic with S631 as informative site

DD_S634 Disomic Diallelic with S634 as informative site

EDTA Ethylene Diamine Tetra Acetic Acid

NoT21 Fetus does not have trisomy 21

NoT18 Fetus does not have trisomy 18

NoT18&21 Fetus does not have trisomy 18 and 21

PCR Polymerase Chain Reaction

PND Prenatal Diagnosis

Rpm Revolution per minute

TD_S535 TrisomicDiallelic with S535 as informative site

TD_MBP TrisomicDiallelic with SMBP as informative site

TD_S317 TrisomicDiallelic with S317 as informative site

TD_S258 TrisomicDiallelic with S258 as informative site

TD_S631 TrisomicDiallelic with S631 as informative site

TD_S634 TrisomicDiallelic with S634 as informative site

TT_S1411 TrisomicTriallelic with S1411 as informative site

TT_S1412 TrisomicTriallelic with S1412 as informative site

TT_S1414 TrisomicTriallelic with S1414 as informative site

TT_S51 TrisomicTriallelic with S51 as informative site

TT_S386 TrisomicTriallelic with S386 as informative site

TT_S535 TrisomicTriallelic with S535 as informative site

TT_MBP TrisomicTriallelic with SMBP as informative site

TT_S317 TrisomicTriallelic with S317 as informative site

TT_S258 TrisomicTriallelic with S258 as informative site

TT_S631 TrisomicTriallelic with S631 as informative site

TT_S634 TrisomicTriallelic with S634 as informative site

Figures Descriptions Pg. No.

Table Description Pg. No

1.1 Classification of chromosomal abnormality:

1.2 Trisomy 21 (Down syndrome)

1.2.1 Medical Issues

• Organic process abnormalities

1.2.3 Physical characteristics

Physical characteristics include:

 Decreased or poor muscle tone

1.2.4 Medical Problems

1.2.5 Diagnosis and Tests

• Chorionic villus testing: At 8 to 12 weeks, a modest example of placenta is gotten for

• Amniocentesis: At 15 to 20 weeks, a little measure of amniotic liquid is gotten for

1.3.2 Clinical Diagnosis

Trisomy 18 typically presents with some combination of the following features:

Trisomy 18 is affirmed by cerotype with FISH examination. FISH, or Fluorescence In Situ

1.4 Chorionic Villus Sampling

Chorionic villus examining (CVS) is a pre-birth test that judgments chromosomal

1.6 Aims and Objectives:

The developed countries(America,Japan.China) with high prevalence of genetic disorders, have

MATERIALS AND METHODS

MATERIALS AND METHODS