Sie sind auf Seite 1von 106

NATURA  2

Biologie für Gymnasien

Andrea Becker
Bärbel Knabe
Alexander Maier
Roman Remé
Horst Schneeweiß
Christian Steinert
Manuel Wilborn

Lösungen

Ernst Klett Verlag


Stuttgart  Leipzig
5  4  3  2  1
1. Auflage 1    |  18  17  16  15  14

Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden.
Die letzte Zahl bezeichnet das Jahr des Druckes.
Das Werk und seine Teile sind urheberrechtlich geschützt. Jede Nutzung in anderen als den gesetzlich zugelassenen Fällen bedarf der
vorherigen schriftlichen Einwilligung des Verlages. Hinweis § 52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung
eingescannt und in ein Netzwerk eingestellt werden. Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen.
Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages.

© Ernst Klett Verlag GmbH, Stuttgart 2014. Alle Rechte vorbehalten. www.klett.de

Autorinnen und Autoren: Andrea Becker, Bärbel Knabe, Alexander Maier, Roman Remé, Dr. Horst Schneeweiß,
Christian Steinert, Manuel Wilborn
Fachliche und fachdidaktische Beratung: Prof. Dr. Ulrich Kattmann

Redaktion: Dr. Detlef Eckebrecht


Mediengestaltung: Marlene Klenk-Boock

Layoutkonzeption und Gestaltung: KOMA AMOK®, Kunstbüro für Gestaltung, Stuttgart

Illustrationen: Otto Nehren, Achern; Ingrid Schobel, Illustration und Kartographie, München;

A15140-04912101
Die Kennzeichen aller Lebewesen (Seite 8/9)
0 1 Nenne die Beobachtungen, die notwendig sind, um eine Koralle (Abb. 1) sicher den Lebewesen zuzuordnen.
Man müsste bei den Korallen die fünf Kennzeichen der Lebewesen beobachten können. Die Koralle müsste sich also fortpflanzen,
wachsen, einen Stoffwechsel aufweisen, auf Umweltreize reagieren und sich bewegen.
$ 2 Erläutere am Beispiel der Venusfliegenfalle alle fünf Kennzeichen der Lebewesen.
Die Venusfliegenfalle ist eine Blütenpflanze, die sich geschlechtlich fortpflanzen kann (Fortpflanzung). Wenn ein Insekt die Reiz-
borste der Blätter berührt (Reizbarkeit), schließt sich das Blatt sehr schnell um das Insekt (Bewegung) und gibt Verdauungssäfte
ab. Mineralstoffe werden über das Blatt aufgenommen (Stoffwechsel) und sind wichtig für das Wachstum der Pflanze (Wachs-
tum).
. 3 Erkläre, warum ein Auto kein Lebewesen ist.
Es kann sich zwar bewegen, wandelt Treibstoff in Abgase um und besitzt Sensoren, die Informationen aus der Umwelt aufneh-
men. Doch können sich Autos nicht selbstständig fortpflanzen und sie wachsen auch nicht. Damit sind nicht alle Kennzeichen der
Lebewesen erfüllt und deshalb sind Autos keine Lebewesen.

Vielfalt der Lebewesen (Seite 10/11)


0 1 Erstelle eine Tabelle mit den wichtigsten Merkmalen der fünf Reiche der Lebewesen.
siehe Tabelle
Bakterien sehr kleine Zellen, Zellwand, kein Zellkern, oft fadenförmige Anhänge
Einzeller Lebewesen aus einer Zelle mit Zellkern, oft Geißeln und Wimpern
Pilze Vielzeller, Zellen mit Zellkern und Zellwand (Anmerkung: Einzellige Pilze sind im Text nicht berücksichtigt.)
Pflanzen Vielzeller, Zellen mit Zellkern und Zellwand, oft grüne Blätter
Tiere meist Vielzeller, Zellen mit Zellkern, keine Zellwand und keine Chloroplasten, häufig schnelle Bewegungen

$ 2 Erläutere am Beispiel des Siebenpunkt-Marienkäfers (Abb. 1) den Zusammenhang zwischen systematischer Ordnung und
Verwandtschaft.
Die systematischen Gruppen spiegeln die natürliche Verwandtschaft wieder. Der Siebenpunkt-Marienkäfer gehört zur Gattung der
Marienkäfer (Coccinella) und hat mit allen Marienkäfern der Gattung einen gemeinsamen Vorfahren. Zusammen mit anderen
Gattungen zählen die Marienkäfer zur Familie der Blatthornkäfer. Alle Blatthornkäfer gehen auf einen gemeinsamen Vorfahren
zurück. (Hinweis: In der ersten Auflage sind in Abb. 1 leider Gattung und Familie falsch beschriftet.)

Methode: Experimente planen, durchführen und auswerten (Seite 12/13)


1 Beschreibe die Funktion der Hypothese für die Planung eines Experiments.
Hypothesen geben eine mögliche Antwort auf die Forschungsfrage und ermöglichen so eine konkrete, z. B. experimentelle Über-
prüfung. Die Beantwortung der Hypothese erfordert daher eine spezifische Anlage des Experiments.
2 Im obigen Experiment werden die Bedingungen konstant gehalten. Erläutere.
Da das Ergebnis des Experiments von mehr als einer Bedingung abhängt, ist es notwendig, nur die Bedingungen, die zur Beant-
wortung der Fragestellung von Interesse sind, zu variieren. Das Flüssigkeitsvolumen hätte beispielsweise auch einen Einfluss auf
die Konzentration von Vitamin C und muss, damit das Ergebnis des Experimentes aussagekräftig ist, konstant gehalten werden.
3 Plane ein Experiment, das die folgende Frage klären soll: Wird Vitamin C durch längeres Kochen zerstört?
Der Versuchsansatz entspricht dem auf der Seite dargestellten, allerdings wird das Gemisch von Wasser und Zitronensaft eine
bestimmte Zeit lang gekocht. Kontrollen wie auf der Seite beschrieben.

Methode: Mikroskopieren (Seite 14/15)


1 Mikroskopiere ein Fertigpräparat, das dir deine Lehrerin oder dein Lehrer zur Verfügung stellt. Alternativ kannst du auch ein
eigenes Kopfhaar verwenden. Wende dabei die auf Seite 14 genannten Arbeitsschritte an.
individuelle Lösung
2 Erstelle ein Stängelquerschnitts-Präparat einer beliebigen Pflanze und fertige eine Übersichtsskizze an. Ergänze die Zeich-
nung durch die Strukturen, die bei starker Vergrößerung sichtbar werden.
individuelle Lösung
3 Abb. 3 zeigt Abweichungen von den Zeichenregeln. Beschreibe, welcher Fehler der Zeichner gemacht hat.
Allen Zeichnungen fehlt die Beschriftung entsprechend Zeichenregel 2. Insbesondere die Abb. a und b sind nicht nach dem Origi-
nal sondern aus der Erinnerung gezeichnet (Verstoß gegen Zeichenregel 4). Die Linien sind zwar, entsprechend der Zeichenregel 5
durchgezogen, allerdings sind hier nicht alle Strukturen von einer eigenen Linie begrenzt. So zeigt die Linie in Abb. c entweder die
Mittellamelle, Zellwand oder die Plasmamembran.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura Biologie 2 Lösungen
Methode: Modelle nutzen und entwickeln (Seite 16/17)
1 Überprüfe, ob Mode-„Models” (Mannequins) im biologischen Sinn als Modell verstanden werden können.
Mannequins repräsentieren einer Theorie von idealisierten Körpermaßen, damit ist ihre Eigenschaft als Mannequin also vom
Menschen konstruiert. Anders als biologische Modelle dienen sie aber nicht dem Verständnis eines biologischen Phänomens son-
dern der Präsentation von Garderobe. In ihrer Entstehung ähneln Mannequins also biologischen Modellen, in der Funktion jedoch
nicht.
2 Nenne Eigenschaften der Röhrenblüte, die das Modell von ihr nicht enthält. Verwende Abb. 2.
Duft, konkrete Farbe, Materialbeschaffenheit, Konsistenz des Materials stellen Eigenschaften des Originals dar, die das Modell
nicht enthält.
3 Nenne Eigenschaften, die das Simulationsmodell der Bienenvolkentwicklung besitzen sollte.
In der Simulation sollten äußere Bedingungen, wie z. B. Blütenangebot und Lufttemperatur, eine Rolle spielen. Außerdem wird das
Ergebnis bei unterschiedlichem Krankheitsdruck oder Honigräuberei durch Wespen anders ausfallen.
4 Erläutere Modelltyp und die jeweilige Modellgrenze für die in Abb. 5 dargestellten Modelle.
Deckeltopfmodell für die Flugmuskulatur von Insekten: Grenze: z. B. Kraft für die Flügelbewegung wird von außen ausgeübt.
Fernsehturmmodell für Grashalm: Grenze: Stabilität wird nicht nur durch die Gesamtbauweise, also den Hohlstängel, beeinflusst
sondern auch durch die Feinbauweise, also Zellenverkokung bzw. Eisenstreben im Beton.
Isolationsmodell für Vogelfedern: Grenze: Wärmeverlust nicht zeitlich konstant, da die Wärme im Kolben sinkt und damit die
Temperaturdifferenz zwischen außen und innen abnimmt.

Methode: Diagramme auswerten und erstellen (Seite 18/19)


1 Beschreibe das Säulendiagramm in Abb. 3 entsprechend der Anleitung auf dieser Seite.
Das Diagramm zeigt die Anzahl der in den Jahren 2008 bis 2012 in deutschen Zoos geborenen Elefanten. Dabei liegt die An-
zahl der Afrikanischen Elefanten zwischen null und drei Tieren, die der Asiatischen Elefanten zwischen zwei und sieben Tieren.
Insgesamt ist trotz Schwankungen zu erkennen, dass die Geburtenanzahl der Afrikanischen Elefanten ab- und die der Asiatischen
Elefanten zunimmt.
2 Erläutere, wie im Balkendiagramm (Abb. 4) rasch die Gesamtzahl aller Elefantengeburten in deutschen Zoos abgelesen wer-
den kann.
Die Balkenlänge (blauer und orangener Anteil zusammengenommen) ergibt die Anzahl aller Elefantengeburten in einem Jahr.
3 Recherchiere, was mit „Bevölkerungspyramide“ gemeint ist. Begründe, warum dieser Diagrammtyp für die Darstellung beson-
ders geeignet ist.
Dabei wird der Anteil der Menschen eines bestimmten Alters an der Gesamtbevölkerung (bzw. in anderer Darstellungsweise ihre
absolute Zahl) dargestellt. Durch die Darstellungsweise lassen sich die Daten für beide Geschlechter gesondert aufführen.
4 In einem Zoo sollen die Besucherzahlen am Pinguinbecken, am Eisbärgehege und bei den Bisons ermittelt und in einem
Diagramm dargestellt werden. Begründe die Auswahl des Diagrammtyps.
Da es für die jeweiligen Stationen keine Zwischenwerte gibt (etwa halb Pinguinbecken, halb Eisbärgehege) eignet sich für die
Datendarstellung das Säulendiagramm, das Liniendiagramm ist dagegen weniger geeignet.

Methode: Vorträge vorbereiten und halten (Seite 20/21)


1 Erstelle eine kleine Literaturliste für einen möglichen Vortrag zum Thema „Alte Haustierrassen“.
individuelle Lösung
2 Beschreibe die Wirkung der beiden Fotos in Abb. 4, wenn sie am Anfang eines Vortrags verwendet werden.
Das linke Bild zeigt den Waschbären in einer natürlichen Umgebung und ist daher in seiner Wirkung eher neutral. Das rechte Bild
motiviert dagegen stärker, sich mit dem Thema Waschbären zu beschäftigen, da es das Tier in einer ungewohnten Umgebung
zeigt.
3 Entwirf einen möglichen Vortragsanfang für das Thema „Alte Haustierrassen“.
individuelle Lösung
4 Erstelle aus dem Text dieser Seite eine Checkliste für einen gelungenen Vortrag und diskutiere sie mit deinen Mitschülerinnen
und Mitschülern.
individuelle Lösung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura Biologie 2 Lösungen
Methode: Bewerten (Seite 22/23)
1 Vervollständige die Problembeschreibung zum Eichenprozessionsspinner, indem du weitere Personengruppen nennst, die
direkt oder indirekt betroffen sind.
Waldbesitzer sind durch den Verlust ihrer Bäume betroffen. Außerdem könnten Anwohner von angrenzenden Grundstücken in
ihrer Gesundheit eingeschränkt sein.
2 Nenne eine weitere Handlungsmöglichkeit, wie mit der Gefährdung durch den Eichenprozessionsspinner umgegangen wer-
den soll.
Beispiel für eine Lösung: Eine weitere Handlungsoption könnte darin bestehen, die Bevölkerung durch Warnschilder oder Veröf-
fentlichung in der Presse zu warnen, es ihr aber dennoch freizustellen, den Wald zu betreten.
3 Benenne den Wert, der hinter deiner in Aufgabe 2 aufgestellten Handlungsmöglichkeit steht.
Wert bezogen auf die Beispiellösung zu Aufgabe 2: Die Anwohner können frei entscheiden, ob sie den Wald betreten wollen.
4 Wähle eine Handlungsmöglichkeit aus der Liste aus und nenne ein Contra-Argument.
Beispiel Contra-Argument zu Handlungsoption 2: Die Sperrung des Waldes verhindert, dass sich Menschen ungehindert in dem
betroffenen Waldstück bewegen (Sachaussage). Damit wird gegen deren Freizügigkeit verstoßen (Wertaussage). Die Sperrung ist
also abzulehnen (Schlussfolgerung).
5 Schätze die Folgen der von dir gewählten Handlungsmöglichkeiten ab.
Beispiel: Bei dieser Handlungsmöglichkeit kann z. B. die gesundheitliche Beeinträchtigung von Menschen, die unwissentlich in das
betroffene Waldstück gelangen, nicht ausgeschlossen werden.

Methode: Aufgaben bearbeiten (Seite 24/25)


1 Nenne Kriterien, die für den Vergleich von Buntspecht und Grünspecht (Abb. 2) bedeutsam sind, wenn man erfahren will, ob
sie verwandt sind.
Kriterien könnten Ähnlichkeiten bzw. Abweichungen im Körperbau, im Trommeln oder in der Nahrungszusammensetzung sein.
2 Beschreibe den Unterschied zwischen „Erklären“ und „Begründen“.
Während sich „Erklären“ auf naturwissenschaftlich belegbare Ursachen für eine bestimmte Wirkung bezieht, verlangt „Begrün-
den“ nach (von Menschen gemachten) Intentionen für bestimmte Phänomene.

Methode: Selbstständig lernen (Seite 26/27)


1 Finde heraus, wie du am besten lernst. Leite daraus eine Lernstrategie für dich ab.
individuelle Lösung
2 „Wer schon etwas weiß, lernt besser.“ Nimm Stellung zu dieser Aussage.
Wer schon etwas weiß, hat es leichter, Neuigkeiten mit dem bereits Gewussten zu verknüpfen. Dadurch lernt er effektiver und
schneller.
3 Erläutere, wie die Atmosphäre sein sollte, damit du optimale Lernergebnisse erreichst.
Eine positive Stimmung z. B. durch ein aufgeräumtes Zimmer oder durch andere schöne Begleiterlebnisse erleichtert das Lernen.
Stress, Unruhe und Ablenkung erschweren es.
4 Lernen mit Musik? Diskutiere, ob Hintergrundmusik für das Lernen förderlich sein kann.
Hierbei soll sowohl der ablenkende Charakter der Musik als auch die Erzeugung einer positiven Grundstimmung gegeneinander
abgewogen werden. Die Gewichtung ist eine individuelle Lösung.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura Biologie 2 Lösungen
1 Die Zelle
1.1 Ein Blick in die Welt der Zellen

Unser Körper besteht aus Zellen (Seite 30/31)


0 1 Ermittle mithilfe der Maßstäbe und mit einem Lineal die Durchmesser der in den Abbildungen 1 und 2 gezeigten Zellen.
Errechne daraus die Vergrößerung der Zellen in den gezeigten Abbildungen.
Abb. 1, Durchmesser der Hautzelle: 48 µm (Vergrößerung = 500 x)
Abb. 2 a, Durchmesser längs: Nervenzelle 704 µm (Vergrößerung = 85,2 x)
Abb. 2b, Durchmesser längs: Muskelzelle 660 µm (Vergrößerung = 65,1 x)
Abb. 2c, Durchmesser Knorpelzelle: 31 µm (Vergrößerung = 451 x)
$ 2 Erläutere anhand der Abbildungen 1 und 2, was eine Zelle und was ein Gewebe ist.
Gewebe bestehen aus Zellen und ihren nach außen abgegebenen Produkten. Eine einzelne Zelle erkennt man daran, dass sich das
von einer Zellmembran umgebene Zellplasma im mikroskopischen Bild vom Hintergrund abhebt.

Pflanzliche Zellen (Seite 32/33)


0 1 Pflanzliche und tierische Zellen weisen Gemeinsamkeiten auf, sie unterscheiden sich aber auch. Stelle Gemeinsamkeiten und
Unterschiede in einer Tabelle zusammen.
Gemeinsamkeiten Unterschiede

Tierische Zellen Pflanzliche Zellen Pflanzliche Zellen Tierische Zellen


Zellmembran Zellmembran Chloroplasten keine
Zellplasma Zellplasma Vakuole keine
Mitochondrien Mitochondrien Zellwand keine
Zellkern Zellkern

$ 2 Gewebe bestehen aus Zellen und von ihnen hergestellten Stoffen. Erläutere diese Aussage am Beispiel eines pflanzlichen und
tierischen Gewebes.
Zellwände gehen darauf zurück, dass pflanzliche Zellen Baumaterial ausgeschieden haben, das außerhalb des von der Zellmemb-
ran umgrenzten Raums zur Zellwand zusammengefügt wurde. Ein pflanzliches Gewebe besteht also aus Zellen und von ihnen ab-
gegebenen Produkten. Gleiches trifft auf die Gewebe vielzelliger tierischer Organismen zu, z. B. Knorpelgewebe, Knochengewebe,
Bindegewebe bestehen aus Gewebezellen und von ihnen ausgeschiedenen Produkten (Knorpel-, Knochen-, Bindegewebssubstanz).

Praktikum: Mikroskopieren von Zellen (Seite 34/35)


1 Mikroskopiere das Präparat bei stärkster Vergrößerung. Fertige eine handtellergroße Zeichnung von drei nebeneinanderlie-
genden Zellen an und beschrifte sie.
Beim Moos sind die Zellen je nach Art unterschiedlich geformt. Wasserpestgewebe entspricht etwa der Abbildung 32.1 im Schüler-
buch (Zellen etwas mehr langgestreckt). In beiden Fällen sieht man deutlich die Zellgrenzen, Chloroplasten und den Zellkern.
2 Bevor du eine Zelle zeichnest, notiere um welches Präparat es sich handelt und wie stark es vergrößert wird.
Gesamtvergrößerung: Vergrößerung Okular x Vergrößerung Objektiv
individuelle Lösung
3 Mikroskopiere das Zwiebelhäutchen. Zeichne drei Zellen (handtellergroß) und beschrifte sie.
siehe Abbildung 32.3a im Schülerbuch
4 Vergleiche deine Zeichnung mit Abb. 3 auf Seite 32. Beschrifte deine Zeichnung und erkläre Abweichungen von der Abbildung.
Die auf dem Foto erkennbaren scheinbaren Überschneidungen der Zellwände können beim Mikroskopieren als Täuschung erkannt
werden. Die Zeichnung sollte keine Überlappungen darstellen.
5 Mikroskopiere das Präparat und zeichne eine Zelle. Beschrifte die Bestandteile der gezeichneten Zelle.
Die Abbildung 1 auf Seite 43 im Schülerbuch zeigt ein solches Präparat mit schwacher Anfärbung.
6 Vergleiche deine Zeichnung mit dem Bau einer tierischen Zelle (s. Seite 31). Fallen dir Abweichungen auf, so finde Erklärungen
dafür.
Die Zellen sind unregelmäßig geformt, selten kugelig. Zellkern und äußere Begrenzung sind gut erkennbar, jedoch nicht die sehr
dünne Zellmembran. Mitochondrien können nicht erkannt werden; sie sind zu klein.
7 Das Mikroskop kann immer nur auf eine hauchdünne Ebene scharf gestellt werden. Man spricht auch von einem optischen
Schnitt. Der Rest der Zelle bleibt unscharf. Lege mehrere optische Schnitte gedanklich durch das Zellmodell und skizziere das
Ergebnis. Schätze die Anzahl solcher einzelnen Schnitte ab, die notwendig sind, um ein zutreffendes Bild von der räumlichen
Beschaffenheit des Modells zu bekommen.
Meist genügen vier bis fünf Schnitte, um z. B. zu erkennen, dass sich der Zellkern und die Chloroplasten in einer Pflanzenzelle im
randständigen Zellplasma befinden. Bei Tierzellen reichen evtl. drei Schnittebenen aus, um die Verteilung und Anordnung der
erkennbaren Organellen richtig zu erkennen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Vom Einzeller zum Vielzeller (Seite 36)
$ 1 Man könnte behaupten, dass mit Lebewesen wie Volvox in der Evolution die ersten natürlichen „Leichen“ aufgetreten sind.
Nimm dazu Stellung.
Zellen vermehren sich, indem sich eine „Mutterzelle“ in zwei „Tochterzellen“ teilt. Während dies bei Einzellern dazu führt, dass die
„Mutterzelle” in zwei „Tochterzellen” aufgeht, sich verjüngt und deswegen theoretisch unsterblich ist, übernehmen bei Vielzelligen
spezialisierte Zellen (Keimzellen) die Fortpflanzung. Nur deren Nachkommen begründen die nächste Generation, alle anderen
Körperzellen altern und sterben früher oder später ab.
. 2 Erläutere, inwieweit sich Zellkolonien von echten Vielzellern unterscheiden.
Echte Vielzeller weisen verschiedene Gewebe auf, die jeweils aus hoch spezialisierten Zellen bestehen. Zellkolonien bestehen aus
mehr oder weniger gleichen Zellen. Sie weisen keine Gewebe auf.

Differenzierung von Zellen (Seite 37)


0 1 Recherchiere im Buch, welche Aufgaben je eine der gezeigten spezialisierten Zellen in pflanzlichen und tierischen Lebewesen
haben. Stelle die Ergebnisse in einer Tabelle zusammen.
Funktion tierischer Zellen
Darmepithelzellen: Aufnahme von Nährstoffen und Wasser, Grenze zur Außenwelt
Knorpelzellen: Schutz von Knochen im Bereich der Gelenke
Blutzellen: Weiße Blutzellen: Träger der Immunfunktionen; Rote Blutzellen: Aufnahme, Transport, Abgabe von Sauerstoff
Zellen der glatten Muskulatur: ermöglichen Bewegungen des Darms zum Transport des Nahrungsbreis
Funktion pflanzlicher Zellen:
Blattzellen mit Chloroplasten: Fotosynthese
Zellen des Blattabschlussgewebes: verhindern das Vertrocknen und das Eindringen von Krankheitserregern
Drüsenzellen: produzieren Stoffe und geben sie ab
Zellen der Leitungsbahn: Stofftransport (z. B. Wasser, Zuckerlösung)
$ 2 Vergleiche die Eigenschaften von Stammzellen bei Tier und Mensch mit denen von Meristemzellen bei Pflanzen.
Tierische Stammzellen und pflanzlichen meristematische Zellen dienen der Gewebeerneuerung durch Zellteilung. Eine Mutterzelle
teilt sich in zwei Tochterzellen. Eine davon bleibt teilungsaktiv, die andere spezialisiert sich. Pflanzliche meristematische Zellen
eines Gewebes sind in der Lage, Zellen anderer Gewebe zu erzeugen. Tierische Zellen können dies nicht.

Wachstum (Seite 38/39)


0 1 Vergleiche das Wachstum von Pflanzen und Tieren. Berücksichtige dabei Abb. 3.
Pflanzen und Tiere wachsen, indem sich ihre Zellen durch Zellteilung vermehren und dann größer werden. Die Größe eines Orga-
nismus nimmt dann zu, wenn seine Zellen an Größe zunehmen. Da die Größe, die Zellen erreichen können, begrenzt ist, ist eine
Vermehrung von Zellen durch Teilung unverzichtbar, um die Größenzunahme des ganzen Lebewesens zu erklären.
$ 2 Wachstum ist nicht nur Zellteilung. Erläutere diese Aussage.
Wäre Zellwachstum auf die Vermehrung von Zellen durch Teilung beschränkt, würde die Biomasse insgesamt nicht zunehmen.
Zellen würden zwar mehr, aber auch immer kleiner werden.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
1.2 Wie Lebewesen funktionieren

Lebewesen als System (Seite 40/41)


$ 1 Recherchiere, worum es sich bei einem Betriebssystem handelt, und vergleiche es in Form einer Tabelle mit dem System Zelle.
siehe Tabelle
Betriebssystem System Zelle
besteht aus einzelnen Programmen, die Fähigkeiten eines Com- besteht aus verschiedenen Organellen, die einer Zelle Abgrenzung
puters ermöglichen wie Speichern, andere Programme ausführen, von der Umgebung, Versorgung mit Energie und Wachstum ermög-
Dateien kopieren, usw. lichen
wird von Menschen erzeugt (programmiert) Jede Zelle geht aus einer Zelle hervor.
funktioniert durch Energieversorgung von außen nutzt aufgenommene Stoffe und Energie zur Aufrechterhaltung der
Lebensvorgänge
erfüllt eine Aufgabe innerhalb des Computers bildet bei Mehrzellern mit gleichartigen Zellen ein spezialisiertes
Gewebe; zeigt bei Einzellern alle Lebensvorgänge

$ 2 Erläutere mithilfe von Abb. 4, wie man sich den Menschen als biologisches System vorstellen kann.
Ein System besteht aus Teilen, die miteinander in Beziehung stehen. Der Mensch besteht aus Organen. Bei der Versorgung aller
Körperzellen mit Sauerstoff spielt nicht nur das Organ Lunge eine Rolle, vielmehr sind an der äußeren Atmung Gehirn, Muskulatur,
Blut und Herz beteiligt. Diese Organe unterhalten Beziehungen wie sie Abb. 4 zeigt. Der Mensch als Ganzes steht mit der Umge-
bung im Austausch, z. B. bezüglich der Atemgase.
. 3 Das Ökosystem Wald weist typische Systemeigenschaften auf. Erläutere jeweils an einem Beispiel die Systemeigenschaften,
das Zusammenwirken der Teile des Systems und den Austausch mit der Umgebung des Systems.
Ein Wald besteht aus verschiedenen Lebewesen, die untereinander und mit der unbelebten Umgebung in Beziehung stehen. Ein
Wald steht über die Atmosphäre mit der Umgebung im Austausch von Stoffen und Energie.

Teste Dich selbst (Seite 43)


0 1 Zeichne eine Zelle aus Abb. 1 stark vergrößert ab und beschrifte sie.
siehe Abbildung

$ 2 In Abb. 1 sind nicht alle Organellen der Zellen erkennbar. Nenne die übrigen Organellen und ihre Funktion in der Zelle.
In Abb. 1 sind Mitochondrien nicht zu erkennen. Ihre Funktion ist die Energiebereitstellung für die Zelle.
$ 3 Ordne die Bilder nach Tier- oder Pflanzenzellen. Nenne die Kriterien der Zuordnung.
Tierische Zellen: a, d, e; pflanzliche Zellen: b, c, f
. 4 Worin stimmt der Bau von Zellen aus Pflanzen und Tieren überein, worin unterscheidet er sich? Lege eine Tabelle an. Notiere,
welche Funktion die einzelnen Bestandteile für die Zellen haben.
siehe Tabellen
Übereinstimmungen Funktion Unterschiede: nur in Pflanzenzellen Funktion
Zellmembran Zellgrenze Zellwand Stabilität
Mitochondrien Energiebereitstellung Vakuole Speicherung
Zellplasma füllt eine Zelle aus Chloroplasten Fotosynthese
Zellkern enthält genetisches Material, das eine Zelle
steuert

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
0 5 Benenne die Teile des Mikroskops (Abb. 3), die den vergrößerten Blick auf das Objekt erlauben.
Okular und Objektiv vergrößern das Bild eines Objekts.

. 6 Erläutere die Eigenschaften, die ein Objekt haben muss, damit man durch das Lichtmikroskop ein aussagekräftiges Bild sieht.
Ein Objekt muss Licht durchlassen, damit man etwas sehen kann. Dicke Objekte schneidet man in hauchdünne Scheiben, damit
das Präparat lichtdurchlässig wird. Würden alle Strukturen gleich viel Licht durchlassen, könnte man keine Unterschiede erken-
nen. Für Abhilfe kann dann mit speziellen Anfärbungen gesorgt werden.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
2 Wirbellose Tiere
2. 1 Insekten

Insekten sind Sechsbeiner (Seite 46/47)


0 1 Nenne drei typische Merkmale, an denen man Insekten erkennen kann.
Merkmale der Insekten: Außenskelett mit Unterteilung in Kopf, Brust und Hinterleib, 6 Gliederbeine, Komplexaugen.
$ 2 In Abb. 4 sind viele Insekten dargestellt, die alle den grundlegenden Bau der Insekten aufweisen. Zeichne ein Fantasie-Insekt,
das alle Merkmale der Insekten zeigt.
Individuelle Lösung, welche die wichtigsten Merkmale zeigt.
$ 3 Beschreibe die Funktion von drei im Text genannten Organen.
Außenskelett: Schutz, Stabilität; Gliederbeine: Fortbewegung; Komplexaugen: Sehen; Fühler: Tasten, Riechen;
Mundwerkzeuge: Nahrungsaufnahme; Flügel: Fortbewegung.
. 4 Erkläre, inwiefern das harte Außenskelett eine Voraussetzung für die Vielfalt und den Erfolg der Insekten darstellt.
Harte Skelettteile lassen filigrane und stabile Strukturen zu, die unterschiedliche Funktionen erfüllen können. Dies wird an den
Mundwerkzeugen und Beinen besonders deutlich.

Innere Organe der Insekten (Seite 48/49)


0 1 Beschreibe das Gegenspielerprinzip der Muskeln am Beispiel des Gelenks eines Gliederbeins (Abb. 2).
In dem Gelenk des Gliederbeins befinden sich zwei Muskeln. Kontrahiert der eine Muskel (Beuger) wird das Gelenk gebeugt und
der andere Muskel gestreckt. Kontrahiert der andere Muskel (Strecker) wird das Gelenk gestreckt und der andere Muskel gebeugt.
Beuger und Strecker haben eine gegensätzliche Wirkung und sind somit ein Beispiel für das Gegenspielerprinzip.
$ 2 Erläutere den Vorteil von zusätzlichen Herzen am Grund von schmalen Strukturen wie Fühlern und Gliederbeinen.
Ohne die zusätzlichen Herzen wäre die Strömung in den schmalen Organen sehr gering. Durch die zusätzlichen Herzen wird der
Transport in Fühler und Gliederbeine unterstützt.
. 3 Sowohl bei Insekten als auch bei Wirbeltieren muss Sauerstoff aus der Luft zu den Organen gelangen und gleichzeitig Kohlen-
stoffdioxid abgegeben werden. Vergleiche den Weg der Atemgase bei Insekten und Wirbeltieren.
Bei den Insekten gelangt Sauerstoff über die Tracheen fast bis zu den Organen. Er muss nur noch die Tracheenwand durchdringen
und eine kurze Strecke zum Organ überwinden. Kohlenstoffdioxid geht den umgekehrten Weg. Bei Wirbeltieren wird Sauerstoff
aus der Luft in den Lungenbläschen über die Wände der Lungenbläschen und Kapillaren ins Blut aufgenommen. Von dort wird das
sauerstoffreiche Blut im Körper verteilt. Im Körper gelangt Sauerstoff aus dem Blut durch die Kapillarwände zu den Organen und
gleichzeitig geht Kohlenstoffdioxid in das Blut über. Nun wird das Kohlenstoffdioxid über die Blutbahn zur Lunge transportiert
und dort über die Lungenbläschen und die Lunge an die Luft abgegeben.

Leben im Bienenstaat (Seite 50/51)


0 1 Stelle das Leben der Bienen anhand einer Jahresuhr dar. Notiere zu jeder Jahreszeit, was im Bienenstock passiert.
Frühjahr: Die Königin legt viele Eier, das Volk nimmt an Größe zu, Arbeiterinnen sammeln Pollen und Nektar und pflegen die Brut,
Honig wird eingelagert, Heranziehen von Drohnen und neuen Königinnen, Ausschwärmen von jungen Königinnen zur Gründung
von neuen Bienenvölkern.
Sommer: Drohnenschlacht, Anlegen von Futtervorräten, die Königin legt weniger Eier.
Herbst: Die Königin legt keine Eier mehr, Arbeiterinnen sammeln nicht mehr.
Winter: Bienen bilden Wintertraube und heizen den Stock durch Muskelzittern.
$ 2 Notiere unter Einbeziehung von Abb. 3 Merkmale und Aufgaben einer Arbeiterin, der Königin und eines Drohns.
Königin: 20 mm, langer Hinterleib, einfache Mundwerkzeuge, Stachel, Fortpflanzung (Eiablage)
Arbeiterin: 14 mm, kurzer Hinterleib, große Mundwerkzeuge, Stachel, Füttern, Putzen, Verteidigung, Honigherstellung, Wabenbau,
Sammeltätigkeit, Temperaturregulation
Drohn: 18 mm, große Komplexaugen, stark behaarte Brust, einfache Mundwerkzeuge, kein Stachel, Fortpflanzung (Begattung)
. 3 Erläutere, wie sich ein Bienenvolk vermehrt.
Ein Bienenvolk vermehrt sich, indem die alte Königin mit einem Teil der Arbeiterinnen ausschwärmt und eine neue Unterkunft
sucht. Im alten Bienenstock schlüpft kurz darauf eine neue Königin, die später von Drohnen begattet wird. So entstehen aus
einem Volk zwei Bienenvölker.

Kommunikation im Bienenstaat (Seite 52/53)


$ 1 Wenn die Königin entfernt wird, merken das nach wenigen Stunden alle Bienen im Volk. Erkläre.
Wenn die Königin fehlt, wird der Duftstoff der Königin weniger und dies bemerken schnell alle Bienen im Volk.
$ 2 Der Rundtanz enthält keine Information über die Richtung. Erläutere, warum dies nicht nötig ist.
Da die Futterquelle in der Nähe des Stocks liegt, müssen die Bienen nur um den Stock fliegen, um die Futterquelle zu finden. Eine
Richtungsangabe ist nicht vorteilhaft.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 3 Eine Arbeiterin tanzt auf der Wabe den Tanz in Abb. 3. Zeichne die mithilfe der Tanzfigur beschriebene Lage von Bienenstock,
Sonne und Futterquelle.
Die Futterquelle liegt vom Stock aus betrachtet etwa 120° links von der Sonne. (Es sind unterschiedliche Zeichnungen möglich.)

Extra: Experiment: Bienen teilen die Entfernung mit (Seite 53)


1 Erkläre, wie die Entfernung der Futterquelle im Tanz mitgeteilt wird.
Je weiter entfernt die Futterquelle liegt, desto weniger Schwänzelläufe erfolgen pro Minute.
2 Erläutere die Rolle der Landschaft bei der Entfernungsmessung.
Honigbienen orientieren sich an Landmarken. Die Entfernung bestimmen sie offensichtlich durch die Anzahl von auffallenden
Landmarken. Je mehr Landmarken auf dem Weg liegen, umso mehr Schwänzelläufe erfolgen pro Minute.

Material: Wildbienen (Seite 54/55)


$ 1 Nenne Voraussetzungen dafür, dass sich die Hahnenfuß-Scherenbiene in einem Garten ansiedeln kann.
Die Hahnenfuß-Scherenbiene benötigt Pflanzen der Gattung Hahnenfuß als Futterquelle und Röhren mit einem Innendurchmes-
ser von etwa 3,5 mm in Holz als Nistmöglichkeit.
. 2 Erläutere, warum stark spezialisierte Arten häufiger vom Aussterben bedroht sind.
Stark spezialisierte Arten finden häufig ihre speziellen Bedingungen nicht vor und sind dann selten und vom Aussterben bedroht.
0 3 Beschreibe Unterschiede und Gemeinsamkeiten der Lebensweisen von Steinhummel und Honigbiene.
Während die Honigbiene in Hohlräumen in Holz lebt und große Völker bildet, leben Steinhummeln im Boden und bilden nur kleine
Staaten.
$ 4 Nisthilfen für Wildbienen werden häufig „Bienenhotel“ genannt. Erkläre, warum diese Bezeichnung falsch ist.
Es handelt sich nicht um ein kurzfristiges Quartier zur Übernachtung, sondern um einen Brutplatz, in dem sich die Larven über
Monate aufhalten und entwickeln.
$ 5 In Gärten findet man Blumen, deren Blüten komplett mit Blütenblättern gefüllt sind. Erkläre, warum solche Blumen für Wild-
bienen wertlos sind.
Gefüllte Blüten besitzen keine Staubbeutel und bilden keinen Nektar. Für Bienen sind sie damit wertlos.
. 6 Entwirf einen Flyer mit Tipps zum Wildbienenschutz.
Individuelle Lösungen mit Tipps zum Anbau von Futterpflanzen für Bienen und dem Bau von Nisthilfen.

Angepasstheiten bei Insekten (Seite 56/57)


0 1 Beschreibe anhand von Abb. 2, wie die ursprünglichen Laufbeine der Insekten abgewandelt werden.
Sprungbein: Schenkel vergrößert und Schiene verlängert; Klammerbein: Fußglied zu Haken umgeformt; Sammelbein: erstes Fuß-
glied mit bürstenförmiger Behaarung zum Auskämmen und Sammeln von Pollen; Fangbein: Schenkel und Schiene vergrößert und
mit kräftigen Borsten besetzt.
$ 2 Erläutere am Beispiel der abgewandelten Laufbeine den Zusammenhang zwischen Struktur und Funktion.
Für alle dargestellten Laufbeine gilt, dass die Struktur so abgewandelt ist, dass eine bestimmte Funktion möglich ist. Struktur und
Funktion hängen zusammen.
$ 3 Vergleiche die Funktionsweise der Mundwerkzeuge in Abb. 3 mit passenden Werkzeugen oder Haushaltsgegenständen.
Schmetterling: Trinkhalm; Fliege: Staubsauger; Stechmücke: Spritze; Honigbiene: Eiskaffeelöffel.
$ 4 Erläutere am Beispiel der Honigbiene, auf welche Weise sie durch Beine und Mundwerkzeuge an ihre Lebensweise angepasst
ist.
Die Beine können alle als Laufbeine eingesetzt werden. Das ist sinnvoll, um im Stock und auf Blüten herumzulaufen. Die Hinter-
beine der Arbeiterinnen sind zu Sammelbeinen umgewandelt. Damit können Arbeiterinnen beim Blütenbesuch große Mengen an
Pollen in Pollenhöschen sammeln. Ihre Mundwerkzeuge können kauen, lecken und saugen. So sind Arbeiterinnen beispielsweise in
der Lage, Wachs zu kauen und zu formen und Nektar aus Blüten zu saugen.

Die Entwicklung der Insekten (Seite 58/59)


0 1 Erläutere, dass erwachsene Schmetterlinge durch ihren Körperbau an Partnerfindung und Fortpflanzung angepasst sind.
Die Flügel sind sinnvoll zur Fortbewegung. Diese ist entscheidend für die Partnerfindung. Ausgewachsene Insekten sind ge-
schlechtsreif und können Eier oder Spermien abgeben. Dies ist Voraussetzung für die Begattung.
$ 2 Das Puppenstadium wird auch als „Puppenruhe“ bezeichnet. Begründe, warum diese Bezeichnung ungenau ist.
Die Puppe ist nur äußerlich ruhig und unbeweglich (daher der Name), aber im Innern finden dramatische Umbauprozesse statt.
. 3 Erkläre den Vorteil von Larvenstadien, die sich von den erwachsenen Insekten deutlich unterscheiden.
Dadurch kann beispielsweise eine Nahrungskonkurrenz zwischen Larven und erwachsenen Insekten vermieden werden.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Insektenflug (Seite 60/61)
0 1 Beschreibe Gemeinsamkeiten und Unterschiede von direkter und indirekter Flugmuskulatur.
Gemeinsamkeit: Zwei Muskeln (Heber und Senker) arbeiten im Gegenspielerprinzip.
Unterschied: Die direkte Flugmuskulatur setzt direkt bei den Flügeln an, während die indirekte Flugmuskulatur an der Rückenplat-
te ansetzt.
$ 2 Erkläre, wie Libellen ihre Flügel einzeln bewegen können, während sich bei Schwebfliegen alle Flügel im Gleichtakt bewegen.
Da bei der direkten Flugmuskulatur der Libellen jeder Flügel mit eigenen Muskeln bewegt wird, ist es auch möglich, jeden Flügel
einzeln und unabhängig von den anderen zu bewegen. Bei der indirekten Flugmuskulatur der Schwebfliegen wird die Rückenplat-
te bewegt und alle Flügel indirekt mitbewegt. Da alle Flügel mit der Rückenplatte verbunden sind, bewegen sie sich immer im
Gleichtakt.
. 3 Erläutere am Deckel-Topf-Modell (Abb. 5) die Funktionsweise der indirekten Flugmuskulatur. Ordne die Bestandteile des Mo-
dells dem Original zu. Beschreibe dann den Ablauf der Flugbewegung.
Der Topfdeckel entspricht der Rückenplatte und der Topf dem restlichen Brustpanzer. Die beiden Kochlöffel stellen die Flügel dar.
Wie bei der indirekten Flugmuskulatur bewegen sich die Flügel, sobald der Deckel auf und ab bewegt wird.
. 4 Beschreibe, wie sich bei der indirekten Flugmuskulatur die Flügel senken.
Wenn die Längsmuskulatur kontrahiert, wird die Brust kürzer und gleichzeitig durch die Körperflüssigkeit die Rückenplatte nach
oben gedrückt. Dies hat zur Folge, dass sich die Flügel senken.

Insekten mit Puppenstadium (Seite 63)


0 1 Stelle die wichtigsten Merkmale der hier beschriebenen Insektenordnungen in einer Tabelle zusammen.
siehe Tabelle
Silberfischen keine Flügel
Libellen keine Puppe; vier lange, häutige Flügel
Heuschrecken keine Puppe, Vorderflügel starr, Hinterflügel häutig
Wanzen keine Puppe, Vorderflügel zur Hälfte häutig, Hinterflügel ganz häutig
Zweiflügler Puppe, Hinterflügel zu kleinen Kolben umgewandelt
Hautflügler Puppe, vier häutige Flügel
Käfer Puppe, Vorderflügel hart, Hinterflügel häutig

$ 2 Ordne die in Abb. 1 dargestellten Tiere (a–d) jeweils der richtigen Insektenordnung zu.
a) Zweiflügler, b) Käfer, c) Libelle, d) Wanze
. 3 Nimm Stellung zu der Bezeichnung „Urinsekt“ für das Silberfischchen.
Das heutige Silberfischchen ist natürlich kein Urinsekt, allerdings ähneln heutige Silberfischchen verblüffend stark sehr alten
fossilen Insekten.

Insekten und Wirbeltiere im Vergleich (Seite 64)


0 1 Notiere in einer Tabelle Unterschiede zwischen Wirbeltieren und Insekten.
siehe Tabelle
Wirbeltiere Insekten
Skelett Innenskelett Außenskelett
Auge Linsenauge Komplexauge
Blutkreislauf geschlossen offen
Mundwerkzeuge innen außen

0 2 Beschreibe zwei Gemeinsamkeiten von Wirbeltieren und Insekten.


Harte Skelettteile, Muskulatur funktioniert im Gegenspielerprinzip, Zentralnervensystem verläuft längs durch den Körper.
. 3 Erläutere, wie Vögel und Insekten unterschiedlich an eine fliegende Lebensweise angepasst sind.
Bei den Vögeln sind die Vorderextremitäten zu Flügeln mit Federn umgebildet, während die Flügel der Insekten flache Ausstülpun-
gen des Außenskeletts darstellen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Praktikum: Mehlkäferzucht (Seite 65)
1 Erstelle ein Protokoll, in dem möglichst viele Beobachtungen festgehalten werden. Achte besonders auf verschiedene Ent-
wicklungsstadien.
Individuelle Lösung mit folgenden Beobachtungen denkbar:
Larve: Fressverhalten, Bewegung und Wachstum könnten dokumentiert werden.
Puppe: Bewegung bei Reizung möglich.
Erwachsenes Insekt: Fressverhalten, Bewegung, (Fortpflanzung).
2 Zähle täglich die Anzahl der unterschiedlichen Entwicklungsstadien. Stelle die Ergebnisse in einem Diagramm dar.
Individuelle Lösung mit Säulendiagramm.
3 Stelle die Entwicklung der Mehlkäfer dar. Zeichne dazu die wichtigsten Entwicklungsstadien.
Larve, Puppe, Imago
4 Zeichne eine Mehlkäferlarve handtellergroß und beschrifte die Zeichnung.
Zeichnung mit Mund, Kopf, Komplexaugen, Beinen, Atemöffnungen.
5 Untersuche die Seiten der Larve auf Atemöffnungen.
Seitlich befinden sich an den Segmenten kleine Löcher. Das sind die Atemöffnungen.
6 Nenne Merkmale, die eine Zuordnung der Larven zu den Insekten ermöglichen.
Außenskelett und sechs Gliederbeine.
7 Zeichne eine Puppe von der Bauchseite aus und beschrifte die Zeichnung.
Individuelle Lösung. Die Anlagen für Beine, Flügel, Fühler und Mundwerkzeuge können gezeichnet und beschriftet werden.
8 Untersuche vorsichtig, ob sich die Puppe bewegen kann.
Wenn man die Puppe anfasst oder mit der Federstahl-Pinzette anhebt, bewegt sie kurz und heftig ihren Hinterleib auf und ab.
9 Nenne Organe, die bei der Puppe zu erkennen sind, bei der Larve aber nicht vorkommen.
Flügelanlagen, Fühler und Komplexaugen (vorher Punktaugen) sind neu.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
2. 2 Spinnentiere

Die Kreuzspinne (Seite 66/67)


0 1 Vergleiche die Baupläne von Spinnen und Insekten.
siehe Tabelle
Spinnen Insekten
Gemeinsamkeiten Außenskelett, Gliederbeine
Unterschiede 8 Beine 6 Beine
zweigliedriger Körper dreigliedriger Körper
Fächerlungen Tracheen
Linsenaugen Komplexaugen
keine Fühler Fühler
keine Flügel Flügel
Spinndrüsen keine Spinndrüsen

$ 2 Beschreibe anhand von Abb. 4 den Netzbau einer Garten-Kreuzspinne.


Zunächst lässt die Spinne einen stabilen Faden vom Wind an einen anderen Ast wehen, so dass der Zwischenraum überspannt
wird. Ausgehend von diesem Faden spinnt sie ein Grundgerüst aus stabilen Fäden. In dieses Grundgerüst wird von innen nach
außen eine Hilfsspirale gewebt. Schließlich spinnt sie von außen nach innen die Fangspirale mit klebrigen Fäden und frisst dabei
die Hilfsspirale auf.
. 3 Erkläre, wie das Männchen bei der Paarung verhindert, dass es vom Weibchen mit Beute verwechselt wird.
Das Männchen zupft erst vorsichtig in einem bestimmten Rhythmus am Netz. Durch diese Signale wird das Weibchen nicht nur
auf das Männchen aufmerksam, sondern erkennt auch, dass es sich dabei nicht um Beute handelt. Dieses Balzverhalten ist ein
weiteres Beispiel für Information und Kommunikation im Tierreich.

Spinnentiere (Seite 68)


0 1 Nenne gemeinsame Merkmale aller Spinnentiere.
Alle Spinnentiere haben ein Außenskelett mit acht Gliederbeinen. (Außer den Weberknechten haben alle einen zweigliedrigen
Körper.)
$ 2 Spinnentiere werden oft mit den Insekten verwechselt. Beschreibe Unterschiede zwischen Insekten und Spinnentieren.
siehe Tabelle
Spinnen Insekten
Äußerlich leicht erkennbare 8 Beine 6 Beine
Unterschiede. zweigliedriger Körper dreigliedriger Körper
Linsenaugen Komplexaugen
keine Fühler Fühler
keine Flügel Flügel

Material: Zecken (Seite 69)


0 1 Beschreibe den Lebenszyklus des Holzbocks.
Aus den Eier schlüpfen Larven mit nur sechs Beinen. Diese saugen an einer Maus oder einem anderen Wirtstier einige Tage Blut
und überwintern dann. Im Frühjahr häuten sie sich zu Nymphen mit acht Beinen. Diese benötigen wiederum eine Blutmahlzeit
und überwintern dann. Im nächsten Frühjahr häuten sie sich zu adulten Zecken, die sich paaren. Das Weibchen saugt sich in
einigen Tagen mit Blut voll und legt schließlich etwa 2000 Eier.
0 2 Erkläre, warum jedes Stadium eine Blutmahlzeit benötigt.
Jedes Stadium benötigt Nährstoffe als Energiequelle für Lebensvorgänge und als Baustoffe zum Wachstum. Diese Nährstoffe
erhält jedes Stadium aus dem Blut von Säugetieren.
$ 3 Berechne, wie lange ein Lebenszyklus dauert.
Die Larven und Nymphen überwintern jeweils. Daher dauert die Entwicklung insgesamt zwei Jahre.
. 4 Erkläre das verstärkte Auftreten von Zeckenbissen im Frühsommer.
Da bei allen Stadien die Häutung nach der Überwinterung erfolgt und die Zecken dann eine Blutmahlzeit benötigen, lauern im
Frühsommer besonders viele Zecken auf einen neuen Wirt.
0 5 Stelle die Häufigkeiten der Zeckenstadien in einem geeigneten Diagramm dar.
Da es sich um Einzelwerte handelt, ist ein Säulendiagramm möglich. Im Säulendiagramm ist die Abnahme der Individuenanzahl
in den Zeckenstadien gut erkennbar. Da die Einzelwerte in der Summe ein Ganzes ergeben (die Gesamtanzahl der Zecken) ist
auch ein Kreisdiagramm denkbar. In diesem Diagramm ist gut zu erkennen, dass Larven und Nymphen deutlich dominieren
(s. Abbildungen).

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
700
657
600
Zeckenstadien (Anzahl)

500

400

300
234
200

100
38
0
Larven Nymphen adulte Zecken

adulte Zecken
38

Nymphen
234

Larven
657

$ 6 Erkläre die unterschiedlichen Häufigkeiten der Zeckenstadien.


Da in jedem Zeckenstadium Individuen durch Tod verloren gehen, weil sie beispielsweise keinen Wirt gefunden haben, nimmt die
Anzahl der Individuen zunehmend ab.
. 7 Erkläre, inwiefern die Mundwerkzeuge der Zecke durch ihre spezielle Struktur zum Blutsaugen gut geeignet sind.
Die langen Kieferzangen können gegeneinander bewegt werden. Dabei schneiden die seitlichen Zähne der Kieferzangen einen
tiefen Kanal in die feste Haut von Säugetieren. Durch den dazwischen liegenden Kanal kann die Zecke Blut saugen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafiken: Otto Nehren, Achern
2. 3 Schnecken

Die Weinbergschnecke – ein Weichtier (Seite 70/71)


$ 1 Verwende ein Blatt Papier als Modell für die Kriechsohle und erkläre damit die Fortbewegung einer Schnecke.
Legt man ein Blatt flach auf den Tisch, dient dieses als Modell für die Kriechsohle. Hebt man nun am Hinterende das Papier an
und setzt es ein wenig nach vorn versetzt wieder auf, bildet sich eine kleine Welle. Wenn diese Welle nach vorn geschoben wird,
landet jede Stelle ein Stück weiter vorne. Mit diesem Modell wird schön deutlich, dass dabei eine Welle nach vorn läuft und die
Kriechsohle stets Kontakt zum Untergrund hat.
$ 2 Weichtiere haben ein Hydroskelett. Erkläre, was damit gemeint ist, indem du eine Luftmatratze zum Vergleich heranziehst.
Ein Hohlraum mit einer dehnbaren Wand wird stabil, wenn er mit Wasser gefüllt wird. Dieses Prinzip lässt sich leichter mit einem
luftgefüllten Raum veranschaulichen. Geeignete Modelle sind eine Luftmatratze oder ein Luftballon. Die Gummiwand entspricht
der muskulösen Haut und die Luft im Innern entspricht der Körperflüssigkeit. Sobald die Luftmatratze so weit mit Luft gefüllt
wird, dass sich die Außenwand dehnt, bekommt sie Stabilität.
$ 3 Muscheln (Abb. 5) gehören ebenfalls zu den Weichtieren. Vergleiche den Körperbau von Muschel und Schnecke.
Gemeinsamkeiten: Harte Skelettteile und muskulöser Fuß.
Unterschiede: Kriechsohle und Schneckenhaus bei typischen Schnecken; zwei Schalenhälften mit zwei Schließmuskeln und finger-
artigem Fuß.
. 4 Erkläre, warum man in Gebieten mit kalkhaltigen Böden besonders viele Weinberschnecken findet.
Da das Gehäuse der Weinbergschnecke Kalk enthält, ist es für die Schnecken vorteilhaft, wenn die Böden kalkhaltig sind. So kön-
nen sie leichter Kalkverbindungen über die Nahrung aufnehmen und wachsen.

Praktikum: Schnecken (Seite 72/73)


1 Beobachte möglichst genau den Fuß der Schnecke von der Seite und von unten, während sie sich fortbewegt. Protokolliere
deine Beobachtungen.
Während die Schnecke kriecht, laufen mehrere quer liegende Wellen von hinten nach vorn. Jederzeit hat ein großer Teil der Kriech-
sohle Kontakt zum Untergrund.
2 Führe mit mehreren Schnecken ein Schneckenrennen durch (Strecke ca. 10 cm). Berechne und vergleiche die Geschwindigkei-
ten der Schnecken.
Die Geschwindigkeit wird berechnet, indem man den zurückgelegten Weg (in Metern) durch die dafür benötigte Zeit (in Sekun-
den) teilt. Das Ergebnis gibt die Geschwindigkeit in Metern pro Sekunde an. Für die Umrechnung in Kilometer pro Stunde muss
man das Ergebnis mit 3,6 multiplizieren.
3 Beobachte das Öffnen und Schließen der Atemöffnung.
Die Atemöffnung lässt sich besonders gut bei Weinbergschnecken beobachten, wenn man sie anhebt und auf die Gehäuseöffnung
schaut. Die Atemöffnung kann durch einen Ringmuskel verschlossen werden und wird nur vorübergehend geöffnet. Dies hat die
Funktion, dass nicht zu viel Wasser über die Atemhöhle an die Umgebung verdunstet.
4 Protokolliere das Verhalten der Schnecke.
Je nach Zustand der Schnecke (Hunger, Stress, ...) sind hier sehr individuelle Reaktionen möglich.
5 Beurteile, ob das beobachtete Verhalten auf einen Geruchssinn schließen lässt.
Ein schöner Hinweis auf einen Geruchssinn ergibt sich dann, wenn die Schnecke zielstrebig der Apfelspur folgt.
6 Beschreibe die Geräusche, die beim Fressen auftreten.
Die Geräusche erinnern an ein Kratzen.
7 Erkläre die Geräusche mit der Form der Radula.
Die Radula erinnert durch die vielen kleinen Zähne an eine Feile. Die Geräusche ergeben sich durch das Abraspeln von Material
durch diese Zähne.
8 Bestimme mit dem Bestimmungsschlüssel auf der rechten Seite den Artnamen einer gefundenen oder von der Lehrkraft
ausgeteilten Schnecke.
Individuelle Lösung, je nach ausgeteilten Arten. Die Schnecken müssen nicht leben. Der Bestimmungsschlüssel funktioniert auch
mit leeren Schneckenhäusern.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
2. 4 Weitere Wirbellose

Lebensweise der Regenwürmer (Seite 74/75)


0 1 Beschreibe die Angepasstheiten des Regenwurms an ein Leben im Boden.
Die auffallendste Angepasstheit besteht in der Körperform. Wie viele andere Tiere, die im Boden leben, hat er eine längliche Form
mit rundlichem Querschnitt, die an eine Wurst erinnert. Solch eine Körperform hat Vorteile beim Bewegen durch Erdgänge. Die
Fortbewegung wird durch Borsten an der Unterseite unterstützt.
$ 2 Beschreibe anhand von Abb. 2 die Fortbewegung eines Regenwurms.
Zunächst verlängert der Regenwurm sein Vorderende, indem er es schmaler macht (durch die Kontraktion der Ringmuskulatur).
Nun verschmälert er die Mitte und Hinterende, während er gleichzeitig das Vorderende verdickt. Das hat zu Folge, dass sich das
Hinterende nach vorn bewegt und der Regenwurm langsam vorwärts kommt.
. 3 In einem Experiment wurde untersucht, welchen Einfluss Regenwürmer auf die Ernte haben. Beschreibe die Versuchsergeb-
nisse (Abb. 7) und erkläre die Unterschiede.
Die Ernte fällt mit Regenwürmern deutlich besser aus. Insbesondere die Ähren tragen beinah doppelt so viele Körner. Dies erklärt
sich dadurch, dass die Regenwürmer durch ihre Tätigkeit im Boden, diesen in vielfältiger Weise verbessern. Die Gänge sorgen
für bessere Durchlüftung und Bewässerung. Die Blätter, die sie in den Boden ziehen, verrotten und ergeben Mineralstoffe, die
Pflanzen zum Wachstum benötigen. Im Kot der Regenwürmer sind wertvolle Ton-Humus-Komplexe enthalten, die für das Pflan-
zenwachstum förderlich sind.

Praktikum: Regenwurm (Seite 76)


1 Beschreibe die Geräusche, die auftreten, wenn sich der Regenwurm auf Papier bewegt.
Es sind leise Kratzgeräusche zu hören.
2 Erkläre die Entstehung der Geräusche durch die Beschaffenheit der Unterseite.
Die Geräusche entstehen, wenn die harten Borsten auf der Unterseite des Regenwurms über das Papier streichen.
3 Beschreibe die Fortbewegung des Regenwurms.
Zunächst verlängert der Regenwurm sein Vorderende, indem er es schmaler macht (durch die Kontraktion der Ringmuskulatur).
Nun verschmälert er die Mitte und Hinterende, während er gleichzeitig das Vorderende verdickt. Das hat zu Folge, dass sich das
Hinterende nach vorn bewegt und der Regenwurm langsam vorwärts kommt.
4 Fertige ein Versuchsprotokoll an.
Das Protokoll sollte dokumentieren, dass der Regenwurm auf starkes Licht reagiert und sich in die dunkle Röhre zurückzieht.
5 Plane ein weiteres Experiment, mit dem du untersuchen kannst, ob auch der mittlere Bereich des Regenwurms lichtempfind-
lich ist.
Man kann in die Mitte der Röhre ein Loch schneiden oder zwei getrennte Papierröhren über Vorder- und Hinterende des Wurms
schieben. In dem Experiment müsste man nur die Körpermitte beleuchten und auf Reaktionen achten.
(Hinweis: Im Vordergrund steht die logische Planung des Experiments. Die Durchführung ergibt oft keine deutlichen Reaktionen.)

Material: Regenwürmer (Seite 77)


0 1 Beschreibe die Fortbewegung des Blutegels (Abb. 1).
Zunächst ist der Blutegel mit dem Vorderende am Untergrund festgesaugt. Dann spannt er das Hinterende möglichst weit weg
und saugt sich damit fest. Nun löst er das Vorderende und macht einen Überschlag. Dabei landet das Vorderende auf der anderen
Seite und kann sich dort festsaugen. Nun löst er das Hinterende ab. Ein Egel bewegt sich also ähnlich wie ein Turner beim Flick-
flack fort.
$ 2 Beschreibe, wie der Bau der Mundregion mit der Lebensweise des Blutegels zusammenhängt.
Die kreisrunden Lippen schließen sich dicht an den Untergrund an und ermöglichen das Festsaugen. Die drei messerscharfen Zäh-
ne erzeugen dann eine Wunde, aus der Blut fließt. Durch die festgesaugte Mundfeldregion kann das Blut nicht zur Seite verloren
gehen.
$ 3 Beschreibe, wie Schlammröhrenwürmer an ihren Lebensraum angepasst sind.
Durch einen roten Farbstoff, der gut Sauerstoff binden kann, sind sie gut an das Leben in sauerstoffarmem Wasser angepasst.
$ 4 Beschreibe, wie der Wattwurm an seine Lebensweise angepasst ist.
Er kann U-förmige Röhren graben in denen Sand mit Bakterien und Algen vom Trichter zum Wurm gelangt und Kot über das
andere Ende ausgeschieden wird.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Teste dich selbst (Seite 79)
0 1 Beschreibe die besondere Abwandlung des Vorderbeins der Maulwurfsgrille (Abb. 1).
Das Vorderbein der Maulwurfsgrille hat verkürzte und stark verdickte Beinglieder. Die Fußglieder sind ebenfalls verdickt und
weisen harte Spitzen auf.
$ 2 Erläutere die unterschiedliche Funktion der abgebildeten Beine der Maulwurfsgrille.
Die Vorderbeine dienen als Grabwerkzeuge, denn sie sind wie Schaufeln gebildet. (Anmerkung: In den verdickten Beingliedern
finden große Muskeln Platz und durch die Kürze der Beinglieder können große Kräfte entwickelt werden.) Die harten Spitzen an
den Fußgliedern erleichtern das Abgraben von Erde. Die Hinterbeine sind durch die langen Schenkel- und Schienenglieder an das
Laufen angepasst und ermöglichen große Schritte.
$ 3 Beschreibe die Aussage des Diagramms.
Die Anzahl der Arbeiterinnen ist im Februar am geringsten und liegt unter 10 000 Individuen. Bis zum Juni steigt die Anzahl der
Arbeiterinnen auf über 40 000. Anschließend sinkt die Zahl der Arbeiterinnen wieder ab.
Im Winter gibt es im Bienenvolk keine Drohnen. Im April werden die ersten Drohnen gebildet und nehmen bis zum Juni auf über
20 000 Individuen zu. Ende August sinkt die Zahl in wenigen Wochen auf Null ab.
. 4 Erkläre die Veränderung der Zusammensetzung des Bienenvolks im Jahresverlauf.
Im Winter gibt es im Bienenvolk keine Brut. Nur etwa 10 000 Arbeiterinnen überwintern mit der Königin. Im Frühjahr werden
zunächst Arbeiterinnen und schließlich Drohnen herangezogen. Da es immer mehr Arbeiterinnenbrut als Drohnenbrut gibt, sind
die Arbeiterinnen deutlich in der Überzahl. Ende August werden die Drohnen nicht mehr gefüttert und aus dem Stock vertrieben.
Dies ist vorteilhaft, da die Drohnen nur zur Begattung der Königin im Sommer dienen. Im Winter würden sie unnötig Honigvorräte
verbrauchen.
0 5 Stelle Gemeinsamkeiten und Unterschiede von Insekten und Spinnen in einer Tabelle zusammen. Berücksichtige dabei
Skelett, Gliedmaßen, Körpergliederung, Augen, Fühler, Mundwerkzeuge, Herz, Atmungsorgane, Nervensystem, Flügel und
Spinndrüsen.
Insekten und Spinnen: Außenskelett; Insekten: Gliederbeine (6); Spinnen: Gliederbeine (8); Insekten: Kopf, Brust, Hinterleib;
Spinnen: Vorder- und Hinterkörper; Insekten: Komplexaugen; Spinnen: Punktaugen; Insekten: 2 Fühler; Spinnen: keine Fühler;
Insekten: äußere Mundwerkzeuge mit Oberlippe, Oberkiefer, Unterkiefer und Unterlippe; Spinnen: äußere Mundwerkzeuge mit
Kiefertaster und Kieferzange (mit Giftklaue); Insekten und Spinnen: Röhrenherz; Insekten: Tracheen (Röhrentracheen);
Spinnen: Tracheen (Fächer- und Röhrentracheen); Insekten und Spinnen: Bauchmark; Insekten: meist Flügel; Spinnen: keine Flü-
gel; Insekten: keine Spinndrüsen; Spinnen: Spinndrüsen
$ 6 Erkläre, warum die meisten Schneckenarten in feuchten Lebensräumen zu finden sind.
Die Schnecke hat ein Hydroskelett und sondert über ihre feuchte Haut ständig Schleim ab. Schnecken geben in trockener Umge-
bung zu viel Wasser ab. Die Schnecken würden austrocknen.
. 7 Erläutere, wie das Verhalten der Heideschnecken an ihren Lebensraum angepasst ist.
In der Mittagshitze wird es am Boden sehr heiß. An der Spitze von Pflanzen­stängeln ist die Temperatur eher geringer. Vor dem
Vertrocknen schützen sie sich, indem sie sich in ihr Gehäuse zurückziehen und die Öffnung mit dem Stängel verschließen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3 Stoffwechsel und Bewegung
3. 1 Ernährung

Bestandteile der Nahrung (Seite 82/83)


0 1 Informiere dich über den Nährstoffgehalt von drei Lebensmitteln. Stelle die Ergebnisse in Form eines geeigneten Diagramms
dar.
individuelle Lösung; Diagrammtyp entweder Säulendiagramm aus dem Gehalt pro 100 g oder Kreisdiagramm mit Anteilen
$ 2 Ein Burger hat einen Energiegehalt von 1275 kJ (305 kcal). Berechne, wie lange du Fußball spielen musst, um die Energie um-
zusetzen.
Notwendig ist die Angabe der eigenen Körpermasse, in der Beispielrechnung 45 kg. Wenn pro Stunde beim Fußballspielen 33 kJ
pro kg Körpermasse verbraucht werden, sind dies bei 45 kg Körpermasse pro Stunde 1485 kJ. Der Burger hat einen Energiegehalt
von 1275 kJ. Dann muss man 1275 kJ/1485 kJ/h, also 0,86 Stunden oder 51 Minuten Fußball spielen.
. 3 Ein Erwachsener benötigt am Tag durchschnittlich 68 g Eiweiß, ein Kleinkind nur etwa 35 g. Da es wächst, muss der Eiweißbe-
darf eines Kleinkindes aber viel größer sein als der eines Erwachsenen. Erkläre anhand von Abb. 5.
Dass der absolute Betrag des Eiweißbedarfs beim Erwachsenen höher ist, liegt daran, dass seine Masse größer ist. Pro Kilogramm
benötigt das Kleinkind aber viel mehr Proteine, da es sich im Wachstum befindet und tatsächlich an Größe und Masse zunimmt.
Gerade dafür werden aber Proteine verwendet.

Praktikum: Mikroskopieren (Seite 84/85)


1 Beschreibe, welche Beobachtung auf Stärke schließen lässt.
Die Lösung färbt sich tiefblau bis schwarz.
2 Prüfe folgende Lebensmittel auf das Vorhandensein von Stärke und stelle das Ergebnis in Form einer Tabelle dar: Limonade,
Wurst, Kartoffeln, Brot, Nudeln, gekochtes Ei, Apfel, Haferflocken, Reis.
Kartoffeln, Brot, Nudeln, Haferflocken und Reis beinhalten Stärke, möglicherweise auch Wurst, je nach Herstellung und Inhalts-
stoffen.
3 Beschreibe deine Beobachtungen.
In Gegenwart von Eiweißen färbt sich die Biuret-Lösung violett, ohne bleibt sie tiefblau.
4 Überprüfe die in Aufgabe 2 genannten Lebensmittel auf das Vorkommen von Eiweißen.
Vor allem Wurst und Ei enthalten Eiweiß.
5 Kontrolliere mit Teststäbchen den Zuckergehalt in den drei Lösungen und beschreibe deine Beobachtungen.
Sofern der Messbereich der Teststäbchen zwischen 0,1–6 g/l liegt, lässt sich eine entsprechende Farbveränderung in der Stamm-
lösung (Konzentration 5 g/l, also 0,5 %) und in der einmal um den Faktor zehn verdünnten Lösung (0,5 g/l, also 0,05 %) auf den
Teststreifen feststellen. Die Zuckerkonzentration in der zweimal verdünnten Lösung (0,05 g/l, also 0,005 %) sind für den positiven
Nachweis zu gering. Der Nachweis ist bei Wasser ebenfalls negativ.
6 Bestimme mithilfe von Teststäbchen den Zuckergehalt in koffeinhaltiger Limonade und in Honig. Löse dazu einen Teelöffel
Honig in 250 ml Wasser. Beachte dabei, dass die Teststäbchen nur bis zu einer bestimmten Konzentration messen können.
individuelle Lösung. Falls die maximal messbare Zuckerkonzentration überschritten wird, muss das Getränk verdünnt werden und
nach der neuen Messung mit dem Verdünnungsfaktor umgerechnet werden.
7 Formuliere deine Beobachtungen.
Der Wasserfleck verschwindet beim Trocknen, der Fettfleck nicht.
8 Führe den Fettnachweis mit Walnüssen, einem Ei, Limonade und Chips durch und halte deine Ergebnisse in einer Tabelle fest.
Walnüsse +; Ei –; Limonade –; Chips + (Legende: +: enthält Fett, –: enthält kein Fett)
9 Milch ist laut Werbung ein gesundes Lebensmittel. Aber welche Nährstoffe sind in Milch enthalten?
a) Plane zu dieser Frage passende Nachweise und führe sich durch.
b) Begründe jeweils mithilfe deiner Beobachtungen, welche der drei Nährstoffe in der Milch enthalten sind.
Die Experimente zum Nachweis der drei Nährstoffe werden jeweils mit negativer Kontrolle durchgeführt.
a) Stärke-Nachweis: Zur Milch bzw. zu etwas Wasser wird jeweils Lugol‘sche Lösung gegeben.
b) In Milch und bzw. etwas Wasser wird jeweils ein Zucker-Teststreifen gehalten.
c) Zu Milch bzw. etwas Wasser wird jeweils etwas Natronlauge, Siedesteinchen und Fehling 1 gegeben und über dem Gasbrenner
vorsichtig erhitzt.
d) Ein Tropfen Milch bzw. ein Tropfen Wasser wird auf Löschpapier getropft und dann jeweils mit dem Fön getrocknet.
Die Beobachtungen lassen folgende Schlüsse zu:
Zu a) Beide Lösungen färben sich gelb. In Milch ist keine Stärke enthalten.
Zu b) Die Teststreifen zeigen, dass Milch auch Zucker enthält.
Zu c) In der Milch lässt sich nach einiger Zeit eine violette Verfärbung feststellen, in Wasser nicht. Daher sind in Milch Eiweiße
enthalten, in Wasser hingegen nicht.
Zu d) Der Wassertropfen hinterlässt nach dem Trocknen mit dem Fön keinerlei Spuren, an der Stelle, an der der Milchtropfen
aufgebracht wurde, bleibt das Löschpapier glasig. Milch enthält also Fette, Wasser nicht.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Vitamine und Co (Seite 86/87)
0 1 In einem Rezept findet sich folgende Empfehlung: „Das Gemüse soll nur kurz gedünstet werden.“ Ein intensives Kochen hin
gegen wird nicht empfohlen. Erläutere dies mit den Informationen auf dieser Seite.
Beim Dünsten wird das Gemüse nur kurz im heißen Wasserdampf zubereitet. Die in ihm enthaltenen Stoffe werden daher nicht
so lange und nicht so hohen Temperaturen ausgesetzt. Daher ist der Vitamingehalt nach dem Dünsten höher als nach intensivem
Kochen.
$ 2 Milch wird häufig in dunklen Flaschen oder in Kartons verpackt. Erläutere.
Dunkle Flaschen bzw. Kartons schützen vor zu starkem Licht. Daher zerfallen die in der Milch enthaltenen Vitamine nicht so
schnell und die Milch ist vitaminhaltiger.
$ 3 Ballaststoffarme Nahrung kann zu Verstopfung führen. Dies kann durch ausreichendes Trinken verhindert werden. Erkläre.
Ballaststoffe quellen in den Verdauungsorganen auf, indem sie Wasser aufnehmen. Ist im Nahrungsbrei sehr wenig Wasser ent-
halten. So entsteht dabei ein stark eingedickter Brei, der sehr fest werden kann. Dieser lässt sich dann nur sehr schwer durch den
Darm bewegen, was zu Schmerzen führen kann. Ausreichendes Trinken kann dagegen vorbeugen.
. 4 Skorbut war früher eine unter Seefahrern gefürchtete und verbreitete Krankheit. Informiere dich darüber und bereite eine
Präsentation vor, die neben der Ursache auch die Symptome erläutert.
Die Präsentation sollte Folgendes umfassen: Skorbut ist die Folge von Vitamin-C-Mangel. Da es früher noch keine Konservierungs-
methoden für Vitamin-C-haltige Nahrungsmittel gab, waren diese wenige Wochen nach Antritt der Schiffsreise aufgebraucht oder
schlecht geworden. Da Schiffsreisen aber viele Wochen dauern konnten, begann dann die Zeit des Mangels. Vitamin C ist unter
anderem an der Synthese von bestimmten Fasern beteiligt, die das Bindegewebe stabilisieren. Herrscht Mangel, finden diese
Vorgänge im Körper kaum noch statt. Das Bindegewebe wird daher empfindlich und anfällig. Leichte Beanspruchungen führen
dazu, dass es nachhaltig beschädigt wird. Es kann daher schnell zu Blutungen und Zahnausfall kommen. Den Betroffenen konnte
an Land meist schnell geholfen werden, wenn sie Nahrungsmittel verzehrten, die reich an Vitamin C sind.
. 5 Bei der Zubereitung von Salat soll immer auch ein wenig Öl verwendet werden. Erkläre.
Die fettlöslichen Vitamine A, D, E und K können nur dann resorbiert werden, wenn sie in etwas Öl oder Fett gelöst sind. Sonst
werden sie ausgeschieden und stehen dem Körper nicht zur Verfügung.

Ausgewogene Ernährung (Seite 88/89)


0 1 Informiere dich über Nahrungsmittel, die hauptsächlich Fette, Eiweiße oder Kohlenhydrate enthalten. Lege eine Tabelle an.
Individuelle Lösung, z.B.
Fett: Butter, Öl, fettiger Speck, …
Proteine: Fleisch, Fisch, Hülsenfrüchte, …
Kohlenhydrate: Getreide, Kartoffeln, Brot, Reis, Nudeln, …
$ 2 Gib für jedes der beiden in Abb. 3 dargestellten Gerichte die Gesamtmengen der drei Nährstoffgruppen sowie die insgesamt
enthaltene Energie an. Nutze dazu Abb. 4.
siehe Tabelle
Gesamtmassen der Nährstoffe Kohlenhydrate Fette Eiweiße
(jeweils in Gramm)
Pommes mit Currywurst 0,52 + 28,8 + 4,8 46,8 + 12,4 + 0,02 16,51 + 3,44 + 0,28
zusammen 34,12 59,22 20,23
belegtes Brötchen 45,6 + 1,3 + 0,81 1,08 + 0,1 + 0,03 + 0,09 + 11,6 8,4 + 0,45 + 0,21 + 0,27 + 10,4
zusammen 48,04 12,9 19,73

Gesamtenergiegehalt (jeweils in kJ):


Pommes mit Currywurst: 1866,8 + 1080,8 + 87,2 = 3034,8
Belegtes Brötchen: 943,2 +3 0,5 + 10,65 +2 2,95 + 610,8 = 1618,1
. 3 Stelle fest, inwieweit die zwei Mahlzeiten in Abb. 3 die empfohlene Nährstoffzusammensetzung aufweisen. Nutze dazu Abb. 2
und 4. Zeichne für jede der beiden Mahlzeiten ein passendes Kreisdiagramm.
Zunächst muss die absolute Gesamtmasse der Gerichte ermittelt werden:
Pommes mit Currywurst: 230 g belegtes Brötchen: 270 g
Davon wird der Anteil der drei Nährstoffgruppen ermittelt (s. Ergebnisse Aufgabe 2)
Kohlenhydrate: 34,12 g/230 g x 100 = 14 % 48,4 g/270 g x 100 = 17,8 %
Fette: 59,22 g/230 g x 100 = 25,7 % 12,9 g/270 g x 100 = 4,8 %
Eiweiße: 20,23 g/230 g x 100 = 8,8 % 48,4 g/270 g x 100 = 7,3 %
Die Daten werden nun in einem Kreisdiagramm dargestellt. Beide Gerichte entsprechen nicht den Empfehlungen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 4 Erläutere Möglichkeiten, die Ausgewogenheit der beiden Gerichte zu verbessern.
In beiden Gerichten muss zunächst der Gehalt an Eiweiß erhöht werden, dies ginge z. B. in Gericht 1 durch einen hülsenfruchthalti-
gen Salat (also mit Bohnen oder Erbsen), in Gericht 2 z. B. durch eine kleine Fleischbeilage (z. B. Wurstscheiben).
Der Fettgehalt in Gericht 1 ist nahezu ausreichend, in Gericht 2 könnte das Brötchen z. B. mit Butter bestrichen werden. Der Koh-
lenhydrat-Gehalt müsste in beiden Gerichten erhöht werden. Dies gelänge z. B. durch einen größeren Anteil an Brot bei Gericht 2
oder durch Brotbeilagen bei Gericht 1.
Insgesamt darf bei der Aufgabe aber nicht vergessen werden, dass die hier dargestellten Nahrungsmittel nicht die einzigen sind,
die am Tag verzehrt werden. Daher ist es auch möglich, die in diesen Gerichten fehlenden Nährstoffe durch andere Mahlzeiten zu
sich zu nehmen.
$ 5 Bei einer veganen Ernährung werden gar keine tierischen Produkte verzehrt, also auch nicht Milch, Eier und Honig. Erläutere,
inwiefern dies problematisch werden kann.
Bei Veganern kann vor allem die Versorgung mit Eiweißen unvollständig sein, denn diese sind gerade in tierischen Produkten
enthalten. Dies kann problematisch werden, da Eiweiße vor allem zum Aufbau und zum funktionierenden Ablauf von Zellen und
damit auch zum Wachstum benötigt werden.
. 6 Stelle eine Mahlzeit zusammen, die dir schmeckt. Untersuche mithilfe von Abb. 2 und 4, ob sie ausgewogen ist.
individuell, anhand von Aufgabe 2 und 4 kann aber die Vorgehensweise ermittelt werden

Material: Ernährung kritisch betrachtet (Seite 90/91)


$ 1 Beurteile, ob die geschilderte Ernährungsweise sinnvoll ist.
Durch die angesprochene Vielfalt gelingt es, dass das Thema Ernährung positiv besetzt bleibt. Darüber hinaus ist gewährleistet,
dass bei der empfohlenen Ernährungsweise alle lebenswichtigen Stoffe, wie Nährstoffe, Vitamine, Ballaststoffe, Mineralstoffe in
ausreichender Menge täglich zu sich genommen werden können.
. 2 Erstelle einen Fragebogen zum Ernährungsverhalten von Jugendlichen und gib ihn möglichst vielen Freunden, Mitschülern
etc. Werte das Ergebnis deiner Umfrage aus.
individuelle Lösung. Der Fragebogen sollte aber folgende Aspekte beinhalten:
– Wie regelmäßig isst du und wie viele Mahlzeiten nimmt du pro Tag ein?
– Wie viel Flüssigkeit trinkst du pro Tag?
– Isst du eher Fastfood oder kochst du selbst/bzw. isst du Gekochtes daheim?
– Wie oft isst du Obst und Gemüse am Tag und wie viele verschiedene Sorten sind es täglich?
– Bist du Vegetarier oder Veganer (wenn ja: Wie achtest du auf deine Eiweißversorgung)?
$ 3 Ermittle die durchschnittliche Masse einer Himbeere und kläre dann die Frage, wie viele Himbeeren in einem „Fruchtjoghurt
mit Himbeergeschmack“ enthalten sein müssen.
Vorgehensweise: Mehrere Himbeeren wiegen und den Durchschnittswert berechnen (etwa 3–6 g). Ein Fruchtjoghurt mit Himbeer-
geschmack enthält demgemäß etwa 1–2 Himbeeren.
$ 4 Liste Vorteile aus Sicht des Herstellers auf, Aromen statt Früchte zu verwenden.
Vorteile in der Verwendung von Aromen aus Sicht eines Lebensmittelherstellers:
– Aromen sind billiger als echte Früchte.
– Aromen behalten viel länger den Geschmack als echte Früchte.
– Aromen sind länger haltbar als echte Früchte.
– Aromen schmecken intensiver als echte Früchte, damit schmeckt das Lebensmittel manchmal besser.
0 5 Finde Beispiele für solche Werbung (Zeitschriften, Internet). Fasse die Aussagen der Werbung zusammen und beurteile ihre
Wirkung auf Kinder.
Die Werbung soll niedlich und ansprechend auf Kinder wirken. Kinder sollen daher ihren Eltern gegenüber den Kauf dieses Le-
bensmittels einfordern. Einmal an dieses Lebensmittel gewöhnt wird es häufig wieder gekauft.
. 6 Notiere die Angaben zu Nährstoffen und Brennwert eines solchen Lebensmittels. Beurteile, ob es für Kinder geeignet ist.
individuelle Lösung, je nach gewähltem Lebensmittel. Häufig dürfte aber herauskommen, dass die Lebensmittel vor allem sehr
zucker- und fetthaltig sind. Hinweis: Dies bewirkt, dass die Lebensmittel gut schmecken, die Kinder daran gewöhnt werden und
das Lebensmittel erneut einfordern werden.
$ 7 Errechne, wie lange du radfahren musst, um die mit 100 g des Beispiellebensmittels zugeführte Energie umzusetzen. (Radfah-
ren: 880 kJ/h).
1842 kJ/880 kJ/h = 2,09 Stunden oder 2 Stunden und 5 Minuten
$ 8 Beim Fernsehen setzt man pro Stunde und Kilogramm Körpermasse etwa 4,4 kJ um. Berechne wie in Aufgabe 7 und vergleiche
die Ergebnisse.
Berechnungen für einen 45 kg schweren Schüler: Beim Fernsehen 4,4 kJ pro kg und Stunde, also 198 kJ für diese Person.
1842 kJ/198 kJ/h = 9,3 Stunden oder 9 Stunden und 18 Minuten

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 9 Fasse die Aussagen dieser Werbung zusammen. Findest du sie überzeugend? Beurteile.
Zusatzinformationen: Energiebedarf eines 70 kg schweren 20-Jährigen am Tag, sitzende Tätigkeit: ca. 11 500 kJ; Brennwert des
Körperfetts: ca. 29 400 kJ/kg.
Ohne große Veränderungen in Lebens- und Ernährungsgewohnheiten soll ein Abnehmen möglich sein, indem man die Produkte
der Firma bodybest erwirbt. Die Wirkung soll auf einem Wirkstoff auf dem Pflaster beruhen, der lokal die Fettverbrennung fördert.
Der der Nahrung zugesetzte Stoff soll die Aufnahme von Fett durch den Darm verhindern. Die Werbung kann überzeugend sein,
weil sie dem Verbraucher ein gutes Gefühl vermittelt, indem
– die auf dem Bild dargestellte Person vor dem Abnehmen dick und unglücklich, danach glücklich und muskulös aussieht.
– die beworbenen Produkte angeblich patentiert sind.
– die Erfolgsgeschichte einer angeblichen Testperson angefügt wird.
– das Abnehmen ohne Umstellung der eigenen Gewohnheiten versprochen wird, was insgesamt als erleichternd wahrgenommen
werden dürfte.
– der Artikel positiv besetzte Phrasen enthält („Bikini-Figur“, „man wird Sie lieben“, „leicht gemacht“, „Frustrierendes unterbleibt“,
…).
Die Werbung ist unrealistisch. 10 kg Fett in 10 Tagen würde bedeuten, dass die Energiemenge von 294 000 kJ umgewandelt oder
eingespart werden müsste. Bei einer täglich notwendigen Zufuhr von etwa 10 800 kJ kann in 14 Tagen diese Energiemenge nicht
eingespart werden Dies gelingt selbst dann nicht, wenn man vollkommen auf Nahrungszufuhr verzichtet. Darüber hinaus ist ein
Abnehmen ohne Umstellung der eigenen Gewohnheiten nicht möglich
. 10 Informiere dich über erfolgreiches, gesundes Abnehmen. Bereite einen Kurzvortrag oder ein Referat dazu vor.
Erfolgreiches Abnehmen ist ein langfristiger Vorgang und beruht im Wesentlichen auf drei Prinzipien: Zuerst muss die Ernährung
umgestellt werden, was als Zweites eine Verhaltensänderung bedeutet. Beides bewirkt, dass man sich ausgewogener ernährt und
gleichzeitig die Menge der pro Tag zugeführten energiereichen Stoffe verringert. Als Drittes muss man zusätzlich mehr Sport trei-
ben oder sich intensiver bewegen. Hierdurch wird pro Tag mehr Energie benötigt, die teilweise aus gespeichertem Fett. Freigesetzt
wird. Die Ernährungsweise muss abwechslungsreich sein, um Mangelerscheinungen zu vermeiden.

Körpergewicht (Seite 92)


0 1 Erläutere, wie sich der BMI durch stärkeres Längenwachstum eines Jugendlichen verändert.
Durch starkes Längenwachstum wird der Nenner des Bruchs zur Berechnung des BMI größer. Unterbleibt gleichzeitig eine Zunah-
me der Körpermasse, etwa durch entsprechenden Muskelaufbau, so bleibt der Zähler dieses Bruchs gleich groß. Dann wird der
BMI kleiner. Ein Beispiel kann dies verdeutlichen:
Jugendlicher vor dem Wachstum: Größe: 149 cm, Gewicht: 41 kg, BMI also 18,46 kg/m2, Fazit: normalgewichtig
Jugendlicher nach dem Wachstum: Größe: 161 cm, Gewicht: 41 kg, BMI also 15,8 kg/m2, Fazit: untergewichtig

Fehlernährung (Seite 93)


0 1 Anorexie hat mit falscher Körperwahrnehmung zu tun. Erläutere mithilfe der Abb. 1 und des Zitats.
Die Betroffenen nehmen sich selbst als dickleibig und zu fett wahr. Nahrung wird als verstärkend für diesen Effekt betrachtet.
$ 2 Erläutere die Empfindungen, die oben zitiert werden, indem du dich in einen Betroffenen hineinversetzt.
Betroffene Menschen leiden stark. Starke Gewichtszunahme oder auch -abnahme kann unterschiedliche psychische Gründe
haben. Negative Reaktionen Außenstehender können sehr verletzend sein.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3. 2 Verdauung der Nahrung

Der Weg der Nahrung (Seite 94/95)


0 1 Stelle die Verarbeitung der Nahrung (z. B. eines mit Ei belegten Brötchens) durch die Verdauungsorgane dar, indem du
a) einen Text schreibst
oder
b) ein Verlaufsschema erstellst.
individuelle Lösung. Auf jeden Fall muss zum Ausdruck kommen, dass die Kohlenhydratverdauung in Mund und Dünndarm, die
Eiweißverdauung in Magen und Dünndarm und die Verdauung der Fette im Dünndarm jeweils mithilfe von Enzymen erfolgt und
dass erst dann die Bausteine der Nährstoffe durch die Zellen der Darm- und Blutgefäßwand ins Blut und bei den Fettsäuren in die
Lymphe und damit in den Körper übertreten können.
$ 2 Durchfall kann eine Reaktion des Körpers auf bestimmte Bakterien sein, die in den Darm gelangt sind.
a) Erläutere den Vorteil für den Menschen.
b) Mehrere Tage anhaltende Durchfälle sind lebensgefährlich. Erkläre, indem du Abb. 1 nutzt.
a) Der Durchfall fördert die schnelle Ausscheidung der im Darm befindlichen die Krankheit auslösenden Bakterien.
b) Bei länger anhaltenden Durchfällen verliert der Körper sehr viel Wasser und mit ihm wichtige Mineralstoffe. Wird dem nicht
durch viel Trinken und Einnahme bestimmter Mineralsalze entgegengewirkt, kann es zu lebensbedrohlichen Mangelerscheinun-
gen kommen.

Enzyme – Werkzeuge der Zellen (Seite 96)


0 1 Erläutere den Begriff „substratspezifisch“.
Substratspezifisch bedeutet, dass ein Enzym nur einen bestimmten Stoff (das Substrat) umsetzen kann. Dies liegt daran, dass
das Enzym eine bestimmte dreidimensionale Form besitzt, in die nur ein bestimmtes Substrat hineinpasst.
$ 2 Stelle eine begründete Hypothese zu folgender Beobachtung auf: Steckt man in einen stärkehaltigen, festen Pudding einen
Löffel, der zuvor abgeleckt wurde, so wird der Pudding nach etwa einer Stunde flüssig.
Der am Löffel anhaftende Speichel enthält das Enzym Amylase. Das zerlegt die Stärke im Pudding nach und nach in Zweierbau-
steine aus Zucker. Daher ist der Pudding nach einiger Zeit flüssig.
. 3 Plane ein Experiment, um die Hypothese aus Aufgabe 2 zu überprüfen.
Überprüfungsexperiment: In den Pudding zuvor ein paar Tropfen Iod-Kaliumiodid-Lösung (Lugol‘sche Lösung) geben. Die sich
bildende schwarze Farbe verschwindet an der Stelle, an der der mit Speichel benetzte Löffel in den Pudding eintaucht. Dann ist
dort keine Stärke mehr enthalten.

Praktikum: Enzyme (Seite 97)


1 Gib an, was du nach und nach schmeckst.
Nach und nach schmeckt das zerkaute Brot im Mund süßlich.
2 Beschreibe die Durchführung.
Auf drei Versuchsansätze wird jeweils Fehling-Lösung I und II gegeben und dann auf ca. 70 °C erwärmt. In Versuchsansatz 1 befin-
det sich nur Speichel, in 2 unzerkautes Brot und in 3 Brot, das etwa 5 Minuten im Mund zerkaut wurde.
3 Vergleiche die Beobachtungen der drei Versuchsansätze miteinander.
In den ersten beiden Versuchsansätzen bleiben die Lösungen jeweils dunkelblau und klar. Da der Fehling-Nachweis Zucker anzei-
gen kann, wenn sich das Gemisch hellrot färbt und ein Niederschlag entsteht, ist hier jeweils kein Zucker enthalten. Im 3. Ansatz
ist der Zuckernachweis positiv. Die Stärke muss also durch die Wirkung eines Enzyms im Speichel in Zucker zersetzt worden sein.
4 Plane unter Verwendung eines weiteren Nachweisverfahrens ein Experiment, das deine Erklärung unterstützen kann
(s. Seite 84). Führe es durch.
Alternativ kann man die Versuchsansätze jeweils mit Iod-Kaliumiodid-Lösung (Lugol`scher Lösung) versetzen. Dabei beobachtet
man
– Im ersten Versuch, dass die Lösung die gelbe Eigenfarbe der Iod-Kaliumiodid-Lösung behält,
– im zweiten Versuch eine blau-schwarze Verfärbung der Iod-Kaliumiodid-Lösung (Nachweis für Stärke),
– im dritten Versuch wieder die gelbe Eigenfarbe der Iod-Kaliumiodid-Lösung. Auch dies ist ein Hinweis, dass die Stärke durch die
Wirkung eines Enzyms im Speichel zerlegt worden sein muss.
5 Nenne die Beobachtungen und erkläre sie.
In Schale 1 bleibt nach der Zugabe von Speichel die gelbliche Eigenfarbe des Agars sichtbar, weil weder Iod-Kaliumiodid-Lösung
hinzugegeben wurde noch Enzyme vorhanden sind, die die Stärke abbauen könnten. In Schale 3 wird zwar ein Enzym hinzugege-
ben, dennoch bleibt die blau-schwarze Farbe der Iod-Kaliumiodid-Lösung erkennbar, weil Stärke nicht das richtige Substrat für
Trypsin darstellt. Hingegen entsteht an der Stelle der Schale 2, wo der Speichel verstrichen wurde, ein Fleck in der blau-schwarzen
Verfärbung; er hat die gelbliche Eigenfarbe des Agars. Im Speichel ist ein Enzym enthalten, das Stärke abbaut.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Vorgänge im Dünndarm (Seite 98/99)
0 1 Beschreibe die Verdauung der Nährstoffe im Dünndarm.
Nährstoffe werden im Dünndarm in Bausteine zerlegt. Dabei werden länger- und kurzkettige Kohlenhydrate in Einfachzucker,
Proteine und kurzkettige Aminosäureketten in einzelne Aminosäuren und Fette in Fettsäuren und Glycerin zerlegt. Bei jedem
Zerlegungsschritt ist ein bestimmtes Enzym beteiligt.
$ 2 Erläutere das Bausteinprinzip.
Das Bausteinprinzip besagt, dass Stoffe wie die Nährstoffe aus universellen Bausteinen bestehen. Beim Abbau dieser Stoffe wer-
den die Bausteine freigesetzt und können in anderer Kombination und auch an anderer Stelle wieder zusammengesetzt werden.
. 3 Erläutere am Beispiel des Dünndarms das Basiskonzept Struktur und Funktion.
Die Oberfläche der inneren Dünndarmwand ist durch Auffaltung vergrößert. Das fördert den Stoffübertritt. Gleiches gilt für die
verzweigten Blut- und Lymphgefäße in der Dünndarmwand. Beides fördert die Resorption. Die Länge des Dünndarms ist ein
weiteres Beispiel dafür, dass der Bau eines Organs an seine Funktion angepasst ist. So wird gewährleistet, dass der Nahrungsbrei
genügend Zeit im Dünndarm verweilt, bis die Enzyme die Nahrung in ihre Bausteine zersetzt haben.

Leber und Niere (Seite 100/101)


0 1 Das Blut gelangt vom Dünndarm zunächst in die Leber. Erläutere die Bedeutung.
Die Leber kann dadurch Problemstoffe unschädlich machen, bevor sie sich im Körper verteilen, und sie speichert Kohlenhydrate,
indem sie dem Blut aus Richtung Dünndarm Zuckerbausteine entnimmt.
. 2 Nur diejenigen Blutgefäße des Darms, die den Dickdarm versorgen, sind nicht unmittelbar an die Leber angeschlossen. Daher
werden manche Medikamente in Form von Zäpfchen verabreicht. Erkläre den Vorteil.
Medikamente, die über den Enddarm resorbiert werden, gelangen in Blutgefäße, die nicht unmittelbar in die Leber führen. Daher
kann die Leber diese Medikamente nicht unmittelbar abbauen, sodass diese in höherer Konzentration zu den Orten ihres Wirkens
gelangen können.
$ 3 Organspende geht mit Sorgen und Ängsten einher. Informiere dich und stelle Pro- und Contra-Argumente zusammen.
Folgende Fragen können neben anderen auftauchen:
– Wer entscheidet darüber, ob ich tot bin?
– Kann die Nachfrage über ein Organ den Arzt in seiner Entscheidung derart beeinflussen, dass er mich für tot erklärt, obwohl ich
noch behandelbar und überlebensfähig bin.
– Wer entscheidet darüber, welche Organe entnommen werden?
– Wer entscheidet darüber, wer die Organe erhält?
Mögliche Argumente:
Pro: Man trägt dazu bei, dass ein schwer erkrankter und vom Tod bedrohter Mensch länger leben kann. Dies geschieht zu einem
Zeitpunkt, an dem die Ärzte aus ihrer Sicht erklären, dass man selbst tot ist.
Contra: Man vertraut den Ärzten nicht oder vermutet, dass deren Entscheidung durch andere Beweggründe geleitet wird (z. B. an
der Transplantation Geld zu verdienen). Manche Menschen, die an ein Leben nach dem Tod glauben, könnten vermuten, dass ihr
Körper dann unvollständig ist. Gerade in Bezug auf das dann fehlende Herz könnten manche Menschen davon ausgehen, dass
ihnen dann die Seele abhanden gekommen ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3. 3 Atmung

Bau und Funktion der Lunge (Seite 102/103)


0 1 Beschreibe den Weg des Sauerstoffs von der eingeatmeten Luft bis zu einer Zelle des menschlichen Körpers, indem du
a) einen kurzen Text schreibst
oder
b) ein Verlaufsschema erstellst.
a) Durch Nase oder Mund gelangt die Luft in den Rachen, von dort in die Luftröhre und dann in die Bronchien und von dort bis in
die Alveolen. Hier erfolgt der Übertritt der Luft ins Blut; mit dem er zu den Zellen transportiert wird.
b) Nase/Mund → Rachen → Luftröhre → Bronchien → Alveolen → Blut → Zelle
$ 2 Bei der Zellatmung fällt Kohlenstoffdioxid an. Erläutere den Weg dieses Gases aus den Zellen in die Umgebungsluft. Verwen-
de hierzu die Abbildungen 2 und 3.
Kohlenstoffdioxid entsteht bei der Zellatmung in jeder Zelle. Es löst sich in der die Zellen umgebenden Gewebsflüssigkeiten und
dann auch im Blut. Mit diesem wird es bis zu den Alveolen transportiert. Aufgrund seiner höheren Konzentration im Blut ver-
glichen mit der in den Alveolen vorhandenen Luft tritt das Gas in die Alveolen über. Beim Ausatmen wird es an die Umgebung
abgegeben.
. 3 Die Oberfläche aller Alveolen in der Lunge beträgt ca. 200 m2 (Größe eines Tennisplatzes). Erläutere den Vorteil, indem du ein
Basiskonzept einbeziehst.
Zum Basiskonzept Struktur und Funktion gehört das Prinzip der passenden Oberflächengröße. Durch die besonders große Fläche
der Alveolen ist die Kontaktfläche zwischen Blut und Luft besonders groß, sodass in der kurzen Zeit eines Atemzuges die Atem­
gase effektiv ausgetauscht werden können.

Der Atemmechanismus (Seite 104/105)


0 1 Nimm kritisch Stellung zu folgender Aussage: „Die Lunge ist ein Muskel. Durch ihr Zusammenziehen erfolgt die Ausatmung.
Dehnt sie sich, atmen wir ein.“
Die Lunge ist kein Muskel. Ihre Befüllung und Entleerung erfolgt passiv durch umgebende Muskelgruppen. Wäre die Lunge selbst
ein Muskel, so könnte sie sich selbst nur zusammenziehen und dabei Luft hinausdrücken. Muskeln dehnen sich nicht aktiv.
$ 2 Auf dieser Doppelseite befinden sich mehrere Beispiele für das Basiskonzept Struktur und Funktion (s. auch Seite 400). Finde
und erläutere sie.
Beispiele für das Basiskonzept Struktur und Funktion:
a) Äußere und innere Zwischenrippenmuskeln sind Gegenspieler genauso wie Zwerchfell und Bauchmuskulatur. Gemeinsam über-
nehmen sie jeweils das Ein- und Ausatmen bei der Brust- bzw. Bauchatmung.
b) Bewegliche Verbindung der Rippen mit der Wirbelsäule: Nur so ist eine Auf- und Abbewegung des Brustkorbes möglich.
. 3 Erkläre die Reaktion des Körpers auf sportliche Aktivitäten, indem du Abb. 3 und den Text verwendest. Ordne dabei auch Stör-
größe und Effektor zu.
Rezeptoren in Halsschlagader und Gehirn registrieren den durch Sport niedrigen Sauerstoffgehalt im Blut bzw. den hohen Koh-
lenstoffdioxidgehalt. Im Atemzentrum im Gehirn führt die Abweichung des Istwerts vom Sollwert zur Leitung eines Stellwertes an
das Erfolgsorgan Atemmuskulatur. Die intensivere Atmung führt dazu, dass vermehrt Sauerstoff ins Blut gelangt und Kohlenstoff-
dioxid ausgeatmet wird. So wird der Körper dem erhöhtem Sauerstoffbedarf gerecht, indem erreicht wird, dass die Veränderung
ausgeglichen wird.

Material: Modell zur Mechanik des Atmens (Seite 106)


0 1 Vergleiche das Torso-Modell mit deinem Wissen über das Original.
Das Modell veranschaulicht die Lage der Organe im Körper und ihre Größe recht gut. Vergleicht man das Torso-Modell mit der
Realität, so lassen sich auch Unterschiede feststellen: So bestehen die Organe aus anderen Materialien und nicht aus Hartkunst-
stoff. Tatsächlich sind die Organe weder hart noch fest, sondern weich und flexibel. Die Farbe der Organe ist nicht richtig abgebil-
det. Vorgänge – wie zum Beispiel Atembewegungen – können mit diesem Modell nicht gezeigt werden.
$ 2 Ordne in Form einer Tabelle den Bestandteilen des Modells die Teile des Originals zu. Erläutere, inwiefern Modell und Original
nicht identisch sind.
Als Tabelle formatieren:
gegabeltes Röhrchen – Luftröhre und Bronchien
Luftballons – Lungenflügel
Glasglocke – Raum innerhalb des Brustkorbes
Gummimembran – Zwerchfell
Die Materialien, aus denen die Modellbestandteile sind, sind vollkommen andersartig und weisen nicht dieselben Eigenschaften
auf. Ferner muss die Gummimembran durch äußeren Zug abgesenkt werden, im Original geschieht das durch die im Zwerchfell
liegenden Muskeln. Um die Ballone herum befindet sich im Modell ein gasgefüllter Raum, was im Original nicht der Fall ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 3 Das Modell soll die Vorgänge bei der Bauchatmung veranschaulichen. Erläutere dies.
Durch Ziehen an der Gummimembran wird der in der Glasglocke befindliche Raum größer. Da sich so der Luftdruck in diesem Ge-
fäß verringert. Der nun höhere umgebende Luftdruck drückt Luft in die Ballons. Zieht sich die Membran ohne äußeren Zug durch
ihre Eigenelastizität zusammen, laufen die Vorgänge umgekehrt ab.
. 4 Ordne den Bestandteilen des Modells die Teile des Originals zu.
horizontale Pappstreifen: Rippen; vertikale Pappstreifen: Wirbelsäule und Brustbein
. 5 Erkläre, was mit den Gummibändern beim Verschieben wie in Abb. 3 geschieht, und vergleiche dieses Verhalten des Modells
mit den Vorgängen bei der Brustatmung.
Während ein Gummiband erschlafft, wird das andere gedehnt. Die Gummibänder stellen modellhaft die Muskeln dar. Während
bei der Brustatmung die Muskeln die Bewegung der Rippen verursachen, führen im Modell die Bewegungen der Pappstreifen
(stellen den Brustkorb dar) zum Anspannen bzw. Erschlaffen der Gummibänder (stellen die Atemmuskulatur dar).

Praktikum: Atmung messen (Seite 107)


1 Ermittle mithilfe von experimentellen Daten das Atemzugvolumen verschiedener Personen sowie die Vitalkapazität.
individuelle Lösung
2 Stelle Gemeinsamkeiten und Unterschiede hinsichtlich der gemessenen Atemvolumina bei verschiedenen Personen fest.
Finde mögliche Erklärungen für Unterschiede.
Unterschiede oder Gemeinsamkeiten der Personen können an verschiedenen Voraussetzungen hängen, z.B. Alter, Geschlecht,
Trainingszustand, Tagesform, Gesundheitszustand, etc.
3 Bestimme für wenigstens 10 verschiedene Versuchsteilnehmer das Atemzugvolumen sowie die Anzahl der Atemzüge pro
Minute. Fertige dazu eine Tabelle nach folgendem Muster an.

Atemzüge pro Minute Atemzugvolumen (l) Atemzeitvolumen (l/min)


Eric 8 0,7
Inga 9 0,5

individuelle Lösung
4 Ermittle für jede Versuchsperson das Atemzeitvolumen.
Das Atemzeitvolumen berechnet sich aus dem Produkt von Atemzügen pro Minute (Atemfrequenz in Atemzüge/min) und dem
Atemzugvolumen (in Liter/Zug. Damit ergibt sich das Atemzeitvolumen (in l/min).
5 Stelle die Ergebnisse der verschiedenen Versuchsteilnehmer in einer sinnvollen Diagrammform gegenüber und erläutere
mögliche Unterschiede.
Sinnvoll ist hier, Balkendiagramme als Ergebnis der Versuchsteilnehmer gegenüberzustellen. Unterschiede können mit den in der
Aufgabe liegenden Verschiedenheiten erläutert werden. Darüber hinaus wird das AZV durch zwei Größen (Atemzüge pro Minute
und Atemzugvolumen) beeinflusst, es ist also möglich, dass zwei Personen trotz unterschiedlicherer Atemfrequenz bzw. verschie-
dener Atemtiefe dasselbe AZV haben.
6 Erkläre folgende Beobachtung: Zwei Versuchsteilnehmer haben dasselbe Atemzeitvolumen von 5,6 Liter/min. Allerdings
atmet der eine 14-mal pro Minute ein und aus, der andere nur 8-mal.
Die Teilnehmer unterschieden sich in ihrem Atemzugvolumen: Person A atmet hierbei nur 0,4 Liter ein, wohingegen Person B
0,7 Liter einatmet.
7 Ändert sich das Atemzeitvolumen durch körperliche Belastung? Plane ein Experiment zur Überprüfung.
Man kann den Versuch durchführen, indem man vor und nach körperlicher Belastung (z. B. einige Runden auf dem Schulhof
laufen) sowohl die Menge der Atemzüge pro Minute als auch das Atemzugvolumen bestimmt. Im Ergebnis kann man feststellen,
dass das AZV nach der Belastung höher ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3. 4 Blutkreislauf

Zusammensetzung und Aufgaben des Blutes (Seite 108/109)


0 1 Stelle die Zusammensetzung des Blutes (Abb. 2) in einem geeigneten Diagramm dar.
Sinnvoll ist hier ein Kreisdiagramm; bitte ein entsprechendes anfertigen! Also: 56 % Blutplasma, 44 % Blutzellen.
0 2 Fasse die Aufgaben des Blutes in einer Tabelle zusammen.
siehe Tabelle
Wasser Transport von Nährstoffen, Abfallstoffen, Hormonen, Salzen, Eiweißen, Fetten u. v. m. sowie der Ab-
transport von Abfall- und Giftstoffen und der Transport von Wärme
Rote Blutzellen Sauerstoff- und Kohlenstoffdioxidtransport
Weiße Blutzellen Abwehr und Vernichten von Fremdstoffen und Krankheitserregern
Blutplättchen Gemeinsam mit Stoffen des Blutplasmas erwirken sie den Wundverschluss durch Blutgerinnung.

$ 3 Eine Blutuntersuchung an zwei 70 kg schweren Männern ergibt: Ein Untrainierter hat eine Gesamtmasse von Hämoglobin von
1050 g, ein auf Ausdauer Trainierter von 1520 g. Stelle eine Hypothese zur Erklärung auf.
Hypothese: Der Körper des Ausdauersportlers ist im Laufe der Zeit trainiert worden. Die ständige körperliche Belastung führt zu
dauerhaft
– erhöhtem Energiebedarf,
– damit verbunden zu stärkerem Ausmaß an Zellatmung,
– damit verbunden zu erhöhtem Sauerstoffbedarf.
Daher hat der Körper den Gehalt an Hämoglobin erhöht. So ist es ihm möglich, in einem Liter Blut mehr Sauerstoff zu transportie-
ren als beim Untrainierten.
. 4 Eine Blutuntersuchung führt bei drei Patienten zu den in Abb. 4 dargestellten Ergebnissen. Vergleiche die Werte mit den
Angaben in Abb. 3 und formuliere begründete Vermutungen über Beschwerden, unter denen die Patienten leiden.
Die erste Person leidet vermutlich unter Sauerstoffmangel und ist körperlich weniger belastbar, da der Gehalt an Roten Blutzellen
deutlich geringer ist als beim Gesunden und diese für den Sauerstofftransport verantwortlich sind. Bei der zweiten Person könnte
die Blutgerinnung gestört sein, da der Gehalt an Blutplättchen geringer ist als beim Gesunden. Bei der dritten Person könnte die
Körperabwehr geschwächt sein, da der Gehalt an Weißen Blutzellen geringer ist als beim Gesunden.

Der Blutkreislauf (Seite 110/111)


0 1 Beschreibe den Weg des Kohlenstoffdioxids von den Zellen zur Außenwelt.
Kohlenstoffdioxid fällt bei der Zellatmung im Gewebe an. Es wird dort in Blutkapillaren aufgenommen und mit dem Blut trans-
portiert. Venen leiten es in die rechte Herzhälfte, dort wird durch die Lungenarterie in die Lunge gepumpt. Dort gelangt es aus den
Kapillaren in die Alveolen und wird ausgeatmet.
$ 2 Die Gesamtlänge aller Blutgefäße im menschlichen Körper beträgt rund 100 000 km. Das deutet auf ein Basiskonzept hin.
Benenne es und erläutere.
Basiskonzept Struktur und Funktion: Nur weil ein so ausgedehntes und sich verzweigendes Gefäßnetz vorhanden ist, kann jedes
Gewebe bis hin zu jeder Zelle erreicht werden. So ist auch die Funktion der Versorgung einer jeden Zelle genauso wie die Entsor-
gung der im Stoffwechsel der Zellen entstehenden Abfallstoffe gewährleistet.
. 3 Die Durchblutung der Organe ist nicht immer gleich. Bei körperlicher Arbeit werden die Muskeln stärker durchblutet, nach
dem Essen die Verdauungsorgane. Erläutere, indem du die Begriffe Versorgung und Entsorgung verwendest.
Beim Sport müssen vor allem die Muskelzellen mehr leisten und werden daher bevorzugt versorgt. Dies gelingt durch eine bessere
Durchblutung der jeweiligen Muskelgewebe. Gleichzeitig müssen auch die vermehrt anfallenden Abfallstoffe abtransportiert und
entsorgt werden. Nach einer Mahlzeit ist das Angebot an Nährstoffen groß. Die Nährstoffe können nur dann effektiv verdaut
werden, wenn die Zellen der Verdauungsorgane gut mit Blut versorgt werden. Dann können auch die Nährstoffe besser ins Blut
aufgenommen werden, sodass auf diese Weise die Versorgung optimiert wird.

Transport des Blutes (Seite 112/113)


0 1 Beschreibe die Fließrichtung des Blutes ausgehend von der rechten Vorkammer, indem du
a) einen Text schreibst oder
b) ein Verlaufsschema anfertigst.
als Fließschema: rechte Vorkammer → rechte Kammer → Lungenarterie → Lunge → Lungenvene → linke Vorkammer → linke
Kammer → Aorta → Körperarterie → Kapillaren → Gewebe und Zellen → Kapillaren → Venen → Körpervene → rechte Vorkam-
mer; oder als Text analog
$ 2 Befindet sich das in Abb. 1 gezeigte Herz in der Systole oder in der Diastole? Begründe.
Das Herz ist in der Diastole, weil die Taschenklappen geschlossen und die Segelklappen geöffnet sind. Daher strömt Blut aus den
Vorkammern in die Kammern.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 3 Erkläre die Folgen für Körper und Lunge, wenn rechte und linke Herzhälfte vertauscht wären, die ableitenden Blutgefäße aber
dieselben blieben.
Da die linke Herzhälfte muskulöser ist, würde sie das Blut mit zu hohem Druck durch die Lunge pumpen. Deren feinen Strukturen,
die Alveolen, würden dann geschädigt. Dann liefe die Lunge voll Blutplasma. Atmen wäre kaum mehr möglich. Da die rechte
Herzhälfte das Blut mit sehr geringem Druck pumpt, würde es nicht ausreichend in alle Körperregionen gepumpt. Das Gewebe
wäre unterversorgt. Möglicherweise käme das Blut in den Venen nicht gegen die Schwerkraft zum Herzen zurück. Der Blutstrom
käme zum Erliegen.

Praktikum: Herzpräparation (Seite 114)


1 Orientiere dich zunächst, wo vorn und hinten sowie rechts und links beim Herzen ist. Fertige dann eine Skizze des Herzens an
und beschrifte die erkennbaren Teile. Die Abbildungen auf Seite 111 und 112 können als Hilfe dienen.
Deutlich erkennbar sind (s. Abb.):
– rechte und linke Herzhälfte,
– der auf der linken Herzkammer aufliegende linke Vorhof auf,
– der von der rechten Herzkammer dezent abgetrennt rechte Vorhof,
– die großen Arterien, die in den Körper führen ebenso wie die Arterien, die in die Lunge führen,
– die neben dem rechten Vorhof befindlichen Reste der großen aus dem Körper ins Herz führenden Körpervene.
in den Körper
führende Arterie

linker Vorhof

in die Lunge
führende Arterie linke Kammer

rechter Vorhof

aus dem Körper


kommende Blutgefäße rechte Kammer

2 Benenne die an den Vorhöfen und Kammern entspringenden Adern, soweit sie an dem zu präparierenden Herzen noch zu
erkennen sind.
Je nach Präparationszustand sind mehr oder weniger Gefäßansätze erhalten und noch erkennbar. Im Optimalfall sind noch alle
Gefäße erkennbar, also Aorta, große Körpervene, Lungenvene und Lungenarterie.
3 Skizziere das gesamte geöffnete Herz.
Die Skizze sollte etwa Abb. 112.1 im Schülerbuch entsprechen.
4 Fertige eine Skizze der Segelklappen an.
Die Skizze gleicht entsprechenden Bereichen in Abb. 112.1 im Schülerbuch.
5 Vergleiche die rechte mit der linken Hälfte des Herzmuskels.
Es ist zu erkennen, dass die linke Herzhälfte deutlich muskulöser ist als die rechte.
6 Kennzeichne (z. B. mit Bindfäden) den Weg des Blutes durch das Herz, also aus der Körperschleife in die Lunge und aus der
Lunge zurück in den Körper.
individuelle Lösung. Anmerkung: der Weg des Blutes aus dem Körper über den rechten Vorhof und die rechte Kammer weiter in die
Lunge und von dort über linken Vorhof und linke Kammer müssen deutlich werden.

Material: Herz und Kreislauf (Seite 115)


0 1 Errechne für jeden Messzeitpunkt die Herzfrequenz (Schläge/min).
Da die Herzschläge jeweils nur in einem Zeitraum von 30 s ermittelt wurden, muss zur Berechnung das vorliegende Ergebnis mit
zwei multipliziert werden.
A 84a 146 96 88
B 72 118 70 72
C 90 174 142 116
D 78 154 102 84
E 92 148 98 92
F 82 132 108 84
$ 2 Stelle die Entwicklung der Herzfrequenz in einem Diagramm dar. Wähle dazu begründet eine Diagrammform aus.
Die Werte können für jede Person in einem Kurvendiagramm dargestellt werden, in dem die Herzfrequenzen in Abhängigkeit von
der Zeit aufgetragen werden. Das Kurvendiagramm ist geeignet, die Änderung eines Messwertes im zeitlichen Verlauf darzustel-
len.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Ingrid Schobel, München
$ 3 Erkläre den Kurvenverlauf bzw. formuliere Hypothesen zur Erklärung.
Durch körperliche Belastung wird mehr Energie in jeder der beteiligten Muskelzellen benötigt. Daher läuft dort die Zellatmung
intensiver ab. Durch den erhöhten Verbrauch an Sauerstoff und energiereichen Stoffen entsteht dort ein Mangel, sodass mit dem
Blut nicht mehr genügend von diesen Stoffen herantransportiert werden. Daher steigt die Herzfrequenz, denn nur so ist ein erhöh-
ter Transport möglich. Ähnlich verhält es sich mit dem Abtransport des Abfallstoffs Kohlenstoffdioxid. Lässt die Belastung nach, so
ist der Bedarf wieder geringer, sodass die Herzfrequenz wieder auf einen niedrigeren Wert geregelt wird.
0 4 Beschreibe die drei in Abb. 2 dargestellten Kurven und erkläre ihren Verlauf.
Der Gesamtdurchmesser aller Blutgefäße, die Strömungsgeschwindigkeit des Blutes sowie der Blutdruck sind in Abhängigkeit
zum jeweiligen Ort in den Blutgefäßen dargestellt. Der Gesamtdurchmesser aller Blutgefäße ist in der Aorta sehr klein, nimmt
wegen der zunehmenden Verzweigung zu den Arterien hin etwas zu und steigt im Bereich der Kapillaren stark an. Beim Übergang
in die Venen sinkt er mit der nun abnehmenden Verzweigung ebenso stark. Der Blutdruck hingegen ist in Aorta und Arterien hoch,
fällt in den Kapillaren plötzlich ab und bleibt dann so gering in den Venen. In den Kapillaren fließt das Blut langsam mit gerin-
gem Druck (großer Gesamtdurchmesser, Reibung an den Kapillarwänden). Hier findet der Stoffaustausch mit dem Gewebe statt.
Nachdem die Kapillaren durchflossen worden sind, steigt die Strömungsgeschwindigkeit des Blutes wieder an, weil der Transport
durch die Venen durch die Muskulatur gefördert wird und weil die Venenklappen ein Zurückfließen des Blutes verhindern.
. 5 Die Ergebnisse der drei Messungen stehen im Zusammenhang miteinander. Erkläre.
Eine immer weitere Verzweigung der großen Blutgefäße in Kapillaren ausgehend vom Herzen vergrößert den Gesamtdurchmesser
aller Gefäße. Durch höheren Reibungswiderstand an den Gefäßwänden sinkt daher die Strömungsgeschwindigkeit, ebenso nimmt
der Blutdruck ab, mit dem das Blut fortbewegt wird. Vereinigen sich die Kapillaren wieder zu Venen, so sinkt der Gesamtdurch-
messer aller Gefäße. Dann kann auch die Geschwindigkeit des Blutflusses wieder leicht zunehmen. Dies hängt mit den Venenklap-
pen und der umgebenden, zur Kontraktion fähigen Muskulatur zusammen. Ein sich vergrößernder Blutdruck kann auf diese Weise
aber nicht mehr aufgebaut werden.

Erkrankungen von Herz und Kreislauf (Seite 116)


0 1 Informiere dich und erläutere, wie man Koronaren Herzkrankheiten vorbeugen kann.
Nicht Rauchen, fettarme Ernährung, zuckerarme Ernährung, Bewegung, Übergewicht vermeiden, ausgeglichen leben (auch see-
lisch).
$ 2 Begründe, dass die Überlebensaussichten direkt nach einem Infarkt größer sind, als wenn man erst lange mit einer Behand-
lung wartet.
Die Überlebenschance ist groß, weil lebensrettende Maßnahmen unmittelbar eingeleitet werden können und ein Absterben
größerer Herzteile verhindert oder vielleicht rückgängig gemacht werden kann. Sind erst einmal größere Herzmuskelbereiche
abgestorben, so lässt sich dies nicht rückgängig machen.
. 3 In der Randspalte ist der Ort eines Infarktes markiert. Stelle Vermutungen über die Folgen auf und vergleiche mit möglichen
anderen Positionen.
Der Infarkt liegt mittig in der linken Herzhälfte. Daher kann der Transport des Blutes durch die Körperschleife beeinträchtigt sein.
Liegt der Infarkt z. B. in der rechten Herzhälfte, kann die Beladung des Blutes mit Sauerstoff beeinträchtigt sein, weil das Blut
nicht mehr intensiv genug durch die Lungenschleife gedrückt wird.

Rauchen ist gefährlich (Seite 117)


0 1 Rauchen ist ein Risikofaktor bei im Text nicht genannten Erkrankungen. Informiere dich und zähle drei auf.
Alle Erkrankungen von Organen der Atemwege (Bronchitis, schlechte Zähne, …); alle Krebserkrankungen der Atemwege, Herzin-
farkt, …
$ 2 2013 enthielt eine Packung Zigaretten in Deutschland ca. 19 Zigaretten und kostete ca. 5 ¤. Berechne die Kosten, die der tägli-
che Verbrauch einer Schachtel in 20 Jahren verursacht.
5 Jahre x 365 Tage/Jahre x 5 €/Schachtel x 1 Schachtel/Tag = 36 500 €
. 3 Analysiere Abb. 1 und erläutere, was sie aussagt.
Grundsätzlich gilt, dass die Überlebenschance mit dem Alter abnimmt. So werden knapp 100 % aller Menschen 40 Jahre alt, ca.
70 % aller nicht rauchenden Menschen 70 Jahre und nur etwa 20 % aller Nichtraucher werden 90 Jahre und älter. Unterscheidet
man zwischen Rauchern und Nichtraucher, so ergibt sich folgendes Bild: Die Überlebenschance eines Rauchers ist ab dem 40. Le-
bensjahr grundsätzlich geringer als die eines Nichtrauchers. Zwar liegt sie anfänglich nur knapp unter der der Raucher, bis zum
55. Lebensjahr liegt sie bei etwa 90 % (Nichtraucher: ca. 95 %). Dann sinkt die Überlebenschance der Raucher allerdings deutlich,
sodass sie bei den 55- bis 85-Jährigen bis zu etwa 25 % unter derjenigen der Raucher liegt. Für Raucher, die um das 50. Lebensjahr
mit dem Rauchen aufgehört haben, sind die Verhältnisse nicht ganz so ausgeprägt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3. 5 Muskeln und Gelenke

Bau und Funktion der Muskulatur (Seite 118/119)


$ 1 Erläutere die Folgen eines Sehnenrisses.
Ist eine Sehne gerissen, so kann die Kraft eines Muskels nicht mehr auf den angrenzenden Knochen übertragen werden. Üblicher-
weise kann dann ein Gelenk nicht mehr bewegt werden.
. 2 Das Lösen der Myosinköpfe vom Actin erfordert Energie. Wenn ein Tier stirbt, werden die Muskeln nach kurzer Zeit steif, die
Körperteile lassen sich kaum mehr bewegen (Totenstarre). Erkläre die Totenstarre auf elektronenmikroskopischer Ebene.
Die Totenstarre lässt sich begründen, weil die Actin- an die Myosinköpfe fest binden. Wird nun keine Energie durch Zellatmung
mehr zur Verfügung gestellt, kann diese Bindung nicht mehr aufgebrochen werden.

Gelenke ermöglichen Bewegung (Seite 120/121)


0 1 Erläutere die Folgen eines Bänderrisses.
Bänder festigen die Gelenkenden gegeneinander. Fällt die durch die Bänder gegebene Festigkeit infolge eines Risses weg, so ist
ein Gelenk weniger stabil, und die Knochen sind auf unnatürliche Art und Weise beweglich.
$ 2 Auch in der Technik ist man häufig auf Gelenke angewiesen. Ordne die in Abb. 3 gezeigten Verbindungen jeweils einem
Gelenktyp zu und begründe.
Bild 1 (Gelenk an einem Stativ): Kugelgelenk, weil eine kugelförmige Verdickung in eine pfannenförmige Vertiefung ragt und so
eine Beweglichkeit in alle Raumrichtungen möglich ist.
Bild 2 (Scharnier an einer Tür): Scharniergelenk, weil ein zylinderförmiger Gelenkkopf in einer rinnenförmigen Gelenkpfanne sitzt.
Bewegung ist somit nur in eine Raumrichtung möglich.
$ 3 Es gibt vier verschiedene Gelenktypen (Abb. 3). Beschreibe, in welcher Richtung sich das Gelenk eines Typs bewegen lässt, und
gib jeweils ein Beispiel aus deinem Körper an.
Ein Kugelgelenk erlaubt Bewegungen in alle Richtungen. Vorkommen: Oberschenkelknochen/Hüfte bzw. Oberarmknochen und
Schulter
Scharniergelenk: Es gibt nur eine Bewegungsmöglichkeit, weil ein zylinderförmiger Gelenkkopf in einer rinnenförmigen Gelenk-
pfanne sitzt. Vorkommen Ellenbogengelenk
Drehgelenk: Bau ähnlich wie der des Scharniergelenks, allerdings stehen sich die beteiligten Knochen nicht gegenüber, sondern
zeigen in dieselbe Richtung. Vorkommen: Gelenk an Elle und Speiche
Sattelgelenk: zwei U-förmig abgeflachte Knochenenden stehen sich um 90° verdreht im Gelenk gegenüber. Beweglichkeit ist dann
in zwei Richtungen möglich. Vorkommen am Daumengelenk.
$ 4 Erläutere am Beispiel von Gelenken, wie Bau und Funktionsweise eng miteinander verknüpft sind.
Nur wenn eine auf eine bestimmte Weise geformte Struktur vorhanden ist, kann eine bestimmte Bewegung ausgeführt werden.
Nur, wenn also der Gelenkkopf eine bestimmte Form hat und in einer entsprechend geformten Gelenkpfanne des gegenüberlie-
genden Knochens liegt, hat das Gelenk eine bestimmte Beweglichkeit.

Schäden können verhindert werden (Seite 122/123)


0 1 Beschreibe rückenschonende Möglichkeiten beim Tragen und stelle rückenbelastende Möglichkeiten gegenüber (Abb. 3).
Rückenschonende Möglichkeiten sind:
– Lasten vom Boden aufheben, indem man in die Knie geht und aus den Knien anhebt,
– nicht von oben mit durchgestreckten Beinen bücken,
– aufrecht und nicht mit vorgebeugtem Oberkörper sitzen, die Füße vollflächig aufstellen,
– aufrecht und nicht gebückt fortbewegen,
– zur Erholung hinlegen, am besten mit angewinkelten Beinen.
Insgesamt geht es darum, den Rücken ständig gerade und nicht gekrümmt zu halten.
$ 2 Entnimm Abb. 3 die Belastung der Wirbelsäule bei rückenschonender und rückenbelastender Hebeweise, wenn eine 25 kg
schwere Kiste getragen wird.
Rückenschonend: ca. 55 kg (das 2,2 fache der Kiste, also 250 %), rückenbelastend: ca. 112,5 kg (das 4,5 fache der Kiste, also 450 %)
. 3 Einseitiges Training der Bauchmuskulatur allein schadet der Wirbelsäule mehr, als es ihr hilft. Erkläre mithilfe von Abb. 4.
Durch einseitiges Bauchmuskeltraining wird der Rückenbeuger stärker trainiert als der Rückenstrecker. Er kann daher auch stär-
ker an der Wirbelsäule ziehen. Die Wirbelsäule wird dann nach vorn gezogen und bleibt nicht aufrecht. Dies führt zur Belastung
der Wirbelsäule und damit zur Verspannung.
$ 4 Bei normaler Belastung beträgt die Herzfrequenz eines Sportlers ca. 50 eines Nichtsportlers 75 Schläge pro Minute. Erkläre.
Herz und Kreislauf sind durch die regelmäßige Belastung des Sportlers trainiert. Der Herzmuskel ist meist größer als der des
Untrainierten. Daher kann mit jedem Herzschlag ein größeres Volumen Blut gepumpt werden. Mit jedem Herzschlag wird beim
Sportler daher auch mehr von den Stoffen durch den Körper transportiert, die sich im Blut befinden. Da in etwa die gleichen Men-
gen dieser Stoffe durch den Körper des Sportlers wie auch des Ungeübten bewegt werden müssen, schlägt das Herz des Sportlers
weniger häufig pro Minute.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Teste dich selbst (Seite 125)
0 1 Gib die Namen und die jeweilige Funktion der in Abb. 1 mit Ziffern gekennzeichneten Teile des menschlichen Verdauungssys-
tems an.
1) Speiseröhre; 2) Magen; 3) Leber; 4) Bauchspeicheldrüse; 5) Gallenblase; 6) Dünndarm; 7) Dickdarm; 8) Blinddarm; 9) Wurmfort-
satz; 10) Enddarm
$ 2 Der Dünndarm ist doppelt so lang wie unser Körper. Sein Inneres weist viele Falten auf. Erläutere die Bedeutung dieser Merk-
male für die Verdauung.
Durch die Länge und die innere Auffaltung vergrößert sich die Oberfläche des Dünndarms sehr stark. Auf diese Weise kann die
Resorption schnell und effektiv stattfinden, da der Stoffaustausch durch eine große Oberfläche schneller vonstatten gehen kann.
$ 3 Leite aus Abb. 2 Aussagen über Eigenschaften der Enzyme ab.
Enzyme können nur auf bestimmte Weise geformte Stoffe (Substrate) umsetzen, sie sind substratspezifisch. Ein Enzym kann
dieses Substrat nur in einer bestimmten Weise umsetzen. Es hat also auf dieses Substrat immer dieselbe Wirkung. Enzyme sind
wirkungsspezifisch.
$ 4 Erläutere anhand der Abbildung das Schlüssel-Schloss-Prinzip.
Das Enzym hat eine Stelle (Substrat­bindungsstelle), an der ein Stoff anbinden kann. Diese ist vergleichbar mit einem Schloss. Nur
ein bestimmter Stoff, das Substrat, passt wie ein Schlüssel in diese Bindungsstelle, sodass das Sub­strat erfolgreich umgesetzt
werden kann.
. 5 Erkläre die in Abb. 3 dargestellte Zusammensetzung der eingeatmeten und ausgeatmeten Luft.
Die Einatemluft beinhaltet 4 % mehr Sauerstoff als die Ausatemluft. In Bezug auf den Gehalt von Kohlenstoffdioxid ist das Ver-
hältnis umgekehrt. Dies liegt daran, dass der über die Lunge ins Blut aufgenommene Sauerstoff zu den Zellen transportiert wird.
Er wird dort für die Zellatmung benötigt. Dabei werden energiereiche Stoffe umgesetzt und die in ihnen steckende Energie für
die Zelle nutzbar gemacht. Bei dieser Stoffumwandlung entsteht Kohlenstoffdioxid, welches über das Blut und die Lunge an die
Umgebungsluft abgegeben wird.
. 6 Beschreibe den Verlauf der Kurve in Abb. 4. Erkläre.
Beschreibung: Dargestellt ist die Herzfrequenz in Schlägen pro Minute in Abhängigkeit von der Zeit in Minuten. Die Herzfrequenz
ist dabei in 25er-Schritten von 0 bis 200 Schlägen aufgetragen, wobei der Bereich von 0 bis 75 nicht skaliert ist. Die Zeit ist in
5er-Schritten von der 0. bis zur 22. Minute aufgetragen. Während die Herzfrequenz zu Beginn der Untersuchung bei etwa 115
Schlägen pro Minute liegt, steigt sie ab dem Startpunkt bei etwa einer Minute binnen einer Minute auf ca. 175 Schläge pro Minu-
te. Bei dieser Frequenz bleibt sie mit leichten Schwankungen bis zum Zieleinlauf bei der 18. Minute konstant, um dann bis zur 21.
Minute recht gleichmäßig auf etwa 115 Schläge pro Minute abzufallen.
Auswertung: Durch die sportliche Belastung benötigen vor allem die Muskelzellen mehr energiereiche Stoffe und auch Sauerstoff
für die erhöhte Zellatmung. Diesem Bedarf wird durch eine Erhöhung der Herzfrequenz und damit einer schnelleren Anlieferung
von Sauerstoff entsprochen. Zudem kann der verstärkte Anfall von Kohlenstoffdioxid als Stoffwechselendprodukt auf diese Weise
schneller entfernt werden. Nach Beendigung der Belastung sinkt der Bedarf an Transport von Sauerstoff und Kohlenstoffdioxid
wieder und die Herzfrequenz sinkt demgemäß auf die Frequenz, die vor der Belastung gemessen wurde.
$ 7 Ordne das in Abb. 5 gezeigte Gelenk einem Gelenktyp zu und erläutere, welche Bewegungen damit möglich sind.
Man erkennt ein kugelförmiges Knochenende, dem eine kugelförmige Vertiefung gegenübergestellt ist. Es handelt sich also um
ein Kugelgelenk. Mit ihm sind kreisförmige Bewegungen in alle Raumrichtungen möglich.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
4 Stoffwechsel der Pflanzen
4. 1 Bau- und Energiestoffwechsel sind verbunden

Das Laubblatt – Ort der Fotosynthese (Seite 128/129)


$ 1 Erläutere den Zusammenhang von Funktionen und Strukturen der Gewebe eines Blattes.
Epidermiszellen erfüllen durch lückenlose, enge Anordnung und eine verdickte äußere Zellwand die Schutzfunktion. Langgestreck-
te Palisadenzellen erlauben die Anordnung vieler Chloroplasten übereinander. Das fördert die Effektivität der Fotosynthese. Das
chloroplastenreiche Schwammgewebe dient ebenfalls der Fotosynthese. Hohlräume fördern zugleich den Gasaustausch.
$ 2 Skizziere einen Blattquerschnitt im DIN-A5-Format. Markiere die Wege des Wassers, des Kohlenstoffdioxids und des Sauer-
stoffs mit unterschiedlich farbigen Pfeilen.
siehe Abbildung

Wasser

vom
Leitbündel Kohlen-
stoffdioxid

Sauerstoff

Fotosynthese und Atmung (Seite 130/131)


0 1 Nenne Zellen der Pflanze, in denen Fotosynthese sowie Zellatmung ablaufen, und nenne solche, in denen nur Zellatmung
stattfindet.
Fotosynthese und Zellatmung: z. B. Palisadengewebezellen, Zellen des Schwammgewebes;
nur Zellatmung: z. B. Zellen der oberen Epidermis, Zellen der Wurzel.
$ 2 Auch Luchse leben indirekt von Pflanzen. Erkläre diese Aussage.
Der Luchs lebt räuberisch. Zu seiner bevorzugten Nahrung gehören Rehe. Rehe sind Pflanzenfresser. Von den Pflanze produzierte
Nährstoffe werden im Reh umgebaut und als Baustoffe für das Wachstum des Tierkörpers verwendet. Frisst der Luchs das Reh,
nutzt er diese Stoffe zur Bereitstellung der Energie für die Lebensprozesse und zum Aufbau seines Körpers. Der Luchs frisst keine
Pflanzen, ernährt sich aber von Stoffen, die in Pflanzen produziert und im Reh in tierische Stoffe umgewandelt wurden.
. 3 Häufig stehen Zimmerpflanzen auf Fensterbänken, unter denen Heizkörper angebracht sind. An diesem Ort gedeihen manche
Pflanzen auch dann nicht, wenn sie genügend Licht erhalten. Erkläre.
Trotz vorhandener Schutzeinrichtungen der Blätter kommt es zu starker Verdunstung im warmen Luftstrom. Schließen sich dabei
die Spaltöffnungen, sinkt die Fotosyntheseaktivität. Der Pflanze fehlen Nährstoffe.

Praktikum: Fotosynthese (Seite 132/133)


1 Die Fotosyntheseaktivität ist vom Licht abhängig. Erkläre mithilfe deiner Beobachtungen.
Die austretenden Sauerstoffbläschen sind ein Maß für die Fotosyntheseaktivität, da Sauerstoff ein Produkt der Fotosynthese ist.
Die Zahl der aufsteigenden Sauerstoffbläschen ist abhängig von der Lichtintensität. So steigen mehr Sauerstoffbläschen bei voller
Belichtung auf als bei Lichteinfall durch Transparentpapier.
2 Plane einen Versuch, mit dem der Einfluss der Temperatur auf die Fotosynthese nachgewiesen werden kann.
Der Versuchsaufbau entsprechend Abb. 1 wird variiert durch Verwendung: a) gekühlten Wassers, b) erwärmten Wassers.
3 Beschreibe das Versuchsergebnis und erkläre es.
Der innere Teil der Schablone, der dem Licht ausgesetzt war, färbt sich dunkel. Dort fand unter Lichteinwirkung Fotosynthese
statt, in deren Verlauf in den Chloroplasten Stärke gebildet wurde. Diese Stärke wird durch Iod-Kaliumiodid-Lösung nachgewiesen,
erkennbar an der dunklen Färbung.
4 Formuliere zu den beiden Hypothesen jeweils die Prognose der zu erwartenden Beobachtungen.
Zu 1: Es sind zwei unterschiedlich gefärbte Bereiche des Rundfilters erkennbar. Zu 2: Es ist nur ein grüner Bereich erkennbar.
5 Vergleiche die Versuchsergebnisse, die mit Blättern verschiedener Pflanzen erzielt wurden.
Der Anteil der Farbstoffe in den Blättern kann je nach Pflanzenart und Jahreszeit schwanken. Es sind grüne und gelbe Bereiche
erkennbar.
6 Entscheide, ob Hypothese 1, 2 oder keine richtig ist. Begründe deine Entscheidung.
Hypothese 1 ist richtig, da sich im Verlauf des Versuchs eine Verteilung unterschiedlicher Farbstoffe auf dem Rundfilter ergibt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Die Wurzel – ein Pflanzenorgan (Seite 134/135)
$ 1 Erläutere den Zusammenhang von Struktur und Funktion bei den Geweben der Wurzel an zwei Beispielen.
Mögliche Aussagen sind: z. B. Rhizodermis: Zellen bilden einen geschlossenen Zellverband – Schutz vor mechanischen Einflüssen
und Krankheitserregern; haarartige Ausstülpungen der Wurzelhaarzellen vergrößern die Wasser aufnehmende Oberfläche;
z. B. Xylem: Das Xylem besteht aus zylindrischen abgestorbenen Zellen, deren Querwände aufgelöst wurden. In den langen, festen
Röhren kann Wasser geleitet werden.
0 2 Beschreibe den Weg des Wassers aus dem Boden bis in ein Blatt.
Das Wasser gelangt durch Osmose in die Wurzelhaarzelle und bewegt sich entlang des Konzentrationsgefälles durch Diffusion
und Osmose bis in das Xylem des Leitbündels, das bis in die Blätter reicht. Dort verdunstendes Wasser saugt Wasser aus der
Wurzel nach.
$ 3 Der griechische Naturforscher Aristoteles (384 v. Chr. – 322. v. Chr.) bezeichnete die Wurzel als „Mund der Pflanze“. Begründe,
inwiefern diese Aussage zutrifft bzw. nicht zutrifft.
Zutreffend ist: Die Wurzel dient Aufnahme von Wasser und Mineralstoffen; nicht zutreffend ist: Die Pflanze nimmt über die Wur-
zeln keine Nährstoffe auf. Sie bildet Nährstoffe selbst.

Sprossachse und Stofftransport (Seite 136/137)


0 1 Beschreibe mithilfe der Abb. 4 die Wege von Flüssigkeiten durch die Pflanze.
Wasser und darin gelöste Mineralstoffe: Wurzel → Sprossachse → Blatt; in Wasser gelöste Nährstoffbestandteile: Blatt →
Sprossachse → Wurzel.
. 2 Erkläre, weshalb im Winter der Wassertransport durch das Xylem behindert ist.
Aufgrund fehlender Blätter der Laubbäume kommt es nicht zum Transpirationssog, die Wassersäule verharrt im Xylem. Bei Tem-
peraturen unter dem Gefrierpunkt ist das Wasser im Boden und im Xylem gefroren.

Material: Fotosynthese (Seite 138)


$ 1 Van Helmont kam zu folgendem Ergebnis: „169 Pfund Holz, Rinde und Wurzeln entstanden aus Wasser allein.“ Beurteile diese
Erkenntnis des 17. Jahrhunderts aus heutiger Sicht.
Van Helmont wusste nicht, dass ein Luftbestandteil, das Kohlenstoffdioxid, einen entscheidenden Beitrag zur Bildung von Biomas-
se leistet. Seine Aussage trifft aus heutiger Sicht nicht zu.
. 2 Beurteile, ob die Aussage Priestleys zur Luftverbesserung stimmt.
Eine Pflanze unter einer Glocke bewirkt, dass eine Kerze länger brennt als ohne Pflanze. Analog gilt das Ergebnis für das Über-
leben der Maus. Wenn Auffrischung der Luft als Erhöhung des Sauerstoffgehalts (durch Fotosynthese) verstanden wird, ist seine
Aussage richtig.
$ 3 Plane ein Experiment zur Messwerterfassung für die Daten, die Abb. 4 zugrunde liegen.
Eine Pflanze wird mit einer Plastikhaube luftdicht abgeschlossen. Sensoren zur Messung der Sauerstoffkonzentrationen und der
Lichtintensität werden unterhalb der Haube befestigt. Die Pflanze wird entsprechend des natürlichen Tagesablaufs belichtet.
Sauerstoffkonzentrationen und Lichtintensität werden von einem Messgerät erfasst und grafisch aufgezeichnet.
. 4 Erkläre das Zustandekommen negativer Werte für die Sauerstofffreisetzung in Abb. 4.
Bei Dunkelheit wird infolge der Zellatmung Sauerstoff aufgenommen, jedoch keiner durch Fotosynthese freigesetzt.

Praktikum: Wasserhaushalt (Seite 139)


1 Wähle einen geeigneten Ausschnitt aus dem mikroskopischen Bild. Zeichne bei 400-facher Vergrößerung eine Spaltöffnung
und beschrifte sie.
siehe Abbildung

dünne äußere Zellwand

Schließzelle

dicke innere Zellwand

Zellkern

Spalt offen Chloroplast

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
2 Beobachte die Veränderungen an der Spaltöffnung nach dem Durchsaugen von Natriumnitrat-Lösung. Skizziere deine Beob-
achtungen.
siehe Abbildung

Spalt geschlossen

3 Beobachte Veränderungen an den Tulpen über mehrere Stunden. Notiere deine Beobachtungen.
Die Blütenblätter der Tulpe in Wasser bleiben unverändert. Die Blütenblätter der Tulpen in den unterschiedlich gefärbten Tinten
sind nach mehreren Stunden in der Farbe der jeweiligen Tinte gefärbt.
4 Zeichne die mikroskopische Ansicht der Querschnitte der Tulpenstängel und beschrifte die Leitbündel. Trage in die Zeichnung
Farbbeobachtungen ein.
siehe Abbildung

Der innen liegende Teil der Leitbündel weist eine Farbänderung auf.
5 Vergleiche deine Zeichnungen und erkläre die Befunde.
Die Schnitte sehen einander ähnlich. In jedem der Querschnitte finden wir die Bereiche des Xylems durch die jeweils verwendete
Tinte gefärbt. Da die Tinte in Wasser gelöst wurde, zeigt die Färbung an, dass das Xylem für den Transport des Wassers verant-
wortlich ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
4. 2 Pflanzenanbau

Mineralstoffe bei Pflanzen (Seite 140/141)


$ 1 Erkläre die Anreicherung des Bodens mit Stickstoffverbindungen durch Knöllchenbakterien.
Die Knöllchenbakterien binden Stickstoff aus der Luft und stellen daraus stickstoffhaltige Mineralstoffe her. Aus abgestorbenen
Bakterien nimmt die Wurzel z.B. einer Lupine die stickstoffhaltigen Mineralstoffe auf. Sterben Pflanzenteile der Lupine ab oder
werden sie untergegraben, bauen Kleinstlebewesen die Pflanzenteile ab. Dabei werden stickstoffhaltige Mineralstoffe im Boden
angereichert.
. 2 Garten- und Ackerflächen werden gedüngt, damit sie jedes Jahr ertragreiche Ernten hervorbringen. Naturbelassene Wälder
müssen nicht gedüngt werden. Erkläre.
Garten- und Ackerflächen werden jedes Jahr abgeerntet. In der Ernte enthaltene Mineralstoffe werden dauerhaft dem Boden
entzogen und müssen durch Düngung ersetzt werden. In den Böden naturbelassener Wäldern werden die in den Bäumen und im
abgefallenen Laub enthaltenen Mineralstoffe bei deren Zersetzung wieder freigesetzt.

Material: Wichtige Nahrungspflanzen (Seite 142)


$ 1 Fertige von der Fotosynthese bis zur Einlagerung von Stärke im Samenkorn des Weizens ein Verlaufsschema an.
siehe Abbildung

Wasser Sauerstoff

Fotosynthese Glucose Stärke

Kohlenstoffdioxid

0 2 Begründe mithilfe der Abb. 1 die Zeitpunkte für das Düngen eines Weizenfeldes mit stickstoffhaltigem Dünger.
Stickstoffzufuhr ist wichtig für die Bildung von Eiweiß. Die 1. Düngung fördert die Ausbildung von Seitentrieben, die 2. Düngung
das Längenwachstum, die 3. Düngung das Wachstum der Ähren bzw. Getreidekörner und den Gehalt an Eiweiß.
$ 3 Beschreibe die Vorgänge von der Fotosynthese im Blatt bis zur Einlagerung von Stärke in der Sprossknolle einer Kartoffel-
pflanze.
Wasser und Kohlenstoffdioxid sind die Ausgangsstoffe der Fotosynthese im Blatt. Reaktionsprodukte sind Sauerstoff und Glucose.
Glucose wird gelöst im Phloem in die unterirdischen Pflanzenteile transportiert und dort als Stärke in die Sprossknolle eingela-
gert.
$ 4 Leite aus Abb. 2 die Bedeutung der Sprossknollen für wild wachsende Kartoffelpflanzen ab.
Wild wachsende Kartoffelpflanzen können sich über die Sprossknollen vermehren. Aus ihnen können heranwachsende, farblose
Keime zunächst Wasser, Nährstoffe und Mineralstoffe aus der Knolle entnehmen, bis der Keim über dem Boden Blätter ausbildet
und durch Fotosynthese Nährstoffe selbst herstellt.
$ 5 Skizziere eine Übersicht zum Stoffwechsel des Zuckerrohrs.
siehe Abbildung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
$ 6 Vergleiche Kartoffel, Zuckerrohr und Zuckerrübe in Bezug auf folgende Merkmale: Speicherorgan, Speicherstoff, Verwendung
durch den Menschen.
siehe Tabelle

Kartoffel Zuckerrohr Zuckerrübe


Speicherorgan Sprossknolle Sprossachse Wurzelrübe
Speicherstoff Stärke Saccharose Saccharose
Verwendung Speisestärke, nach- Süßen von Speisen, Konservieren von Süßen von Speisen, Konservieren von
wachsender Rohstoff Lebensmitteln Lebensmitteln

$ 7 Begründe, warum der Anteil des Rübenzuckers an der Weltzuckerproduktion sinkt. Recherchiere dazu im Internet.
Relativ niedrige Preise für Rohrzucker und niedrige Transportkosten ermöglichen günstige Importe, um den Bedarf an Zucker zu
decken.
$ 8 Benenne mithilfe eines Atlas wichtige Anbaugebiete für Zuckerrüben und Zuckerrohr.
Zuckerrohr: Brasilien, China, Indien, Kuba, Mexiko, Australien. Zuckerrübe: Deutschland, Frankreich, Polen.

Sojabohne – Ernährung für Millionen (Seite 144/145)


0 1 Nenne die Vorzüge der Nutzpflanze Sojabohne. Beziehe dich auch auf Abb. 2.
Ein hoher Ölgehalt und sehr hoher Eiweißgehalt machen die Sojabohne zu einem wertvollen Rohstoff für diese Nährstoffe.
$ 2 Recherchiere die Flächenrangfolge der in Deutschland angebauten Ölpflanzen und erkläre die Stellung der Sojabohne.
Rangfolge: 1) Raps, 2) Sonnenblume, 3) Öllein. Soja kommt wegen der überwiegend ungünstigen Klimabedingungen nur weit
zurück auf Rang 4.
. 3 Der hohe Fleischkonsum in Industrieländern wie Deutschland ist mitverantwortlich für die Abholzung von Regenwäldern.
Nimm Stellung zu dieser Aussage.
Sojabohnenschrot ist ein sehr effektives Futtermittel. In Industrieländern nutzen Viehmäster daher Sojabohnenschrot zur Erhö-
hung des Eiweißgehalts der Nahrung für Nutztiere. Da Sojabohnen auch in Ländern Südamerikas angebaut werden, trägt der
hohe Fleischkonsum in Industrieländern dazu bei, dass in Südamerika Regenwald gerodet wird, um Anbauflächen für Sojabohnen
zu gewinnen.

Teste dich selbst (Seite 147)


$ 1 Ordne das abgebildete Gewebe einem Pflanzenorgan zu und begründe.
Das lichtmikroskopische Bild zeigt ein Gewebe, das zu einem Laubblatt gehört. Ein Laubblatt wird auf der Blattunterseite von der
unteren Epidermis begrenzt. Sie besteht aus eng aneinander gefügten farblosen Zellen, zwischen denen Spaltöffnungen eingela-
gert sind. Die Spaltöffnungen bestehen hier aus zwei bohnenförmigen Schließzellen. Dazwischen befindet sich ein Spalt.
0 2 Notiere die Wortgleichung der Fotosynthese und erläutere sie.
Kohlenstoffdioxid + Wasser → Glucose + Sauerstoff. Eine pflanzliche Zelle, z. B. im Laubblatt, nimmt in ihre Chloroplasten Kohlen-
stoffdioxid und Wasser auf. Hat die Zelle ausreichend Licht, stellt sie in der Fotosynthese Glucose und Sauerstoff her. Die Energie
des Lichts wird dabei umgewandelt in chemische Energie in Glucose und Sauerstoff.
. 3 Bei den Experimenten a) und c) in Abb. 2 steigen Gasbläschen auf, bei b) und d) nicht. Erkläre die Beobachtungen.
Bei den Versuchen a) und c) steigen Gasbläschen auf, die aus Sauerstoff bestehen. Wasserpest bildet unter Lichteinfluss durch
Fotosynthese Sauerstoff, der als Gas aus dem Wasser entweicht. Bei den Versuchen b) und d) entweicht kein Sauerstoff. Bei
Versuch b) fehlt der Wasserpest das Kohlenstoffdioxid und damit ein Ausgangsstoff der Fotosynthese. Bei Versuch d) ist kein Licht
vorhanden. Fotosynthese findet bei b) und d) nicht statt.
$ 4 Erkläre die in Abb. 3 erkennbaren Messergebnisse.
In dem Aquarium wachsen Pflanzen. Für die Fotosynthese nehmen sie tagsüber Kohlenstoffdioxid auf und benutzen es als
Ausgangsstoff der Fotosynthese. Nachts steigt der Kohlenstoffdioxidgehalt, weil die Pflanzen Zellatmung betreiben, aber keine
Fotosynthese durchführen.
0 5 Nenne die Aufgaben der Pflanzenorgane Wurzel, Sprossachse und Blatt.
Wurzel: Verankerung der Pflanze im Boden, Aufnahme von Wasser und darin gelösten Mineralstoffen;
Sprossachse: Transport von Wasser und darin gelösten Mineralstoffen, Transport von wasserlöslichen Nährstoffbestandteilen;
Blatt: Herstellung des Nährstoffs Glucose durch Fotosynthese (Ernährung der Pflanze).
. 6 Die Stelzwurzeln der Mangroven ermöglichen das Wachsen im Küstenschlamm. Erkläre diese Aussage.
Die Stelzwurzeln sind bei Ebbe sichtbar. Ihre Länge und Stabilität ermöglicht es, dass die Blätter bei Flut aus dem Wasser ragen
und die für das Wachstum notwendigen Nährstoffe produzieren.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
5 Ökosystem Wald
5. 1 Lebensgemeinschaft Wald

Wälder bestehen nicht nur aus Bäumen (Seite 150/151)


0 1 Fertige eine Mind-Map zum Wald mit den Informationen dieser Doppelseite an.
siehe Abbildung
abiotische Umweltfaktoren
physikal. & chem. Bedingungen
Nadelwälder Lufttemperatur
Biotop
Laubmisch- Niederschlagsmenge
Wald-
wälder gemein- Öko- Tageslichtdauer
Forste schaft system Bodenfeuchte
Wald
Pflanzen
Tiere biotische Umweltfaktoren
Biozönose Konkurrenz
fressen – gefressen werden

$ 2 Die Bäume im Wald sind nicht Teil des Biotops, sondern der Biozönose. Erläutere.
Die Bäume des Waldes sind Pflanzen und gehören somit zu den Lebewesen. Die Gesamtheit der Lebewesen heißt Biozönose. Sie
würden dann zum Biotop zählen, wenn sie unbelebt wären wie Steine.
. 3 Vergleiche die in Abb. 3 dargestellten Temperaturverläufe auf der Wiese und im Wald und erkläre die Befunde.
Vergleich: Der Temperaturverlauf auf der Wiese schwankt deutlich stärker als der im Wald: Die Temperatur sinkt nachts auf der
Wiese stärker ab (2 Uhr: 9 °C auf der Wiese gegen 14 °C im Wald) und steigt tagsüber schneller und höher (12 Uhr: 39 °C auf der
Wiese gegen 25 °C im Wald).
Erklärung: Die Bäume des Waldes beschatten tagsüber den Erdboden, sodass die Temperatur dort nicht so schnell und so hoch
ansteigt wie auf der Wiese. Nachts kühlt die Luft im Wald nicht so stark ab, weil die Bäume den Wärmeaustausch mit der Umge-
bungsluft verringern.

Nahrungsbeziehungen im Wald (Seite 152/153)


0 1 Notiere eine beliebige Nahrungskette aus Abb. 2 in dein Heft. Verwende dabei die Pfeile in der im Text dargestellten Bedeu-
tung.
Eiche → Waldmaus → Fuchs (Die Eiche wird von der Waldmaus gefressen, die Waldmaus wird vom Fuchs gefressen.)
$ 2 Lass jeweils einmal den Produzenten, Konsumenten 1. Ordnung und Endkonsumenten einer Nahrungskette aussterben und
stelle je eine Hypothese auf, welche Konsequenzen dies für andere Lebewesen der Kette hat.
Produzent stirbt aus: Eichen dienen vielen Tieren wie z. B. der Waldmaus und dem Buntspecht als Nahrungsquelle. Stirbt die Eiche
aus, so sind Konsumenten dann entweder selbst vom Aussterben bedroht oder weichen auf andere Pflanzen als Nahrung aus,
wodurch diese dann möglicherweise im Bestand bedroht sind.
Konsument 1. Ordnung stirbt aus (Waldmaus): Stirbt die Waldmaus aus, so sind Konsumenten höherer Ordnung wie der Sperber
oder der Fuchs entweder selbst vom Aussterben bedroht oder fangen dafür mehr andere Tiere, wodurch diese möglicherweise im
Bestand bedroht sind. Da weniger Eicheln gefressen werden, kann der Bestand dieser Baumart möglicherweise wachsen.
Endkonsument stirbt aus (Fuchs): Endkonsumenten wie der Fuchs fangen und fressen Tiere wie die Waldmaus. Stirbt der Fuchs
aus, so kann sich die Waldmaus stärker vermehren. Dadurch werden wiederum die Pflanzen, von denen sich die Waldmaus
ernährt, stärker geschädigt.
$ 3 Nimm dir ein Stück eines Kartoffel- oder Zwiebelnetzes und zerschneide in der Mitte eine Verbindung, dann eine weitere usw.
Ziehe dazwischen jeweils an zwei Seiten des Netzes. Erläutere mithilfe dieses Modells die Stabilität von Ökosystemen.
Ein unbeschädigtes Netz ist stabil und zerreißt nicht so leicht. Je mehr Verbindungen zerschnitten werden, desto leichter kann
das Netz reißen. Auch ein Nahrungsnetz mit vielen Nahrungsbeziehungen ist stabil, solange keine Nahrungsbeziehungen durch
Aussterben von Lebewesen zerrissen werden. Fallen zu viele Nahrungsbeziehungen weg, ist das Ökosystem nicht mehr stabil und
die Vielfalt der Lebewesen nimmt ab.
. 4 Durch den Einfluss des Menschen sterben zurzeit weltweit sehr viele Arten von Lebewesen aus oder sind vom Aussterben
bedroht. Stelle eine Hypothese auf, welche Konsequenzen dies langfristig für Ökosysteme haben könnte.
Durch das Aussterben verschiedener Lebewesen werden andere Arten, die von ihnen abhängig sind, ebenfalls bedroht und ster-
ben eventuell aus. Ökosysteme verarmen in ihrer Artenvielfalt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Destruenten (Seite 154)
0 1 Beschreibe den Abbau eines Laubblatts mit den dazugehörigen Tieren unter Verwendung von Abb. 1.
Welke Blätter werden von Regenwürmern aufgenommen und teilweise verdaut. Springschwänze fressen Bruchstücke zerfallender
Blätter und zerkleinern sie weiter. Milben zersetzen sehr kleine Blattreste weiter. Mikroorganismen wie Amöben sorgen für den
Endabbau zu kleinsten Fragmenten, die u. a. den Humus bilden.
$ 2 Erläutere die Funktionen, die die Destruenten im Ökosystem Wald haben.
Destruenten sorgen zum einen für den natürlichen Abbau von Laub und anderen toten Pflanzenresten sowie toten Tieren im Wald.
Zum anderen setzen sie darin gebundene Mineralstoffe wieder frei und düngen somit die Pflanzen des Waldes.
. 3 Bei der Holznutzung wurden Bäume häufig vollständig mit der Rinde und Teilen der Wurzeln aus dem Wald entfernt. Erläutere
die langfristigen Konsequenzen.
Durch die vollständige Entfernung aller Bestandteile eines Baums aus dem Wald beim Fällen verliert der Boden langfristig
wichtige Mineralstoffe. Es verbleiben keine Reste, die durch Destruenten zersetzt und deren Mineralstoffe wieder in den Boden
freigesetzt werden können. Dadurch wird das Wachstum der Pflanzen gestört.

Pilze im Wald (Seite 155)


0 1 Beschreibe die verschiedenen Ernährungsformen der Pilze und benenne sie.
Baumpilze wie der Zunderschwamm leben im Holz und ernähren sich davon. Die abgebauten Nährstoffe nehmen sie anschließend
auf. Außen am Stamm bilden sie Fruchtkörper zur Vermehrung. Ihre Ernährungsweise ist parasitisch. Parasiten ernähren sich von
lebenden Lebewesen und schädigen diese häufig bis zu deren Tod.
Viele Bodenpilze wie der Fliegenpilz umgeben mit ihren Hyphen die Wurzeln von Bäumen und dringen sogar in diese ein. Sie
entziehen dem Baum Nährstoffe. Im Austausch erleichtern sie ihm die Aufnahme von Wasser und Mineralstoffen. Eine Wechselbe-
ziehung zwischen Lebewesen, die wie hier für beide Arten vorteilhaft ist, nennt man Symbiose.
$ 2 Pilze können für Bäume nützlich und schädlich sein. Erkläre.
Symbiotisch lebende Bodenpilze wie der Fliegenpilz sind vorteilhaft für Bäume, da sie diese bei der Versorgung mit Wasser und
Mineralstoffen unterstützen. Parasitisch lebende Baumpilze wie der Zunderschwamm schädigen die Bäume, da sie ihm einseitig
Nährstoffe entziehen und das Holz zersetzen.

Praktikum: Bodenuntersuchung (Seite 156/157)


1 Erstelle einen Steckbrief zu deiner Bodenprobe. Vergleicht in der Klasse verschiedene Bodenproben unterschiedlicher Stand-
orte miteinander.
individuelle Lösung
2 Führe die Schlämmanalyse durch und erweitere deinen Steckbrief aus Aufgabe 1.
individuelle Lösung
3 Führe die Experimente zur Wasserhaltefähigkeit mit den unterschiedlichen Proben durch und vergleiche die Ergebnisse.
individuelle Lösung
4 Erläutere, welche Bestandteile ein guter Boden haben sollte. Nutze dazu die Ergebnisse aller durchgeführten Experimente.
Ein guter, d. h. fruchtbarer Boden sollte viel Humus enthalten, der Wasser und Mineralstoffe bindet. Er sollte viel grobes Material
wie Sand und Kies enthalten, sodass eine gute Durchlüftung, Bewurzelung und Wasserführung gegeben ist. Aber auch feines
Material wie Ton sollte in kleineren Mengen vorhanden sein, das ebenfalls Wasser und Mineralstoffe bindet. Laub und anderes
loses Material schützen die Waldoberfläche und können von Destruenten abgebaut werden, wodurch Mineralstoffe in den Boden
gelangen.

Weg der Energie und Kreislauf der Stoffe (Seite 158/159)


0 1 Ein Teil der Energie wird auf jeder Konsumentenstufe gebunden in abgefallenem Laub oder in ausgeschiedenen Stoffen abge-
geben. Erläutere, wie diese Biomasse im Ökosystem doch noch genutzt wird.
Laub, tote Pflanzenteile und Ausscheidungen wie Kot enthalten noch Nährstoffe. Diese nutzen Destruenten für ihre eigene Ener-
gieversorgung.
$ 2 Berechne, welche Masse an Blättern jeweils notwendig ist, damit die mittlere Körpermasse einer Raupe, Kohlmeise oder
eines männlichen oder weiblichen Sperbers entstehen kann.
siehe Tabelle
Tier mittlere Körpermasse benötigte Masse an Blättern
Raupe 0,8 g 8 g
Kohlmeise 16 g 1600 g
Sperber männlich 136 g 136 000 g
Sperber weiblich 240 g 240 000 g

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 3 Beschreibe den Kreislauf der Mineralstoffe anhand von Abb. 3.
Die Produzenten (Pflanzen) nehmen Mineralstoffe mit Wasser aus dem Boden auf und bauen sie in ihre pflanzliche Biomasse mit
ein. Diese enthält also Nähr- und Mineralstoffe. Konsumenten (Tiere) fressen die pflanzliche Biomasse und bilden daraus eigene
tierische Biomasse. Ein Teil der Mineralstoffe nehmen sie dabei auf, er wird neben Nährstoffen Bestandteil der eigenen tierischen
Biomasse. Ein anderer Teil wird als Kot und Urin ausgeschieden. Innerhalb der Konsumenten wiederholt sich dies in jeder Ebene
der Konsumenten. Die im Urin vorhandenen Mineralstoffe gelangen direkt wieder in den Boden, wo sie erneut von Produzenten
genutzt werden können. Reste toter Tiere und Pflanzen sowie Kot wird von Destruenten abgebaut. Dabei werden die Mineralstoffe
der toten Biomasse wieder frei gesetzt, gelangen in den Boden und können von Produzenten wieder genutzt werden.
. 4 Holz gilt als klimafreundlicher Brennstoff, der den Kohlenstoffdioxidgehalt der Atmosphäre nicht erhöht. Erkläre.
Bei der Verbrennung von Holz kann nur soviel Kohlenstoffdioxid freigesetzt werden, wie zuvor durch die Fotosynthese des Baums
aus der Atmosphäre aufgenommen und zu Glucose verarbeitet wurde. Es wird also anders als beim Verbrennen fossiler Brennstof-
fe wie Kohle, Erdgas und Erdöl kein zusätzliches Kohlenstoffdioxid in die Atmosphäre abgegeben.

Nebeneinander im Wald (Seite 160/161)


$ 1 Erkläre die Angepasstheiten von Buntspecht und Baumläufer an ihren Lebensraum.
Der Buntspecht besitzt einen meißelartigen Schnabel, mit dem er Spalten in der Rinde weiten und Löcher in sie hinein schlagen
kann. Mit seiner langen und mit Widerhaken versehenen Schleuderzunge kann er Insekten, Spinnen und Käferlarven aus den
Spalten und Löchern herausholen. Mit seinem Schnabel kann er sich auch Brut- Übernachtungs- und Überwinterungshöhlen in
Bäume schlagen.
Der Baumläufer hat einen langen pinzettenartigen Schnabel, mit dem er in enge Spalten am Baum gelangen und dort Insekten
und Spinnen hervorholen kann. Zudem ist er sehr leicht. Er sucht beständig die Rinde von Bäumen ab, indem er diese hoch läuft.
. 2 Im Wald leben auch Grün-, Schwarz- und Kleinspecht. Erstelle zu einer der Arten einen Steckbrief und erläutere, inwiefern die
Art nicht in Konkurrenz zum Buntspecht steht.
siehe Tabelle
Grünspecht Schwarzspecht Kleinspecht
Größe 28–32 cm bis 58 cm 14–16 cm
mittlere Körpermasse 175 g 250–350 g 20–25 g
Verbreitung Europa bis Vorderasien Nord- und Mitteleuropa bis Asien Nord- und Mitteleuropa bis Asien
Lebensraum bevorzugt offene, lichte Bereiche bevorzugt Buchenwälder mit bevorzugt Waldgebiete mit hohem
wie Lichtungen, Waldränder, Parks, Fichten und Tannen sowie Eichen- Bestand an alten Bäumen, beson-
Heine; dabei fast ausschließlich Kiefern-Mischwälder, jedoch auch ders Weichholzbäume, häufig in
Laubwälder andere Wälder mit Nadelholzanteil Bruch- und Auenwäldern
Ernährung Der Grünspecht sucht seine Im Sommer frisst der Schwarz- Im Frühjahr und Sommer frisst der
Nahrung, meist Ameisen, fast specht hauptsächlich Holz bewoh- Kleinspecht Blattläuse, Raupen
ausschließlich am Boden. Im Winter nende Ameisen, im Winter auch und Ameisen, im Winter Käfer. Die
sucht er auch an Felswänden, Steil- bodenlebende aus Ameisenhügeln, Nahrung wird im Kronenbereich
hängen und Häusern nach Insekten, daneben Borken bewohnende Käfer. gesucht, selten am Stamm und fast
usw. nie am Boden.
Brut- und Überwinte- Er nutzt verlassene Höhlen anderer Er hämmert eigene Höhlen, bevor- Er hämmert eigene Höhlen in alte,
rungshöhlen Spechte, hämmert aber auch zugt in freistehenden Rotbuchen weiche, zerfallene und oft auch
eigene. Bei der Baumart ist er nicht mit guter Rundumsicht, manchmal schon tote Bäume.
wählerisch. in Tannen oder Kiefern.
Färbung Rücken dunkelgrün, Bauch hellgrün; einheitlich schwarz mit rotem schwarz-weiß gestreift, ähnlich dem
schwarze Gesichtsmaske, Scheitel Scheitel Buntspecht, aber ohne Rotanteil
und Nacken rot und deutlich kleiner
Konkurrenzverringe- Spezialisierung auf Ameisen am Bo- Spezialisierung auf holzbewoh- Nahrungssuche im Kronenbereich,
rung durch den, Verbreitung in lichten Wäldern nende Ameisen selten am Stamm

Methode: Begriffsnetz (Seite 161)


1 Skizziere ein Begriffsnetz mit folgenden Wörtern: Lebensraum, Arten, ökologische Nischen, Umweltfaktoren, Konkurrenz,
Konkurrenzverringerung. Ergänze, wenn nötig, fehlende Begriffe.
siehe Abbildung
Lebensraum bietet verschiedene Ökologische
Nischen
leben in haben
einem verschiedene führt zu
ist begrenzt,
führt zu Arten
leben
stehen in nebeneinander Konkurrenzverringerung
Konkurrenz durch
ermöglicht langfristig
gefährdet
hat abiotische
und biotische gehört zu den Überleben und Gesamtheit aller
biotischen abiotischen und
beeinflussen Fortpflanzung * biotischen
Umweltfaktoren

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
5. 2 Waldtypen
Der Stockwerkbau des Waldes (Seite 162/163)
0 1 Stell die Daten aus Abb. 3 in einem Kreisdiagramm dar. Nenne Vor- und Nachteile, die diese Art der Darstellung gegenüber
einer Tabelle oder einem Balkendiagramm hat.
siehe Abbildung und Tabelle.

Reflexion an den
22 Blättern
10 7
Baumschicht

Strauchschicht
79
Krautschicht

Moosschicht

Vorteile Nachteile
Ein Kreisdiagramm zeigt anschaulich die unterschiedlichen Anteile Bei zu vielen Teilen oder vielen kleinen Anteilen wird es schnell
verschiedener Teile eines Ganzen. unübersichtlich.
Gut für eindimensionale Daten (Anzahl in verschiedenen Katego- Es lassen sich keine Abhängigkeiten eines Faktors von einem ande-
rien, prozentuale Anteile) ren darstellen (eindimensional).
Nicht nutzbar beim Wert Null oder bei negativen Zahlen.

$ 2 Auch in sehr dunklen Bereichen eines Waldes kann man Pilze finden. Erkläre.
Pilze sind keine Produzenten, d. h. sie betreiben keine Fotosynthese. Daher sind sie nicht auf Licht angewiesen.

Laub- und Nadelbäume – zwei Lebensweisen (Seite 164/165)


$ 1 Bereite ein Kurzreferat zu den Angepasstheiten von Laub- und Nadelbäumen an ihre Umweltbedingungen vor. Gehe auf die
Probleme beider Baumtypen und die jeweiligen Lösungen ein. Mache dir nicht mehr als 7 Stichpunkte für deinen Kurzvortrag.
individuelle Lösung

Material: Bäume (Seite 166/167)


0 1 Schließe aus den Abbildungen 1–4 auf die jeweilige Bedeutung des Baumes für andere Lebewesen und erläutere sie.
siehe Tabelle
Spechthöhle Die Spechthöhle im Baum dient hauptsächlich der Brut und Aufzucht von Jungtieren sowie dem Überwintern
und als sicherer Schlafplatz (Schutz).
Fledermaus in Höhle Die Fledermaushöhle im Baum schützt die Tiere tagsüber im Schlaf.
Käferlarven mit Fressgang Die Borkenkäferlarven nutzen die Borke des Baums als Nahrung, die versteckten Gänge schützen vor Fress-
feinden.
Fäulnis im Astloch Pilze und Mikroorganismen nutzen das Holz als Nährstoffquelle, wobei es zersetzt wird.

$ 2 Erkläre, warum ein Baum innen hohl sein kann und er trotzdem weiterlebt und lange Zeit nicht bricht.
Die Leitungsbahnen für Wasser und darin gelöste Mineralstoffe sowie dem nährstoffhaltigen Pflanzensaft liegen in der Borke und
im Bast. Daher kann ein Baum auch weiterleben, wenn er hohl ist.
$ 3 Erläutere die Nahrungsbeziehung zwischen den an der Symbiose bei Flechten beteiligten Arten anhand von Abb. 5.
Der an der Flechte beteiligte Pilz gibt Säuren an das Gestein ab und löst damit Mineralstoffe aus diesem, die er aufnimmt und
teilweise mit aufgenommenem Wasser an die Algen oder Cyanobakterien weitergibt. Diese nehmen Kohlenstoffdioxid aus der
Luft auf und betreiben bei Licht Fotosynthese. So erzeugte Nährstoffe und Sauerstoff geben sie teilweise an den Pilz ab. Das beim
Abbau der Nährstoffe gebildete Kohlenstoffdioxid und Wasser nutzt die Alge oder das Cyanobakterium.
. 4 Formuliere eine begründete Hypothese für den in Abb. 6 erkennbaren Befund.
Die Flechten wachsen in verschiedenen Richtungen unterschiedlich gut auf der Baumrinde, weil die abiotischen Umweltfaktoren
verschieden ausgeprägt sind (Stichwort: Wetterseite).
$ 5 Vergleiche die in Abb. 7 dargestellten Größenordnungen der Stoffflüsse.
Für die tägliche Produktion von 12 kg Biomasse nimmt ein Baum 22 kg Kohlenstoffdioxid aus der Luft auf und produziert 12 kg
Sauerstoff. Der überwiegende Teil des aufgenommenen Wassers eines Baums verdunstet über die Blätter.
. 6 Die Bezeichnung „Kohlenstoffdioxidspeicher“ für Bäume hat eine gewisse Berechtigung, ist aber genau genommen falsch.
Erläutere diese Aussage.
Bäume „speichern“ kein Kohlenstoffdioxid, sie nutzen es als Ausgangsstoff zur Produktion von Biomasse. Es entsteht wieder bei
der Zersetzung oder Verbrennung von Biomasse mit Sauerstoff, weshalb es scheinbar in der Biomasse gespeichert ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
0 7 Stelle die Werte in Abb. 9 in einem Diagramm der. Begründe die Wahl des Diagrammtyps und erläutere dein Vorgehen.
siehe Abbildung
60
auf dem Waldboden (%)

50
40
Lichtanteil

30
20
10
0
Jan Mrz Mai Jul Sep Nov

$ 8 Erkläre mithilfe des von dir erstellten Diagramms das zeitliche Auftreten des Frühblühers Buschwindröschen.
Das Buschwindröschen blüht im Frühjahr. Wie das Diagramm zeigt, gelangt zwischen Mai und September fast kein Licht auf den
Waldboden, sodass das Buschwindröschen hier nicht blühen kann. Zwischen Januar und April deutlich mehr Licht auf den Boden,
hier kann es blühen. Auch im Herbst und Winter gelangt viel Licht auf den Boden, jedoch ist es dann zu kalt zum Blühen. Die
Abbildung 8 auf Seite 167 zeigt, warum es von November bis April heller ist auf dem Waldboden. Die Laubbäume tragen in diesem
Zeitraum keine Blätter.

Konkurrenz bestimmt die Artenzusammensetzung im Wald (Seite 168)


0 1 Erläutere, welchen Einfluss die Zusammensetzung des Bodens auf das Wasserangebot an einem Standort hat.
Erde bindet Wasser und erhöht die Wasserverfügbarkeit. In sandigen Böden kann Wasser dagegen gut abfließen, sie trocknen
schneller aus.
$ 2 In Wäldern mit Rothirschen ist die Rotbuche konkurrenzschwächer als in Wäldern ohne Hirsche. Bilde eine Hypothese zur
Erklärung dieses Sachverhalts.
Rothirsche fressen die Triebe der jungen Rotbuchen, die im Schatten anderer Bäume überdauern. Wenn ein alter Baum fällt und
das Blätterdach aufreißt, können diese geschädigten jungen Rotbuchen nicht schnell genug heranwachsen, um junge Pflanzen
anderer Arten wie der Stieleiche zu überschatten. Die Eichen gewinnen den Wachstumswettbewerb gegen die Rotbuche.

Material: Experimente zur Wurzelkonkurrenz (Seite 169)


$ 1 Zu einem Experiment gehören eine Fragestellung und eine oder mehrere Hypothesen (S. 12). Stelle eine Fragestellung und
zwei Hypothesen für das in Abb. 1 dargestellte Experiment auf.
Fragestellung: Konkurrieren der Glatthafer und die Aufrechte Trespe über den Boden durch z. B. Überwachsen oder im Boden
durch ihre Wurzeln gegeneinander?
Hypothesen:
a) Glatthafer und Aufrechte Trespe konkurrieren über dem Boden gegeneinander.
b) Glatthafer und Aufrechte Trespe konkurrieren im Boden gegeneinander.
$ 2 Erläutere anhand des Versuchsergebnisses, welche der aufgestellten Hypothesen zutrifft.
Werden beide Pflanzen zusammen ausgesät (zweiter Ansatz), wächst der Glatthafer nahe der Aufrechten Trespe schlechter. Wieso
dies so ist, lässt sich mit diesem Ansatz nicht erklären, beide Hypothesen können zutreffen. Werden beide Pflanzen zusammen
ausgesät und durch eine Barriere über dem Boden getrennt (dritter Ansatz), wächst der Glatthafer nahe der Aufrechten Trespe
schlechter. Hypothese a) ist damit widerlegt.
Werden beide Pflanzen zusammen ausgesät und durch eine Barriere im Boden getrennt (vierter Ansatz), wächst der Glatthafer
nahe der Aufrechten Trespe genau so gut, wie im Kontrollansatz (erster Ansatz). Hypothese a) (Glatthafer und Aufrechte Trespe
konkurrieren über dem Boden gegeneinander) ist damit widerlegt.
$ 3 Erläutere die Bedeutung des Kontrollansatzes.
Im Kontrollansatz (erster Ansatz) sind beide Pflanzen vollständig getrennt. Dieser Ansatz hat mehrere Funktionen: Er zeigt,
wie gut die Pflanzen alleine für sich unter den festgelegten Bedingungen (Beleuchtung, Bodenfeuchte, Zusammensetzung des
Bodens) wachsen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
$ 4 Werte die Ergebnisse der beiden Versuche aus. Dazu gehört
a) eine kurze Beschreibung der dargestellten Daten,
b) die Nennung der Schlussfolgerungen und
c) die Formulierung einer Gesamtaussage als Ergebnis.
a) Dargestellt ist eine Tabelle mit Daten zur Keimungszahl, Spross- und Wurzellänge von Kressekeimlingen, die mit reinem Lei-
tungswasser oder zerriebenen Walnussblättern ausgesät wurden.
b) Werden Kressesamen mit zerriebenen Walnussblättern ausgesät, so sinkt der Keimungserfolg und das Wachstum der Wurzeln
und des Sprosses wird gehemmt.
c) Walnussbaumblätter hemmen das Keimen und Wachstum anderer Pflanzen durch einen Giftstoff, der z. B. in den Blättern des
Walnussbaums enthalten ist.
. 5 Walnussbäume wachsen langsam und werden nicht sehr hoch. Erläutere, wie sie trotzdem konkurrenzfähig gegenüber ande-
ren Pflanzenarten sein können.
Durch den Laubfall im Herbst gelangen die Blätter des Walnussbaums auf den Boden, wo sie langsam zersetzt werden. Das Gift,
das das Wachstum anderer Pflanzen hemmt, wird so langsam aber stetig freigesetzt. Dadurch können um den Walnussbaum
herum kaum andere Pflanzen wachsen und diese auch nicht sehr schnell oder hoch.

Waldgesellschaften (Seite 170)


0 1 Beschreibe die Klimadiagramme (Abb. 1) und begründe, an welchem der beiden Standorte die Waldgesellschaft Eichen-Hain-
buchen-Wald vorkommen könnte.
Im Klimadiagramm a) liegen die monatlichen Durchschnittstemperaturen ganzjährig über 0 °C. Von Mai bis September liegt die
Temperatur über 10 °C, die Vegetationsperiode dauert also gut fünf Monate an. Die Niederschlagsmenge ist recht hoch. Von Mai
bis August liegt sie bei 80 mm, sonst bei 60 mm. Nur im Februar sinkt sie auf ca. 40 mm ab.
Im Diagramm b) liegt die Temperatur von Oktober bis April unter 0 °C, nur im Juni liegt sie über 10 °C, die Vegetationsperiode dau-
ert also nur rund einen Monat an. Die Niederschlagsmenge liegt fast ganzjährig bei 20 mm, nur zwischen Juli und August steigt
sie kurzzeitig bis auf 40 mm an.
Nur am Standort des Klimadiagramms a) kann die Waldgesellschaft Eichen-Hainbuchen-Wald vorkommen. Eichen und Hainbu-
chen sind Laubbäume und wachsen nur an Standorten mit mindestens drei Monaten Vegetationsperiode (Temperatur über 10 °C).
Dies ist nur im Klimadiagramm a) der Fall.
$ 2 An unbefestigen Flussufern findet man oft Erlen-Bruchwälder. Erkläre.
Unbefestigte Flussufer sind oft sehr feucht und im Frühjahr öfter überschwemmt. Auf dem nassen Boden können Erlen wachsen,
es bilden sich Erlen-Bruchwälder.
$ 3 In Gebieten mit sandigen Böden herrschen natürlicherweise Kiefern-Eichen-Mischwälder vor. Gib mithilfe der Abb. 2 an, wel-
che weiteren Aussagen sich damit über den Boden machen lassen.
Eichenmischwälder mit Kiefern kommen auf trockenen stark sauren oder trockenen alkalischen Böden vor, entsprechend ist der
Boden an diesen Standorten vermutlich trocken und entweder stark sauer oder alkalisch.

Praktikum: Baumarten bestimmen (Seite 171)


1 Bestimme verschiedene Blätter mithilfe des Bestimmungsschlüssels.
individuelle Lösung
2 Informiere dich, wie man Stieleiche und Traubeneiche an weiteren Merkmalen unterscheiden kann, und stelle das Ergebnis
zeichnerisch dar.
Stieleiche: Die Stieleiche hat meist eine oder bis zu drei Eicheln an einem langen Stiel. Das Blatt der Stieleiche hat an der Basis
„Öhrchen“. Bei der Traubeneiche hängen mehrere Eicheln eng aneinander an einem kurzen Stiel. Das Blatt der Traubeneiche hat
keine „Öhrchen“ (siehe Abbildung)

Öhrchen

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
5.3 Wald und Mensch

Waldnutzung und nachhaltige Entwicklung (Seite 172/173)


0 1 Erstelle eine Mind-Map zu den Verwendungsmöglichkeiten von Holz.
siehe Abbildung

Möbel Bücher
Holzhäuser Pappe/Papier Zeitungen
Werkzeugholz Kartons
Boote Bauholz Verwendung
Musikinstrumente von Holz
Parkett- & Dielenböden Kaminfeuerholz
Brennholz
Holzpellets
Holzwolle Chemiegrundstoff
Verpackungsmaterial
Kisten/Paletten

$ 2 Holz wird im Gegensatz zu Öl und Kohle als nachwachsender Rohstoff bezeichnet. Erkläre.
Holz wird durch Bäume gebildet. Durch Anpflanzung und Fällen von Bäumen kann Holz immer wieder neu produziert werden, es
„wächst nach“. Öl und Kohle entstehen dagegen unter besonderen Bedingungen in einem Millionen Jahre dauernden Prozess. Der
Mensch kann sie nicht gezielt neu produzieren, sondern nur verbrauchen.
$ 3 Erläutere unter Verwendung von Abb. 2 die Bevorzugung von Fichten in der Forstwirtschaft und das im Text genannte Baum­
alter zum Erntezeitpunkt bei Fichten.
Nadelbäume wie die Fichte wachsen generell gerade, ihre Stämme sind daher gut zum Zersägen in längere Bretter geeignet. Jun-
ge Fichten haben einen sehr hohen jährlichen Holzzuwachs in m3/ha x Jahr (Abb. 2, rechtes Diagramm), dass erst ab einem Alter
von 50 Jahren abnimmt. Die Holzmenge in einem Fichtenforst in m3/ha steigt bis etwa 80 Jahren jährlich stark an (Abb. 2, rechtes
Diagramm). Im Alter von ca. 70 Jahren, in dem Fichten gefällt werden, ist die Zunahme des Holzzuwachses bereits geringer und
die Holzmenge im Fichtenforst steigt nicht mehr so stark an.
. 4 Die Anpflanzung von Fichtenforsten steht zunehmend in der Kritik. Begründe.
Die Anpflanzung von Fichtenforsten ist wirtschaftlich nachhaltig. Die Bäume wachsen schnell und das Holz ist gut nutzbar. Jedoch
ist die ökologische Nachhaltigkeit gering. Durch die großflächige Anpflanzung nur einer Baumart ist die Artenvielfalt an Pflanzen
im Fichtenforst gering. Da viele Tiere eine höhere Vielfalt an Pflanzen oder andere Pflanzen als die Fichte benötigen, ist auch die
Artenvielfalt an Tieren im Fichtenforst geringer als in Mischwäldern. Das Risiko größerer Schäden durch Baumschädlinge ist auch
in Fichtenforsten größer als in Mischwäldern, da mehr gleiche Bäume auf selben Raum stehen, die als Nahrung für die Baum-
schädlinge dienen, und weniger verschiedene Räuber, die die Schädlinge fressen.

Eine große Artenvielfalt sorgt für Stabilität im Wald (Seite 174/175)


$ 1 Erkläre, warum die Borkenkäfer schädlicher für Bäume sind als Holz zersetzende Pilze.
Borkenkäferlarven fressen sich in langen Gängen durch den nährstoffreichen Bast der Bäume. Hier liegen viele Gefäße, die
Wasser zu den Blättern und Nährstoffe zu den Wurzeln transportieren. Sie werden durch den Fraß zerstört und der Baum so stark
geschädigt. Holz zersetzende Pilze zerstören das bereits tote Holz der Bäume, das den Baum stabilisiert, aber keine weitere Funk-
tion mehr hat. Ein durch Pilze zersetzter hohler Baum kann daher durchaus noch sehr alt werden.
$ 2 Erläutere mithilfe von Abb. 4 den Zusammenhang zwischen den Individuenanzahlen von Borkenkäfer und Buntspecht.
Je mehr Borkenkäfer es gibt, desto mehr nimmt die Zahl der Buntspechte zu. Sie kommen einfacher und schneller an ausreichend
Nahrung und können so mehr Eier legen und Junge erfolgreich großziehen. Diese fressen wiederum mehr Borkenkäfer. Daher gilt,
je mehr Buntspechte es gibt, desto weniger Borkenkäfer gibt es. Je weniger Borkenkäfer es gibt, desto weniger Buntspechte gibt
es, denn sie bekommen nicht mehr genug Nahrung und bekommen weniger Nachwuchs. Je weniger Buntspechte es gibt, desto
mehr Borkenkäfer gibt es, da sie weniger zahlreich gefressen werden.
. 3 Diskutiere die Vor- und Nachteile der Maßnahme, kranke Bäume im Wald zu belassen.
Nachteile:
– In kranken Bäumen können sich Baumschädlinge wie der Borkenkäfer gut und schnell vermehren.
– Durch die schnelle Vermehrung von Baumschädlingen beginnen diese, auch gesunde Bäume zu befallen und schädigen diese.
– Kranke Bäume nehmen Platz ein, an dem gesunde junge Bäume nachwachsen könnten.
Vorteile:
– Kranke Bäume sind Nahrungsquelle vieler Pilze und Tiere.
– In kranken Bäumen bauen viele Tiere wie z. B. der Buntspecht ihre Höhlen.
– Durch kranke Bäume im Wald nimmt so die Artenvielfalt an Pilzen und Tieren im Wald zu.
– Die größere Artenvielfalt bewirkt, dass der Wald als ganzes stabiler ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Waldschutz und Naturschutz (Seite 176)
$ 1 Notiere Argumente für und gegen die Einrichtung eines Naturschutzgebiets in einem Waldgebiet wie dem Nationalpark Baye-
rischer Wald aus Sicht eines dort lebenden Anwohners.
Argumente für die Einrichtung eines Naturschutzgebiets:
– In einem Naturschutzgebiet kommen langfristig mehr verschiedene Arten von Pflanzen und Tieren vor.
– Ein Wald mit höherer Artenvielfalt ist stabiler und weniger gefährdet durch Baumschädlinge.
– Ein vielfältiger Wald ist für Touristen interessanter.
– Durch Tourismus entstehen Arbeitsplätze z. B. durch Hotels und Restaurants.
Argumente gegen die Einrichtung eines Naturschutzgebiets:
– In eigenen Fichtenforsten treten Schäden auf durch Baumschädlinge aus dem Schutzgebiet.
– Das Forststerben ist ein großer wirtschaftlicher Schaden für die Holzwirtschaft und kostet Arbeitsplätze.
– Es kommen zunächst weniger Touristen, da tote Wälder nicht besonders attraktiv sind (Verlust von Einkommen und Arbeitsplät-
zen).
. 2 Diskutiere mithilfe der notierten Argumente mit einem Mitschüler über eine solche Einrichtung. Überlegt und diskutiert mög-
liche Kompromisse.
individuelle Lösung; mögliche Kompromisse: Entschädigung von Arbeitern in der Holzwirtschaft, Einrichtung von Gebieten mit
begrenzten Waldschutzmaßnahmen, wie z. B. dem Aufstellen von Borkenkäferfallen am Rande der Nationalparks.

Teste dich selbst (Seite 179)


0 1 Zeichne einen Flaschengarten in dein Heft. Wähle dazu die Lebewesen aus, die du sinnvollerweise hineinsetzen solltest.
Für den Flaschengarten eignen sich Moos oder Efeu, eine größere oder 2 bis 3 kleinere Schnecken, ein Regenwurm, wenige Floh-
krebse und Asseln.
$ 2 Erläutere deine Auswahl. Gib dazu alle Nahrungsbeziehungen, Stoffkreisläufe und den Weg der Energie an.
In einem Flaschengarten sollten sinnvollerweise langsam wachsende Produzenten, wenige Konsumenten sowie Destruenten
vorkommen, damit ein geschlossener Stoffkreislauf entsteht. In einem solchen Flaschengarten können die Lebewesen längere Zeit
überleben, wenn die Anzahl der Lebewesen gut zueinander und zur Flaschengröße abgestimmt ist. Größere Tiere wie Eidechsen
und Mäuse eignen sich nicht, auch Spinnen nicht, da Insekten als Nahrung fehlen.
Nahrungsbeziehung: Moos/Efeu → Schnecke
Stoffkreislauf: Die Schnecke als Konsument frisst Pflanzen (Produzenten). Diese benötigen Mineralstoffe, Wasser und Kohlenstoff-
dioxid und produzieren energiereiche Biomasse und Sauerstoff (Fotosynthese). Die Schnecke baut einen Teil ihrer Nahrung in eige-
ne Biomasse um. Den größeren Teil baut sie mit Sauerstoff wieder zu Wasser und Kohlenstoffdioxid ab (Zellatmung). Ausscheidun-
gen sowie totes Pflanzenmaterial werden von den Destruenten abgebaut. Dabei werden Mineralstoffe und Wasser freigesetzt.
0 3 Skizziere ein Begriffsnetz mit möglichst vielen Begriffen der Mind-Map (s. Abb. 1, Seite 178) und ergänze den Begriff „Arten-
vielfalt“.
siehe Abbildung
Konkurrenz stehen
führt
unterein- beeinflussen die abiotische
langfristig Konkurrenzstärke Umwelteinflüsse
zu ander in
von
Konkurrenz-
ausschluss vermindert
Pflanzen sind
führt stehen Produzenten
zur Bildung untereinander werden
von in gefressen fressen u.a.
verhindert von
Ökologische bilden Konsumenten
Konkurrenz- führt Nische sich
zu ihre Tiere nutzen
verminderung nutzen Reste von
erhöht bilden Reste von
erhöht stehen am bilden
verringert die Anfang von
die Destruenten
Artenvielfalt führt können
zu sein
vielfältigen Nahrungs- sind oft
erhöhen die
beziehungen sind oft
Naturschutz- erhöhen verringert Pilze
maßnahmen die die Bakterien
verringert bilden z.B.
ökologische Fichtenmono-
Nachhaltigkeit kulturen Symbiose

Anmerkung: Begriffsnetze sehen je nach Anordnung der Begriffe unterschiedlich aus.


. 4 Vergleiche die Mind-Map mit deinem Begriffsnetz. Bewerte, welche Darstellung dir zum Lernen mehr hilft.
Eine Mind-Map eignet sich gut zur Sortierung von zueinander passenden Über- und Unterbegriffen. Ein Begriffsnetz stellt Bezie-
hungen zwischen Begriffen dar. Entsprechend sollten sie zum Lernen eingesetzt werden.
Bewertung: individuelle Lösung
0 5 Die Steckbriefe in Abb. 2 geben Kennzeichen ökologischer Nischen an. Erläutere.
Als ökologische Nische werden alle Wechselwirkungen eines Lebewesens mit seiner Umwelt bezeichnet, die es aufgrund seiner
körperlichen Angepasstheit und Lebensweise eingehen kann. Die beiden Steckbriefe beschreiben die Wechselwirkungen von Eich-
hörnchen und Grauhörnchen mit ihrer Umwelt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
. 6 In Mitteleuropa wird ein Zurückdrängen des Eichhörnchens durch das Grauhörnchen befürchtet, jedoch keine vollständige
Verdrängung erwartet. Begründe.
Das Eichhörnchen und das Grauhörnchen haben nahezu die gleiche ökologische Nische (Nahrung, Lebensweise, Nistort). Das
Grauhörnchen ist nach den Erfahrungen aus England konkurrenzstärker und verdrängt das Eichhörnchen aus den von ihm
nutzbaren Lebensräumen (Laub- und Laubmischwälder). Das Eichhörnchen wird vermutlich in Nadelwäldern überleben können, in
denen das Grauhörnchen nicht vorkommt.
. 7 Lebewesen wurden und werden häufig aus fremden Ländern zur Jagd oder als Haustier eingeführt. Nenne Beispiele und
bewerte dieses Handeln.
Gelangen diese Tiere in die Freiheit, konkurrieren die eingeführten Arten häufig mit einheimischen Arten, die eine ähnliche öko-
logische Nische nutzen. Wenn die eingeführten Tiere konkurrenzstärker sind, verdrängen sie die einheimischen Arten langfristig.
Denn oftmals haben sie in der neuen Umgebung keine oder weniger natürliche Feinde, oder sie können sich besser gegen diese
wehren. Vermehren sie sich zu stark, können sie den Bestand der einheimischen Art sowie den der Lebewesen, von denen sie sich
ernähren, gefährden.
Bewertung: Bei der Einführung von fremden Arten sollte man sich zuvor erkundigen, ob einheimische Lebewesen durch sie ver-
drängt werden könnten.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
6 Gewässerökosysteme
6. 1 Stehende Gewässer

Pflanzen des Sees (Seite 182/183)


0 1 Um natürliche Seen verlaufen verschiedene Zonen mit bestimmten Pflanzenarten wie Gürtel. Erläutere.
Pflanzengürtel liegen kreisförmig um den See. Ein solcher Gürtel zeichnet sich durch gleiche Lebensbedingungen aus, insbesonde-
re die Wassertiefe. Um einen See herum können Zonen unterbrochen sein, z. B. wenn dort der Seeboden plötzlich abfällt.
$ 2 Samen von Schilfrohr gelangen auch an den Grund von Seen und Samen von Tauchblattpflanzen an das Ufer. Erkläre, warum
die Zonen eines Sees trotzdem erhalten bleiben.
Die Bedingungen für das Wachstum und die Entwicklung der Pflanzen stimmen mit ihrem natürlichen Standort nicht überein.
So fehlt dem Samen des Schilfrohrs zum Keimen Sauerstoff, wenn der Samen am Grund des Sees liegt. Den Tauchblattpflanzen
genügt der Wasserstand im Uferbereich nicht, um sich gegen Uferpflanzen zu behaupten.
. 3 Wasserlinsen sind kleine Pflanzen, die auf dem Wasser schwimmen und dort eine geschlossene „Decke“ bilden können, durch
die kaum Licht dringt. Nenne begründete Vermutungen zu den Konsequenzen für die Zonen des Sees.
1. Behinderung des Durchtritts von Licht in das Gewässer, da die Wasserlinsen das Licht absorbieren.
2. Fotosyntheseaktivität von Pflanzen des Tauchblattgürtels sinkt, da die Lichtintensität zu gering ist.
3. Wasserlinsen verhindern die Erwärmung des Wassers im Sommer, da sie die Wasseroberfläche vor der Wärmestrahlung isolie-
ren.
4. Sterben die Wasserlinsen, können sie dem Ökosystem schaden, da sie absinken und Faulschlamm bilden.

Seerosen: Leben über und unter Wasser (Seite 184)


$ 1 Seerosen sind an die Lebensweise einer Schwimmblattpflanze angepasst. Beschreibe diese Angepasstheit.
Die langen, dünnen Stiele der Blätter und Blüten biegen sich entsprechend des Wasserstandes. Die Stiele halten sich im Wasser
aufrecht, weil sie in ihrem Inneren durch luftgefüllte Kanäle Auftrieb erhalten. Die Schwimmblätter der Weißen Seerose enthalten
ausgedehnte, mit Luft gefüllte Hohlräume zwischen den Zellen des Blattes. Sie bewirken den Auftrieb für die Blätter. Der Gasaus-
tausch erfolgt durch Spaltöffnungen, die sich ausschließlich auf der Oberseite des Schwimmblattes befinden.
. 2 Stelle eine begründete Hypothese zur Veränderung des Stärkegehalts im Erdspross der Seerose im Verlauf eines Jahres auf.
Hypothese: Der Stärkegehalt nimmt im Sommer beständig zu, sinkt im Herbst langsam und Winter schneller ab, bevor er im
Frühjahr den geringsten Wert aufweist Begründung: Die Seerose produziert im Sommer bei optimaler Lichtversorgung durch
Fotosynthese viel Glucose, die sie nur teilweise zur Energiebereitstellung und für das Wachsen benötigt. Ein Teil der erzeugten
Glucose wird in der Seerose im Erdspross in Stärke umgewandelt und gespeichert. Im Herbst werden die grünen Pflanzenteile ab-
gebaut. Die Fotosynthese kommt zum Erliegen. Der Stärkegehalt im Erdspross nimmt durch deren Abbau leicht ab. Im Winter ist
das umgebende Wasser kalt, der Stoffwechsel der Seerose ist minimiert. Es wird Stärke für die Zellatmung benötigt. Im zeitigen
Frühjahr treibt die Seerose neue Blätter aus. Dazu muss sie Stärke in Baustoffe umwandeln bzw. zur Energiebereitstellung nutzen.
Der Stärkegehalt im Erdspross sinkt stark und bleibt auf niedrigem Niveau, bis die neuen Blätter Fotosynthese betreiben.

Praktikum: Modelle zu Schwimmblattpflanzen (Seite 185)


1 Fertige das Strukturmodell eines Seerosenblattes nach dem in Abb. 1 dargestellten Muster an.
siehe Abbildung

2 Beschreibe Unterschiede zwischen den Laubblättern von Landpflanzen und den Schwimmblättern der Seerose.
Laubblätter von Landpflanzen enthalten keine Luftkanäle sondern kleine Hohlräume im Schwammgewebe. Die Spaltöffnungen
befinden sich meist in der unteren Epidermis. Die Schwimmblätter weisen Spaltöffnungen in der oberen Epidermis auf und große
luftgefüllte Hohlräume im Blattgewebe.
3 Vergleiche die Versuchsergebnisse mit der Blasenfolie mit denen der Overheadfolie und erläutere die Unterschiede.
Beim Auflegen der Folien auf das Wasser bleiben beide Folien an der Oberfläche. Wird die Schüssel bewegt, entstehen Wellen im
Wasser. Es schwappt über die Overheadfolie, worauf diese absinkt. Die Blasenfolie bleibt beständig auf dem Wasser. Die Luft in
den Plastikblasen der Folie verhindert das Absinken.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
4 Übertrage die an den Funktionsmodellen „Blasenfolie“ und „Overheadfolie“ gewonnenen Erkenntnisse auf die Schwimmblät-
ter von Wasserpflanzen.
Wie die Luft in den Kammern der Folie gibt die Luft in den Hohlräumen des Schwimmblattes den Blättern Auftrieb. Solch ein Blatt
geht auch bei Wellengang nicht unter.

Atmen im Wasser (Seite 186/187)


0 1 Vergleiche die Kiemenatmung bei Eintagsfliegenlarven und Fischen.
Gemeinsamkeiten: Sauerstoffaufnahme aus dem Wasser, Kohlenstoffdioxidabgabe in das Wasser, Kiemen mit großer Austausch-
fläche.
Unterschiede: Sauerstoff wird bei den Eintagsfliegenlarven durch dünne Chitinhäute der Tracheenkiemen in die Tracheen über-
führt. Der Sauerstoff wird über die Tracheen direkt zu den Organen befördert. bei den Fischen gelangt der Sauerstoff in das Blut
der Kiemen-Kapillaren. Der Sauerstoff wird an Hämoglobin gebunden. Mit dem Blut gelangt der Sauerstoff zu den Organen. Der
Transport des Kohlenstoffdioxids erfolgt jeweils in entgegengesetzter Richtung.
$ 2 Wähle aus den Abbildungen dieser Doppelseite Strukturen aus, die eine Vergrößerung der Atemfläche zeigen. Erkläre den
Zusammenhang zwischen Struktur und Funktion an den gewählten Beispielen.
Die Kiemenblättchen der Fische weisen eine große Oberfläche auf. Pro Zeit kann eine größere Menge Wasser die Kiemenoberflä-
che berühren. Der Gasaustausch an der vergrößerten Oberfläche läuft gegenüber einer kleinen Fläche schneller ab. Eine deutliche
Oberflächenvergrößerung ist auch bei den Tracheenkiemen der Eintagsfliegenlarve und der Kleinlibellenlarve zu erkennen. Auch
hier besteht der Zusammenhang zwischen Struktur und Funktion analog zu den Kiemenblättchen.
. 3 Erkläre unter Verwendung von Abb. 1 und 3, wie die Wasserspinne unter Wasser atmet.
Die Wasserspinne befördert Luft Körperhaaren und Beinen unter die Wasseroberfläche zu einer dort verankerten Luftblase
zwischen Spinnfäden. Ist der Behälter gefüllt, wölbt er sich nach oben und sieht dann aus wie eine Glocke. Die gespeicherte Luft
nutzt die Spinne für ihre Atmung unter Wasser, indem sie durch Körperkontakt eine Verbindung zwischen der Blase und ihren
Tracheen herstellt.

Ernährung in einem See (Seite 188)


$ 1 Beschreibe eine Nahrungskette und ordne die Begriffe „Produzent“ und „Konsument“ begründet zu. Beziehe dich auf Abb. 1.
Am Anfang der Nahrungskette im See stehen die Planktonalgen. Sie sind die Produzenten, d.h. sie stellen Nährstoffe selbst her
(Fotosynthese). Sie werden gefressen vom Wasserfloh, einem Konsumenten, der Nährstoffe aufnehmen muss. Der Wasserfloh wird
gefressen von einer Großlibellenlarve. Die Großlibellenlarve wird von der Rotfeder gefressen und die Rotfeder wird vom Graureiher
gefressen. Alle diese Fleischfresser sind ebenfalls Konsumenten.

Der See im Jahresverlauf (Seite 189)


. 1 Die Lebensbedingungen im Oberflächenwasser eines Sees sind beträchtlichen Schwankungen unterworfen. Erläutere mithilfe
von Abb. 3.
Die Frühjahrszirkulation bewirkt die Durchmischung des mineralstoffreichen Tiefenwassers mit dem mineralstoffhaltigen
Oberflächenwasser. Dadurch erhöht sich der Mineralstoffgehalt des Oberflächenwassers im Frühjahr beträchtlich. Mit steigen-
der Lichteinstrahlung und Temperatur im Frühjahr und Sommer sinkt der Mineralstoffgehalt aufgrund der Vermehrung und des
Wachstums der Produzenten. Der Mineralstoffgehalt des Oberflächenwassers sinkt kontinuierlich. Das Wachstum der Produzen-
ten zieht eine Vermehrung der Konsumenten nach sich, deren Stoffwechselendprodukte erhöhen den Mineralstoffgehalt des Ober-
flächenwassers diskontinuierlich. Mit der Herbstzirkulation steigt der Mineralstoffgehalt im Oberflächenwasser. Er bleibt erhöht,
da aufgrund der niedrigen Temperaturen und Lichtintensität die Aktivität der Produzenten eingeschränkt ist.
. 2 Erkläre, warum die Planktonblüte, also die Massenvermehrung von Grünalgen im Oberflächenwasser, im Frühjahr einsetzt.
Nutze dazu Abb. 3.
Die Frühjahrszirkulation bewirkt die Durchmischung des mineralstoffreichen Tiefenwassers mit dem mineralstoffhaltigen Ober-
flächenwasser. Dadurch erhöht sich der Mineralstoffgehalt des Oberflächenwassers im Frühjahr beträchtlich. Mit der Erhöhung
der Lichteinstrahlung und Temperatur im Frühjahr wird die Produktion von Nährstoffen und Sauerstoff auf der Grundlage der
Fotosynthese durch Produzenten erhöht. Produzenten sind u. a. Grünalgen. Bei extrem guter Versorgung mit Mineralstoffen und
einer günstige Temperatur tritt eine Massenvermehrung von Grünalgen auf.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Extra: Anomalie des Wassers (Seite 189)
1 Stelle die Werte in der Tabelle (Abb. 2) in einem Diagramm dar und erläutere es.
Dargestellt ist die Dichte von Wasser (g/l) in Abhängigkeit von der Temperatur (°C). Wasser hat bei 4 °C seine höchste Dichte.
Kühlt es weiter ab oder erwärmt es sich, nimmt seine Dichte jeweils ab (s. Abb.).

1000
999,9
999,8
999,7
Dichte (g/l)

999,6
999,5
999,4
999,3
999,2
999,1
999
0 1 2 3 4 5 6 7 8 9 10
Temperatur (°C)

Schwimmen und Schweben (Seite 190)


$ 1 Auch Lebewesen, die sich aktiv fortbewegen können, sind an das Schweben angepasst. Erläutere den Vorteil.
Im Wasser schweben zu können, bedeutet für Lebewesen eine Energieersparnis. Sie müssen dann keine Kraft aufwenden, um ein
Absinken oder Aufsteigen zu verhindern.

Praktikum: Plankton untersuchen (Seite 191)


1 Vergleiche die Planktonlebewesen in den beiden Proben.
individuelle Lösung (Es ist zu erwarten: oberflächennah Phytoplankton überzählig, in zwei Meter Tiefe Zooplankton überzählig.)
2 Erläutere die Bedeutung der in der Durchführung genannten Hinweise.
Man sollte das Deckglas vorsichtig auflegen, um die empfindlichen Kleinstlebewesen nicht zu beschädigen. Man sollte nicht zu
lange mit voller Lichtstärke beleuchten, weil Licht mit Wärmestrahlung verbunden ist. Eine zu hohe Temperatur im Präparat schä-
digt ebenfalls die darin enthaltenen Lebewesen.
3 Ermittle die Sinkgeschwindigkeiten der unterschiedlich geformten Modelle.
individuelle Lösung (Lösungsansatz zur Sinkgeschwindigkeit (Quotient aus Weg und Zeit; Vsi = s/t
4 Stelle einen Zusammenhang zwischen Form und der Sinkgeschwindigkeit der Modelle her.
Je größer die Oberfläche des Körpers bei gleicher Masse ist, desto geringer ist die Sinkgeschwindigkeit.
5 Beziehe die Ergebnisse des Modellversuchs auf die Gestalt von Planktonorganismen.
Bestimmte Strukturen, wie Ausstülpungen oder Körperanhänge, wirken dem Absinken im Wasser entgegen. Dies entspricht dem
Modellversuch. Absinken im Wasser würde z. B. für Planktonalgen bedeuten, weniger Licht für die Fotosynthese zu erhalten. Tieri-
sche Planktonorganismen weisen die gleichen Merkmale auf wie ihre potenzielle Nahrung.

Nebeneinander leben – Koexistenz am See (Seite 192/193)


0 1 Beschreibe die ökologischen Nischen von Reiher- und Löffelenten. Lege eine Tabelle dazu an.
siehe Tabelle
Entenart Nahrungsanspruch, angepasste Brutplatz Brut-, Aufzuchtzeiten Erreichen der Nahrungsquelle
Schnabelform
Löffelente Planktonalgen werden durch einen Seih- Ufergebüsch mit April bis Juni schwimmen auf dem Oberflächen-
schnabel gefiltert. krautigen Pflanzen wasser
Reiherente Größere Schnecken werden durch einen Röhrichtgürtel Juni bis August tauchen im Tiefenwasser
kräftigen Schnabel zerlegt.

$ 2 Löffel- und Reiherenten leben in unseren Gewässern friedlich nebeneinander. Erkläre mithilfe der Ergebnisse von Aufgabe 1.
Löffel- und Reiherenten unterscheiden sich in ihren Ansprüchen an die Nahrung und in den für die Nahrungsaufnahme angepass-
ten Schnabelformen. Sie unterscheiden sich auch in der Lage der Brutplätze und den Brut- und Aufzuchtzeiten. Die Unterschiede
sind so deutlich ausgeprägt, dass für sie die jeweils andere Art keine Konkurrenz darstellt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Material: Nahrungsbeziehungen in einem See (Seite 194/195)
0 1 Ordne die in Abb. 1 dargestellten Lebewesen zu einer Nahrungskette.
Algen → Kaulquappe → Großlibellenlarve → Teichralle → Seeadler (→ wird gefressen von …)
$ 2 Pflanzen sind direkt oder indirekt die Nahrungsgrundlage für alle Tiere im See. Erläutere diese Aussage und verwende dabei
die Begriffe „autotroph“ und „heterotroph“.
Die Pflanzen sind autotroph, sie wandeln Lichtenergie in chemische Energie um und erzeugen aus Kohlenstoffdioxid und Wasser
Sauerstoff und Glucose (und daraus alle anderen Nährstoffe) selbst. Die Nährstoffe sind die Ernährungsgrundlage für die hetero-
trophen Tiere. Die Konsumenten erzeugen nicht selbst Nährstoffe aus anorganischen Stoffen, sondern sind auf die autotrophen
Produzenten angewiesen.
$ 3 Im Nahrungsnetz eines Sees lassen sich einige Arten eindeutig einer Ernährungsebene zuordnen. Auf Kaulquappe und Rotfe-
der trifft das in der hier dargestellten Form nicht zu (Abb. 2). Erkläre.
Kaulquappen fressen pflanzliches und tierisches Plankton. Die Rotfeder ernährt sich von Pflanzen und Tieren. Beide sind somit
Konsumenten erster und zweiter Ordnung, je nach ihrer Nahrung.
. 4 Leite aus den Daten in Abb. 3 eine Eigenschaft von DDT ab, die die Konzentrationsunterschiede verständlich macht.
Der Hecht enthält mit 2,1 mg/kg mehr DDT in seinem Fett als die Rotfeder (1,1 mg/kg) oder die Brasse (0,9 mg/kg). Die Tiere mit
einem geringeren Anteil an DDT im Fett sind Planktonfresser, denn DDT wird in geringer Konzentration vom Plankton aus dem
Wasser aufgenommen. Der Hecht ernährt sich u. a. von Rotfeder und Brasse. Mit diesen Tieren nimmt er auch das DDT auf, das sie
in deren Fett angereichert hat. DDT reichert sich in der Nahrungskette an.
$ 5 Erläutere die in Abb. 4 dargestellten Zusammenhänge.
Beim Aufbau ihrer Biomasse binden die Produzenten durch Fotosynthese Sonnenenergie. In der Nahrungskette wird die in den Le-
bewesen gespeicherte Energie von Ernährungsebene zu Ernährungsebene teilweise abgegeben und nur etwa 1/10 in der eigenen
Biomasse gespeichert. Die Abgabe erfolgt in Form von Wärme oder Stoffen (Ausscheidungen oder z. B. Fellwechsel bei Tieren oder
z. B. Laubfall bei Bäumen).
. 6 Entscheide begründet, welche der folgenden Aussagen zutrifft: Nahrungsketten sind in ihrer Länge begrenzt, weil
a) beim Ausfall eines Konsumenten alle nachgeordneten gefährdet wären;
b) weil der Energiegehalt der Biomasse der Produzenten nicht ausreichen würde, um über mehrere Stufen hinweg Konsu-
menten 4. Ordnung damit zu versorgen.
Aussage b) trifft zu. Von einer Ernährungsebene zur anderen nimmt die gespeicherte Energie jeweils um 1/10 ab. Von 1 Mio. Joule
Sonnenenergie gelangen zu den Konsumenten 3. Ordnung nur etwa 10 Joule, Konsumenten 4. Ordnung erhielten nur 1 Joule davon.
Das würde nur für sehr wenige Tiere auf dieser Stufe ausreichen.
Aussage a) trifft nicht zu, da sich fast alle Tiere von unterschiedlichen Arten ernähren (Nahrungsnetz).
$ 7 Erläutere den Kreislauf des Sauerstoffs mithilfe von Abb. 5.
Die Planktonalgen und Wasserpflanzen sind die Produzenten. Sie erzeugen aus Kohlenstoffdioxid und Wasser durch Fotosynthese
Glucose und Sauerstoff. Von den Pflanzen abgegebener Sauerstoff wird in Wasser gelöst. Produzenten, Konsumenten und Destru-
enten benötigen Sauerstoff zur Zellatmung. Dabei werden Glucose und Sauerstoff in Kohlenstoffdioxid und Wasser umgewandelt,
die wiederum die Grundlage für die Fotosynthese der Pflanzen sind.
. 8 Erkläre, dass im See ein Kreislauf für eine Reihe von Stoffen vorliegt, nicht jedoch für die Biomasse.
Biomasse besteht aus Stoffen, die in Lebewesen gebunden sind. Das sind z. B. die Nährstoffe Kohlenhydrate, Fette oder Eiweiße.
Sie werden in Nahrungsbeziehungen schließlich alle zu Kohlenstoffdioxid und Wasser abgebaut. Die Produzenten nehmen keine
Nährstoffe auf, sondern erzeugen aus Kohlenstoffdioxid und Wasser neue Biomasse.
. 9 Die Stoffkreisläufe werden von der Energie der Sonne angetrieben. Nimm Stellung zu dieser Aussage.
Produzenten erzeugen mithilfe der Sonnenenergie Biomasse, die die Ernährungsgrundlage für alle Konsumenten und Destruen-
ten bildet. Die Konsumenten und Destruenten geben bei ihren Lebensvorgängen Energie an die Umgebung ab und bilden dabei
energiearme Stoffe. Nur durch die Energie der Sonne können diese Prozesse fortwährend ablaufen.

Überdüngung eines Sees (Seite 196)


0 1 Beschreibe die grafische Darstellung von Messwerten in Abb. 2.
Dargestellt ist der Phosphatgehalt (mg/m3) im Bodenseewasser in Abhängigkeit von der Zeit (Jahrzehnten). Der Phosphatgehalt
steigt von 1960 bis 1978 von 15 mg/m3 auf 85 mg/m3 an. Seit Anfang der 1980iger-Jahre bis 2010 fällt dann der Phosphatgehalt
langsam auf 10 mg/m3 ab. Dieser niedrige Wert ist von Bestand. Dargestellt ist außerdem der Sauerstoffgehalt (mg/l) im Boden-
seewasser in Abhängigkeit von der Zeit. Der Sauerstoffgehalt ist starken Schwankungen unterworfen. Den höchsten Sauerstoffge-
halt hatte der Bodensee Anfang 1970 mit 7 mg/l, den niedrigsten Wert hatte der Bodensee 1971 mit 2 mg/l. In den anderen Jahren
schwankt er zwischen 7 und 4 mg/l. Seit 1993 liegt der Sauerstoffgehalt beständig über 6 mg/l.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 2 Erläutere den Zusammenhang zwischen den beiden Kurven in Abb. 2.
Als im Jahr 1971 der Sauerstoffgehalt des Bodenseewassers niedrig war, erreichte der Phosphatgehalt gerade einen Hochpunkt.
Phosphat fördert das Wachstum von Algen und anderen Pflanzen. Bei deren Absterben, z. B. mangels genügend Lichteinfalls
durch Massenvermehrung oder jahreszeitlich bedingt, kommt es zu einer raschen Vermehrung von Destruenten, die die Biomasse
unter Sauerstoffverbrauch in Wasser und Kohlenstoffdioxid abbauen und Mineralstoffe freisetzen (1971 und 1972). Das Absinken
des Phosphatgehaltes seit Anfang der 1980iger-Jahre bis 2010 ist verbunden mit dem Ansteigen des Sauerstoffgehalts im Boden-
see. Der niedrige Phosphatgehalt genügt den Pflanzen zur Fotosynthese, wirkt aber einem üppigen Pflanzenwachstum entgegen.
Die Zahl der Destruenten ist angemessen und der Sauerstoffgehalt im See ausgewogen.
. 3 Auch der Eintrag von Pflanzenrückständen oder Ausscheidungen von Tieren können zur Eutrophierung eines Sees führen.
Erkläre.
In das Gewässer eingebrachte Pflanzenrückständen oder Ausscheidungen von Tieren unterliegen den natürlichen Abbauprozessen
in einem See. Es kommt es zu einer raschen Vermehrung von Destruenten, die die Biomasse unter Sauerstoffverbrauch in Wasser
und Kohlenstoffdioxid abbauen. Die dabei freigesetzten Mineralstoffe fördern das Wachstum von Algen und Pflanzen im See. Ein
starker Bewuchs mit Pflanzen ist ein Zeichen für eine Überdüngung (Eutrophierung) eines Sees.

Verlandung eines Sees (Seite 197)


0 1 Worin unterscheiden sich Niedermoore und Hochmoore? Recherchiere.
Ein Niedermoor entsteht aus einem eutrophierten See über sehr lange Zeiträume. Aus abgestorbenen Pflanzenresten bildet sich
dann unter der Einwirkung von Destruenten Schlamm. Schicht für Schicht lagern sich Reste von Pflanzen aus allen Zonen des Sees
ab. Wegen schlechter Sauerstoffversorgung werden die Pflanzen aus dem Erlenbruchwald, der Röhrichtzone und die Riedgräser
nicht komplett abgebaut. Über lange Zeiträume bildet sich daraus Niedermoortorf. Aus dem flachen See wurde ein Niedermoor. Es
hat Kontakt zum Grundwasser. Bei ausreichend Niederschlägen wächst auf dem Niedermoortorf Torfmoos. Es hält das Nieder-
schlagswasser und kommt mit wenig Mineralstoffen aus. Untere Teile des Torfmooses sterben ab, werden aber aufgrund von
Sauerstoffmangel nicht abgebaut. Es bildet sich Hochmoortorf.
$ 2 Erläutere die ökologische Bedeutung von Mooren.
Moore bilden mehr Biomasse als dort abgebaut wird. Sie sind wichtige Speicher für Kohlenstoff: Außerdem herrschen dort Um-
weltbedingungen, die für viele Tier- und Pflanzenarten überlebenswichtig sind.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
6. 2 Fließgewässer

Die Regionen eines Flusses (Seite 198/199)


$ 1 Erkläre die Zusammenhänge zwischen den in Abb. 2 angegebenen Daten. Suche dazu die Messpunkte in Abb. 1 auf.
1) In der Nähe der Quelle ist das Wasser kalt (Höhenlage, erst kurze Zeit an der warmen Luft, Schatten). Sauerstoff aus der Luft
konnte das Wasser noch nicht aufnehmen. Pflanzenbewuchs ist kaum vorhanden. Konsumenten verbrauchen Sauerstoff beim
Abbau eingetragener Biomasse. Das Wasser ist klar, da es keine Schwebstoffe enthält.
2) Das Wasser hat sich durch Luft und Sonne etwas erwärmt. Im Oberlauf fließt das Wasser schnell. Luftsauerstoff kann dadurch
leichter von Wasser aufgenommen werden. Destruenten haben Überreste von Pflanzen und Tieren zersetzt. Der erhöhte Mine-
ralstoffgehalt des Wassers führt zur Vermehrung von Algen (grünes Wasser).
3) Durch Zuflüsse führt der Fluss hier wesentlich mehr Wasser als im Quellbach, das Flussbett ist breiter und tiefer. Das Wasser
hat sich weiter erwärmt. Neben Algen (Grünfärbung) leben viele Konsumenten und Destruenten im Wasser, die Sauerstoff
benötigen. Detritus wird von Destruenten abgebaut. Dadurch erhöht sich der Mineralstoffgehalt, während der Sauerstoffgehalt
sinkt.
4) In Küstennähe ist der Fluss in seinem Unterlauf durch weitere Zuflüsse zu einem Strom angeschwollen. Das weiter erwärmte
Wasser fließt langsam. Schwebstoffe, die aus dem Abbau von Biomasse durch Destruenten stammen, lagern sich ab.
Der Mineralstoffgehalt ist erhöht. Der Sauerstoffgehalt ist gesunken, da stoffabbauende Prozesse Sauerstoff verbrauchen.
Planktonalgen findet man im trüben Wasser wenig, trotz des relativ hohen Mineralstoffgehalts. Ihnen fehlt das Licht.

Vielfalt und Angepasstheit (Seite 200)


$ 1 Vergleiche die Angepasstheiten der verschiedenen Köcherfliegenlarven aus Abb. 1 an das Leben im Oberlauf eines Flusses.
Gemeinsamkeiten: Köcherfliegenlarven erzeugen Spinnfäden. Am Ende ihrer Larvenzeit bauen sie schützende Köcher, die ihnen
als Wohnröhre dienen und in der die Umwandlung der Larve zur Puppe erfolgt.
Unterschiede: Die Larven der verschiedenen Arten halten sich in Flussbereichen mit unterschiedlich starker Strömung auf. Die
Materialien für die Köcher aus der unmittelbaren Umgebung halten der jeweiligen Strömung stand. Zusätzlich sind die Köcher gut
getarnt, da Köchermaterial und Untergrund gleich aussehen. Entsprechend der Strömung sind die Köcher unterschiedlich geformt.
$ 2 Erläutere anhand von Abb. 2 die Angepasstheiten der Steinfliegenlarve an stark strömendes Wasser.
Die abgebildete Steinfliegenlarve läuft auf Schotter, über den das Wasser strömt. Sie kann sich in Bereichen mit schwacher Strö-
mung aufhalten. Im Wasserstrom kann sie sich durch ihre Körperhaltung der Strömung anpassen. Bei geringer Strömungsstärke
richtet sie ihren stromlinienförmigen Körper auf, bei mittlerer Strömung duckt sich an den Untergrund, bei starker Strömung
presst sie sich flach an den Stein. Sie reagiert auf unterschiedlich starke Strömung durch Verhaltensänderungen.

Extra: Der Atlantische Lachs – ein Wanderfisch (Seite 201)


1 Beschreibe den Lebenszyklus des Atlantischen Lachses.
Lachse schlüpfen im Oberlauf eines Flusses aus den Eiern. Die kleinen Lachse ernähren sich auf dem kiesigen Untergrund dieses
Baches zunächst vom Biofilm. Das sind Algen und Bakterien, die auf Steinen wachsen. Sie entwickeln sich zu grünen Tieren mit
Streifen von der Rücken- zur Bauchseite.
Als silbrige Junglachse wandern sie nach 2 bis 3 Jahren flussabwärts bis in den Atlantischen Ozean. Dort ziehen sie einige Jahre
umher und wachsen bis zu einer Länge von bis zu einem Meter heran. Zum Laichen kehren sie in ihr Heimatgewässer zurück
(Laichaufstieg). Dort legen die Weibchen Eier ab, die von den Männchen besamt werden. Der Zyklus beginnt von Neuem.
2 Erläutere die Gefährdungen für den Lachs in den Bereichen A, B und C in Abb. 3.
A) Die Jungtiere können Beute von Fleischfressern werden. Giftstoffe aus Abwässern von Haushalten und Industrie können zu
Wachstums- und Entwicklungsstörungen führen. Verletzungen an Turbinen von Wasserkraftwerken sind möglich.
B) Intensiver Fischfang kann die Anzahl der Lachse stark verringern. Außerdem können die Lachse Beute großer Raubfische wer-
den.
C) Erhöhte Strömungsgeschwindigkeiten durch Kanalisierung der Flüsse erfordern einen höheren Energieaufwand beim Aufstieg
in den Oberlauf des Heimatflusses. Ruhezonen, z. B. Seitenarme, wurden beseitigt. Querbauten wie z. B. Staustufen erschweren
oder unterbinden die Wandermöglichkeit in das Laichgebiet.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Stoffe und Energie durchlaufen das Fließgewässer (Seite 202/203)
$ 1 Ein großer Teil der Biomasse eines Flusses wird von Destruenten nicht dort abgebaut, wo sie produziert wurde. Erläutere die
Gründe.
Es gibt im Oberlauf und Mittellauf Produzenten und Konsumenten benachbarter Ökosysteme (Wald, Wiese o. ä.) die nährstoffhal-
tige, zerfallende Teile von Lebewesen in den Stoffhaushalt einspeisen. Durch die ständige Bewegung des Wassers flussabwärts
erfolgt der Abbau unterhalb des Entstehungs- oder Eintragungsorts.
$ 2 Fertige eine Skizze eines Flussverlaufs an und trage für die verschiedenen Zonen durch beschriftete Pfeile den Stoffaustausch
mit der Umgebung des Flusses ein. Erstelle so eine Stoffbilanz.
In allen Flussabschnitten findet der Eintrag von Biomasse in den Fluss statt. Insbesondere im Mittellauf erzeugen Algen und
andere Pflanzen Biomasse. Die Biomasse wird im fließenden Wasser zu großen Teilen von Destruenten abgebaut. Dadurch steigt
der Mineralstoffgehalt im Wasser von der Quelle bis zur Mündung.
. 3 Die Lachswanderung stellt eine Angepasstheit an die unterschiedlichen Umweltansprüche der frisch geschlüpften und der
heranwachsenden Lachse dar. Erkläre.
Die frisch geschlüpften Lachse benötigen für ihre Entwicklung ein flaches, schnell fließendes, sauerstoffhaltiges, kaltes nährstoff-
reiches Gewässer, z. B. einen Gebirgsbach. Durch ihre Körperfärbung sind sie im Heimatgewässer als Junglachse gut getarnt. Mit
zunehmender Größe steigt ihr Nahrungsbedarf. Statt Insektenlarven fressen sie Fische und andere Meeresbewohner. Das große
Nahrungsangebot ermöglicht das Anlegen von Nährstoffreserven für den Aufstieg in das Laichgewässer. Durch die Lachswande-
rung und Eiablage im Oberlauf des Heimatflusses haben die Junglachse wiederum gute Startbedingungen.

Material: Reinhaltung von Fließgewässern (Seite 204/205)


$ 1 Die Rechercheaufgaben (a–d) können in arbeitsteiliger Gruppenarbeit durchgeführt werden. Die Gruppen können sich im
Plenum gegenseitig über die erzielten Ergebnisse informieren: Themen für die Gruppenarbeit sind:
a) mechanische Reinigung in einer Kläranlage,
b) Funktionsweise der biologischen Klärung in einer Kläranlage,
c) Fällungsmitteleinsatz in einer Kläranlage,
d) Entstehung und Verwendung von Klärschlamm.
Grundlagen, die erläutert werde können:
a) Entfernung grober Verschmutzungen mit einem Rechen, Entfernung von Sand und Kies im Sandfang, Absetzen feiner Schmutz-
stoffe im Vorklärbecken;
b) Bakterien und einzellige Tiere nutzen im Schmutzwasser enthaltene Nährstoffe, hoher Bedarf an Sauerstoff, Absetzen der
Mikroorganismen als Belebtschlamm;
c) Zusatz von Chemikalien, Abbinden z. B. von Phosphat;
d) Klärschlamm als Stoffgemisch, Sedimentation, belastet z. B. mit Rückständen von Schwermetallen, Medikamenten oder Hor-
monen, Erzeugen von Methan und dessen energetische Nutzung.
0 2 Vergleiche die Messergebnisse für Sauerstoff und Bakterien und erläutere den Zusammenhang.
Nach der Abwassereinleitung steigt die Anzahl der Bakterien stark an, die Konzentration des Sauerstoffs sinkt. Die Bakterien
bauen organische Substanz aus dem Abwasser ab und benötigen dazu Sauerstoff. Im weiteren Verlauf sinkt das Nahrungsange-
bot für die Bakterien und damit ihr Sauerstoffbedarf. Der Sauerstoffgehalt steigt weiter an (durch das vermehrte Algenwachs-
tum).
$ 3 Gib die Ursachen für den Verlauf der übrigen Kurven an.
Schlammröhrenwürmer: Der Gehalt steigt etwas verzögert nach dem Abwassereinleitungsbereich, das Bakterienwachstum führt
zu mehr Nahrungsangebot und damit zu einer starken Vermehrung. Mit der Abnahme der zur Verfügung stehenden Nahrung
sinkt auch ihr Gehalt, im sauberen Wasser sind nur wenige vorhanden.
Tote Biomasse: Sie wird von den Destruenten (überwiegend Bakterien) abgebaut, der Gehalt an toter Biomasse sinkt kontinuier-
lich.
Algen: Der Gehalt an Algen sinkt nach der Einleitungsstelle in Strömungsrichtung langsam aufgrund des Lichtmangels infolge
der Wassertrübung. Nach der niedrigsten Konzentration steigt der Gehalt an Algen kontinuierlich an. Durch den Stoffabbau durch
Destruenten verringert sich die Trübung und frei gesetzte Mineralstoffe fördern die Vermehrung der Algen.
Reinwassertiere: Der Bestand ist vor der Einleitungsstelle hoch, nimmt jedoch nach der Einleitung aufgrund des Sauerstoffman-
gels stark ab. Die Erhöhung des Sauerstoffgehalts zieht eine Zunahme der Reinwassertiere nach sich.
$ 4 Informiere dich über die abgebildeten Zeigerarten. Stelle Zusammenhänge zwischen ihrer Lebensweise und ihrem Vorkom-
men (Gewässergüte) her.
Die Steinfliegenlarve benötigt sauerstoffhaltige, kühle, saubere, Fließgewässer mit steinigem Untergrund, frisst Biofilm (Algen
und Bakterien, die auf Steinen wachsen) und Detritus (nährstoffhaltige, zerfallende Teile von Lebewesen) (Gewässergüte I).
Die Wasserassel ernährt sich von Detritus, lebt in langsam fließenden Gewässern, die die Ablagerung abgestorbener Pflanzentei-
le, z. B. Falllaub, erlauben. Sie ist sehr widerstandsfähig gegenüber trübem Wasser, überlebt geringe Konzentrationen an Sauer-
stoff, ohne Schaden zu nehmen (Gewässergüte IV).
Der „Abwasserpilz“ (umgangssprachliche Bezeichnung) ist eine überwiegend fadenförmige Lebensgemeinschaft aus Bakterien.
Sie entwickelt sich in verschmutzten Gewässern. Sie ernährt sich im Abwasser enthaltenen Nährstoffen (Gewässergüte III).
Schlammröhrenwürmer haben ausreichend Nährstoffe im Abwasser. Mit der Abnahme der zur Verfügung stehenden Nährstoffe
sinkt auch ihr Gehalt, im sauberen Wasser sind nur wenige vorhanden (Gewässergüte V).

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 5 Nimm Stellung zu der folgenden Aussage zur Bedeutung von Zeigerarten: Zeigerarten geben zuverlässiger Auskunft über die
Wasserqualität als die Messung des Sauerstoff- und Mineralstoffgehalts.
Zeigerarten geben Orientierung bei der Bestimmung der Gewässergüte. Leichte oder vor einer relativ kurzen Zeit eingetretene
Veränderungen der Wasserqualität können sie nicht sofort anzeigen. Hier sind Messgeräte zuverlässig. Sie geben die zum Zeit-
punkt der Messung vorhandenen Konzentrationen an. Zeigerorganismen erlauben die Beurteilung der Wasserqualität in größeren
Zeiträumen.

Teste dich selbst (Seite 207)


0 1 Beschreibe den Zusammenhang von Struktur und Funktion an einem Organ der Teichrose.
Schwimmblatt: Der lange Blattstiel ist von Luftkanälen durchzogen. Dadurch kann ein Gasaustausch zwischen Blatt, Erdspross
und Wurzel stattfinden. Spaltöffnungen auf der Blattoberseite ermöglichen den Gasaustausch mit der Atmosphäre. Viele luftge-
füllte Hohlräume lassen das Blatt auf dem Wasser schwimmen.
Wurzel: Die Wurzeln der Teichrose verankern den Erdspross und damit die ganze Pflanze im Untergrund. Sie können Mineralstoffe
aus dem Boden aufnehmen, die zu den Blättern gelangen können.
$ 2 Beschreibe und erkläre den in Abb. 2 dargestellten Kurvenverlauf.
Die Kurve steigt im Frühjahr gleichmäßig an, bleibt dann in Sommer und Herbst leicht abfallend auf hohem Niveau und fällt im
Winter deutlich ab. Von Mai bis September lagert die Teichrose nach und nach Stärke als Reservestoff im Erdspross ein. Sie wurde
aus Glucose gebildet, einem Produkt der Fotosynthese. Durch Zellatmung wird aus der Stärke freigesetzte Glucose abgebaut. Im
Winter findet keine Fotosynthese, aber immer noch Zellatmung statt. Dadurch sinkt der Stärkegehalt im Erdspross. Im Frühjahr
wird Stärke in Baustoffe für den Austrieb der Blätter umgewandelt. Der Stärkegehalt im Erdspross nimmt stark ab.
$ 3 Vergleiche Ober- und Unterlauf eines Flusses mit dem Mittellauf. Verwende dazu Abb. 3.
Allen Flussabschnitten ist gemeinsam, dass Wasser in einem Flussbett fließt. Unterschiedlich sind die Fließgeschwindigkeiten des
Wassers. Im Oberlauf fließt es schnell und reißt Geröll oder Sand mit. Der Fluss spült tiefe Täler aus. Im Bereich des Mittellaufs
ist die Landschaft flacher. Die Fließgeschwindigkeit des Wassers nimmt ab. Der Fluss lagert Geröll und Sand ab. Es können Inseln
oder Kiesbänke entstehen. Im Unterlauf ist die Fließgeschwindigkeit des Wassers am geringsten. Dadurch nehmen die Ablagerun-
gen zu. Es bilden sich verzweigte Mündungsbereiche.
$ 4 Erläutere das Vorkommen verschiedener Lebewesen in den drei Regionen eines Flusses unter Einbeziehung von Abb. 4.
Im Oberlauf kommen wenig Wasserpflanzen vor, da die Strömung sehr stark ist. Im Mittellauf kommen viele Grünalgen vor. Der
Mineralstoffgehalt ist hoch genug, das Wasser ist hinreichend klar, sodass die Algen Fotosynthese betreiben können. Im Unterlauf
ist das Wasser mineralstoffhaltig, aber durch Schwebstoffe meist trüb, sodass weniger Licht in das Wasser dringt. Es kommen im
Wasser wenig Pflanzen vor.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
7 Mensch und Umwelt
7. 1 Weg zur modernen Gesellschaft

Entwicklung der Landwirtschaft (Seite 210/211)


0 1 Erläutere die Zunahme der Artenvielfalt in Mitteleuropa bei der Besiedlung durch die früheren Ackerbauern.
Die frühen Ackerbauern brachten im Saatgut Wildkräuter mit, die sich auf den neu angelegten Feldern ausbreiteten. Außerdem
ergaben sich durch Äcker neue Pflanzenstandorte. Dadurch stieg insgesamt die Anzahl der Pflanzenarten.
$ 2 Erstelle aus den Daten von Abb. 2 ein geeignetes Diagramm.
siehe Abbildung

90
80
70
Hektarertrag (100kg)

60
50
40
30
20
10
0
1750 1800 1850 1900 1950 2000 2050

. 3 Interpretiere das Diagramm aus Aufgabe 2.


Die Verbesserung von Zucht und Anbautechnik erhöhten den Ertrag von Winterweizen seit 1800. Zunächst erfolgt der Ertragsan-
stieg nur langsam. Ab 1950 ist eine starke Zunahme der Hektarerträge zu verzeichnen. Das ist auf die Technisierung (Traktor statt
Pferdegespann), Mineraldüngung und Pflanzenschutzmittel in Kombination mit neuen ertragreichen Sorten zurückzuführen.

Folgen der industriellen Landwirtschaft (Seite 212/213)


0 1 Stelle die Messwerte aus der Tabelle (Abb. 3) in einer geeigneten Grafik dar.
siehe Abbildung (Hinweis: Die Erträge ohne Bienen könnten auch in einer zweiten y-Achse dargestellt werden, sofern die Lern-
gruppe damit vertraut ist. Dann wird die Interpretation jedoch unübersichtlicher.)

12 000 ohne Bienen mit Bienen


10 000
Ernteertrag (kg/ha)

8 000

6 000

4 000

2 000

0
Kirsche Mirabelle Zwetschge

$ 2 Interpretiere die Grafik aus Aufgabe 1.


Bienen sichern gerade im Obstbau die Erträge. Ohne Bienen wären Kirschen, Äpfel und Mirabellen unerschwinglich teuer. Der
Einsatz von bienenschädigenden Pflanzenschutzmitteln gefährdet also die Ertragsstabilität von Obstbauern.
$ 3 Bewerte die Maßnahmen zur Produktionssteigerung in der Landwirtschaft: Düngung, Pflanzenschutz und Massentierhaltung.
individuelle Lösung: Bei der Bewertung sollten Sachaussagen und Wertaussagen enthalten sein sowie eine Schlussfolgerung.
Außerdem wäre hier ein Perspektivwechsel sinnvoll.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Material: Nahrungsmittel aus aller Welt (Seite 214)
0 1 Ein Containerschiff fährt in einer Woche etwa 3000 km. Schätze aus den Daten in Abb. 2 grob ab, wie lange jeweils die Reise
der Bananen nach Deutschland dauert.
Die Kilometerzahl wird mal 7 genommen und durch 3000 geteilt, dann erhält man die ungefähre Anzahl der Tage, die das Schiff
unterwegs ist. Beispiel Costa Rica: 9650 x 7 / 3000; also gut 22 Tage.
$ 2 Erstelle eine Grafik zur Herkunft der in der EU verzehrten Bananen anhand von Abb. 2.
siehe Abbildung

Kamerun
Honduras 5
5 Costa Rica
19
Panama 12

18 21
Kolumbien Ecuador
2
Guatemala

$ 3 Natürlicherweise werden Bananen nach der Ernte nach ca. einer Woche reif. Begründe die Behandlung der Bananen.
Ohne die Behandlung würden die Bananen vorzeitig reif und bevor sie beim Verbraucher einträfen verdorben. Durch Kohlenstoff-
dioxid wird der Reifungsprozess unterbrochen, durch Ethin wird er nach der Ankunft wieder angeregt.
$ 4 Beschreibe und erläutere das Diagramm.
Das Diagramm zeigt die Kohlenstoffdioxidbilanz von Tomaten bei verschiedenen Anbau- und Transportverfahren. Es ist die Masse
des freigesetzten Kohlenstoffdioxids in g pro kg Tomaten aufgeführt. Mit über 9 kg freigesetztem Kohlenstoffdioxid pro kg sind
Tomaten, die im beheizten Gewächshaus gezogen werden, besonders kohlenstoffdioxidintensiv. Am besten schneiden ökologisch
erzeugte Tomaten aus regionaler Produktion ab.
. 5 Leite aus den Daten eine Empfehlung für einen klimafreundlichen Tomateneinkauf ab.
Regional erzeugte Produkte haben durch die verringerten Transportwege eine wesentlich günstigere Kohlenstoffdioxidbilanz, sie
sollten bevorzugt eingekauft werden. Im Winter erzeugte Tomaten verursachen einen hohen Kohlenstoffdioxidausstoß durch die
Beheizung von Gewächshäusern. Sie sind daher zu meiden. Als Empfehlung ergibt sich: Günstig sind saisonale Produkte aus der
Region.
$ 6 Erläutere, welche Auswirkung menschliche Ernährungsgewohnheiten auf das Klima haben.
Bei der Produktion von Rindfleisch wird neben Kohlenstoffdioxid auch Methan als besonders klimaschädliches Gas erzeugt. Damit
trägt Rindfleischkonsum zu einem erhöhten Ausstoß von Methan bei. Die Klimaauswirkung ist selbst bei heimischem Rindfleisch
höher als bei dem Verzehr von Hühnerfleisch, dessen Klimaeffekt etwa nur 1/3 des Rindfleischs betragen.

Praktikum: Wo kommt man Essen her? (Seite 215)


1 Beim Einkauf regionale Produkte bevorzugen: Gib für jede Zutat an, woher sie stammt. Schätze die Transportkilometer ab
und berechne aus allen Zutaten den mittleren Transportweg. Gewinner in der Klasse ist, wer den geringsten Transportweg
erreicht.
individuelle Lösung
2 Die Auflage dieser Pizza kann beliebig variiert werden. Dabei können auch ungewöhnliche Kombinationen sehr gut schme-
cken. Finde deine Lieblingsauflage heraus. Bedingung: Sie soll regional erzeugt worden sein.
individuelle Lösung
3 Erstelle eine Liste von zwanzig verschiedenen Obst- oder Gemüseerzeugnissen mit Herkunft und Preis.
individuelle Lösung
4 Gib für jedes Erzeugnis auf der Liste an, ob es im Supermarkt auch eine Alternative aus regionalem Anbau gibt. Begründe, wie
deine Kaufentscheidung ausfallen würde.
individuelle Lösung
5 Überprüfe, welchen Transportweg dein favorisiertes Wasser hinter sich hat. Beurteile, ob sich der Transportweg lohnt.
individuelle Lösung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Die Rolle der Landwirtschaft in der Industriegesellschaft (Seite 216/217)
0 1 Beschreibe die in Abb. 2 dargestellten Daten.
Das Diagramm zeigt die durchschnittliche Betriebsgröße und die Anzahl der betrieblichen Arbeitskräfte im Zeitraum von 1960 bis
2010 in Deutschland. Während im Jahr 1960 auf relativ kleinen Betrieben verhältnismäßig viele Menschen Arbeit fanden, war 2010
der Betrieb, auf dem etwa die gleiche Anzahl von Menschen arbeitete, fünfmal so groß.
$ 2 Erläutere die in Abb. 2 dargestellten Daten.
Durch die Industrialisierung in der Landwirtschaft wird der Hektarertrag und damit die Produktivität erhöht. Gleichzeitig wird die
Produktivität pro Arbeitskraft deutlich erhöht. Durch die heutigen Produktionsmethoden lassen sich kostengünstig große Mengen
an landwirtschaftlichen Produkten erzeugen. Das führt aber auch dazu, dass weniger Menschen von der Landwirtschaft leben
können.
. 3 Brot, das aus traditionell erzeugtem Getreide hergestellt wurde, kostet etwa 30 % mehr als solches aus konventionell erzeug-
tem. Würdest du es kaufen? Begründe deine Entscheidung.
individuelle Lösung
. 4 Erläutere den Zusammenhang zwischen der Technisierung der Landwirtschaft und der Massentierhaltung (Abb. 1).
Durch den Einsatz von technischen Hilfsmitteln wie Melkmaschinen oder sogar Melkrobotern können sehr viele Tiere in einem
Betrieb gehalten werden. Die Anzahl der verfügbaren Arbeitskräfte bestimmt nicht so sehr die Größe des Tierbestands wie der
Grad der Technisierung.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
7. 2 Globale Zusammenhänge

Ursachen und Folgen der Klimaveränderung (Seite 218/219)


0 1 Stelle eine Mind-Map zum Treibhauseffekt und der globalen Erwärmung auf. Stelle dabei farblich die Unterschiede zwischen
dem natürlichen und dem vom Menschen verursachten Treibhauseffekt dar.
siehe Abbildung

bedeutsamste bedeutsamste Kohlenstoffdioxid


Wasserdampf Treibhaus- Treibhausgase
gase Methan
Kohlenstoff-
dioxid natürlicher

Treibhaus-
effekt
antropogen-
14 °C Folgen verstärkter Klimaveränderung
Atmossphären- Gletscherschmelze
temperatur Folgen
Anstieg der Meeresspiegel
Artensterben

$ 2 Bereite mithilfe der Mind-Map einen Kurzvortrag zum natürlichen Treibhauseffekt und zur globalen Erwärmung vor.
individuelle Lösung

Nachhaltige Entwicklung (Seite 220)


$ 1 Wie kannst du lokal handeln? Beschreibe anhand von zwei Beispielen, wie du dein Handeln nachhaltig gestalten kannst.
individuelle Lösung

Material: Nachhaltige Entwicklung (Seite 221)


0 1 Beschreibe kurz, aber umfassend das Diagramm zum Bevölkerungswachstum (Abb. 1).
Im Diagramm zum Wachstum der Weltbevölkerung ist zum einen die Weltbevölkerung (linke Skala) in Abhängigkeit der Zeit, zum
anderen der durchschnittliche jährliche Zuwachs der Weltbevölkerung (gemessen in zehn Jahren, rechte Skala) in Abhängigkeit
der Zeit dargestellt. Als Zeitraum sind die Jahre 1700 bis 2050 angegeben.
Die Weltbevölkerung steigt von unter einer Milliarde Menschen 1700 auf ca. 2,5 Milliarden Menschen 1950 langsam an. Nach 1950
steigt die Weltbevölkerung steil (exponentiell) auf rund 7 Milliarden Menschen 2011 an. In der Prognose nimmt der Anstieg ab
2025 (8 Milliarden Menschen) langsam wieder ab. Im Jahr 2050 wird eine Weltbevölkerung von rund 9,14 Milliarden Menschen
angenommen.
Der jährliche Zuwachs der Weltbevölkerung in zehn Jahren steigt von 1700 bis 1950 langsam an, 1930 bis 1950 liegt er knapp über
20 Millionen. Bis 1990 steigt der Zuwachs stark bis auf rund 80 Millionen Menschen pro Jahr an und sinkt ab 2000 langsam wie-
der. Bis 2050 ist ein starker Rückgang des jährlichen Zuwachses bis auf rund 35 Millionen pro Jahr vorhergesagt.
$ 2 Erläutere die vermutete Abnahme des Bevölkerungswachstums (Abb. 1).
Die vermutete Abnahme des Bevölkerungswachstums basiert auf dem vermuteten geringeren jährlichen Zuwachs der Weltbevöl-
kerung. Die Weltbevölkerung scheint sich nach der Grafik nach einer langen Phase starken Wachstums auf einer Zahl von über
9 Milliarden Menschen zu stabilisieren, indem der jährliche Zuwachs abnimmt.
$ 3 Erkläre die unterschiedlichen Erträge an Getreide, die in Asien und Nordamerika produziert wurden.
Der Flächenertrag für Getreide ist 2012 in Nordamerika mit 547 t/ha am größten, in Asien beträgt er 385,1 t/ha. Gleichzeitig ist
die Getreideproduktion in Asien mit rund 1500 Millionen Tonnen größer als in Nordamerika knapp unter 500 Millionen Tonnen. In
Nordamerika ist die Produktion von Getreide stark industrialisiert. Mit optimaler Düngung, Bewässerung, Unkraut- und Insekten-
bekämpfung sowie technischen Säh- und Erntehilfen kann mehr Getreide auf gleicher Fläche gewonnen werden als in Asien. Die
größere Getreideproduktion in Asien rührt daher von einer größeren Anbaufläche als in Nordamerika.
. 4 Sollten Entwicklungsländer ihre Landwirtschaft industrialisieren oder eine moderne Landwirtschaft mit vielfältigen Pflanzen-
und Tierarten anstreben? Diskutiert miteinander.
Durch stärkere Industrialisierung der Landwirtschaft kann mehr Getreide pro Fläche produziert werden, es können mehr Men-
schen davon ernährt werden. Durch eine Landwirtschaft mit vielfältigen Pflanzen- und Tierarten können die Bedürfnisse der
jeweiligen Bevölkerung individueller befriedigt werden, zugleich werden die natürlichen Landschaften dabei stärker geschützt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Das Energieproblem (Seite 222/223)
0 1 Berechne die prozentualen Anteile der Stromproduktion in Deutschland 2011 (Abb. 3) und stelle sie in einem geeigneten
Diagramm dar. Gib an, wievielfach größer der Anteil fossiler Brennstoffe im Vergleich zur alternativen Stromproduktion ist.
fossile Brennstoffe: 58 %, Atomkraftwerke: 17,6 %, Windkraft: 8 %, Wasserkraft: 3 %, Biomasse: 6 %, Solarzellen: 3,2 %, andere
Energieträger: 4,2 %
geeignetes Diagramm: Kreisdiagramm (auch Säulendiagramm möglich)
Der Anteil der fossilen Energieträger an der Gesamtstromproduktion ist rund 3,2-mal größer als der Anteil alternativer Strompro-
duktion (Windkraft, Wasserkraft, Biomasse, Solarzellen).
$ 2 Berechne den prozentualen Anteil der Ackerfläche für Biobrennstoffe an der Gesamtackerfläche (Abb. 4) und den ungefähren
jährlichen Anstieg der Maisanbaufläche in Deutschland (Abb. 5).
Der prozentuale Anteil der Ackerfläche für Biobrennstoffe an der Gesamtackerfläche in Deutschland beträgt rund 16,5 %. Der
ungefähre jährliche Anstieg der Maisanbaufläche in Deutschland beträgt rund 94 900 ha/Jahr.
. 3 Diskutiere Vor- und Nachteile der genannten Alternativen zur Strom- und Brennstoffgewinnung. Verwende für die Diskussion
und zur Abschätzung der weiteren Entwicklung deine Ergebnisse aus den Aufgaben 1 und 2.
individuelle Lösung: Als Vorteile könnten genannt werden: Schutz des Klimas; Unabhängigkeit von fossilen Brennstoffen aus
anderen Ländern; nachhaltiger Umgang mit Ressourcen (weniger/ kein Verbrauch fossiler Brennstoffe).
Als Nachteile könnten genannt werden: Ökologisch nicht nachhaltig, wenn Biobrennstoffe durch industrielle Landwirtschaft
produziert werden; Zerstörung natürlicher Landschaften für Monokulturen; Verringerung der Artenvielfalt von Pflanzen und
Tieren; das Landschaftsbild verändert sich nachteilig durch Windkraftwerke; Flusslandschaften verändern sich nachteilig durch
Wasserkraftwerke; Wind- und Wasserkraftwerke beeinflussen das Zugverhalten von Wandervögeln bzw. wandernden Fischarten;
Nahrungsmittel werden teurer, da sie „verheizt“ werden.
Weitere Entwicklung: Die Fläche, die zur industriellen Produktion von Biokraftstoffen genutzt wird, wird vermutlich weiter zuneh-
men, ebenso der Anteil an alternativer Stromproduktion.

Müll und Recycling (Seite 224/225)


0 1 Einmal in das Meer gelangt, lässt sich Plastik und anderer Müll nicht effektiv beseitigen. Erkläre.
Das Plastik schwimmt im oberen Bereich des Meeres. Es verteilt sich im Meer auf eine sehr große Fläche und wird durch den
Wellenschlag stark zerkleinert. Es könnte nur noch mit sehr feinen Netzen aus dem Wasser gefischt werden, wobei riesige Gebiete
abgefahren werden müssten, und dies mehrfach.
$ 2 Fliegende Seevögel, wie der Albatros, sind durch gefressenen Müll doppelt gefährdet. Erkläre.
Zum einen füllt es die Mägen der Vögel, sodass sie weniger Nahrung aufnehmen und verdauen können. Es verbleibt oft lange im
Magen, sodass der Vogel unnötig schwerer wird und mehr Nahrung zum Fliegen benötigt.
$ 3 Berechne die Mengen und den Gesamtwert der Metalle, die in den Handys in deutschen Schubladen liegen.
siehe Tabelle (Wert in Euro: 170 Millionen)

Metall Masse in kg insgesamt


Kupfer 743 750
Kobalt 328 850
Silber 21 250
Gold 204
Palladium 765
Tantal 340

$ 4 Erläutere Vorteile des Recyclings von Abfällen mithilfe deiner Ergebnisse von Aufgabe 1–3.
Durch Recycling gelangt weniger Müll bzw. weniger Kohlenstoffdioxid, giftige Abgase und giftige Verbrennungsrückstände in die
Umwelt, die mühsam oder gar nicht wieder entfernt werden können. Tiere und Pflanzen leiden weniger unter den Folgen. Recyc-
ling auch wirtschaftlich sinnvoll, da sich im Müll viele Wertstoffe befinden.

Nachwachsende Rohstoffe (Seite 226/227)


$ 1 Begründe die Vorteile der mehrfachen Verwendung von Holz anhand des Verlaufsschemas in Abb. 2.
Von besonderer Bedeutung ist die Folge von zunächst stofflicher Nutzung, nachfolgender chemischer Nutzung und letztlich
energetischer Nutzung von Holz. Somit wird ein nachhaltiger Umgang mit dem Rohstoff Holz bewirkt. Eine sofortige energetische
Nutzung von Holz schont Ressourcen weniger.
. 2 Erörtere, ob die Verbrennung von Holzpellets in Heizungen als kohlenstoffdioxidneutral bezeichnet werden kann.
Einerseits kann Holz beim Verbrennen nur die Menge an Kohlenstoffdioxid abgeben, wie der einzelne Baum bei der Bildung
von Holz eingebaut hatte. Andererseits werden beim Ernten von Holz, das für die Verbrennung vorgesehen ist, schwere Maschi-
nen eingesetzt. Dadurch kann die Struktur des Waldbodens geschädigt werden. Außerdem wird dem Boden das zur Verrottung
geeignete Material, z. B. Wurzeln, für die Remineralisierung entzogen. Eine Schädigung des Waldbodens bedeutet, dass der Baum-
wuchs sich verlangsamt und somit die Speicherfähigkeit des Waldes für Kohlenstoffdioxid abnimmt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Material: Der ökologische Fußabdruck (Seite 228/229)
0 1 Gib für 5 Regionen an, ob sie a) zu sehr, b) angemessen und c) kaum zum globalen ökologischen Fußabdruck der Menschheit
beitragen (Abb. 1).
individuelle Lösung: Alle Länder/ Regionen von 10,7 bis 2,5 ha/ Person tragen zu sehr, alle Länder/ Regionen mit 1,8–2,5 ha/ Person
angemessen und alle Länder unter 1,8 ha/ Person kaum zum globalen ökologischen Fußabdruck der Menschheit bei.
$ 2 Erläutere mögliche Gründe für den unterschiedlich großen Fußabdruck verschiedener Regionen.
individuelle Lösung; mögliche Gründe: starke Bebauung (Siedlungsfläche), viel Landwirtschaft (Acker- und Weidefläche), viel
Fischfang (Wasserfläche), starke Holznutzung (Waldfläche), hohe Industrialisierung mit hohem Verbrauch fossiler Brennstoffe
(Energiefläche)
. 3 Erläutere, warum ein hoher Fleischkonsum den ökologischen Fußabdruck stärker vergrößert als eine vegetarische Ernährung.
Nur ein Zehntel der Biomasse, die ein Tier aufnimmt, wird in eigene Biomasse umgesetzt. Für 1 kg Fleisch müssen rund 10 kg Ge-
treide verfüttert werden. Zwar weiden viele Tiere wie z. B. Rinder, dennoch wird meist viel Getreide zugefüttert, sodass für Fleisch
Weide- und Ackerfläche benötigt wird.
$ 4 Berechne deinen persönlichen ökologischen Fußabdruck mithilfe eines Footprintrechners im Internet. Für einige Angaben
wirst du Informationen deiner Eltern benötigen.
individuelle Lösung
$ 5 Berechne die Anzahl von Fußballfeldern, die dein ökologischer Fußabdruck ausfüllt. Ein Fußballfeld hat etwa die Größe von
0,73 Hektar.
individuelle Lösung
. 6 Formuliere Tipps, wie du einen ökologischen Fußabdruck verringern kannst.
individuelle Lösung; Möglichkeiten: Energie sparen, vegetarische Ernährung, geringere Nutzung von Kraftfahrzeugen, weniger
Konsum
. 7 Erläutere die Bedeutung der Flächenkategorien für jeden der vier Bereiche des Lebens (Abb. 2).
Wohnen:
– Siedlungsfläche: Bebauung von Fläche für Häuser, Straßen etc.
– Waldfläche: Nutzung von Holz zum Bauen, für Möbel, etc.
– Energiefläche: Nutzung von Energie zum Heizen, Strom, etc.
Ernährung:
– Acker- und Weidefläche: Produktion von Nahrungsmitteln
– Wasserfläche: Fischfang
– Energiefläche: Nutzung von Energie für landwirtschaftliche Maschinen, Lebensmittelfabriken, Kühlung, Transport, etc.
Güter:
– Siedlungsfläche: Bebauung von Fläche für Fabriken, Straßen, Kraftwerke etc.
– Acker- und Weidefläche: Produktion von Rohstoffen wie Baumwolle, Leder, etc.
– Waldfläche: Produktion von Holz
– Energiefläche: Nutzung von Energie für Fabriken, Transport, etc.
$ 8 Erkläre die zeitlichen Unterschiede des Welterschöpfungstags für die verschiedenen Regionen (Abb. 3). Gehe dabei auch auf
die „Reserve“ ein.
Je größer der ökologische Fußabdruck einer Region ist, desto früher im Jahr ist der Zeitpunkt erreicht, an dem sie die Ressourcen,
die ihre Fläche in einem Jahr produzieren kann, verbraucht hat. Ist der ökologische Fußabdruck einer Region kleiner als der, der
den Menschen dort zur Verfügung steht, besitzen sie eine „Reserve“. Sie verbrauchen weniger Ressourcen im Jahr, als ihre Fläche
produzieren kann.
$ 9 Stelle für drei weitere Regionen (Abb. 1) Hypothesen auf, ob sie einen früheren, späteren oder gar keinen regionalen Erschöp-
fungstag haben, und begründe sie.
individuelle Lösung: Regionen mit einem ökologischen Fußabdruck von 10,7 bis 1,8 ha/ Person haben einen Erschöpfungstag. Je
größer der ökologische Fußabdruck ist, desto früher liegt er im Jahr. Regionen mit einem ökologischen Fußabdruck von unter
1,8 ha/ Person besitzen eine „Reserve“. (Hinweis: dies ist nur eine stark vereinfachte Betrachtung. Für eine genaue Betrachtung
müssen die Möglichkeiten der Regionen zur Bildung natürlicher Ressourcen mit in Betracht gezogen werden.)

Teste dich selbst (Seite 231)


0 1 Erstelle aus den Daten in Abb. 1 ein Diagramm und leite eine Aussage daraus ab.
Als Diagramm eignet sich ein Säulen­diagramm, in dem für jede Vogelart nebeneinander die Reviere in Maisfeldern bzw. Brachflä-
chen dargestellt werden. Alternativ eignet sich hier auch ein Balkendiagramm, in dem die Anzahl der Reviere der verschiedenen
Vogelarten auf der einen Seite in Maisfeldern, auf der anderen Seite in Brachflächen dargestellt werden. In Maisfeldern ist die
Anzahl der Reviere für die angegebenen Vogelarten kleiner. Hier brüten weniger Vögel.
$ 2 Stelle Hypothesen zur Ursache der unterschiedlichen Revierzahlen im Maisfeld und im Brachland auf.
Maisfelder haben eine geringe Biodiversität, d. h. eine geringe Anzahl an verschiedenen Pflanzen- und Tierarten, wenig unter-
schiedlich gestaltete Lebensräume und Ernährungsmöglichkeiten. Bei Brachflächen ist diese größer, sie bieten den Vogelarten
vielfältigere Möglichkeiten zur Ernährung und zum Brüten.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 3 Bewerte die Nachhaltigkeit von Biobrennstoff aus Monokulturanbau.
Je nach Einsatz von Maschinen sowie Dünge- und Pflanzenschutzmitteln für den Anbau der Pflanzen ist die Nachhaltigkeit von
Biobrennstoff unterschiedlich groß. Betrachtet man nur die Treibhaus­gase, wird die Nachhaltigkeit mit zunehmendem Einsatz
von Maschinen zum Anbau und Erhalt der Monokulturen kleiner, da diese selbst Brennstoffe benötigen. Ökologisch nachhaltig ist
diese Art der biologischen Brennstoffgewinnung nicht, da hierfür vielfältige Ökosysteme in wenig vielfältige Monokulturen umge-
wandelt werden, wodurch es zur Verringerung der Biodiversität und oft zur Gefährdung von Pflanzen- und Tier­arten kommt.
$ 4 Beschreibe Abb. 3 und formuliere eine Aussage dazu.
Das Diagramm in Abbildung 3 gibt die Zeitpunkte der Ankunft des Grauschnäppers auf Helgoland nach seinem Rückflug aus Afri-
ka wieder. Dargestellt sind die Daten der Ankünfte (y-Achse) während der Jahre 1960–2012 (x-Achse). Die Ankunftszeiten variieren
in den verschiedenen Jahren (orange Punkte).
Es ist jedoch ein Trend zu erkennen (graue Linie), nach dem der Grauschnäpper immer früher im Jahr auf Helgoland eintrifft. Nach
diesem Trend erreichte er Helgoland 2012 rund 11 Tage früher als 1960.
. 5 Erläutere eine mögliche Beziehung zwischen den Beobachtungen und dem Klimawandel.
Viele Zugvögel, wie z. B. der Grauschnäpper, beginnen ihren Rückflug aus den Überwinterungsgebieten, wenn im Frühjahr die Tem-
peratur entlang des Heimzugsweges einen bestimmten Wert übersteigt. Durch die Erwärmung des Weltklimas ist dies inzwischen
früher im Jahr der Fall, als noch 1960. Daher beginnen diese Zugvögel inzwischen früher mit dem Rückflug.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
8 Sinne, Nerven und Hormone
8. 1 Reiz, Erregung und Reaktion

Vom Reiz zur Reaktion (Seite 234/235)


0 1 Hinter dir ertönt ein ungewohntes Geräusch, du drehst dich unwillkürlich um. Beschreibe den hierbei ablaufenden Vorgang in
Form eines Verlaufsschemas
Ein Geräusch wirkt als Reiz, der in Sinneszellen des Ohrs eine Erregung auslöst. Die Erregung gelangt über Nervenzellen zum
Zentralnervensystem und wird dort auf mehrere abgehende Nervenzellen umgeschaltet. Diese führen z. B. zur Muskulatur des
Oberkörpers. Durch Zusammenziehen der entsprechenden Muskeln dreht sich der Körper in Richtung der Reizquelle.
$ 2 Sinnesorgane werden auch als „Fenster zur Welt“ bezeichnet. Erkläre diese Aussage mit Bezug zur Abb. 2.
Sinnesorgane haben Sinneszellen, in denen Umweltveränderungen registriert und in denen in der Informationssprache gespro-
chen ein körpereigenes Signal entsteht. In der Abbildung 2 stehen die Sinnesorgane an der Grenze zwischen Außenwelt und
Innenwelt. Sie nehmen Reize auf und erzeugen eine Erregung, sodass nach Weiterleitung der Erregung Muskelreaktionen erfolgen
können. Ohne die erwähnte Eigenschaft der Sinnesorgane könnten wir nicht auf Umweltveränderungen reagieren und würden
wie in einem geschlossenen Raum getrennt von unserer Umwelt verbleiben. Aus diesem Grund können Sinnesorgane als „Fenster
zur Umwelt“ bezeichnet werden.
. 3 Nach einem versehentlichen Stoß auf ein Auge siehst du kurzzeitig hell blitzende Flecken („Sternchen“). Dieser Stoß wird als
nicht adäquater Reiz bezeichnet. Erläutere
Die weißen Flecken deuten darauf hin, dass es im Zentralnervensystem zu der Verarbeitung einer Erregung gekommen ist, die von
den Lichtsinneszellen ausging. Die Lichtsinneszellen müssen also eine elektrische Erregung hervorgerufen haben. Dies geschah
aber nicht durch Licht, also einen adäquaten Reiz, sondern durch einen Reiz, für den Lichtsinneszellen nicht spezifisch sind.
. 4 Übertrage die Tabelle aus Abb. 3 in deine Unterlagen. Ergänze sie und erläutere die hinzugefügten Elemente.
siehe Tabelle
Modell Original
Hand Reiz
Lichtschalter Sinneszelle
Stromkabel Nervenzellen
elektrischer Strom Erregung
Lampe Organ, in dem eine Reaktion erfolgt, z. B. Muskel

Wie die Hand stellt der Reiz nur den Auslöser für die Reaktion dar. Im elektrischen Strom ist die Aktion der Hand nicht mehr vor-
handen. Das gleiche gilt für den Reiz, der nicht direkt weitergeleitet wird sondern stets die von ihm ausgelöste Erregung.

Reflexe (Seite 236/237)


0 1 Erstelle für den Kniesehnenreflex ein Verlaufsschema.
Schlag mit dem Hammer in die Vertiefung unterhalb der Kniesehne → Dehnung der Kniescheibe → Erregung in den Dehnungs-
sensoren → Erregung zum Rückenmark → Umschaltung auf die motorische Nervenzelle → Erregungsleitung → Aktivierung des
Oberschenkelstreckers → Vorschnellen des Unterschenkels
$ 2 Erläutere die Bedeutung der Hemmung des Oberschenkelbeugers beim Kniesehnenreflex.
Durch die Hemmung des Oberschenkelbeugers bleibt dieser entspannt. Nur so kann das Zusammenziehen des Oberschenkelstre-
ckers zum Vorschnellen des Unterbeines führen, da bei Aktivität beider gegensinniger Muskeln keine Aktion möglich wäre.
. 3 Erkläre, warum nicht der Schlag auf die Kniesehne, sondern die Dehnung des Oberschenkelstreckers der adäquate Reiz für
den Kniesehnenreflex ist.
Der unmittelbar zur Auslösung einer Erregung in den Dehnungssensoren führende Schritt ist die Dehnung, die ihrerseits mittelbar
durch den Schlag herbeigeführt wird.

Extra: Drogentest Pupillenreflex (Seite 237)


1 Wer nach längerer Zeit in der Dunkelheit ins helle Licht trifft, fühlt sich stark geblendet. Erläutere.
Durch die nach längerem Aufenthalt in der Dunkelheit geweitete Pupille trifft plötzlich viel Licht auf den Augenhintergrund. Die
Empfindung geblendet zu sein hält so lange an, bis sich die Pupille verengt hat und damit die Übererregung der Lichtsinneszellen
abgebaut ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Praktikum: Reflexe und Reaktionszeiten (Seite 238/239)
1 Beschreibe deine Beobachtung.
Sobald Person 2 eine Wimper berührt schließt Person 1 spontan das Auge.
2 Skizziere den Ablauf vom Reiz zur Reaktion für diesen Reflex.
Berührungsreiz trifft auf mechanosensorische Zelle im Augenlid → Auslösung einer Erregung in dieser Zelle → Leitung der
Erregung zum ZNS → Umschaltung auf motorische Nervenzelle → Leitung der Erregung zu Lidmuskulatur → Muskulatur wird zur
Kontraktion angeregt
3 Überprüfe, wie der Versuch ausfällt, wenn Person 1 und Person 2 die Rollen tauschen.
individuelle Lösung, Reaktion ähnlich
4 Beschreibe deine Beobachtung.
Bei Kontakt der nackten Fußsohle mit einem spitzen Stein, wird das Bein unwillkürlich vom Boden weg nach hinten gezogen.
5 Überprüfe, welcher der beiden großen Oberschenkelmuskeln sich bei der Reaktion zusammenzieht.
Da sich das Knie bei dieser Reaktion anwinkelt, handelt es sich um den Oberschenkelbeuger.
6 Bei Eigenreflexen sind die Orte der Erregung und der Reaktion gleich, z. B. beim Kniesehnenreflex. Erkläre, ob der Beugereflex
ein Eigenreflex ist oder nicht.
Der Beugereflex ist kein Eigenreflex, da der Ort der Erregungsauslösung (im Fuß) und der Ort der Muskelkontraktion (Oberschen-
kelbeuger) nicht gleich sind.
7 Viele Reflexe dienen dem Eigenschutz. Entwickle eine Hypothese zur Schutzfunktion des Beugereflexes.
Der Beugereflex stellt einen Schutz vor Verletzungen durch spitze Gegenstände dar. Noch bevor ein derartiger Gegenstand die
Haut verletzt wird der Fuß reflexartig angezogen.
8 Beschreibe deine Beobachtung.
Beim Entlangstreichen an der Fußsohle zieht sich der Fuß zusammen und bewegt sich spontan vom entlang streichenden Gegen-
stand weg.
9 Erkläre deine Beobachtung.
Ein Berührungsreiz trifft auf die mechanosensorische Zelle in der Fußsohle. Dadurch wird eine Erregung in dieser Zelle ausgelöst,
die zum ZNS geleitet wird. Sie wird umgeschaltet auf eine motorische Nervenzelle, dadurch Leitung der Erregung zur Fußmuskula-
tur. Die Muskulatur wird zur Kontraktion angeregt, sodass sich der Fuß von der Reizquelle weg bewegt.
10 Eine ähnliche Beobachtung kann bei Neugeborenen an der Hand gemacht werden: Beim Klammerreflex werden die Finger
des Kindes schnell um einen Gegenstand geschlossen, der die Innenseite der Handflächen berührt. Dieser Reflex existiert bei
größeren Kindern nicht mehr.
Entwickle eine Hypothese zur Funktion des Klammerreflexes bei Neugeborenen und dazu, dass er später nicht mehr existiert.
Bei Neugeborenen dient der Klammerreflex dem Schutz vor Stürzen. Das Kind kann sich einem Gegenstand festhalten und ver-
hindert so, dass es herunterfällt. Im späteren Alter wäre dieser Reflex sehr hinderlich für feine und kontrollierte Bewegungen der
Hand, etwa bei Zeichnen oder Schreiben. Der oben genannte Schutz ist hier auch nicht mehr notwendig.
11 Begründe, warum es sich nicht um einen Reflex handelt, der uns das Lineal ergreifen lässt.
Das Greifen des Lineals erfolgt erst nach einer absichtlichen Entscheidung. Es ist also durch unser Bewusstsein gesteuert und
damit kein Reflex.
12 Notiere die Strecke, die das Lineal beim ersten Mal fällt. Bestimme die Reaktionszeit mithilfe der Skala in Abb. 4.
individuelle Lösung
13 Person 1 versucht die Falllänge zu verkürzen.
individuelle Lösung
14 Erkläre den Erfolg oder Nicht-Erfolg von Aufgabe 13.
In gewissem Umfang lässt sich die Reaktionszeit herabsetzen. Das ist eine Folge des nun genaueren Antizipierens der Handlun-
gen desjenigen, der das Lineal fallen lässt.
15 Vergleiche die kürzeste Reaktionszeit aus Aufgabe 13 mit dem Kniesehnenreflex, für den eine Reaktionszeit von 0,1 s angege-
ben wird. Erkläre.
Die Reaktionsgeschwindigkeit ist viel größer als bei der absichtlichen Handlung. Selbst mit Übung beträgt das Verhältnis der Ge-
schwindigkeiten etwa 3 : 1. Bei der bewussten Handlung erfolgt die Muskelaktion erst nach mehreren Nervenzell-Umschaltungen,
beim Reflex ist es im Extremfall nur eine einzige Umschaltung. Die Anzahl der Umschaltungen bestimmt die Geschwindigkeit der
Reaktion.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Bau und Funktion von Nervenzellen (Seite 240/241)
0 1 Beschreibe den Zusammenhang von Struktur und Funktion bei der Nervenzelle.
Die Verästelung der Dendriten dienen der Erregungsaufnahme, der lang gestreckte Bau dient der schnellen Weiterleitung. Mit der
Ausschüttung von Botenstoffen an den Endknöpfchen können nachfolgende Zellen, z. B. Nervenzellen, Drüsenzellen, Muskelzellen
aktiviert werden.
$ 2 Skizziere die Erregungsübertragung an der Synapse als Daumenkino.
Diese individuelle Lösung enthält folgende Stationen: Die Erregung erreicht die Endknöpfchen, daraufhin machen sich transmit-
tergefüllte Bläschen auf den Weg zum synaptischen Spalt, dort entleeren sie ihren Inhalt in den Spalt. DieTransmitter erreichen
die nachfolgende Zelle, dort entsteht eine Erregung.
$ 3 Bei der Krankheit „Multiple Sklerose“ verringert sich langsam die Isolation der Axone. Entwickle eine Hypothese, welche Aus-
wirkung das haben kann.
Da die Geschwindigkeit der Erregungsleitung an isolierten Axonen größer ist als an nicht isolierten, verändert die Abnahme der
Isolation bei Multiple Sklerose diese Geschwindigkeit. In der Folge können bei fortgeschrittener Multipler Sklerose die Muskelak­
tionen nicht in der gleichen Art ausgeführt werden wie bei Gesunden. So kann es z. B. zu Lähmungen der Extremitäten kommen.

Extra: Manche Nervenzellen sind Sinneszellen (Seite 241)


1 Schmerzsensoren haben Warnfunktion. Erläutere hierzu die Besonderheit bei der Entstehung der Erregungen.
Schmerzsensoren sind verästelt, d. h. sie haben eine geringere räumliche Auflösung als punktuelle Sinneszellen (z. B. Lichtsinnes-
zellen). Als Sinnesnervenzellen wird ihre Erregung direkt zum ZNS geleitet, ohne vorher auf eine weitere Nervenzelle umgeschaltet
zu werden. Damit sind diese Art von Schmerzsensoren besonders schnell. Schmerzsensoren reagieren auf unterschiedliche Reiz­
modalitäten (Chemikalien, Hitze, Druck), die aber alle dadurch gekennzeichnet sind, dass sie für den Körper bedrohliche Situatio-
nen anzeigen können. Schmerzsensoren haben damit vor allem Warnfunktion.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
8. 2 Sinne

Das Auge des Menschen (Seite 242/243)


0 1 Zeichne ein Kreuz und einen Kreis im Abstand von 10 cm auf ein weißes Blatt, halte das Blatt vor dein rechtes Auge und
schließe das linke. Fixiere das Kreuz und bewege das Blatt langsam auf dich zu. Nenne die Beobachtung und finde auf diesen
Seiten die passende Erklärung.
Beim Näherrücken verschwindet der Kreis nach rechts, fährt man fort, so erscheint er nach kurzer Zeit noch weiter rechts wieder.
$ 2 Erkläre, warum wir den „Blinden Fleck“ nicht bemerken, wenn wir mit beiden Augen schauen.
Der „Blinde Fleck“ ist die Stelle eines Auges, an der der Sehnerv die Netzhaut nach hinten verlässt. Hier kann das Bild des Objekts
keine Erregung der Lichtsinneszellen auslösen. Im anderen Auge fällt der gleiche Bildausschnitt des Objekts nicht auf den „Blin-
den Fleck“. Das zweite Auge gleicht also die punktuelle Blindheit des ersten Auges aus.
$ 3 Erstelle eine Tabelle der Bestandteile des Auges und ihrer Funktion.
siehe Tabelle
Struktur Funktion
optischer Apparat Erzeugung eines Netzhautbildes
Lederhaut Schutz
Hornhaut Lichtbrechung, Schutz
Augenmuskulatur horizontale und vertikale Bewegung des Augapfels
Nervenzellen Weiterleitung der Erregung zum Gehirn

Sehschärfe und räumliches Sehen (Seite 244/245)


0 1 Entwickle ein Verfahren zur Bestimmung des Nahpunkts und teste es.
Bei Versuchspersonen verschiedenen Alters, z. B. Mitschüler, Lehrer, Geschwister, Großeltern wird der Abstand zum Auge gemes-
sen, bei dem ein Gegenstand noch gerade scharf gesehen werden kann. Hierbei eigenen sich besonders normalsichtige Versuchs-
personen.
$ 2 Stelle die in Abb. 3 aufgelisteten Werte in einem geeigneten Diagramm dar.
siehe Abbildung

80
Nahpunkt (cm)

60

40

20

0
0 10 20 30 40 50 60 70 80
Alter (Jahre)
$ 3 Erkläre, warum ältere Menschen die Zeitung zum Lesen weit weg halten müssen.
Bei älteren Menschen ist der Mindestabstand, bei dem ein Gegenstand scharf gesehen werden kann, größer als bei jungen Men-
schen. Ältere Menschen lesen daher mit weitem Abstand die Zeitung.

Extra: Gegenspielerprinzip bei der Linsenkrümmung (Seite 245)


1 Bei manchen Menschen zieht sich der Ziliarmuskel ungleichmäßig zusammen, das führt zu einer ungleichmäßigen Linsen-
krümmung. Stelle eine Hypothese auf, wie sich diese Eigenschaft auf das Sehvermögen auswirken wird.
Durch die ungleichmäßige Linsenkrümmung werden nicht alle Bereiche eines Objektes scharf abgebildet. So werden mache Stel-
len eines Objekts verschwommen wahrgenommen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Sehsysteme (Seite 246)
. 1 Erläutere, wie Bewegungserkennung beim Komplexauge funktioniert.
Licht eines vorbeiziehenden beweglichen Gegenstands fällt auf unterschiedliche Einzelaugen des Komplexauges. Durch die licht-
undurchlässige Schicht zwischen den Einzelaugen kommt es also zum Nacheinander der Erregungen der Lichtsinneszellen. Das
kann das Nervensystem zu einem Bewegungsmuster verrechnen.

Farbensehen (Seite 247)


0 1 Erläutere, warum wir in der Dämmerung keine Farben erkennen.
Zapfen, die für das Farbensehen verantwortlich sind, reagieren erst bei höheren Lichtstärken als Stäbchen. Daher ist bei Dämme-
rung kein Farbensehen möglich, wohl aber das Sehen mit den lichtempfindlichen Stäbchen.
$ 2 „Das rote Tuch stellt einen besonderen Reiz für den Stier dar“ (Abb. 1). Nimm Stellung zu dieser Aussage.
Rinder verfügen über die zur Rotwahrnehmung notwendigen Zapfen nicht, daher ist dieser Satz nicht richtig. Vielmehr ist es die
Bewegung des Tuches, auf die der Stier reagiert.

Riechen und Schmecken (Seite 248)


$ 1 Wir können mehrere Tausend Gerüche unterscheiden, obwohl wir wesentlich weniger Typen von Geruchsstoffrezeptoren
haben. Erkläre.
Gerüche sind Kombinationen mehrerer Geruchstoffe. Auf unsere Riechsinneszellen wirken Geruchstoffe als Reiz, aus der Kombina-
tion von Art und Menge verschiedener Geruchstoffe ergibt sich ein für einen Geruch spezifisches Muster.

Material: Chemischer Sinn bei Tieren (Seite 249)


$ 1 Stelle die Daten der Tabelle in einem einzigen geeigneten Diagramm dar. Dabei sollen die Anzahl der Riechsinneszellen und
die Atemzüge pro Minute jeweils eine eigene Y-Achse erhalten.
siehe Abbildung
Atemfrequenz (Atemzüge/min)

300
Anzahl der Riechsinneszellen

200
(Millionen)

200

100
100

0 0
Mensch Deutscher Schäferhund

$ 2 Erkläre die Unterschiede in der Geruchsempfindlichkeit von Mensch und Hund unter Zuhilfenahme der Daten.
Der Deutsche Schäferhund hat viel mehr Riechsinneszellen als der Mensch, daher können mehr Geruchsstoffmoleküle pro Zeit
aus der Luft an den Rezeptoren haften bleiben. Das führt dazu, dass schon bei geringer Duftstoffkonzentration in der Luft viele
Riechsinneszellen erregt werden. Die erhöhte Anzahl der Atemzüge steigert diesen Effekt noch, da pro Zeit beim Deutschen
Schäferhund mehr mit Duftstoffmolekülen beladene Luft an den Flimmerhärchen vorbeiziehen als beim Menschen. Insbesondere
bei maximaler Atemzuganzahl ist die Riechsinnesleistung des Deutschen Schäferhundes viel größer. Auf der Basis dieser Zahlen
übertrifft die Hunde-Riechempfindlichkeit die des Menschen überschlagsmäßig um den Faktor 330 : 220 Mio. Riechsinneszellen/
5 Mio. x 300 max. Atemzüge/40 = 330 [Hinweis: Die Empfindlichkeit ist tatsächlich noch wesentlich größer (etwa Faktor 10 Mio.)].
. 3 Während der Arbeit verschließt ein Spürhund das Maul und atmet sehr schnell durch die Nase. Stelle eine Hypothese auf,
warum ein Spürhund diese Arbeit nur kurz durchhalten kann.
Atmung transportiert nicht nur Geruchstoffmoleküle sondern führt auch zur Wasserabgabe aus dem Blut in die Umgebungsluft.
Durch die schnelle Ein- und Ausatmung verliert der Hund sehr viel Wasser. Er kann diese Maximalatmung also nicht sehr lange
durchhalten und ist schließlich sehr erschöpft.
0 4 Beschreibe anhand von Abb. 2 den Geruchssinn der Honigbiene.
Die Antennen sind mit feinen Sinneshärchen ausgestattet. In ihrem Innern erfolgt die Anlagerung von Geruchsstoffmolekülen,
was zur Erregung dieser Sinneshärchen führt.
$ 5 Erläutere unter Bezug auf das Schlüssel-Schloss-Prinzip, wie es Honigbienen gelingt, den Geruch einer Apfelblüte von dem
einer anderen Blüte zu unterscheiden.
Auf den Dendriten der Sinneshärchen liegen Rezeptoren mit spezifischen molekularen Passformen. Die Rezeptoren führen bei
genau passenden Geruchsstoffmolekülen zur Erregung der Sinneshärchen. Dabei passen die Geruchsstoffe in die Rezeptoren wie
ein Schlüssel in ein Schloss. Wenn z. B. Geruchsstoffmoleküle des Apfelblütendufts an die passenden Rezeptoren binden, erfolgt
eine Erregung. Bei anderen Geruchsstoffmolekülen erfolgen an diesen Sinneshärchen keine Erregungen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Sinne des Ohres (Seite 250/251)
0 1 Fasse Strukturen und Funktionen von Außen-, Mittel- und Innenohr in einer Tabelle zusammen.
siehe Tabelle
Struktur Funktion
Gehörgang (Außenohr) Schallleitung als Luftdruckschwankung
Trommelfell (Grenze zwischen Außen- und Mittelohr) Schwingungsaufnahme
Gehörknöchelchen (Mittelohr) hebelartige Verstärkung der Schwingung, Übertragung auf ovales
Fenster
Hörschnecke (Innenohr) Schallleitung als Wasserdruckschwankung
Hörsinneszellen (Innenohr) Auslösung einer Erregung durch Verbiegung der Sinneshärchen

$ 2 Erstelle ein Verlaufsschema zum Vorgang, der es uns ermöglicht, einen Ton zu hören.
Luftdruckschwingungen pflanzen sich durch Ohrmuschel und Außenohr bis zum Trommelfell fort und versetzen es in Schwingung.
→ Schwingendes Trommelfell versetzt nach Übersetzung und Verstärkung durch Gehörknöchelchen ovales Fenster in Schwingung.
→ Schwingendes ovales Fenster löst Druckwelle der Hörschneckenflüsigkeit aus. Dadurch bewegung sich die Deckmembran. →
Deckmembran senkt sich ab und verbiegt dadurch Härchen von Sinneszellen. → Verbiegung der Härchen löst in den Hörsinnes-
zellen eine elektrische Erregung aus. → Schnelle Schwingungen führen zur Verbiegung der Härchen am Schneckeneingang. Wir
empfinden einen hohen Ton.
. 3 Nach einer Karussellfahrt wird plötzlich abgestoppt. Erkläre die Wahrnehmungen, die man dann hat.
Taumel durch Gleichgewichtsverlust. Erklärung: Beim Abstoppen bewegt sich die Bogengangsflüssigkeit noch weiter in der
Drehrichtung des Karussells. Die Härchen der Sinneszellen werden weiter ausgelenkt und vermitteln dadurch einen Eindruck des
Drehens. Dem abgestiegenen Karussellfahrer scheint es, als würde sich die Welt um ihn herum drehen.

Extra: Lautstärke und Hörschäden (Seite 251)


1 Erkläre, warum vor allem hohe Töne lärmbedingte Hörschäden hervorrufen.
Die Hörsinneszellen für hohe Töne sitzen am Eingang der Hörschnecke. Da laute Töne auf die Dauer diese Hörsinneszellen schädi-
gen, beziehen sich die Ausfälle vor allem auch auf hohe Töne.

Praktikum: Hörsinn und Tastsinn (Seite 252)


1 Formuliere zu dem Experiment eine Forschungsfrage.
Beispiel: Wird räumliches Hören erreicht, indem der Schall unsere beiden Ohren zeitversetzt erreicht?
2 Werte das Experiment mit Blick auf die Forschungsfrage aus.
(Abhängig von Forschungsfrage) Beispiel: Ja! Liegt die Schlagstelle minimal rechts oder links neben der Markierung, wird ein
zeitlich versetztes Eintreffen des Schalls und damit ein räumlicher Eindruck erzeugt.
3 Der Schall benötigt eine Sekunde für 34 000 cm (in Luft). Berechne aus dem minimalen Abstand von der Mitte, der rechts oder
links zugeordnet werden kann, die geringste Zeitdifferenz, die unser Gehirn zur Richtungswahrnehmung benötigt.
Individuelle Lösung, Beispielrechnung: Die allgemeine Formel für die Zeitdifferenz lautet: Δt = (2 x dcm)/(34 000 cm/s) Bei d = 1 cm
Abstand von der Mitte benötigt der Schall t = (2 x 1 cm)/(34 000 cm/s) = 0,00006 s oder 0,06 ms
4 Erstelle eine Beobachtungstabelle zum Versuch.
In der Tabelle werden die Daten etwa folgendermaßen angegeben:

Körperteil minimaler Abstand


Handrücken …
Unterarm …
… …

5 Deute das Versuchsergebnis im Hinblick auf die Forschungsfrage.


Die Anzahl der Tastsinneszellen pro Hautfläche ist sehr unterschiedlich. Beispielsweise befinden sich auf der Fingerbeere viele, auf
dem Handrücken oder Unterarm weniger Tastsinneszellen pro Fläche.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Material: Optische Täuschung (Seite 253)
0 1 Gib an, welche der dargestellten Personen größer, welche kleiner erscheint.
Die rechts dargestellte Person wirkt größer als die Person links.
0 2 Überprüfe deine Angabe aus Aufgabe 1 mithilfe eines Lineals.
Tatsächlich sind beide gleich.
$ 3 Vergleiche die Lösungen der Aufgaben 1 und 2 und erkläre den Unterschied.
Wir unterliegen einer visuellen Täuschung. Die Person rechts wird von uns in das perspektive Deutungsmuster integriert und wird
stärker nach diesem Muster als nach ihrer tatsächlichen Größe beurteilt.
. 4 Erkläre, wie die Personen für unsere perspektivische Wahrnehmung richtig gezeichnet werden müssen.
Wenn die rechte Person die gleiche Größe wie die linke Person haben soll, dann muss sie etwa wie die mittlere Person gezeichnet
werden.
0 5 Beschreibe deine spontane Wahrnehmung bei der Betrachtung der beiden Teile von Abb. 2
Etwa die Hälfte aller Testpersonen sieht entweder zwei Gesichtsprofile oder einen Kelch.
0 6 Betrachte beide Abbildungsteile jeweils etwas länger und beschreibe deine Wahrnehmungen.
Bei längerem Hinschauen kippt das Bild und wir erkennen das jeweilige andere Bild. Wir können immer nur eines von beiden
sehen, nicht beide Bilder gleichzeitig.
$ 7 Erkläre, warum bei der rechten Abbildung eine Wahrnehmung zustande kommt, die keine Entsprechung in der Realität hat.
Nach etwas längerem Hinschauen entdecken wir, dass hier ein Porträt verborgen ist. Um dieses Bild zu erkennen, müssen wir die
zweite Hälfte, die nicht existiert, dazu konstruieren.

Wahrnehmung (Seite 254/255)


0 1 Beschreibe anhand von Abb. 3, wie eine Wahrnehmung zustande kommt.
Die Wahrnehmung „Stein“ stellt eine Verarbeitung von verschiedenen Empfindungen dar. Nach aktiven Arm- und Handbewegun-
gen erfolgen durch den Widerstand des Steins ein Dehnungsreiz im Unterarm und ein Tastreiz in der Hand. Dadurch kommen
verschiedene Empfindungen zustande. Diese Empfindungen werden im Gehirn zu einer einheitlichen Wahrnehmung verbunden.
$ 2 Führe den im Text geschilderten Versuch zum „Loch in der Hand“ durch (Abb. 2).
individuelle Lösung
. 3 Erläutere deine Wahrnehmung, wenn du wie bei Aufgabe 2 verfährst, dich jedoch abwechselnd auf die Hand oder den Hinter-
grund konzentrierst.
Bei Konzentration auf das linke oder rechte Auge verschwindet das „Loch in der Hand“. Hierbei werden also die Verarbeitungspro-
zesse im Gehirn beeinflusst. Nur wenn beide Augen zu etwa gleichen Anteilen am Zustandekommen der Seh-Empfindung beteiligt
sind, verarbeitet das Gehirn diese zu der Wahrnehmung „Loch in der Hand“

Die Haut – ein Sinnesorgan und mehr (Seite 256)


0 1 Fasse die Funktionen und zugehörigen Strukturen der Haut in einer Tabelle zusammen.
siehe Tabelle
Struktur Funktion
Hornschicht Schutz vor Krankheitserregern
Keimschicht Bildung der Hornschicht; Pigmentierung schützt vor UV-Strahlung
Lederhaut mechanische Festigung durch Elastizität; Wärmeregulation durch Blutkapillaren; Sinneszellen für
Tasten, Wärme, Kälte und Schmerz
Unterhaut Wärmedämmung durch Fetteinlagerung; Sinneszellen vor Vibration

$ 2 Einige Schmerzsinneszellen reagieren auf mechanische Reize ebenso wie auf Hitze und starke chemische Reize. Erläutere die
Bedeutung dieser Sinneszellen für den Menschen.
Diese Schmerzsinneszellen reagieren auf Reize, die dem Menschen gefährlich werden können und haben damit Warnfunktion.

Wahrnehmung und Verhalten (Seite 257)


0 1 Begründe, warum menschliches Verhalten selten auf einer einzelnen Wahrnehmung allein beruht.
Menschen deuten und verarbeiten Erregungsmuster in großem Umfang und in komplexer Art und Weise. Daher werden nicht
Einzelwahrnehmungen sondern immer ganze Situationsanalysen zur Motivation einer Handlung herangezogen.
$ 2 Erläutere beispielhaft, welche Vorstellungen dich veranlassen, ein Freibad zu besuchen.
individuelle Lösung: Hier sollte jedoch erwähnt werden, dass nicht nur die Absicht nach Abkühlung die treibende Kraft ist, sondern
z. B. auch die Aussicht, Freunde zu treffen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
8. 3 Nervensystem des Menschen

Das Zentralnervensystem (Seite 258/259)


$ 1 Bei einem Unfall wird das Kleinhirn verletzt. Der Patient bewegt sich nach Verheilung der äußeren Wunden unsicher wie ein
Betrunkener. Erkläre.
Im Kleinhirn erfolgen die Koordination fein abgestimmter Bewegungen und die Integration von Sensorik und Motorik. Bei Verlet-
zungen dieses Organs kann es zu Ausfällen in der Koordination führen, was sich in dem schwankenden Gang äußert.
. 2 Vergleiche das Gehirn und ein anderes selbst gewähltes Organ mit Blick auf die Kompartimentierung.
individuelle Lösung: Hier ist wichtig, die Arbeitsteilung der Einzelstrukturen hervorzuheben. Das betrifft das Gehirn ebenso wie
z. B. das Herz.

Freude, Drogen und Sucht (Seite 260/261)


0 1 Erstelle aus Abb. 3 ein geeignetes Diagramm.
siehe Abbildung

16
14
Abhängige (Millionen)

12
10
8
6
4
2
0
Tabak Alkohol Medikamente Kokain, Heroin

$ 2 Erkläre, warum die Nachwirkungen des Kokainmissbrauchs eine erneute Einnahme des Rauschgifts begünstigen.
Die abgeschlagene Stimmung nach der Kokaineinnahme fördert den erneuten Gebrauch des Rauschgiftes, da dieses ja gerade die
Stimmung aufhellt.
. 3 Substanzen, die das Belohnungssystem stimulieren, führen leicht in die Abhängigkeit. Nimm Stellung zu dieser Aussage.
Das Belohnungssystem vermittelt uns im Normalfall eine Bestätigung darüber, ob ein Verhalten wiederholbar ist, da es dieses Ver-
halten mit einem Gefühl der Freude verbindet. Stimulation des Belohnungssystems durch Drogen verleitet uns allerdings ebenso
zur Wiederholung der Drogeneinnahme. Daher sind derartige Substanzen suchtgefährdend.

Extra: Computersucht: Gibt es das? (Seite 261)


1 Beurteile, ob Joe computersüchtig ist. Wende dabei die im Text genannten Suchtkriterien an.
In Joes Verhalten gibt es Hinweise auf Sucht: Seine Aggressivität kann als Entzugssymptomatik gedeutet werden. Dass Joe bis in
die Nacht hinein spielt und dabei die Schule und soziale Bindungen vernachlässigt kann ebenfalls die Folge davon sein, dass er
die Dosis, hier also die Dauer des Konsums steigern muss, um Befriedigung zu erlangen.

Gehirngerechtes Lernen (Seite 262/263)


0 1 Beschreibe das Verlaufsschema in Abb. 1.
Was durch die Sinnesorgane an Umweltveränderungen wahrnehmbar wird, speichern wir für sehr kurze Zeit im Ultrakurzzeitge-
dächtnis. Dinge, die dort nicht vergessen werden nehmen wir ins Kurzzeitgedächtnis auf und behalten sie für 10 bis 20 Minuten.
Erhalten einige dieser Gedächtnisinhalte eine besondere Bedeutung, so können sie ins Langzeitgedächtnis transferiert werden.
Dort werden sie zum lang andauernden Wissensbestand.
$ 2 Versuche dir die folgenden Begriffe nach der im Text beschriebenen Methode einzuprägen: Kaninchen, Schlaf, Dusche,
Eisverkäufer, Dosenwurst, Springseil, Flughafen, Kartenspiel, Aquarium, Karibik. Fällt dir das leicht? Tausche dich mit deinen
Mitschülern darüber aus.
individuelle Lösung
. 3 Nimm Stellung zur Abb. 2. Leite daraus eine Empfehlung ab, wie du dein Lernen zu Hause organisierst.
Die Situation ist doppelt lernunwirksam. Einerseits macht der Vater und nicht das Kind die Hausaufgaben. Dadurch kann das Kind
keinen Lernfortschritt erzielen. Der Fernseher belegt darüber das Kurzzeitgedächtnis, sodass zu viele Botschaften gleichzeitig und
damit keine ins Wissensgedächtnis übertragen werden. Empfehlung: Ablenkungen wie z. B. Fernseher abstellen, Hausaufgaben
selber erledigen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Das vegetative Nervensystem (Seite 264/265)
0 1 Beschreibe anhand von Abb. 1 die unterschiedlichen Anforderungen an das vegetative Nervensystem.
Das vegetative Nervensystem erfüllt zwei gegensätzliche Funktionen und ermöglicht so die Anpassung an aktuelle Verhältnisse.
Im linken Teilbild sind alle zur Jagd benötigten Organe (Skelettmuskulatur, Atmung, Herzschlag) in erhöhter Aktivität. Verdau-
ung findet nicht statt. Im rechten Bild sind die zur Verdauung nötigen Organe aktiv (Darm usw.). Atmung, Herzschlag usw. sind
verlangsamt.
$ 2 Erläutere mithilfe von Abb. 2, wie es kommt, dass die Sauerstoffkonzentration im Blut in Ruhe gleich bleibt.
Beim Zusammenziehen der Atemmuskulatur weitet sich der Brustkorb. Durch die einströmende Luft können die Atemgase aus-
getauscht werden. Die Dehnung des Gegenspielers begrenzt das oben genannte Zusammenziehen, sodass es auch wieder zum
Ausatmen kommt. Der Rhythmus der Atmung richtet sich nach dem Sauerstoffgehalt des Blutes. Bei gleichmäßigem Bedarf, kann
auf dem oben genannten Weg immer eine konstante Menge Sauerstoff in das Blut gelangen.
$ 3 „Voller Bauch studiert nicht gern!“ Nimm Stellung zu dieser sprichwörtlichen Redewendung.
Der Satz erscheint plausibel. Durch die Parasympathicusaktivität ist Atmung und Herzschlag verlangsamt. Der für Lernprozesse
benötigte Sauerstoff steht erst nach der Verdauungsphase wieder in vollem Umfang zur Verfügung.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
8. 4 Hormone

Wirkung von Hormonen (Seite 266/267)


$ 1 Menschen mit einer Schilddrüsenüberfunktion sind meistens sehr schlank. Erkläre.
Bei Thyroxinüberfunktion wird der gesteigerte Energieumsatz zum Dauerzustand, sodass der Energiegehalt der Nahrung nicht in
Depotfett angelegt wird, sondern direkt verarbeitet wird. Dabei kommt es zu einer erhöhten Wärmeproduktion.
$ 2 Erläutere die Bedeutung der hemmenden Wirkung des Thyroxins auf die höherrangigen Hormondrüsen.
Thyroxin wirkt hemmend auf die übergeordneten Hormondrüsen. Damit werden die Ausschüttungen des stimulierenden und des
Freisetzungshormons herunter geregelt. Letztlich wird dadurch einer Überproduktion von Thyroxin entgegengewirkt.

Basiskonzept: Information und Kommunikation (Seite 267)


1 Das Hormon Melatonin wird bei Dunkelheit produziert. Wir reagieren darauf mit Schläfrigkeit. Bei Fledermäusen ruft Melato-
nin körperliche Aktivität hervor. Erläutere.
Das Hormon Melatonin versetzt den gesamten Körper der Fledermaus in Bereitschaft. Damit wird die Nachtaktivität eingeleitet.
Über das Melatonin erhält der Fledermauskörper also Informationen zum Zustand der Außenwelt und wird seinerseits ebenfalls
in einen anderen Aktivitätsmodus versetzt.

Insulin und Glucagon (Seite 268/269)


0 1 Erstelle ein Verlaufsschema zur Produktion und Wirkung des Insulins.
Blutglucosegehalt sinkt. → Sensor auf den b-Zellen spricht an. → b-Zellen schütten das in ihnen produzierte Insulin aus. → Insu-
lin verteilt sich über den Blutkreislauf im ganzen Körper. → Insulin haftet an den Rezeptoren der Zielzellen. → Glucose strömt in
Zielzellen ein und wird dort in die Speicherform Glykogen umgewandelt.
$ 2 Neben den im Text genannten a- und b-Zellen gibt es im Gehirn weitere Sensoren für den Blutglucosegehalt. Sie reagieren
auf einen sinkenden Glucosegehalt mit einer Erregung von Nervenzellen des vegetativen Nervensystems (s. Seite 263). Ent-
wickle eine Hypothese, wo die Axone dieser Nervenzellen enden.
Einer Absenkung des Glucosegehalts wird durch einer Ausschüttung von Glucagon entgegengewirkt. Die Axone der Sensoren
enden an den a-Zellen der Bauchspeicheldrüse, die auf die Erregung der Axone hin das Glucagon ins Blut geben.
. 3 Ein Mitschüler von dir hat Diabetes mellitus. Informiere dich über die zulässigen und notwendigen Hilfsmaßnahmen für den
Fall, dass er bewusstlos wird.
Notarzt verständigen und in Seitenlage betten.

Stress (Seite 270)


0 1 Erstelle eine Tabelle nach dem oben gezeigten Muster, aus der die Wirkung von Adrenalin deutlich wird.
siehe Tabelle
Zelle mit Adrenalinrezeptor Wirkung des Adrenalins
Muskelzelle Glykogenabbau, Glucosebildung
Leberzelle Glykogenabbau, Glucosebildung und Glucosefreisetzung
Herzmuskelzelle schnelleres Zusammenziehen
Bronchien Weitung
Nebennierenrinde Cortisolausschüttung

$ 2 Vergleiche die Wirkung von Cortisol und Glucagon (s. Seite 268).
Beide bewirken die Glucosebildung, sie arbeiten also gleichsinnig: Glucagon aus Glykogen in den Leberzellen, Cortisol aus Protein
in Muskelzellen. Während Cortisol also einen Kohlenhydratspeicher mobilisiert, führt eine länger andauernde Wirkung von Cortisol
zum Muskelabbau.
. 3 Erläutere am Beispiel Stress das Zusammenspiel von Nervenzellen und Hormonen (Abb. 1).
Der Sensor, der zur Adrenalin- und Cortisolausschüttung und damit zu den Stressreaktionen führt, liegt im Gehirn selbst. Die
Verarbeitung der durch Reize vermittelten Erregungen führt zur Feststellung der Bedeutung „akute Gefahr vorhanden“. Daraufhin
werden die Stressreaktionen über das vegetative Nervensystem ausgelöst.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Material: Stress (Seite 271)
0 1 Beschreibe Abb. 1.
Im Vorgang 1 liegt Glykogen in der Leberzelle vor, Glykogen ist ein Glucosespeicher. Bindet im Vorgang 2 das Hormon Glucagon an
die an der Leberzellaußenseite befindlichen passenden Rezeptoren, kommt es zum Abbau des Glykogens. Dieser Prozess wird im
Vorgang 3 noch beschleunigt, wenn zusätzlich Adrenalin an die passenden Rezeptoren bindet.
$ 2 Erläutere die schematisch dargestellten Vorgänge als Anpassung an bestimmte Körperzustände.
Vorgang 1 zeigt den Zustand nach einer Mahlzeit mit ausreichend hohem Glucosegehalt in körperlicher Ruhe. Vorgang 2 zeigt eine
Anpassung an einen Glucosebedarf, der nicht durch die Zufuhr von Nahrung gedeckt werden kann, etwa wenn die letzte Nah-
rungsaufnahme schon längere Zeit her ist. Zustand 3 ist als Anpassung an einen gesteigerten Glucosebedarf, etwa in Folge von
Kurzzeitstress, zu deuten.
. 3 Treten zwei Hormone als Gegenspieler auf, führt das häufig dazu, dass eine Größe konstant gehalten wird. Beurteile, ob das
für das Paar Glucagon und Adrenalin gilt.
Glucagon und Adrenalin sind keine Gegenspieler, sie wirken nicht gegensinnig sondern gleichsinnig: Beide führen zur Freisetzung
von Glucose aus dem Glykogenspeicher der Leber.
0 4 Stelle die in Abb. 2 gegebenen Daten in einem geeigneten Diagramm dar.
siehe Abbildung

40
Schüler bis 12
Schüler zw. 12 und 18
30
Anteil (%)

20

10

0
häufig gelegentlich selten nie
Stress Stress Stress Stress

$ 5 Prüfe, ob Stressreaktionen zur Bewältigung der schulischen Anforderungen beitragen. Verwende dabei dein Diagramm und
Abb. 3.
Die gezeigten Stresssymptome tragen nicht zur Steigerung der gedanklichen, sportlichen oder künstlerischen Leistungen bei.
Insgesamt können sie also nicht zur Bewältigung der schulischen Anforderungen beitragen. Stressreaktionen dienen zur kurzfris-
tigen Leistungssteigerung in bedrohlichen Situationen, Langzeitstress wirkt sich negativ auf die Gesundheit und das schulische
Leistungsvermögen aus.

Teste dich selbst (Seite 273)


0 1 Vergleiche den Bau des Vomeronasalorgans mit dem der Riechschleimhaut des Menschen.
Die Riechschleimhaut des Menschen und das Vomeronasalorgan haben Sinneszellen, bei denen Geruchsstoffmoleküle Erregungen
auslösen, der Sinneszelltyp ist also prinzipiell gleich. Bei der Riechschleimhaut des Menschen gelangen die Geruchsstoffmolekü-
le durch die eingeatmete Luft zu den Sinneszellen. Beim Vomeronasalorgan werden diese durch die Zunge auf die Sinneszellen
übertragen.
0 2 Erläutere Struktur- und Funktionsbeziehungen bei Geruchsstoff und Rezeptor.
Geruchsstoff und Rezeptor passen räumlich genau zueinander. Diese Passung kennt man von einem Schlüssel und einem Schloss.
Deswegen wird bei Geruchsstoff und Rezeptor auch modellhaft von einem Schlüssel-Schloss-Prinzip gesprochen. Bei Anlagerung
des passenden Geruchsstoffs an den Rezeptor kommt es zur Erregung der Sinneszelle.
0 3 Erläutere die Funktionsweise der Bogengänge unter Bezug auf Abb. 1.
Durch eine Drehbewegung wird die an der Wand des Bogengangs sitzende Gallertkappe mitgedreht, nicht jedoch die Flüssigkeit
im Bogengang. Dadurch wird die Gallertkappe gebogen. Das löst bei den Sinneshärchen einen Reiz aus, den wir als Drehung
wahrnehmen.
$ 4 Vergleiche den Aufbau des in Abb. 3 dargestellten Modellversuchs mit dem Aufbau der Bogengänge.
Die am Schüsselrand festgeklebte Lasche entspricht der Gallertkappe im Bogengang. Das Abknicken beim Drehen der Schüssel
entspricht den Vorgängen bei der Drehung des Kopfes. Für Reiz, Erregungsleitung und Wahrnehmung hat das Modell keine Ent-
sprechung.
. 5 Bei kurzzeitiger Drehung bewegt sich die Flüssigkeit kaum, bei längerem Drehen des Stuhls dreht sich die Flüssigkeit mit der
Schale. Erkläre mithilfe des Modells, was geschieht, wenn man sich länger dreht und dann plötzlich stoppt.
Nach längerem Drehen und plötzlichem Stoppen tritt ein Schwindelgefühl auf. Bei geschlossenen Augen hat man den Eindruck,
sich in Gegenrichtung zu drehen. Am Modell kann man nach längerem Drehen erkennen, dass sich Flüssigkeit und Schale gleich-
artig drehen. Stoppt man die Schüssel, dreht sich die Flüssigkeit eine Zeit lang weiter, die Lasche wird in die andere Richtung
abgeknickt. Der entsprechende Vorgang im Bogengang führt zur Reizung der Sinneshärchen. Dadurch entsteht die Wahrnehmung
einer scheinbaren Drehung in Gegenrichtung.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
0 6 Beschreibe die Vorgänge im Zentralnervensystem, die zum Gefühl der Freude führen.
Bei Freude wird in einigen Bereichen des ZNS Dopamin ausgeschüttet. Dieser Botenstoff löst in bestimmten Zellen des Limbischen
Systems Erregungen aus. Werden diese Zellen erregt, so empfinden wir das als Freude.
$ 7 Bei früheren Erstbesteigungen von Achttausendern benutzten Extrembergsteiger häufig Amphetamin. Dieses Mittel fördert
die Freisetzung der Botenstoffe Adrenalin und Noradrenalin. Begründe den Einsatz der Mittel.
Durch den Einsatz von Amphetamin konnte die Leistungsfähigkeit über das natürliche Maß gesteigert werden, da zusätzlich
Adrenalin und Noradrenalin gebildet wurden. Diese führen dann zu den in Aufgabe 6 beschriebenen Wirkungen.
$ 8 Amphetamine machen süchtig. Nenne die Kriterien für Sucht und beurteile das Verhalten der früheren Extrembergsteiger.
Suchtkriterien sind: a) Abhängigkeit, b) Dosissteigerung, um die gleiche Wirkung zu erzielen, c) Entzugserscheinungen bei Abset-
zen der Droge. Bei der Beurteilung muss gefragt werden, warum die Bergsteiger die Leistung erbringen wollten. Unter sportlichen
Gesichtspunkten sind die Amphetamingabe und Doping abzulehnen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
9 Sexualität beim Menschen
9.1 Pubertät

Zeit der Veränderung (Seite 276/277)


$ 1 Erkläre die körperlichen Veränderungen, die sich während der Pubertät ergeben, unter Verwendung von Abb. 2.
Im Zwischenhirn werden bestimmte Hormone freigesetzt und mit dem Blut im Körper verteilt. Sie bewirken, dass in der Hypophy-
se das Hormon Gonadotropin gebildet wird, das ebenfalls mit dem Blut im Körper verteilt wird. Bei Jungen und Mädchen wirkt es
unterschiedlich:
Jungen: Der Hoden bildet dann weitere Hormone, die Androgene. Mit dem Blut verteilt bewirken sie Akne, Bartwuchs, Stimm-
bruch, Achsel- und Schambehaarung, Wachstum der Muskulatur und der Geschlechtsorgane. Die Spermienzellen beginnen zu
reifen.
Mädchen: Bei Mädchen bewirken die Gonadotropine in den Eierstöcken die Follikelreifung und Gelbkörperbildung. Dabei werden
hier die Hormone Östrogen und Progesteron produziert. Mit dem Blut verteilt bewirken sie Akne, Schambehaarung, das Wachs-
tum der Brüste, der Hüften sowie der Geschlechtsorgane.
. 2 Du willst abends mit Freunden ausgehen. Der letzte Bus fährt aber schon um 21.30 Uhr zurück. Deine Eltern fordern, dass du
ihn nimmst. Gib Argumente beider Seiten wieder.
Folgende Sorgen könnten die Eltern haben (Beispiele):
– Sie wissen nicht genau, mit wem du dich triffst und ob sie diesen Menschen vertrauen können.
– Sie befürchten, dass du den letzten Bus verpassen könntest und dann nicht geklärt ist, wie du sicher nach Hause kommst.
– Sie haben Sorgen, dass du Alkohol und/oder andere Drogen konsumierst.
– Sie befürchten, dass du von Fremden angesprochen wirst.
Folgende Wünsche könnte ich haben (Beispiele):
– Ich möchte möglichst (lange) mit den Freunden feiern.
– Ich möchte selbst über meine Freizeitgestaltung bestimmen und nicht peinlich vor den anderen dastehen.
– Ich möchte Neues kennen lernen, u.a. auch andere Menschen.

Material: Pubertät (Seite 278)


$ 1 Erläutere, warum das Ausdrücken von Mitessern die Bildung von Pickeln fördern kann.
Durch das Ausdrücken der Mitesser wird die Haut geöffnet, sodass ggf. die darauf lebenden Krankheitserreger in die Wunde
gelangen können. Dort können sie sich stark vermehren und Entzündungen hervorrufen.
0 2 Informiere dich über die Begriffe „Hygiene“ und „Desinfektion“. Erläutere sie.
Als Hygiene bezeichnet man alle Maßnahmen, die die Ausbreitung von Krankheiten verhüten und dem Erhalt, der Förderung und
Festigung der Gesundheit dienen. Desinfektion bezeichnet die Verringerung der Keimzahl auf ein sehr geringes Maß.
$ 3 Informiere dich über Produkte die Körpergeruch und Pickel bekämpfen sollen. Äußere dich kritisch zu den versprochenen
Werbeaussagen.
individuelle Lösung. Allgemein kann man sagen: Oft zielen die Werbeversprechen darauf ab, dass bei Verwendung des Produktes
die Menge der Krankheitserreger drastisch reduziert werden könne. Dies ist häufig kaum möglich, da eine dauerhafte Desin-
fektion unter solch einfachen Bedingungen (wie Aufbringen einer Lösung) nicht möglich ist. Darüber hinaus wird natürlich die
gesamte Bakterienfauna aus dem bestehenden Gleichgewicht gebracht, sodass nachteilige Folgen für die Haut nicht auszuschlie-
ßen sind.

Material: Fremd- und Eigenwahrnehmung (Seite 279)


0 1 Vergleicht eure Ergebnisse in 3er- oder 4er-Gruppen.
$ 2 Diskutiert mögliche Gründe, die zu euren Entscheidungen geführt haben und stellt eure Gruppenergebnisse vor.
Aufgabe 1 und 2 können nur individuell gelöst werden. Grundsätzlich lässt sich Folgendes sagen: Unterschiede können aus der
eigenen Erziehung resultieren, wenn unterschiedlich gelernt worden ist, Gesichtsausdrücke und andere Formen der nonverbalen
Mitteilung zu interpretieren. Außerdem zeigen die Fotos nur eine Momentaufnahme aus einer viel komplexeren Situation, sodass
eine genauere Einschätzung nur schwer möglich ist. Man schätzt Menschen nach gewissen Mustern ein, die man selbst gelernt
hat. Daher können die Einschätzungen zum Teil sehr unterschiedlich ausfallen. Lächeln kann z. B. als freundschaftlich oder über-
heblich und abweisend aufgefasst werden.
0 3 Formuliert in Kleingruppen Leserbriefe an Jugendzeitschriften. Ziel ist es, Probleme Jugendlicher zum Ausdruck zu bringen.
individuelle Lösung
$ 4 Tauscht mit einer anderen Gruppe euren Leserbrief und formuliert ein Antwortschreiben an die Gruppe, die den Leserbrief
verfasst hat.
individuelle Lösung
$ 5 Lest die Leserbriefe und auch das jeweilige Antwortschreiben der gesamten Klasse vor und besprecht sie.
individuelle Lösung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Sexualität und Sprache (Seite 280)
0 1 Nenne mögliche Gedankengänge zum Ausdruck „das erste Mal“.
„Das erste Mal“ kann vom Grunde her alles bedeuten, was man tatsächlich zum ersten Mal macht. In sexueller Hinsicht gilt dies
genauso, wobei das erste Mal vom Küssen über Petting bis hinzu verschiedenen Arten von Geschlechtsverkehr gemeint sein kön-
nen.
Anmerkung: Dass gerade in sexueller Hinsicht dies alles sowohl Lust als auch Ekel und Ablehnung hervorrufen kann, sollte be-
dacht werden.
$ 2 In einer Jugendzeitschrift wird das Thema Selbstbefriedigung thematisiert, indem dort von „handjob“ gesprochen wird.
a) Empfindest du diese Ausdrucksweise als angemessen? Erläutere.
b) Gerade ältere Menschen könnten mit diesem Begriff gar nichts oder vielleicht eine handwerkliche Tätigkeit verbinden.
Erläutere.
a) individuell
b) Manche Menschen können ggf. kein Englisch und verstehen den Begriff daher nicht. Wenn sie ihn wortwörtlich übersetzen,
liegt der Gedanke an eine handwerkliche Tätigkeit nahe.

Material: Kommunikation ohne Sprache (Seite 281)


0 1 Ordne den dargestellten Personen die Eigenschaften „sympathisch“, „gleichgültig“ oder „ablehnend“ zu. Vergleicht eure Ein-
schätzungen innerhalb der Klasse.
individuelle Lösung
. 2 Erläutere für jedes der 4 Bilder, wodurch Eindrücke wie Sympathie, Gleichgültigkeit oder Ablehnung zum Ausdruck kommen.
Bilder von links nach rechts:
Bild 1: Kurze Blicke zum Gegenüber, Anlächeln, verschränkte Arme hinter dem Kopf signalisieren Sympathie.
Bild 2: Anlächeln, übereinander geschlagene Beine, enge Beinhaltung des Jungen, mit den Haaren Spielen beim Mädchen, Anse-
hen des Gegenübers, deutliches Zuwenden und eine entspannte offene Körperhaltung signalisieren große Sympathie.
Bild 3: Verschränkte Arme vor der Brust, starrer gleichgültiger Gesichtsausdruck gepaart mit starrem Dasitzen und eine geschlos-
sene Beinhaltung signalisieren Ablehnung.
Bild 4: Das Mädchen sieht den Jungen nicht an und wendet sich ab, ihre Beine sind verschränkt und der Kopf auf die Arme ge-
stützt. Dies signalisiert Ablehnung. Der Junge hingegen lächelt das Mädchen an, und hat eine entspannte offene Körperhaltung.
Dies signalisiert Sympathie.
0 3 Beschreibe das Verhalten von Jungen bzw. Mädchen auf einer Party.
Die Jungen stehend am Rand, wirken als Gruppe irgendwie verschlossen und wenig kommunikativ. Sie betrachten die Mädchen,
aber wirken eingeschüchtert und peinlich berührt. Nur wenige tanzen. Die Mädchen stehen in Gruppen zusammen und unterhal-
ten sich oder sie tanzen. Von den Jungen scheinen sie mehr oder weniger Kenntnis zu nehmen.
$ 4 Beschreibe die Signale, die Jungen bzw. Mädchen dabei aussenden, und gib mögliche Gründe für ihr Verhalten an.
Die Jungen möchten cool wirken und auf diese Weise auf sich aufmerksam machen. Sie scheuen sich häufig davor, die Mädchen
anzusprechen oder sich unter sie zu mischen. Ob dies Verhalten bei den Mädchen auffordernd ankommt, bleibt fraglich. Häufig
nehmen sie die Mädchen eher als ungesprächige und daher langweilige Klassenmitglieder wahr.
Die Mädchen fühlen sich in der Gruppe wohl und sind dort zufrieden, genießen die Aktivität. Es ist nicht zwingend erforderlich,
dass die Jungen dabei mitmachen. Vielleicht nutzen sie den Schutz, den die Gruppe bietet, um nicht von Jungen angesprochen zu
werden. Die Jungen finden das Verhalten als wenig auffordernd, die Mädchen wirken als Gruppe geschlossen. Falls die Mädchen
dabei auch noch albern wirken, empfinden die Jungen dies vielleicht als kindisch.
. 5 „Typisch Junge“ – „typisch Mädchen“. Diskutiert, ob es das bezüglich des Verhaltens in Gruppen gibt.
individuelle Lösung

Sexualität und Medien (Seite 282/283)


0 1 Benenne und erläutere ein aktuelles Beispiel aus der Werbung, bei dem die Erkenntnisse des Eyetracking (Abb. 1) offensicht-
lich genutzt worden sind.
Allgemein eignen sich vor allem Beispiele, bei denen Werbung mithilfe sexueller Signale funktioniert. Dabei wird gerne mit leicht
bekleideten Frauen geworben. Zwischen den Zeilen kann dabei die Botschaft mitschwingen, dass die dargestellte Person Interes-
se an sexuellen Handlungen hat. Das eigentlich beworbene Produkt tritt dann in den Hintergrund. Weil es aber mit etwas positiv
Besetztem verknüpft wird, erinnert man sich gerade deshalb daran.
$ 2 Ordne den Personen, die in den Abbildungen 2 und 3 dargestellt sind, Eigenschaften zu. Schreibe eine kleine Geschichte, wie
du dir deren Leben vorstellst. Vergleicht in eurer Klasse.
individuelle Lösung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 3 Petra, 16 Jahre alt, darf sich noch kein Piercing machen lassen. Während ihres Urlaubs setzt sie sich über die Entscheidung
ihrer Eltern hinweg. Bewerte das Handeln, indem du dich sowohl in Petra als auch in ihre Eltern hineinversetzt.
Für die Eltern könnte im Vordergrund stehen, dass es sich um schmerzhafte, gefährliche Eingriffe in den Körper handelt, die nur
von speziell ausgebildeten Fachkräften ausgeführt werden dürfen und selbst bezahlt werden müssen. Diese Eingriffe können nicht
nur gesundheitliche Schäden nach sich ziehen, sondern sind unter Umständen im weiteren Verlauf des Lebens nicht wieder in
ihren Ursprungszustand veränderbar. Dies kann – wenn man älter geworden ist und die Veränderung des Körpers ggf. nicht mehr
aktuellen Trends entspricht – zu schweren Problemen führen, da man sich dann in seinem Körper ggf. nicht mehr wohl fühlt. Man
sollte sich daher sehr gut überlegen, ob man diese Veränderungen des Körpers an sich vornehmen lässt oder ob man dies besser
unterlässt. Petra ist es vielleicht wichtig, das Gleiche zu tun wie andere Mitglieder ihres Freundeskreises, in dem Piercings als
„cool“ gelten.
. 4 Ein Freund schickt dir ein Nacktfoto seiner 15-jährigen Exfreundin über ein soziales Netzwerk. Gleichzeitig geht das Foto auch
an alle anderen „Freunde“. Nimm Stellung dazu.
Das Verhalten ist vollkommen inakzeptabel, da es um sehr intime Details eines Menschen geht. Dies ist umso schlimmer, da das
Foto einer großen Gruppe von Menschen zur Verfügung gestellt wird, die es ihrerseits problemlos noch weiteren Menschen zur
Verfügung stellen kann. In jedem Fall werden die Gefühle und Rechte der Exfreundin verletzt.
. 5 „Sex sells“ (deutsch: „Sex steigert den Verkauf“). Kommentiere diesen aus der Werbebranche stammenden Slogan.
Die Verknüpfung von Produkten mit sexuellen Signalen kann den Absatz der Produkte erhöhen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
9.2 Sexualität und Schwangerschaft

Die Geschlechtsorgane (Seite 284/285)


$ 1 Ordne den verschiedenen Teilen der Geschlechtsorgane eine Funktion zu.
Frau:
Schamlippen: Verschluss der Scheide, Schutz vor Krankheitserregern
Scheide: Geburtskanal, nimmt den Penis beim Geschlechtsverkehr auf, verschließt sich im Normalfall als Schutz vor eindringenden
Krankheitserregern; innere Wand scheidet Erreger abtötende Sekrete aus
Gebärmutter: versorgt das heranwachsende Kind, Ort der Schwangerschaft
Eileiter: Transportiert die Eizelle in die Gebärmutter
Eierstock: Produktion von Eizellen
Kitzler: kann sexuell erregbar sein
Mann:
Vorhaut: schützt Eichel
Harn-Spermienröhre/Spermienleiter: transportieren Spermien vom Hoden nach draußen
Prostata und andere Drüsen: produzieren Sekret, mit dessen Hilfe Spermien in der Scheide beweglich sind
Hoden: produzieren Spermien
Eichel: ist sexuell erregbar
. 2 Erläutere die Funktion des Schleimpfropfes, der normalerweise die Gebärmutter verschließt.
Der Schleimpfropf zwischen Gebärmutter und Scheide verhindert, dass Krankheitserreger in die Gebärmutter gelangen können
und so einerseits die Frau, andererseits aber auch einen in der Gebärmutter heranwachsenden Fetus schädigen können.

Der weibliche Zyklus (Seite 286/287)


0 1 Beschreibe die Veränderungen der LH-Konzentration (Abb. 2).
Dargestellt ist die Konzentration des Hormons LH in Abhängigkeit zum Tag im weiblichen Zyklus. Sie bleibt vom 0. bis ca. 12. Tag
relativ konstant bei einer geringen Konzentration, steigt dann vom 12. bis zum 14. Tag sehr stark an und hat dort eine maximale
Konzentration. Ebenso schnell fällt sie bis ca. zum 16. Tag wieder auf die Ausgangskonzentration zurück und bleibt so konstant bis
zur nächsten Menstruation.
$ 2 Erläutere mithilfe von Abb. 1 die in Abb. 2 dargestellten Wirkungen des LH.
Vor allem erkennt man, dass erst bei maximaler Konzentration von LH der Eisprung erfolgt. Kurz vor dem Eisprung lässt sich darü-
ber hinaus noch ableiten, dass die Reifung des Follikels nicht nur durch FSH, sondern auch durch LH unterstützt wird, da mit dem
Anstieg der Konzentrationen beider Hormone dieser Effekt eintritt.
$ 3 Die in Abb. 2 angegebene Wirkung des Progesterons findet sich in Abb. 1 wieder. Erläutere.
Eine ansteigende Konzentration von Progesteron bewirkt, dass die Gebärmutterschleimhaut dicker und besser durchblutet wird.
Dieser Zustand bleibt erhalten, wenn die Konzentration des Progesterons konstant auf einem hohen Niveau bleibt.
$ 4 Östrogene bewirken auch, dass die Muskulatur der Gebärmutter weniger aktiv ist und der Gebärmutterhals in der Zyklusmitte
geöffnet bleibt. Erläutere die Bedeutung dieser Wirkung.
Geöffneter Gebärmutterhals in der Zyklusmitte: Spermienzellen können bis in die Eileiter vordringen, wo sich eine befruchtete
Eizelle befindet.
Verminderung der Muskelaktivität der Gebärmuttermuskulatur: Nach einer Befruchtung steigt die Chance, dass eine eingenistete
Eizelle nicht abgestoßen wird, sondern in der Gebärmutter verbleiben kann.

Vom Embryo zum Fetus (Seite 288/289)


0 1 Meist stellt eine Frau die Schwangerschaft fest, wenn die erwartete Menstruation ausbleibt. Gib an, welche Organe dann
bereits beim Embryo entwickelt sind (Abb. 3).
Etwa zwei bis drei Wochen nach der Befruchtung sind bereits folgende Organe entwickelt: Kopf und Herz sind deutlich erkennbar,
Lunge, Gliedmaßen und Nerven sind am Beginn ihrer Ausprägung.
. 2 Erläutere die Gefahr für den Embryo, wenn eine Frau viel raucht und Alkohol trinkt und erst beim Ausbleiben der Menstruati-
on merkt, dass sie schwanger ist.
Die Frau weiß ggf. noch nichts von der Schwangerschaft und verändert ihre Lebensumstände nicht, sodass der Embryo gerade
dann stark geschädigt wird.
$ 3 Zeichen einen Comic-Strip mit dem Titel „Szenen einer Schwangerschaft“.
individuelle Lösung. Ein guter Zeichner könnte hier die Stadien ähnlich wie die auf der Doppelseite vorhandenen Abbildungen
darstellen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 4 Erkläre die Versorgung von Embryo und Fetus unter Verwendung des Basiskonzepts Struktur und Funktion. Beziehe dich auf
Abb. 2.
Der mütterliche und der fetale Blutkreislauf vereinigen sich nicht. Daher müssen alle Stoffe, die zur Versorgung des Kindes dienen,
durch die Wände der Blutgefäße und Zotten in den Blutkreislauf des Fetus übertreten. Die Entsorgung der im Stoffwechsel des
Fetus produzierten Abfallstoffe erfolgt entsprechend. Beim Durchtritt durch die Wände erfolgt eine Kontrolle der durchtretenden
Stoffe. Manche werden erleichtert hindurchgelassen, andere am Durchtritt behindert.
Die große Kontaktfläche zwischen mütterlichem Blut und embryonalen bzw. fetalem Blutkreislauf ist ein Beispiel für Oberflächen-
vergrößerung, denn dadurch ist ständig eine hohe Austauschrate zwischen den beiden Kreisläufen möglich. Die Struktur ist also
an die Funktion angepasst.

Schwangerschaft und Geburt (Seite 290/291)


0 1 Schwangere müssen sich besonders schonen. Erläutere dies.
Schwangere versorgen den Fetus. Das begrenzt die Belastbarkeit der Schwangeren und ist Voraussetzung für die normale Ent-
wicklung des Fetus.
0 2 Gib Möglichkeiten an, wie man auf einfache und vielfache Weise einer Hochschwangeren behilflich sein kann.
Dinge abnehmen und für sie tragen, beim Gehen behilflich sein, den Platz im öffentlichen Verkehrsmitteln anbieten, im Haushalt
bei allen möglichen Tätigkeiten behilflich sein, aber auch einfach da sein und z. B. zuhören.
$ 3 Nach der Geburt dauert es einige Wochen, bis die Gebärmutter auf ihre normale Größe zusammengeschrumpft ist. Dabei ist
Stillen förderlich. Erkläre dies.
Der durch das Stillen ausgelöste Reiz erregt Nervenzellen in der Brust, die ihre Erregung an die Hypophyse weitergeben. Das
dadurch freigesetzte Oxytocin erreicht mit dem Blut auch Zielzellen in der Gebärmutter und bewirkt, dass die Gebärmutter wieder
die Größe vor Beginn der Schwangerschaft erreicht.
. 4 Erläutere am Beispiel des Oxytocins die grundsätzliche Wirkung von Hormonen.
Hormone werden in besonderen Organen produziert; die Herstellung wird über das Zentralnervensystem gesteuert. Mit dem Blut
werden sie im gesamten Körper verteilt und erreichen dabei viele Organe gleichzeitig. Sie wirken nur auf bestimmte Zellen, näm-
lich diejenigen, die einen passenden Rezeptor besitzen.

Verhütung (Seite 292/293)


0 1 Erkläre die Wirkungsweise der Pille.
Östrogen bewirkt die Hemmung der FSH- und LH-Produktion in der Hirnanhangsdrüse. Daher reift keine Eizelle heran. Progeste-
ron bewirkt die Verdickung der Gebärmutterschleimhaut. Da in den letzten Pillen einer Packung die Hormonmengen geringer sind,
kann die Schleimhaut unter diesen Umständen nicht aufrecht erhalten werden. Sie reißt ein und wird mit Blut abgegeben, was
einer Menstruation gleich kommt.
$ 2 „Verhütung ist Frauensache.“ Nimm Stellung zu dieser Aussage.
Frauen sind diejenigen, die schwanger werden. Männer können sich ihrer Verantwortung entziehen. Dies kann dazu führen, dass
manche Männer das Thema Verhütung sträflich vernachlässigen. Verhütung geht beide an, gerade weil es auch gilt, sich vor
Krankheiten zu schützen. Beide müssen gleichberechtigt entscheiden, wer in welcher Weise für die Verhütung sorgt.
. 3 Informiere dich über den Pearl-Index. Nenne und erläutere die Angaben für die in Abb. 3 aufgeführten Verhütungsmittel.
Der Pearl-Index gibt an, wie viele von 100 Frauen, die eine bestimmte Verhütungsmethode verwenden, innerhalb eines Jahres
trotzdem schwanger werden.
Pille: 0,1–0,9; Kondome: 2–12; Femidom: 5–25; Spirale: 0,9–3; Cremes etc.: 3–21; Temperaturmethode: 0,8–3;
Coitus interruptus: 4–18
Zusatzinformationen: In Abhängigkeit des Alters der Frau ohne weitere Verhütungsmethode: ca. 20-jährige: 85; ca 35-jährige: 50;
ca. 40-jährige: 30; nach der Menopause: 0

Material: Schwangerschaftsabbruch (Seite 294/295)


$ 1 Ein Kind kann auch behindert zur Welt kommen, obwohl alle Untersuchungsmethoden dies nicht vorhergesagt haben und das
genetische Material vollständig sowie unverändert ist. Erkläre.
Es können Fehler bei der Messmethode oder der Interpretation der Analyse vorliegen. Darüber hinaus können in den untersuchen-
den Labors Proben vertauscht worden sein. Außerdem können auch während des Vorgangs der Geburt Komplikationen auftreten,
die zur Behinderung eines bis dahin gesunden Kindes führen können.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 2 Versuche dich in die Situation von Eltern zu versetzen, die ein stark behindertes Kind erwarten. Diskutiere das Für und Wider
eines Schwangerschaftsabbruchs.
Contra-Argumente: Man wäre sonst dafür verantwortlich, dass ein menschlicher Embryo getötet wird.
Auch ein behinderter Mensch kann Freude empfinden und das Leben genießen. Eltern können ihr Kind lieben, unabhängig davon,
ob es behindert ist oder nicht.
Pro-Argumente: Die Behinderung schränkt die Lebensqualität des gerade entstehenden Menschen so stark ein, dass man vermu-
ten muss, dass der Mensch nicht glücklich sein kann.
Der Mensch muss ein Leben lang intensiv gepflegt werden, was irgendwann nicht mehr von den Eltern übernommen werden
kann. Dies schränkt vielleicht auch das Leben der Eltern, ihre eigene Gesundheit und die Fürsorge für weitere Geschwister zu stark
ein.
0 3 Beschreibe die Daten von Ab. 2.
Mit 12 Jahren sind nur 2 von 10 000 Menschen in Deutschland schwanger. Diese Zahl steigt mit dem Alter von 14 Jahren rasant auf
70 pro 10 000 an und versechsfacht sich dann erneut bis zum Alter von 17 Jahren.
$ 4 Erläutere die Probleme, die jugendliche Mütter oder Väter haben können.
Jugendliche sind finanziell von ihren Eltern abhängig. Außerdem sind sie selbst noch in der Entwicklung, ihre Persönlichkeit ist
noch nicht gefestigt. Daher ist es für Jugendliche besonders schwierig, die Herausforderung der Versorgung und Erziehung eines
Kindes selbständig zu meistern.
Hinzu kommt, dass Jugendliche noch schulpflichtig sind oder eine Ausbildung wahrnehmen. Wird diese Zeit nicht erfolgreich been-
det, so kann dies Folgen für das gesamte weitere Leben haben.
$ 5 Eine Schwangere trägt sich mit dem Gedanken, ihre Schwangerschaft beenden zu lassen. Beschreibe, wie sie vorgehen muss,
um straffrei zu bleiben.
Die Schwangere muss sich in einer staatlich anerkannten Beratungsstelle beraten lassen. Falls sie den Abbruch der Schwanger-
schaft dennoch wünscht, müssen seit der Beratung wenigstens drei Tage vergangen sein. Die Schwangerschaft darf dann nur von
einem Arzt oder einer Ärztin beendet werden und zwar innerhalb der ersten 12 Schwangerschaftswochen. Dies bedeutet praktisch
innerhalb von 24 Wochen nach der letzten Menstruation.
Sind Leben und Gesundheit der Schwangeren in Gefahr, so darf die Schwangerschaft jederzeit abgetrieben werden. Nach einer
Vergewaltigung ist der Eingriff innerhalb der ersten 22 Schwangerschaftswochen straffrei.
$ 6 Vergleiche die verschiedenen Sichtweisen zum Beginn des Lebens.
Die Spannbreite, innerhalb derer ein sich während der Schwangerschaft entwickelndes Lebewesen als Mensch gesehen wird, ist
recht groß. Sie reicht von der Zygote (also unmittelbar nach Befruchtung) bis zur Geburt. Dabei werden verschiedene Kriterien an-
gelegt, z. B. die Befruchtung, die Einnistung in die Gebärmutter, der beginnende Herzschlag, die Kommunikation von Nervenzellen
im Gehirn untereinander, die Beseelung, die Geburt. Sie sind religiös, weltanschaulich oder naturwissenschaftlich geprägt.

Sexualität ist vielfältig (Seite 296)


0 1 Erläutere den Unterschied zwischen Hetero- und Homosexualität.
Homosexuelle haben sexuelle Kontakte mit Partnern des gleichen Geschlechts und gehen auch Partnerschaften mit diesen Men-
schen ein. Heterosexuelle haben Partner des anderen Geschlechts.
$ 2 Nimm Stellung zu folgender Aussage, die man gelegentlich hört: „Homosexualität ist eine Krankheit.“
Die Aussage ist falsch und unverantwortlich. Sie rührt von den vielen Vorurteilen her, die Homosexuellen gegenüber bestehen,
weil diese Art des Zusammenlebens für viele nicht vorstellbar ist. Eine solche Tabuisierung kann für homosexuelle Menschen sehr
belastend sein.
. 3 Viele homosexuelle Menschen leben bewusst in Großstädten und nicht in ländlichen Gebieten. Erläutere.
Gerade in Großstädten ist die Chance, dass man durch die Homosexualität unangenehm auffallen könnte, geringer. Hier lebt man
wesentlich anonymer. Öffentlich zu machen, dass man homosexuell ist, wird dort eher akzeptiert, zumal dort ja auch schon mehr
Menschen leben, die sich geoutet haben.

Partnerschaft (Seite 297)


$ 1 Formuliere, was für dich eine gute Partnerschaft ausmacht.
individuelle Lösung: z. B. niemals oder wenig streiten, dauerhafte Treue, keine Konflikte, alles von den Augen ablesen, friedliches
Miteinander, keine Verletzungen, immer offen und ehrlich sein, nicht mit anderen flirten, nur für den Partner da sein.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Teste dich selbst (Seite 301)
$ 1 Übertrage die Tabelle in Abb. 1 in dein Heft und vervollständige sie.
Ergänzung der vorliegenden Tabelle:
Vorhaut; Schutz; äußere und innere Schamlippen
Eichel; sexuelle Erregung; Kitzler und Schamlippen
Hoden; Produktion der Geschlechtszellen; Eierstöcke
Spermienleiter und Harn-Sperma-Leiter; Weiterleitung der Geschlechtszellen; Eileiter
Harn-Sperma-Leiter; Ausführung des Harns (Urins); Harnröhre
$ 2 Wie soll Jana sich verhalten? Schreibe einen Brief an Jana, in dem du erläuterst, welches Verhalten du Maxim gegenüber für
richtig hältst.
Janas Unsicherheit ist ein Zeichen dafür, dass sie noch keinen Geschlechtsverkehr haben möchte. Dies sollte ihr Freund Maxim
respektieren und ihr die Zeit geben, die sie benötigt. Dass Maxim dies genau nicht tut und Jana stattdessen drängt, sollte Jana
als Zeichen werten, dass Maxim nicht der richtige Partner für sie ist. Jana sollte die Beziehung beenden oder sich durch Maxims
Drängen nicht beeinflussen lassen.
$ 3 Erläutere das Schema zur Hormonwirkung beim weiblichen Zyklus (Abb. 2).
Die in der Hirnanhangsdrüse gebildeten Hormone FSH und LH fördern das Heranreifen eines Follikels im Eierstock. Das durch den
Follikel gebildete Östrogen fördert einerseits die Verdickung der Gebärmutterschleimhaut, sodass sich ein ggf. vorhandener Keim
darin einnisten kann, andererseits hemmt es die Bildung von weiterem FSH, sodass kein neuer Follikel heranreifen kann. Das
durch die Hülle des Follikels gebildete Hormon Progesteron fördert die weitere Verdickung der Gebärmutterschleimhaut sowie die
Einlagerung von Nährstoffen, sodass ein ggf. vorhandener Keim optimal versorgt werden kann.
Ohne Follikel und Follikelhülle sind nach und nach weniger Östrogen und Progesteron im Blut, sodass die Gebärmutterschleim-
haut nicht aufrechterhalten wird und unter Blutungen abreißt. Gleichzeitig wird die Hemmung der FSH-Bildung verringert und ein
neuer Follikel kann heranreifen.
0 4 Beschreibe das Diagramm.
a) Das Geburtsgewicht des Kindes einer Nichtraucherin beträgt ca. 3200 g, seine Körperlänge etwa 52 cm.
b) Bei einer Raucherin wiegt das Kind hingegen ca. 2700 g und ist 48 cm lang.
$ 5 Beurteile das Verhalten der Mütter.
Rauchen während der Schwangerschaft schädigt das ungeborene Kind. Die Mutter beeinflusst somit mitunter negativ das gesam-
te weitere Leben des Ungeborenen. Das Verhalten der Mutter ist unverantwortlich, denn sie setzt das Kind einer Situation aus, der
es nicht entfliehen kann.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
10 Immunbiologie
10.1 Bakterien

Bakterien: Die erfolgreichste Lebensform (Seite 304/305)


0 1 Berechne die Anzahl an Bakterien, die sich aus einem Bakterium unter besten Bedingungen nach 5 Stunden ergibt, und stelle
die Entwicklung der Bakterienanzahl grafisch dar.
Nach 5 Stunden und einer Verdopplungszeit von 20 Minuten haben sich aus einem Bakterium durch Teilung 32 768 Bakterien
gebildet (s. Abb.).

35 000

30 000
Bakterien (Anzahl)

25 000

20 000

15 000

10 000

5 000

0
0 1 2 3 4 5 6
Zeit (Stunden)

. 2 Vergleiche deine grafische Darstellung mit Abb. 5 und erkläre die Unterschiede.
Unter realen Bedingungen verringert sich die Zunahme der Anzahl der Bakterien und wird sogar rückläufig. Die große Zahl an
Bakterien wird nicht mehr optimal versorgt (Begrenztheit der Ressourcen wie Nährstoffe und Sauerstoff) und es kommt zudem
zur Anhäufung schädlicher Stoffwechselprodukte.
$ 3 Verglichen mit der Spitzengeschwindigkeit von Geparden (120 km pro Stunde; 33,3 Meter pro Sekunde) sind Bakterien mit
30 µm pro Sekunde langsam. Bezogen auf die Körperlänge (Bakterium: 2 µm; Gepard: 1 m) ergibt sich ein anderes Bild. Berech-
ne die relativen Geschwindigkeiten (Meter pro Sekunde und Länge) eines Geparden und eines Bakteriums.
relative Geschwindigkeit Gepard: 33,3 Körperlängen pro Sekunde
relative Geschwindigkeit Bakterium: 15 Körperlängen pro Sekunde

Praktikum: Experimentieren mit Bakterien (Seite 306)


1 Beim mikrobiologischen Arbeiten muss strikt auf Sterilität geachtet werden, z. B. dürfen keine Bakterien durch Anfassen oder
Husten in den Nähragar geraten. Erläutere, welche Folgen das haben könnte.
Es könnten unbeabsichtigt Erreger für Krankheiten vermehrt werden.
2 Beim Abkühlen und Festwerden des Agars liegen Bakterien einzeln vor. Nach der Bebrütung sieht man weiße oder gelbe
Flecken. Erkläre.
Jedes Bakterium vermehrt sich unter den Bedingungen so stark, dass eine Kolonie aus einer Vielzahl von Bakteriennachkommen
sichtbar wird.
3 Die Bakterien aus dem Joghurt sind auf Nährstoffe angewiesen. Plane ein Experiment zur Überprüfung dieser Aussage.
Der Versuch kann ohne Nährstoffpulver-Zugabe wiederholt werden. Ein Vergleich der Ergebnisse müsste zeigen, dass sich ohne
Nährstoffpulver keine sichtbaren Kolonien aus den Joghurt-Bakterien entwickeln.

Material: Bakterielle Phänomene verstehen (Seite 307)


0 1 Es ist nicht der Zucker, der Zahnschäden verursacht. Entwickle mithilfe der in Abb. 2 erkennbaren Versuchsergebnisse eine
Hypothese zu den Ursachen von Zahnschäden durch Bakterien.
Ein Zahn in Zuckerwasser ohne Bakterien (steril) bleibt unversehrt (a), ebenso ein Zahn mit darauf befindlichen Bakterien (Bio-
film) ohne Zucker (b). Hingegen wird ein Zahn zerstört, auf dem sich ein Biofilm befindet und der sich in Zuckerwasser befindet
(c). Da der gleiche Effekt mithilfe von Säure erzielt werden kann (d), kann der Schluss darauf gezogen werden, dass es von Bak-
terien erzeugte Säure ist, die Zerstörungen am Zahn verursacht. Säure wird aber nur dann von Bakterien erzeugt, wenn sie über
Zucker als Nährstoff verfügen können.
0 2 Beschreibe die rote Wachstumskurve eines Bakteriums unter Verwendung der Begriffe Minimum, Optimum und Maximum.
Am besten wächst die Bakterienart (rote Kurve) bei ca. 37 °C (Temperaturoptimum). Werden 10 °C (Minimum) unter- oder ca. 45 °C
(Maximum) überschritten, findet kein Wachstum statt, zu erkennen am Ausbleiben einer Zunahme an Biomasse. Der Anstieg der
Wachstumskurve (von 10 °C hin zum Optimum) ist weniger steil als der Abfall vom Optimum zum Maximum. Die Spanne (Tempe-
raturbereich, in dem Wachstum stattfindet) beträgt 35 °C (Spanne = Maximum – Minimum).

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 BW Biologie Lösungen
Grafik: Otto Nehren, Achern
$ 3 Erkläre die konservierende Wirkung folgender Methoden: eingefroren lagern, im Kühlschrank lagern, kochend in ein Gefäß
abfüllen und es dann dicht verschließen.
Eingefrorene Lebensmittel enthalten kein flüssiges Wasser als Grundlage für den bakteriellen Stoffwechsel. Das Termperatur-
minimum für Bakterienwachstum ist zudem unterschritten. Im Kühlschrank wird das Bakterienwachstum langsamer, aber nicht
vollständig gestoppt. Durch Kochen werden die Bakterien abgetötet. Gelangen keine Bakterien später zum Lebensmittel, findet
kein bakterieller Abbau statt.
. 4 Auf einer Käsepackung findest du folgende Angabe: Bei Lagerung unter 4 °C mindestens haltbar bis … Erläutere die Bedeu-
tung dieser Aussage, wobei du berücksichtigst, dass die Packung im Kühlschrank lagert, aber zu den Mahlzeiten eine Stunde
auf dem Tisch liegt.
Eine Temperatur von 4 °C liegt bei den meisten Bakterien unter dem Minimum für Wachstum. Bakterien vermehren sich auf dem
Käse nur sehr langsam oder gar nicht. Auf dem Tisch erwärmt sich der Käse, die Bakterien vermehren sich. Diese Zeiten verringern
die Haltbarkeit des Käses.

Entzündung (Seite 308/309)


0 1 Eine entzündete Hautstelle ist rot, fühlt sich warm an, sie pocht und drückt ein wenig. Im Laufe einer Entzündung bildet sich
Eiter. Nenne für diese Anzeichen von Entzündung die jeweilige Ursache.
Eine entzündete Hautstelle ist rot, weil durch Weitstellung der Kapillaren mehr Blut durch sie hindurchströmt. Sie ist warm, weil
mit dem erhöhten Blutstrom auch größere Wärmemengen zur Hautstelle transportiert werden. Die erhöhte Blutmenge drückt auf
die Kapillaren im Rhythmus des Herzschlags, über Druckrezeptoren nehmen wir dies wahr. Durchlässigere Kapillaren lassen mehr
Flüssigkeit in die Gewebe treten. Dies nehmen wir als Druck wahr. Ausgewanderte Fresszellen (neutrophile Granulocyten) sterben
„nach getaner Arbeit“ am Ort der Infektion millionenfach ab. Findet die Entzündung nahe der Körperoberfläche im Bereich einer
Wunde statt, werden die abgestorbenen Fresszellen als Eiter wahrnehmbar.

Extra: Fremderkennung (Seite 309)


1 Stelle den Ablauf einer Entzündung vom Eindringen der Erreger bis zum Abklingen der Entzündung in einem Verlaufsschema
dar.
Das Verlaufsschema kann sich in der Abfolge der Teilschritte an Abb. 1 auf Seite 308 im Schülerbuch orientieren.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
10.2 Angeborene und erworbene Immunität

Entzündung und Antikörper (Seite 310)


0 1 Beschreibe die Auswirkungen der Tatsache, dass Antikörper zwei Bindungsstellen für Erreger haben und nicht nur eine.
Hätten Antikörpermoleküle lediglich eine Bindungsstelle für Fremdkörper, könnten sie diese zwar immer noch für Fresszellen mar-
kieren, nicht aber verklumpen, weil Verklumpung darauf zurückgeht, dass Antikörpermoleküle „Brücken“ zwischen benachbarten
Fremdkörpern bilden, indem sie mit je einer Bindungsstelle an zwei Fremdkörper binden.
$ 2 Von einer infizierten Gewebestelle können sich Bakterien über Blut- und Lymphgefäße im Körper ausbreiten (Sepsis). Erläute-
re, wie das Immunsystem dagegen vorgeht.
Eine Infektion wird meist durch Entzündungsreaktionen an einer Ausbreitung gehindert. Breiten sich Erreger gelegentlich
dennoch weiter aus, werden sie von Antikörpern, die sich in allen Körperflüssigkeiten befinden, gebunden und für Fresszellen
markiert. Dadurch sind wir insgesamt („systemisch“) geschützt.

Immunzellen in unserem Körper (Seite 311)


0 1 Beschreibe den Weg einer Immunzelle vom Knochenmark in einen Lymphknoten.
Die Immunzelle (z. B. Antikörper produzierender Lymphocyt, Killerzelle) tritt durch die Wand der Kapillaren, die durch das
Knochenmark ziehen, in das Blut. Mit dem Blut wird die Zelle durch das Gefäßsystem transportiert. Entweder tritt sie durch die
Wandung von Kapillaren, die einen Lymphknoten durchziehen, in diesen ein oder sie tritt im Bereich der Gewebe aus Kapillaren
aus, wandert durch das Gewebe zu einem Lymphgefäß, tritt durch dessen Wandung in die Lymphflüssigkeit und lässt sich in den
Lymphknoten befördern.
$ 2 Fresszellen leben rund 48 Stunden. Wenn sie in den Geweben absterben, werden sie von anderen Immunzellen aufgenom-
men und beseitigt. Die Anzahl der Fresszellen im Blut bleibt dennoch konstant, wenn keine Infektion vorliegt. Erläutere.
Die Zahl der Fresszellen (neutrophile Granulocyten) bleibt mehr oder weniger konstant, weil ständig Zellen aus dem Knochenmark
in das Blut und genauso viele vom Blut in die Gewebe treten. Es handelt sich um ein Fließgleichgewicht. Obwohl die Zahl der
Zellen im Blut mehr oder weniger konstant bleibt, fließen beständig viele Zellen zu und ab.

Erworbene Immunität (Seite 312/313)


$ 1 Erläutere, ob bzw. unter welchen Voraussetzungen nach einer passiven Immunisierung langfristig Immunität vorliegt.
Bei der passiven Immunisierung werden erregerspezifische Antikörper verabreicht. Die Antikörper produzierenden Lymphocyten
des Impflings werden dadurch nicht aktiviert. Folglich werden auch keine Gedächtniszellen angelegt. Da Antikörper wie alle Eiwei-
ße (Proteine) in Körperflüssigkeiten einem beständigen (enzymatischen) Abbau unterliegen, nimmt ihre Konzentration mit der
Zeit ab. Wird eine bestimmte Konzentration unterschritten, weist der passiv Geimpfte keinen Schutz mehr gegen den Erreger auf.
In Einzelfällen kann die Bildung von Gedächtniszellen erfolgt sein, bevor alle Erreger durch die passive Immunisierung deaktiviert
sind.
0 2 Gegen einige Erreger reicht eine Grundimmunisierung ein Leben lang. Liste diejenigen Erreger auf, gegen die „aufgefrischt“
werden muss.
Eine „Auffrischungsimpfung“ wird gegen die Erreger des Wundstarrkrampfes (Tetanus), der Diphtherie, des Keuchhustens, der
Kinderlähmung (Polio) und gegen Pneumokokken (Erreger von Lungenentzündung) empfohlen.
. 3 Masern hinterlassen bei einem Teil der erkrankten Kinder Schäden. Bewerte die Argumente für und wider das Impfen gegen
Masern.
Um beurteilen zu können, ob und in welchen Fällen eine Impfung empfehlenswert ist, müssen die Wahrscheinlichkeiten und die
Schwere von Folgeschäden einer Infektion bei Ungeimpften mit den Wahrscheinlichkeiten und der Schwere von Impfschäden
gegeneinander abgewogen werden. Bei dieser Abwägung spielt es keine Rolle, ob der Erreger zur Natur gehört. Dass Firmen mit
Impfstoffen Geld verdienen, ist kein sinnvolles Gegenargument. Entscheidend für die Abwägung ist, dass die gesundheitlichen
Gefahren für Ungeimpfte größer sind als mögliche Impfschäden.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
10.3 Immunsystem und Krankheit

Bakterien als Krankheitsursache (Seite 314)


$ 1 In der Pubertät produziert unsere Haut mehr Fett. Bei einigen Jugendlichen vermehren sich dann Bakterien der Art P. acnes
stark. Die Bakterien setzen Stoffe frei, die Immunzellen anlocken und aktivieren. Die Haut entzündet sich. Erläutere.
Bakterien der Art P. acnes siedeln auf unserer Haut. Sie setzen Stoffe frei, die in die Haut eindringen und die von Wächterzellen
(Makrophagen) mithilfe von Rezeptoren als körperfremd erkannt werden. Die Wächterzellen setzen Botenstoffe frei, die Entzün-
dungsreaktionen in Gang setzen (erhöhte Durchlässigkeit und Klebrigkeit von Kapillaren, Anlockung von Fresszellen, also von
neutrophilen Granulocyten.
$ 2 Auch Ärzten fällt es oft schwer, auf eine Infektion mit Borrelien zu schließen. Begründe.
Die Inkubationszeit, also die Zeitspanne, die zwischen dem Eindringen von Borrelien in den Körper und dem Auftreten von Krank-
heitsanzeichen (Symptomen) liegt, kann Jahre betragen. Dann ist der Zeckenbiss längst vergessen. Da Symptome an zahlreichen
Organen auftreten können und auch bei ganz anderen Erkrankungen vorkommen, ist das Krankheitsbild schwer auf die Infektion
mit Borrelien zurückzuführen.

Mit Antibiotika Bakterien bekämpfen (Seite 315)


. 1 Zum Nachweis des Antibiotikums schnitt Fleming den Bereich aus dem Nährboden, in dem sich weder Schimmelpilze noch
Bakterien befanden, und gab das Material auf einen Nährboden mit Bakterien. Erkläre, wie er mit diesem Versuchsansatz
belegen konnte, dass der Pilz einen gegen die Bakterien wirkenden Stoff ausgeschieden hat.
Im Bereich um das ausgeschnittene Material, wachsen auf dem Nährboden keine Bakterien. Es muss ein Bakterien abtötender
Stoff mit dem ausgeschnittenen Material übertragen worden sein. Er ist auf den Nährboden übergetreten und hat dort Bakte­
rienwachstum verhindert. Als Kontrolle könnte Material aus einem Bereich ausgeschnitten und übertragen werden, der nicht im
Einflussbereich des Pilzes gelegen hat und also keinen bakteriziden Stoff enthalten kann. Mit diesem Material dürfte bakterielles
Wachstum nicht verhindert werden, wenn der Pilz tatsächlich Quelle des Bakteriengiftes ist.

Viren als Krankheitsursache (Seite 317)


0 1 Bei HIV versagt das Immunsystem. Begründe.
HI-Viren nutzen mit den Helferzellen diejenigen Immunzellen als Wirtszellen, die bei der Aktivierung von Killerzellen und Antikör-
per produzierenden Lymphocyten eine Schlüsselrolle spielen. Da die Wirtszellen zugrunde gehen, versagt die Immunabwehr nicht
nur hinsichtlich der HI-Viren. Die Abwehr verschiedenster Erregerarten ist gestört.
$ 2 Nach Aktivierung vermehren sich Helfer- und Killerzellen, es werden Gedächtniszellen angelegt. Sie machen uns immun.
Erläutere. Tipp zur Bearbeitung: Schlage die Rolle der Gedächtniszellen bei der Antikörperproduktion nach.
Gedächtniszellen, die beim Erstkontakt mit einem bestimmten Erreger gebildet werden, reagieren auf den Erreger, wenn er erneut
in den Körper gelangt, also beim Zweitkontakt viel schneller als „unerfahrene“ Immunzellen. Das bedeutet bei Killer- und Helfer-
zellen, dass sie sich in kürzester Zeit vermehren und die große Zahl an erregerspezifischen Immunzellen ohne Verzögerung ihre
Funktionen ausführen können.
$ 3 Erläutere, in welchen Stadien einer Infektion mit Viren Antikörper wirksam sind.
Antikörper werden von Lymphocyten in die Körperflüssigkeit ausgeschieden. In allen „Flüssigkeitsräumen“ unseres Körpers (z. B.
Blut, Gewebsflüssigkeit, Lymphflüssigkeit) erkennen, binden und markieren sie Fremdkörper für die Beseitigung durch Fresszellen.
Hingegen sind Erreger innerhalb von Zellen für Antikörper unerreichbar. Aus diesem Grund können Antikörper nur gegen Viren
wirksam sein, die sich in der Körperflüssigkeit aber nicht in Zellen befinden.

Malaria: Einzeller als Krankheitsursache (Seite 318)


$ 1 Die Larven der Anopheles-Mücke entwickeln sich nur in stehendem Süßwasser (z. B. in Pfützen, Regenrinnen, usw.). Die
Mücken selbst sind dämmerungs- und nachtaktiv. Skizziere Strategien, um den Kreislauf der Infektion zu unterbrechen.
Die Entwicklung von Anopheles-Mücken kann unterbrochen werden. Dies kann dadurch erreicht werden, dass stehende Süßge-
wässer Pfützen, Abwasserkanäle, etc.) beseitigt oder abgedeckt werden, in denen die Larven der Anopheles-Mücke leben. Moski-
tonetze sind wirksam, da sie Schlafende vor Stichen und damit einer Infektion schützen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Seuchen (Seite 319)
0 1 Abb. 2 zeigt den typischen Verlauf einer Seuche mit einem neuartigen und hoch ansteckenden Erreger. Beschreibe die Grafik.
Die Anzahl der Neuinfizierten steigt rasch an, erreicht nach rund zwei Monaten ihren Höhepunkt und fällt dann ebenso rasch ab,
wie sie angestiegen ist.
$ 2 Einige wenige mit einem neuartigen Grippevirus Infizierte reichen aus, um viele Nicht-Infizierte anzustecken. Diese wiederum
stecken weitere an usw. Später sinkt die Anzahl der Neuinfektionen. Erkläre dies unter Bezug auf Abb. 2.
Infiziert ein unbekannter Erreger einen Menschen, hat das Immunsystem dem Erreger nichts entgegenzusetzen. Die Infektion
kann sich in der Population zu einer Epidemie ausbreiten, wenn sich viele Menschen anstecken. Der Erreger breitet sich rasch
nach dem Schneeballprinzip aus. Erwerben Menschen mit der Erkrankung Immunität gegenüber dem jeweiligen Erreger, sind sie
nicht erneut infizierbar. Infizierte Personen treffen seltener auf infizierbare. Die Anzahl der Infektionen geht zurück.

Material: Seuchen (Seite 320/321)


$ 1 Die Pandemien der letzten Jahrzehnte, die durch neuartige Erreger wie AIDS, Schweinegrippe und Vogelgrippe verursacht
werden, hatten ihren Ursprung in Afrika oder Asien. Flugstrecken und -zeiten können die Ausbreitungswege und -geschwin-
digkeiten der Erreger nachvollziehbar machen (Abb. 1). Erläutere.
Die Erreger der genannten Pandemien konnten sich ausbreiten, weil die Erreger von Mensch zu Mensch übertragen werden
konnten und Infizierte durch die Reisen die Erreger auf andere Kontinente getragen haben. Dort trafen sie auf viele Infizierbare,
sodass die Erreger dort rasch verbreitet wurden. Weil Fernreisende heute in der Regel Flugzeuge nutzen, kann die Kette der Anste-
ckungen mithilfe von Flugplänen rekonstruiert werden.
. 2 HI-Viren, die Erreger von AIDS, werden durch Körperflüssigkeiten übertragen, Schweinegrippe- und SARS-Viren durch Tröpf-
cheninfektion. HI-Viren haben Jahrzehnte, Schweinegrippe- und SARS-Viren ein paar Monate gebraucht, um eine Pandemie
auszulösen. Entwickle zu diesen Sachverhalten eine Hypothese.
Zum Austausch von Körperflüssigkeit kommt es – abgesehen von Blutübertragungen – in der Regel bei sexuellen Kontakten. Die
Anzahl dieser Kontakte ist wesentlich kleiner als die Möglichkeiten, Personen durch Tröpfcheninfektion anzustecken.
0 3 Berechne die durchschnittliche tägliche Reisestrecke aller registrierten Geldscheine (den prozentualen Anteil der Scheine, die
mehr als 10 000 km täglich zurücklegen; den prozentualen Anteil von Scheinen, die weniger als 5 km zurücklegen).
Pro Tag reisen alle registrierten Geldscheine zusammen 92 136 731 km. 0,01 Promille aller Geldscheine legen pro Tag mehr als
10 000 km zurück, hingegen 23 Prozent aller Geldscheine weniger als 5 km.
. 4 Geldscheine mit kleinen und großen Strecken geben Hinweise auf die Ausbreitung von Erregern. Begründe.
Anhand der täglich zurückgelegten Strecken von registrierten Geldscheinen lassen sich die Reisewege der Menschen rekonstruie-
ren, die diese Geldscheine mit sich trugen. Geldscheine mit kleinen Strecken geben Hinweise auf die Ausbreitung der Erreger im
Nahfeld. Hier ist die Zahl sozialer Kontakte – gemessen an der Zahl erfasster Geldscheine – am größten, also ist zu erwarten, dass
die größte Anzahl an Neuinfektionen im Nahfeld auftritt. Größere Strecken werden von vergleichsweise wenigen Geldscheinen
zurückgelegt. Sie steht für die Ausbreitung der Erreger an einem weit entfernten Ort. Tritt diese Ereignis ein, entwickelt sich dort
die gleiche Dynamik im Nahfeld wie im ursprünglichen Infektionsherd.
. 5 Geld und Krankheitserreger sind unterschiedliche Dinge. Deswegen kann zwar die Verbreitung eines Erregers, nicht aber der
Beginn einer Epidemie (Pandemie) nachgestellt werden. Begründe.
Die Phase des Übergangs vom Tier zum Menschen kann mithilfe von Geldscheinen nicht modelliert werden, mit ihnen lässt sich
vielmehr die Ausbreitung der Erreger in einer Population und darüber hinaus nachvollziehen. Auch das Abklingen einer Epidemie
dadurch, dass mit einer Erkrankung Immunität gegenüber dem Erreger erworben wird, wird von dem Modell nicht erfasst.
0 6 In der Stadt Essen brachen 2010 die Masern aus. Beschreibe die Ansteckungswege (Abb. 3).
Ausgangspunkte der Ansteckungsketten waren nicht gegen Masern geimpfte Kinder, die Masern in Schulen und Kindergärten auf
nicht geimpfte Kinder übertragen haben. Lediglich drei Fälle gehen auf eine Ansteckung in Familien zurück (Geschwisterkinder).
. 7 Auf fast alle in Essen an Masern Erkrankten traf mindestens eins der folgenden Merkmale zu: Eltern lehnen Masernimpfun-
gen ihrer Kinder ab, behandelnder Arzt impft nicht gegen Masern, Geschwisterkind erkrankt (3 Fälle). Kinder ohne Immun-
schutz gegen Masernviren wurden von der Schule (Kindergarten) ausgeschlossen. Bewerte diese behördliche Maßnahme.
Angesichts der Tatsache, dass es in Deutschland keine Impfpflicht gibt, könnte man davon ausgehen, dass Nichtimpfen harmlos
ist. Masern sind aber keine harmlose Kinderkrankheit. Um die Erkrankung nicht geimpfter Kinder und die Verbreitung der Erreger
durch sie zu verhindern, werden nicht geimpfte Kinder bei Masernausbrüchen von Schule und Kindergarten ausgeschlossen.
$ 8 Elend und Armut der Menschen im globalen Süden, durch Kriege und Naturkatastrophen verursacht oder verschlimmert,
waren die größten Hindernisse bei der Unterbrechung der Infektionsketten der Pocken. Erkläre.
Armut und Elend sind häufig mit einem geringen Bildungsstand verknüpft. Das erschwert das Überzeugen der Menschen von
Quarantänemaßnahmen bei Infizierten und von Schutzimpfungen bei Nichtinfizierten. Außerdem ist häufig eine flächendeckende
Impfung schwierig.
$ 9 Der Mensch ist der einzige Wirt von Pockenviren. Erkläre, warum das ein Vorteil bei der Ausrottung von Pocken war.
Da der Mensch der einzige Wirt des Pockenvirus ist, dürften nach Ausrottung von Pockenerkrankungen keine weiteren Fälle von
Pocken mehr auftreten, weil sich ein Mensch nur an einem erkrankten Menschen – und z. B. nicht an Tieren – anstecken kann.
Sind Tiere Reservoire für Erreger menschlicher Infektionskrankheiten, ist eine Bekämpfung ungleich schwerer.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
. 10 Entwickle Strategien zur Ausrottung der Masern (Abb. 4) in Deutschland bzw weltweit.
Wie aus Abbildung 4 hervorgeht, ist der Mensch der einzige Wirt der Masernviren, ein Tierreservoir gibt es wie bei Pockenviren
nicht. Da ein Impfstoff gegen Masernviren zur Verfügung steht, sollte einer vollständigen Durchimpfung der Bevölkerung bei uns
eigentlich nichts entgegenstehen. Ein funktionierendes Gesundheitssystem, genügend Geld und ein hoher Bildungsstand sind
vorhanden. Aufklärung oder die Einführung einer Impfpflicht könnten helfen, wenn auch durch Reisen immer wieder Infektionen
auftreten können.

Unerwünschte Immunreaktionen (Seite 322/323)


0 1 Den Anzeichen einer Allergie liegen zelluläre Vorgänge zugrunde. Benenne diese.
Allergischen Reaktionen liegt eine Immunisierung gegen körperfremdes Material zugrunde. Lymphocyten produzieren Antikörper.
Diese Antikörper binden an Mastzellen, die dadurch sensibilisiert werden. Binden Allergene an die Antikörper auf der Oberfläche
der Mastzellen, werden die Zellen aktiviert. Sie setzen dann eine Reihe von Botenstoffen frei, die beispielsweise über Muskelzellen
der Bronchien zu Atemnot und Asthma, bei Schleim produzierenden Zellen der Atemwege zu Atemnot, bei Zellen der Kapillarwan-
dung zu Schwellungen und Rötung der betroffenen Hautstelle führen können.
$ 2 Die Zellen des Immunsystems gehen in der Regel nicht gegen körpereigene Zellen vor. Erläutere dies.
Bei der Heranreifung werden Antikörper produzierende Lymphocyten oder Killerzellen zum Absterben gebracht, wenn sie mithilfe
ihrer Rezeptoren Material binden. Das ist biologisch sinnvoll, denn dabei kann es sich nur um körpereigenes Material handeln,
weil die Immunzellen in einer sterilen Umgebung heranreifen.

Teste dich selbst (Seite 325)


0 1 Ordne den Antikörper produzierenden Immunzellen (Lymphocyten) in Abb. 1 die Erreger zu, von denen sie aktiviert werden,
und erläutere deine Entscheidungen.
Bakterium; passender Lymphocyt
a) 1
b) 3
c) 4
d) Passt zu keiner Immunzelle, da es keine Oberflächenstrukturen trägt.
Ein Lymphocyt erkennt Fremdkörper anhand von Oberflächenstrukturen, die nach dem Schlüssel-Schloss-Prinzip zu den Antikör-
pern auf ihrer Oberfläche passen.
$ 2 Fertige eine Skizze an, aus der die Wirkung von Antikörpern ersichtlich wird.
siehe Abbildung

$ 3 Beschreibe die Aussage des Diagramms (Abb. 2).


Bei der Erstinfektion mit einem Erreger dauert es rund 14 Tage, bis die Antikörperkonzentrationen in den Körperflüssigkeiten ihr
Maximum erreichen. Bei einer Zweitinfektion dauert es nur rund 7 Tage, bis die höchste Antikörperkonzentration erreicht wird. Die
Konzentration ist mehr als doppelt so hoch wie bei einer Erstinfektion.
. 4 Erkläre die Entwicklung der Antikörperkonzentrationen bei der Erst- und Zweitinfektion mit demselben Erreger.
Bei einer Erstinfektion gibt es noch keine Gedächtniszellen im Körper. Diese werden im Rahmen einer Erstinfektion erst angelegt.
Die Gedächtniszellen sind erregerspezifisch. Dringt der gleiche Erreger später noch einmal in den Körper ein, werden sie von den
Gedächtniszellen erkannt, die Zellen vermehren sich und wandeln sich in kürzester Zeit in Antikörper produzierende Lymphocyten
um. Die Antikörperkonzentration ist bei einer Zweitinfektion so hoch, weil sich Gedächtniszellen rasch vermehren und mehr Zellen
auch mehr Antikörper produzieren können.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
$ 5 Lege eine Tabelle an, aus der die Funktionen der gezeigten Immunzellen hervorgehen.
Mastzellen: erkennen Fremdkörper und lösen mithilfe von Botenstoffen Allergien aus, die Entzündungsreaktionen ähneln. Mast-
zellen erkennen Fremdkörper mithilfe von Antikörpern auf ihrer Oberfläche.
Fresszellen (neutrophile Granulocyten): beseitigen durch Einverleiben Bakterien für die sie auf ihrer Oberfläche Rezeptoren auf-
weisen;
Wächterzellen (Makrophagen): Erkennen sie Bakterien, für die sie auf ihrer Oberfläche Rezeptoren tragen, lösen sie mithilfe von
Botenstoffen Entzündungsreaktionen aus. Wächterzellen verleiben sich Fremdkörper auch ein. Das ist wichtig, weil Wächterzellen
Helferzellen aktivieren, indem sie ihnen Bruchstücke von Erregern präsentieren.
Antikörper produzierende Zelle (Lympho­cyt): Lymphocyten stellen Antikörper her, die zu Erregern wie der Schlüssel zu einem
Schloss passen. Sie erkennen Fremdkörper mithilfe von Antikörpern auf ihrer Oberfläche.
Killerzellen: Killerzellen spüren von Viren befallene Gewebezellen auf und töten sie ab. Killerzellen weisen auf ihrer Oberfläche
Rezeptoren für Virenbruchstücke auf.
Helferzellen: Helferzellen stimulieren Killerzellen und Antikörper produzierende Zellen. Helferzellen weisen auf ihrer Oberfläche
Rezeptoren für Erregerbruchstücke auf.
. 6 Immunreaktionen auf Erreger basieren auf dem Zusammenspiel mehrerer Typen von Immunzellen. Erläutere an einem ausge-
wählten Beispiel.
Mehrere Lösungen sind möglich, z. B.:
a) Dringen Bakterien in den Körper ein, werden Wächterzellen aktiviert und locken mithilfe von Botenstoffen Fresszellen an.
b) Mastzellen benötigen Antikörper, die sie auf ihrer Oberfläche binden, um Fremdkörper erkennen, d. h. binden zu können.
Diese Antikörper wurden zuvor von Lymphocyten produziert und in die Körperflüssigkeiten abgegeben.
c) Vor einer Antikörperproduktion aktivieren Wächterzellen Helferzellen, die die passenden Lymphocyten aktivieren. Diese pro-
duzieren dann Antikörper.
0 7 Vergleiche aktive und passive Impfung.
Bei der aktiven Immunisierung reagieren Lymphocyten auf Antigen und produzieren zum Antigen passende Antikörper. Im Rah-
men dieser Reaktion werden Lymphocyten-Gedächtniszellen angelegt, die bei einer erneuten Infektion mit dem gleichen Erreger
in kurzer Zeit hohe Antikörperkonzentrationen erzeugen. Bei der sog. passiven Immunisierung werden einem Erkrankten zum
Erreger passende Antikörper gespritzt. Diese Antikörper wurden von Lymphocyten in Versuchstieren oder von Lymphocyten im
Reagenzglas produziert. Gedächtniszellen werden im Patienten nicht angelegt
$ 8 Erläutere die in Abb. 4 dargestellte Vorgehensweise.
Die Abbildung zeigt die aktive Immunisierung eines Versuchstieres, gespritzt werden abgeschwächte Erreger. Nachdem eine Anti-
körperproduktion stattgefunden hat, wird Körperflüssigkeit entnommen, um die Antikörper zu einem Medikament für die passive
Immunisierung aufzuarbeiten.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
11 Genetik
11. 1 Organisationsformen des genetischen Materials

Eltern geben ihr genetisches Material weiter (Seite 328/329)


0 1 Erstelle einen möglichen Karyogrammausschnitt für ein weiteres Kind der in Abb. 3 dargestellten Eltern.
Verschiedene Lösungen denkbar, z. B.


1 2 3 4 5 20 21 22

$ 2 Erkläre mithilfe von Abb. 3, warum Geschwister sich zwar ähnlich sehen, aber nie komplett gleich sind.
Dadurch, dass Vater und Mutter über jeweils zwei homologe Chromosomen verfügen und zufallsmäßig nur ein Chromosom weiter-
geben, entsteht für jedes Geschwisterkind ein individuelles Chromosomenmuster. Bei 23 Chromosomen sind die Möglichkeiten der
Kombination so groß, dass zwei Geschwister nie das gleiche Muster haben. Beide sind jedoch ähnlich, weil sie in einigen Merkma-
len übereinstimmen.

Zellteilung und Mitose (Seite 330/331)


0 1 Fasse die Vorgänge des Zellzyklus zusammen. Wähle dazu eine der drei Vorgehensweisen aus:
a) Stelle die Phasen des Zellzyklus in Form einer Tabelle dar. Berücksichtige dabei die Struktur des genetischen Materials
und das Vorhandensein einzelner Zellorganellen.
siehe Tabelle

Struktur des genetischen Materials Kernmembran Spindelfasern


Interphase Chromosomen als Chromatin; am Ende Doppelchromosomen; im Lichtmikroskop vorhanden nicht vorhanden
nicht zu unterscheiden.
Prophase Doppelchromosomen aufgerollt und gefaltet; im Lichtmikroskop sichtbar. aufgelöst wird gebildet
Metaphase Doppelchromosomen aufgerollt und gefaltet; ordnen sich in Äquatorialebene an; im aufgelöst ausgebildet
Lichtmikroskop sichtbar.
Anaphase Doppelchromosomen werden getrennt. aufgelöst ausgebildet
Telophase Chromosomen entfalten sich. neu gebildet aufgelöst

b) Stelle die Phasen des Zellzyklus in Form eines Verlaufsschemas dar.


siehe Abbildung

Interphase

Chromosomen werden verdoppelt

Prophase
Doppel-Chromosomen werden aufgerollt und gefaltet,
Kernmembran wird aufgelöst, Spindelfasern bilden sich

Metaphase
Doppel-Chromosomen werden aufgerollt und gefaltet,
ordnen sich in Äquatorialebene an, Spindelapparat
ausgebildet
Anaphase
Doppel-Chromosomen werden getrennt, wandern zu den
Polen

Telophase
Chromosomen entfalten sich, Kernmembranen werden
gebildet, Spindelfasern haben sich aufgelöst

c) Bereite einen kurzen Vortrag über die Vorgänge des Zellzyklus vor. Notiere dazu Stichworte.
siehe Aufgabe 1 und 2

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Meiose und Keimzellbildung (Seite 332/333)
0 1 Vergleiche Mitose und Meiose in Form einer Tabelle.
siehe Tabelle; es sind auch andere Lösungen denkbar.

Mitose Meiose
Zahl der Teilungen eine Teilung zwei Teilungen
Chromosomenzahl zu Beginn der Teilungen Chromosomenzahl (46) Chromosomenzahl (46)
Chromosomenzahl nach den Teilungen Chromosomenzahl (46) Chromosomenzahl (23)
Zahl der Tochterzellen zwei mit der Mutterzelle; genetisch iden- vier Tochterzellen; diese sind sowohl
tische Tochterzellen untereinander als auch von der Mutterzelle
genetisch verschieden.
Bedeutung für den Organismus identische Verdopplung von Körperzellen für Herstellung von Keimzellen mit einfachem
Wachstums- und Entwicklungsprozesse Chromosomensatz. Neukombination des
elterlichen Erbgutes zur Erhöhung der gene-
tischen Variabilität bei den Nachkommen.
Ort alle Körperzellen im Wachstum Keimzellen in den Keimdrüsen
Männer und Frauen bei Männern und Frauen identisch bei Männern und Frauen unterschiedlich

0 2 Stelle die Veränderungen der Chromosomenanzahl bei Mitose und Meiose in einer knappen Zeichnung gegenüber. Zeichne
dabei jeweils nur die Zellkerne mit zwei homologen Chromosomenpaaren.
siehe Abbildung

Meiose Mitose

2n 2n

2n

1n

$ 3 Geschwister haben häufig eine gewisse Ähnlichkeit, sind aber nie gleich. Erkläre, wie die Meiose zu dieser Vielfalt beiträgt.
Die genetische Vielfalt wird einmal durch das Crossingover in der Prophase und durch die zufällige Verteilung von mütterlichen
und väterlichen Chromosomen in der Anaphase I erreicht.

Praktikum: Stadien des Zellzyklus (Seite 334)


1 Erstelle für das Vorgehen ein Verlaufsschema.
Wurzelspitzen in ein Reagenzglas geben → 0,5 ml Karmin-Essigsäure zugeben → erhitzen → Wurzelspitzen auf einen Objekt-
träger geben → überschüssige Karmin-Essigsäure absaugen → Präparat quetschen → destilliertes Wasser durch das Präparat
saugen
2 Benenne die mitotischen Teilungsstadien von drei Zellen in deinem Präparat. Begründe die Zuordnungen.
So kannst du vorgehen, um die Aufgabe Schritt für Schritt zu lösen:
a) Mikroskopiere verschiedene Wurzelspitzenpräparate bei mindestens 400-facher Vergrößerung. Skizziere drei Zwiebelzel-
len.
b) Vergleiche deine Zellen mit denen von Mitschülern, die auch schon mit ihren Zeichnungen fertig geworden
sind.
c) Formuliert gemeinsam eine Beschreibung eurer Zwiebelzellen. Berücksichtigt dabei, welche Organellen sichtbar sind, und
beschreibt das Aussehen der Chromosomen.
d) Benennt begründet die Phasen, in denen sich die gezeichneten Zwiebelzellen befinden. Nutzt dazu die Seiten 330/331 und
notiert das Kriterium für die Zuordnung.
individuelle Lösungen

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
Material: Chromosomen im Modell (Seite 335)
0 1 Benenne die von dir im Modell dargestellten Mitosephasen.
individuelle Lösung
0 2 Beschreibe, welche Teile des Modells den Teilen eines Chromosoms entsprechen.
Wollfaden entspricht Einzelchromosom. Zwei gleichfarbige Wollfäden entsprechen einem Doppelchromosom.
$ 3 Erläutere den Darstellungswert und die Grenzen des Wollfaden-Modells.
Der Ablauf der Mitose lässt sich gut darstellen. Die Wollfäden zeigen gut die entspiralisierten Chromosomen. Das Aufrollen der
Chromosomen lässt sich schwieriger darstellen. Es fehlt die Darstellung der Verbindung der Chromosomen am Centromer.
0 4 Beschreibe, welche Strukturen des Chromosoms den Bauteilen des Modells entsprechen.
Einzelner Pfeifenreiniger entspricht Einzelchomosom. Druckknopf entspricht dem Centromer. Zwei miteinander verbundene Pfei-
fenreiniger entsprechen einem Doppelchromosom.
$ 5 Vergleiche das Wollfaden-Modell mit dem Pfeifenreiniger-Modell. Beschreibe dabei jeweils die Aspekte der Mitose, die sich
gut mit dem Modell darstellen lassen, und auch die Aspekte, auf die dies nicht zutrifft.
Im Wollfaden-Modell lässt sich das Chromatin besser darstellen als im Pfeifenreiniger-Modell. Dafür fehlen hier die Centro-
mere, weshalb die Doppelchromosomen schwerer erkennbar sind. Die Centromere ermöglichen aber eine geordnete Verteilung
der Chromosomen. Dies kann mit Pfeifenreinigern gut gezeigt werden. Das Aufrollen der Chromosomen lässt sich nur mit dem
Pfeifenreiniger-Modell darstellen.
$ 6 Auch die Meiose lässt sich im Modell nachstellen. Stelle einem Partner die Vorgänge der Meiose mithilfe des Pfeifenreiniger-
Modells vor. Dein Partner soll dabei die von dir dargestellten Phasen beschreiben. Tauscht nach einem Meiose-Durchgang die
Rollen.
individuelle Lösung

DNA ist das genetische Material (Seite 336/337)


0 1 Stelle in einem Begriffsnetz den Zusammenhang zwischen folgenden Begriffen dar: Chromosom, DNA, Nucleotid, Phosphat,
Basen, Adenin, Guanin, Cytosin, Thymin. Tipp: Informiere dich auf Seite 161, wie ein Begriffsnetz erstellt wird!
siehe Abbildung

Chromosom

enthält

DNA
besteht aus

Nucleotiden

besteht aus

Phosphat und Basen

sind

Adenin, Guanin, Cytosin, Thymin

$ 2 Die Basen der DNA passen zueinander wie Schlüssel und Schloss. Erkläre die Bedeutung des Schlüssel-Schloss-Prinzips für die
Verdopplung der DNA.
Jeweils Adenin und Thymin sowie Guanin und Cytosin passen zueinander wie Schlüssel und Schloss. Dadurch wird gewährleistet,
dass bei der Verdopplung der DNA ein Einzelstrang genügt, um einen neuen Doppelstrang herzustellen. Bei der Verdopplung wird
der Ausgangs-Doppelstrang aufgetrennt und die jeweils fehlende Base ergänzt. So wird die Information des Ausgangs-Doppel-
strangs an die neu entstehenden Tochterzellen weitergegeben.

Vom Gen zum Merkmal (Seite 338/339)


0 1 Stelle den Weg vom Gen zum Protein in Form eines Verlaufsschemas dar.
DNA-Code wird übertragen in m-RNA-Code → m-RNA verlässt den Zellkern → m-RNA wandert zu den Ribosomen → m-RNA-Code
wird in Aminosäureabfolge übersetzt → fertiges Protein entsteht.
0 2 Beschreibe die Entstehung des roten Farbstoffs Betanin in den Rote-Bete-Zellen. Nutze dazu Abb. 2.
Die Gene 1 und 2 werden in m-RNA umgeschrieben (Transkription). Beide m-RNAs wandern aus dem Zellkern heraus und werden
im Cytoplasma in eine Aminosäurekette übersetzt. Die fertigen Aminosäuren falten sich zu Protein 1 und 2. Aus Tyrosin wird mit-
hilfe des Proteins 1 ein Zwischenprodukt hergestellt. Dies wird wiederum mithilfe von Protein 2 zu Betanin umgewandelt. Betanin
führt zur Rotfärbung der Roten Bete.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Material: Der genetische Code (Seite 340)
0 1 Berechne, wie viele verschiedene Aminosäuren sich mit Zweiergruppen, Dreiergruppen bzw. Vierergruppen von Basen codie-
ren lassen.
Bei Zweiergruppen: 42 = 16 Aminosäuren
Bei Dreiergruppen: 43 = 64 Aminosäuren
Bei Vierergruppen: 44 = 256 Aminosäuren
. 2 Stelle eine begründete Hypothese dazu auf, warum ein Codon aus drei Basen besteht.
Bei einer Codierung mit Zweiergruppen könnten nur 16 verschiedene Aminosäuren codiert werden. Da aber 21 verschiedene
Aminosäuren benötigt werden, muss es eine Dreiergruppe sein. Diese könnte sogar 64 verschiedene Aminosäuren codieren. Eine
Vierergruppe wäre zwar auch möglich (256 Aminosäuren), wäre aber unökonomisch, da so viele verschiedene Möglichkeiten nicht
gebraucht werden.
0 3 Übertrage die folgende m-RNA-Basensequenz mithilfe der Codesonne in die entsprechende Abfolge der Aminosäuren.
m-RNA: UACCGAGCUGUCCCUGUGAUC
Tyrosin Arginin Alanin Valin Prolin Valin Isoleucin
$ 4 Ermittle aus der folgenden Basenabfolge UUAUACGUGUAGAUAAUCCUGCCU
a) die komplementäre DNA
AAUAUGCACAUCUAUUAGGACGGA
b) die entsprechende Aminosäure-Abfolge
Histidin – Isoleucin – Tyrosin – Valin

Praktikum: Untersuchung von DNA (Seite 341)


1 Erkläre, warum man die Früchte zerreiben muss, um die DNA zu isolieren.
Durch das Zerreiben werden die festen Pflanzenzellwände zerstört. So werden die Zellkerne freigesetzt, die die DNA enthalten.
2 Mit dem hier beschriebenen Verfahren erhält man keine reine DNA. Es werden z. B. immer Proteine an der DNA haften blei-
ben. Erläutere dies mithilfe der Informationen auf den Seiten 336/337.
Die DNA ist um Proteine gewickelt. Diese Proteine bleiben an der DNA haften.

Mutationen — Veränderungen des genetischen Materials (Seite 342/343)


$ 1 Erkläre mithilfe der Abb. 1 die möglichen Auswirkungen von Genmutationen auf den Bau eines Proteins. Nutze dazu auch die
Seiten 338/339.
Durch den Austausch eines Buchstabens wird der Sinn dieses Wortes verändert. Wird ein Nucleotid der DNA durch ein anderes
ausgetauscht, so kann dies zu einem Einbau einer anderen Aminosäure führen. Diese Veränderung führt dann auch zu einem
veränderten Protein, das gar nicht mehr oder nur eingeschränkt funktionsfähig ist.
Da aber nicht nur ein Codon für eine Aminosäure codiert und sich diese Codons nur in einem Nucleotid unterscheiden, kann es
auch sein, dass ein solcher Austausch gar keine Auswirkungen hat.
Durch den Verlust oder das Hinzukommen eines Buchstabens, geht der Sinn des Satzes komplett verloren. Bei einem Verlust oder
einem Hinzukommen eines Nucleotids führt dies dazu, dass entweder gar kein Protein oder ein völlig verändertes Protein herge-
stellt wird. Solche Mutationen führen immer zu einem Funktionsverlust des Proteins.
0 2 In Abb. 3 ist eine Genommutation dargestellt. Es handelt es sich um eine Trisomie, d. h. ein Chromosom ist dreimal statt zwei-
mal vorhanden. Genommutationen können auch den gesamten Chromosomensatz betreffen (Polyploidie). Stelle grafisch dar,
wie eine solche Genommutation beim in Abb. 3 dargestellten Modellgenom aussähe.
siehe Abbildung

Polyploidie

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
11. 2 Regeln der Vererbung

Vererbung erfolgt nach Regeln (Seite 344/345)


0 1 Welche der folgenden Aussagen sind richtig, welche sind falsch? Begründe deine Entscheidung!
a) Kreuzt man zwei Kaninchen mit rotem Fell, so haben alle Nachkommen ein rotes Fell.
Richtig: Kreuzt man zwei Kaninchen mit rotem Fell, so haben die Nachkommen alle ein rotes Fell.
Da das Merkmal rote Fellfarbe rezessiv ist, zeigen nur homozygote Tiere dieses Merkmal. Das heißt, beide Elternteile
können nur das allele Gen für rote Fellfarbe weitergeben.
b) Kreuzt man zwei Kaninchen mit grauem Fell, so haben die Nachkommen immer ein graues Fell.
Falsch: Kreuzt man zwei Kaninchen mit grauem Fell, so haben alle Nachkommen ein graues Fell.
Tiere mit grauem Fell können sowohl homozygot als auch heterozygot bezüglich dieses Merkmals sein, da es sich um ein
dominantes Merkmal handelt. Kreuzt man zwei graue Kaninchen, die bezüglich des Merkmals Fellfarbe heterozygot sind,
so können auch rote Nachkommen entstehen.
c) Kaninchen mit rotem Fell sind immer homozygot bezüglich dieses Merkmals.
Richtig: Kaninchen mit rotem Fell sind immer homozygot bezüglich dieses Merkmals.
Da es sich um ein rezessives Merkmal handelt, tritt es nur bei homozygoten Tieren auf.
$ 2 Jana erhielt aus der Kreuzung heterozygote graue Kaninchen. Bei grauen Kaninchen lassen sich homozygote von heterozygo-
ten Individuen nicht unterscheiden. Plane ein Vorgehen, mit dem Jana wieder nur homozygot graue Kaninchen für ihre Zucht
erhält.
Jana muss zwei Kaninchen miteinander kreuzen, die beide grau sind. Je nach Elterntieren erhält sie verschiedene Nachkommen.
Die grauen Nachkommen muss sie dann wiederum miteinander kreuzen. Erst wenn sie nach mehreren Generationen immer wie-
der nur graue Tiere erhält, kann sie sicher sein, dass die Tiere bezüglich dieses Merkmals homozygot sind.
Beispiel:
P Bb X Bb
F1 BB Bp Bp pp
BB X Bp
F2 BB BB Bp
BB x BB
F3 Alle BB sicher homozygot
und
Bp x Bp
F3 BB Bp Bp pp

Vererbung beim Menschen (Seite 346/347)


0 1 Ordne den Personen 1 bis 14 in Abb. 3 die entsprechenden Genotypen zu. Verwende dabei schwarz für ein mutiertes Gen und
blau für ein nicht mutiertes Gen.
1: X–; 2: XX; 3: X–; 4: X-; 5: XX;
6: XX; 7: X–; 8: XX; 9: X–; 10: X–;
11: XX; 12: X–; 13: XX; 14: X–
$ 2 Welche der folgenden Aussagen sind richtig, welche falsch? Begründe deine Entscheidung.
a) Bei einem rezessiven Merkmal sind beide Eltern Merkmalsträger, wenn ein Kind Merkmalsträger ist.
Falsch: Bei einem rezessiven Erbgang sind beide Eltern Merkmalsträger, wenn ein Kind Merkmalsträger ist.
Begründung: Wenn beide Eltern heterozygot bezüglich dieses Merkmals sind, können die Nachkommen auch Merkmals-
träger sein, ohne dass die Eltern Merkmalsträger sind.
b) Sind beide Elternteile homozygot bezüglich eines rezessiven Merkmals, so sind alle Kinder Merkmalsträger.
Richtig: Sind beide Elternteile homozygot bezüglich ihres Genotyps für ein rezessiven Merkmals, so sind alle Kinder Merk-
malsträger.
Begründung: Wenn beide Eltern Merkmalsträger sind, müssen sie homozygot bezüglich dieses Merkmals sein. Das heißt,
dass beide Eltern nur die allele Gengruppe weitergeben können, die für die Ausprägung des Merkmals verantwortlich ist.
c) Ist ein Elternteil heterozygot bezüglich eines dominanten Merkmals, können die Kinder Merkmalsträger sein, egal wel-
chen Genotyp der andere Elternteil hat.
Richtig: Ist ein Elternteil heterozygot bezüglich seines Genotyps für ein dominantes Merkmal, können die Kinder Merk-
malsträger sein, egal welchen Genotyp der andere Elternteil hat.
Begründung: Bei einer dominanten Vererbung reicht eine allele Gengruppe aus, damit die Nachkommen Merkmalsträger
sind.
d) Wenn beide Eltern bezüglich eines rezessiven Merkmals heterozygot sind, beträgt die Wahrscheinlichkeit 50 %, dass ein
Kind Merkmalsträger ist.
Falsch: Bei rezessiver Vererbung liegt die Wahrscheinlichkeit, dass ein Kind Merkmalsträger ist, bei 50 %, wenn beide
Eltern bezüglich des Genotyps für dieses Merkmal heterozygot sind.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Gregor Mendel entdeckte Regeln der Vererbung (Seite 348/349)
$ 1 Formuliere die Vererbungsregeln in eigenen Worten. Nutze dazu auch Seite 344/345.
Uniformitätsregel: Kreuzt man zwei Lebewesen, die sich bezüglich eines Merkmals unterscheiden und für dieses Merkmal homo-
zygot sind, so erhält man Nachkommen, die einheitlich die Merkmalsausprägung eines Elternteils zeigen.
0 2 Erstelle das Kreuzungsschema für einen Erbgang zweier reinerbiger Mäuse, die sich in dem Merkmal Fellfarbe unterscheiden.
Braun (B) ist dominant über weiß (b).
Die Mäuse der F1-Generation sind einheitlich braun.
B B
b Bb Bb
b Bb bb
$ 3 Mendel untersuchte auch zwei Merkmalspaare bei Erbsen. Sein Vorgehen sowie das Ergebnis (Unabhängigkeitsregel) kann
Abb. 2 entnommen werden.
a) Beschreibe die zugrunde liegenden Versuche.
Mendel kreuzte Erbsenpflanzen, die sich in zwei Merkmalen unterschieden (Samenfarbe und Samenform). Dabei erhielt
er in der F1-Generation Nachkommen, die einheitlich die Samenform und Samenfarbe eines Elternteils hatten (Uniformi-
tätsregel).
Diese Nachkommen kreuzte er nun wiederum untereinander. Dabei erhielt er in der F2-Generation neben den Merkmals-
kombinationen der Eltern auch Nachkommen mit neuen Merkmalskombinationen. Das heißt, dass diese Merkmale unab-
hängig voneinander vererbt worden waren.
b) Formuliere eine passende Regel zum Versuchsergebnis.
3. Mendel’sche Regel: Kreuzt man zwei Lebewesen einer Art, die sich in zwei Merkmalen reinerbig unterscheiden, so gelten
für beide Merkmale unabhängig voneinander die Uniformitäts- und die Spaltungsregel. In der F2-Generation erhält man
neben den Phänotypen der Eltern neue Merkmalskombinationen.

Gene und Umwelt (Seite 350)


$ 1 Setzt man im Frühjahr eine Kartoffel in die Erde, entwickelt sich daraus eine Pflanze, die im Sommer eine Reihe von Knollen
bildet (Abb. Randspalte). Nenne mögliche Ursachen dafür, dass sich die Knollengröße sehr unterschiedlich ist, obwohl die
Kartoffeln genetisch identisch sind.
Die Kartoffelpflanzen bekommen nicht gleich viele Nährstoffe von der Mutterpflanze, haben nicht den gleichen Platz zur Verfü-
gung und beeinflussen sich gegenseitig in ihrem Wachstum.
$ 2 Würdest du zum Pflanzen im nächsten Jahr eher große oder kleine Kartoffeln auswählen? Begründe deine Entscheidung.
Man sollte eher große Kartoffeln auswählen. Diese haben mehr Stärke eingelagert und können daher der heranwachsenden
Pflanze mehr Nährstoffe bereitstellen. Außerdem ist die Größe auch durch das genetische Material bestimmt. Dieses wird an die
neuen Knollen weitergegeben.

Material: Wissen über Genetik anwenden (Seite 351)


0 1 Stelle eine begründete Vermutung über die genetische Grundlage der Felllänge bei Katzen an.
Da beide Katzen für das Merkmal der Felllänge homozygot sind, muss das Merkmal „kurzes Fell“ dominant vererbt werden. Nach
der ersten Mendel’schen Regel zeigen bei einem dominant-rezessiven Erbgang bei der Kreuzung zweier homozygoter Eltern die
Nachkommen einheitlich das dominante Merkmal.
$ 2 Beschreibe wie der Züchter weiter vorgehen muss, um langhaarige Katzen zu züchten.
Die Katzen der F1-Generation zeigen phänotypisch alle das kurze Fell. Genotypisch sind sie jedoch heterozygot bezüglich dieses
Merkmals.
Kreuzt der Züchter nun die Katzen aus der F1-Generation untereinander, so erhält er Katzen mit kurzem Fell und solche mit
langem Fell. Die Katzen mit langem Fell sind homozygot bezüglich dieser Merkmalsausprägung, da es sich um eine rezessive
Merkmalsausprägung handelt. Kreuzt er nun zwei Katzen mit langem Fell, so werden alle Nachkommen ebenfalls ein langes Fell
haben.
. 3 Erstelle ein Kreuzungsschema für die Kreuzung der beiden folgenden Katzen (F1- und F2-Generation): einfarbig schwarzes Fell
x braun getigertes Fell.
F1-Generation:
aB
Ab AaBb
F2-Generation:
AB Ab aB ab
AB AABB AABb AaBb AaBb
Ab AABb AAbb AaBb Aabb
aB AaBB AaBb aaBB aaBb
ab AaBb Aabb aaBb aabb

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
0 4 Nenne die passende Vererbungsregel.
2. Mendel’sche Regel (Spaltungsregel)
$ 5 Erstelle ein Kreuzungsschema für diesen Erbgang.
Kreuzungsschema für die F2-Generation
G: gelb, g: grün
G g
G GG Gg
g Gg gg
gelb : grün entspricht 3 : 1
0 6 Erläutere das in Abb. 3 dargestellte Ergebnis.
In einer Höhe von 30 m werden alle drei Pflanzen ca. 90 cm hoch. In einer Höhe von 3050 m, zeigen alle drei Pflanzen eine deutlich
geringere Wuchshöhe. Obwohl alle Nachkommen der Pflanze A (bzw. B oder C) den gleichen Genotyp haben, werden sie in
unterschiedlichen Höhen unterschiedlich groß. Dies bezeichnet man als Modifikation. Trotz gleichen Genotyps ist der Phänotyp
unterschiedlich, da die Ausprägung des Phänotyps durch die Umwelt beeinflusst wird.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
11. 3 Genetik angewandt

Der genetische Fingerabdruck (Seite 352/353)


0 1 Analysiere das in Abb. 3 dargestellte Ergebnis eines Vaterschaftstests.
Das Kind zeigt für die ersten den ersten Marker das Allel 11 wie die Mutter und das Allel 12 wie der Vater. Für den zweiten Marker
hat das Kind das Muster 10 und 11. Muster 10 besitzen beide Eltern und Muster 11 nur der Vater. Das bedeutet, dass Allel 10 von
der Mutter vererbt wurde und Allel 11 vom Vater.
Für den dritten Marker zeigt das Kind das Muster 14/17. Muster 14 besitzen beide Eltern, Muster 17 nur der Vater. Muster 14 muss
also von der Mutter vererbt worden sein, Muster 17 vom Vater. Da für jeden Marker Übereinstimmungen mit Vater und Mutter zu
finden sind, ist es sehr wahrscheinlich, dass der untersuchte Mann der Vater des Kindes ist.

Extra: Polymerase-Kettenreaktion (Seite 353)


1 Stelle den Ablauf der PCR in einem Verlaufsschema dar.
Probe auf 90 °C erwärmen um DNA-Doppelstränge zu trennen → Temperatur auf ca. 50 °C senken, damit sich Primer an passen-
de DNA-Stücke anlagern können → Temperatur auf 70 °C erhöhen. DNA Einzelstränge werden mithilfe von DNA-Polymerase zu
Doppelsträngen ergänzt → erneutes Erhitzen um einen neuen Zyklus zu starten.

Genetisch bedingte Krankheiten beim Menschen (Seite 354/355)


0 1 Erkläre mithilfe von Abb. 4 die Entstehung einer Trisomie.
Eine Fehlverteilung der Chromosomen kann in der ersten oder auch in der zweiten Teilung der Meiose entstehen. Wenn in der
ersten Teilung die homologen Chromosomen des Chromosoms 21 nicht voneinander getrennt werden, sondern in eine Zelle gelan-
gen, entsteht eine Zelle, in der ein haploider Chromosomensatz vorliegt, jedoch das Chromosom 21 zweimal vorkommt. Diese Zelle
durchläuft nun die zweite Teilung nach normalem Ablauf. Bei der Befruchtung durch eine Spermienzelle, kommt noch einmal ein
vollständiger haploider Chromosomensatz dazu. Es entsteht eine Zygote, die das Chromosom 21 dreimal enthält.
Die Fehlverteilung kann auch erst in der zweiten Teilung vorliegen. Hier liegt der Fehler darin, dass sich die Doppelchromosomen
des Chromosoms 21 nicht trennen. Eine Zelle erhält ein Doppelchromosom 21, in der anderen Zelle fehlt das Chromosom. Bei der
Verschmelzung von Ei- und Spermienzelle kommt noch ein zusätzliches Chromosom 21 dazu. Die Zelle enthält das Chromosom 21
dreimal.
. 2 Personen, die an Phenylketonurie leiden, sind nicht in der Lage, Phenylalanin enzymatisch in Tyrosin umzubauen. Zum
Nachweis wird diesen Personen eine bestimmte Menge Phenylalanin verabreicht. In Abständen von zwei Stunden misst man
die Konzentration von Tyrosin im Blut. Abb. 3 zeigt das Ergebnis eines solchen Tests. Getestet wurden hier 3 Personen. Eine
Person ist an Phenylketonurie erkrankt, zwei Personen sind gesund. Eine der gesunden Personen ist homozygot, eine hetero-
zygot.
Ordne den drei Personen die Genotypen (AA, Aa, aa) zu. Begründe deine Entscheidung.
Person C ist nicht in der Lage, Phenylalanin abzubauen. Deshalb bleibt der Tyrosinspiegel im Blut auch nach Gabe von Phenyl-
alanin konstant niedrig. Sie hat den Genotyp aa. Person A kann Phenylalanin schnell zu Tyrosin abbauen. Der Spiegel an Tyrosin
steigt schnell, sinkt aber auch schnell wieder, da dieses weiter abgebaut wird (Genotyp AA). Bei Person B erfolgt der Abbau des
Phenylalanins langsamer (Genotyp Aa). Diese Person kann das Phenylalanin nur langsam abbauen, da sie nur ein intaktes Chro-
mosom besitzt.

Pränatale Diagnostik (Seite 356/357)


$ 1 Stelle das Verfahren einer Fruchtwasseruntersuchung in einem Verlaufsschema dar.
Entnahme von Fruchtwasser unter Ultraschallkontrolle → Trennung von Zellen und Überstand → Untersuchung des Überstands
auf Stoffwechselprodukte → Vermehrung der Zellen im Labor → Isolierung des genetischen Materials → Erstellung eines Karyo-
gramms
. 2 „Bei einer pränatalen Diagnostik handelt es sich nicht um eine Diagnostik im eigentlichen Sinn, da sich bei einer Diagnose
immer ein Therapievorschlag des Arztes anschließt.“ Nimm Stellung zu dieser Aussage.
Für die meisten genetisch bedingten Erkrankungen, die bei einer pränatalen Diagnostik festgestellt werden, gibt es zurzeit noch
keine Therapiemöglichkeiten. Die Schwangeren stehen nur vor der Frage, ob sie das Kind trotz seiner Behinderung bekommen
wollen oder eine Abtreibung vornehmen lassen.
. 3 Die PID ist in Deutschland sehr umstritten. Paare, in deren Familie eine genetisch bedingte Krankheit vorkommt, wünschen
sich häufig eine PID. Vertreter der Behindertenverbände sind häufig dagegen. Recherchiert in arbeitsteiligen Gruppen im
Internet.
Gruppe A sammelt Argumente, die betroffene Paare für eine PID vorbringen könnten.
Gruppe B sammelt Argumente, die Menschen mit Behinderung gegen eine PID vorbringen könnten.
Tauscht eure Ergebnisse aus. Formuliert einen eigenen Standpunkt zur PID.
individuelle Lösung

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Gentechnik in der Medizin (Seite 358/359)
$ 1 Erläutere das Verfahren zur gentechnischen Herstellung von Insulin (Abb. 1). Dabei kannst du folgendermaßen vorgehen:
a) Beschreibe das Verfahren in Form eines Informationstextes für Diabetiker.
Informationstext für Diabetiker: Viele Diabetiker benötigen täglich Insulin. Dies betrifft in Deutschland ca. 7 Millionen Men-
schen. Früher bekamen Diabetiker Rinder- oder Schweine-Insulin. Heute ist es jedoch möglich, menschliches Insulin in Bakte-
rien herzustellen. Dies funktioniert so: Das Gen für Insulin wurde aus dem Menschen isoliert. Danach hat man das Gen mithil-
fe eines Vektors in Bakterien eingeschleust. Die Bakterien produzieren nun menschliches Insulin. Das so hergestellte Insulin
hat viele Vorteile. Es kann in großen Mengen und deshalb zu geringen Kosten hergestellt werden. Außerdem können durch
dieses Insulin keine Krankheiten (wie z. B. von Rindern oder Schweinen) auf den Menschen übertragen werden. Da das durch
Bakterien hergestellte Insulin genauso aufgebaut ist, wie menschliches Insulin, wirkt es genau wie menschliches Insulin und
hat keine Nebenwirkungen.
b) Berichte in einem Text für die Schülerzeitung. (Hier musst du alle Fachbegriffe erklären!)
Text für die Schülerzeitung: In Deutschland leiden ca. 7 Millionen Menschen an der Zuckerkrankheit (Diabetes). Diese Men-
schen können Zucker, den sie mit der Nahrung aufgenommen haben, nicht richtig abbauen. Dies liegt daran, dass ihnen ein
wichtiges Hormon fehlt, das Insulin. Früher bekamen Diabetiker Rinder- oder Schweine-Insulin als Ersatz für ihr eigenes
Insulin. Dies wirkte aber nicht genauso und hatte viele Nebenwirkungen. Heute ist es jedoch möglich, menschliches Insulin in
Bakterien herzustellen. Dies funktioniert so: Das Gen für Insulin wurde aus dem genetischen Material eines Menschen he-
rausgeschnitten. Dies gelingt inzwischen mit bestimmten biochemischen Verfahren. Danach hat man das Gen mithilfe eines
Vektors in Bakterien eingeschleust. Die Bakterien produzieren nun menschliches Insulin. Das so hergestellte Insulin hat viele
Vorteile. Es kann in großen Mengen und deshalb zu geringen Kosten hergestellt werden. Außerdem können durch dieses
Insulin keine Krankheiten (wie z. B. von Rindern oder Schweinen) auf den Menschen übertragen werden. Da das durch Bakte-
rien hergestellte Insulin genauso aufgebaut ist wie menschliches Insulin, wirkt es genau wie menschliches Insulin und hat
keine Nebenwirkungen.
c) Stelle das Verfahren in einem Verlaufsschema dar.
Gewinnung eines Plasmids aus E. coli → Schneiden des Plasmids mit einem Restriktionsenzym → Isolierung des menschli-
chen Insulingens → Schneiden des menschlichen Insulingens mit Restriktionsenzym → Verbinden von Plasmid und Gen mit
einer Ligase → Einschleusen des Plasmids in ein Bakterium.
$ 2 In manchen Ländern kann jedermann einen Gentest für sein Kind durchführen lassen, der zu Aussagen über die Wahrschein-
lichkeit bestimmter Krebserkrankungen führt. Nenne Pro- und Contra-Argumente (s. auch Extra).
individuelle Lösung; Lehrerhinweis: Hier kann auch eine Bewertung mithilfe der Seiten 16/17 vorgenommen werden!

Genetik in der Landwirtschaft (Seite 360/361)


$ 1 Die in Abb. 3 dargestellten Hybrid-Rinder haben eine besonders hohe Milchleistung. Deshalb möchte der Bauer sie unterein-
ander kreuzen.
a) Erstelle das Kreuzungsschema der F2-Generation.
siehe Abbildung

X
AAbb aaBB

Ab Ab aB aB

X
AaBb AaBb

F2: AaBb X Aa Bb
AB Ab aB ab
AB AABB AABb AaBB AaBb
Ab AABb AAbb AaBb Aabb
aB AaBB AaBB aaBB aaBb
ab AaBb Aabb aaBb aabb

b) Erläutere, warum der positive Effekt der heterozygoten Nachkommen in der nächsten Generation verloren geht.
Heterozygote Tiere lassen sich nicht genauso wieder züchten (siehe a), in der nächsten Generation werden statistisch nur 2
von 16 Nachkommen den gleichen Genotyp haben wie ihre Eltern.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
$ 2 In Deutschland ist der Anbau von gentechnisch verändertem Mais verboten, obwohl die Europäische Union dies genehmigt
hat. Sammle mithilfe einer Internetrecherche Pro- und Contra-Argumente zum Anbau von gentechnisch verändertem Mais.
Pro:
– Bauern haben die Wahlfreiheit zwischen dem Anbau von gentechnisch verändertem Mais und nicht gentechnisch verändertem
Mais.
– Eventuell höherer Ertrag für den Landwirt.
– Eventuell weniger Einsatz von Spritzmitteln notwendig.
– Bisher ist keine schädigende Wirkung für Mensch und Umwelt eindeutig festgestellt worden.
Contra:
– Schutz von Biobauern.
– Eventuell kein höherer Ertrag für den Landwirt.
– Eventuell bleibt Einsatz von Spritzmitteln gleich.
– Langzeitwirkungen sind nicht einschätzbar. Erfahrung mit gentechnisch verändertem Saatgut erst seit ca. 20 Jahren.
Anmerkung: Je nach Quelle finden sich verschiedene Argumente. Der Vorteil für den Landwirt (Spritzmittel sparen; höherer Ertrag)
hängt sehr stark von den klimatischen Verhältnissen im Anbaujahr ab. In Deutschland bringt gentechnisch veränderter Mais, der
resistent gegen den Maiszünsler ist, nur in wenigen Gegenden einen Vorteil.
Auch was das Gefahrenpotential angeht, findet man ganz unterschiedliche Einschätzungen. Die eine Seite sagt, man hat in den
letzten 25 Jahren keine ernsthaften Gefahren gefunden, die anderen sagen, dass 25 Jahre ein zu kurzer Zeitraum sind.

Teste dich selbst (Seite 363)


0 1 Stelle den Weg vom Gen zum Protein mithilfe von Abb. 1 in einem kurzen Text dar. Verwende dabei die Fachbegriffe.
Entsprechend dem Gen auf der DNA, das die Bauanleitung für das entsprechende Protein trägt, wird in eine m-RNA geschrieben
(Transkription). Die m-RNA wandert durch die Kernporen aus dem Zellkern hinaus zu den Ribosomen. Hier wird die m-RNA-Basen-
abfolge in eine Aminosäureabfolge übersetzt (Translation). Sind alle Aminosäuren, aus denen das Protein besteht, aneinanderge-
fügt, löst sich die Kette von den Ribosomen. Die Aminosäurekette faltet sich anschließend zum funktionsfähigen Protein.
$ 2 Übersetze die in Abb. 1 dargestellte Abfolge der Aminosäuren zurück in eine m-RNA. Nutze dazu die Codesonne auf Seite 340.
GUA GGA GCC CCC
$ 3 Mutationen, bei denen nur eine Base ausgetauscht wurde, haben häufig keine Auswirkung. Erläutere dies mithilfe der Code-
sonne auf der Seite 340.
Für die dritte Base eines Codons gibt es mehrere Möglichkeiten. So kann die Aminosäure Arginin z. B. durch das Codon CGG, CGA,
CGC oder CGU codiert sein. Erfolgt nun ein Austausch in der dritten Base, so wird trotzdem die richtige Aminosäure eingebaut und
ein funktionsfähiges Protein gebildet.
$ 4 Ordne den in Abb. 2 dargestellten Pflanzen die entsprechenden Genotypen zu.
1: aa, 2: AA, 3: Aa, 4: AA, 5,6: Aa, 7: aa

Elterngeneration
aa AA

F1-Generation
Aa

F2-Generation
AA Aa Aa aa

$ 5 Ordne den Katzen die entsprechenden Genotypen zu. Dabei kannst du davon ausgehen, dass die Katzen 4, 6, 8 und 11 homozy-
got bezüglich des Merkmals sind und 5 Zehen haben.
Alle Merkmalsträger haben den Genotyp Aa und alle gesunden Katzen den Genotyp aa.
$ 6 Entscheide begründet, ob das Merkmal dominant oder rezessiv ist.
Das Gen für das Merkmal sitzt auf einem Autosom und wird dominant vererbt. Sowohl männliche als auch weibliche Katzen sind
betroffen, was auf einen autosomalen Erbgang schließen lässt. Das Elternpaar 7 und 8 bekommt einen Nachkommen, der Merk-
malsträger ist, obwohl die Mutter homozygot gesund ist. Dies ist nur möglich, wenn das Merkmal dominant ist.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Grafik: Otto Nehren, Achern
12 Evolution
12. 1 Evolution der Arten

Fossilien – Spuren aus der Vergangenheit (Seite 366/367)


$ 1 Während es in manchen Schichten sehr viele Fossilien gibt, findet man in anderen Schichten keine. Erkläre diese Beobach-
tung.
Das Auftreten von Fossilien hängt von den Erhaltungsbedingungen ab. In Schichten, die aus sauerstoffreichen Ablagerungen
entstanden sind, sind die meisten Lebewesen längst vollständig verwest und daher keine Fossilien zu finden. Schichten, die aus
sauerstoffarmen Ablagerungen stammen, enthalten oft viele Fossilien.
$ 2 Um Fossilien zu deuten, sind gute Kenntnisse über Angepasstheiten und Strukturen bei heutigen Lebewesen nötig. Erläutere
diese Aussage.
Die Lebensweise eines Fossils kann aufgrund von Strukturen abgeleitet werden, wenn die Funktion von speziellen Strukturen
bekannt ist. Der Vergleich mit Strukturen von heutigen Lebewesen und deren Funktionsweise ist dabei hilfreich.

Basiskonzept: Geschichte und Verwandtschaft (Seite 367)


1 Beschreibe die Veränderungen im Aussehen der Schnecken und die Artaufspaltung.
Die Schnecken unterscheiden sich in der Größe und in der Form der Gehäuseöffnung. Die Öffnung ist bei der einen Linie wie ein
halbes Oval geformt, bei der anderen eckig.

Material: Lebende Fossilien (Seite 369)


$ 1 Begründe die Bezeichnung von Nautilus als „lebendes Fossil“.
Nautilus ist ein heute lebendes Tier, das Ammoniten ähnelt, die seit mehreren Millionen Jahren ausgestorben sind und heute nur
noch fossil erhalten sind.
. 2 Die Arme von Ammoniten sind fossil nicht erhalten. Manche Forscher vermuten Arme wie bei Nautilus. Nimm Stellung.
Da Nautilus viele Merkmale hat, die fossilen Ammoniten ähneln, erscheint es plausibel, dass die Arme ebenfalls wie bei Ammoni-
ten ausgebildet sind. Allerdings ist das lediglich eine unsichere Vermutung. Solange es keine fossilen Befunde gibt, ist diese nicht
belegt. Wir wissen schlichtweg nicht, wie die Arme von Ammoniten ausgesehen haben.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
12. 2 Evolutionstheorien

Frühe Theorien zur Herkunft des Menschen (Seite 370)


$ 1 Cuvier und Lamarck lebten zur gleichen Zeit in Paris. Damals waren fossile Ammoniten bekannt und es war klar, dass diese
längst ausgestorben waren. Schreibe ein Streitgespräch der beiden Forscher über die Deutung von Ammoniten (Abb. 1).
Cuvier wird behaupten, dass sich Arten nicht verändern können. Er geht davon aus, dass die Ammoniten Reste von Tierarten sind,
die durch irgendwelche Katastrophen ausgestorben sind. Lamarck hingegen wird ausführen, dass sich Arten sehr wohl über viele
Generationen verändern können. Die Ammoniten können sich daher in andere, heute lebende Arten entwickelt haben. Ein starkes
Argument für Lamarck könnte sein, dass in alten Schichten kaum Fossilien zu finden sind, die heutigen Arten ähnlich sehen. Dieser
Befund widerspricht der Artkonstanz.

Extra: Die Evolutionstheorie von Lamarck (Seite 371)


1 Beschreibe, wie nach Lamarcks Evolutionstheorie die Evolution der Giraffen weitergehen könnte.
Solange weiter oben an den Bäumen noch saftige Blätter wachsen, müssten die Giraffen das Bedürfnis haben, an diese zu gelan-
gen. Sie werden also nach Lamarck ihre Hälse danach strecken und durch diesen Gebrauch längere Hälse bekommen, die sie dann
an die Nachkommen weitergeben.
2 Lamarck verwies auf den Grottenolm, der in dunklen Höhlen lebt und verkümmerte Augen hat. Erkläre die Verkleinerung der
Augen nach der Evolutionstheorie von Lamarck.
Da der Grottenolm in der Höhle keinen Gebrauch von den Augen macht, verkümmern nach Ansicht von Lamarck die Augen. Diese
Verkümmerung der Augen wird nach seiner Theorie an die Nachkommen weitergegeben.

Darwins Evolutionstheorie (Seite 372/373)


0 1 Stelle Darwins Evolutionstheorie in einem Verlaufsschema dar.
Überproduktion von variablen Nachkommen → Konkurrenz unter den Nachkommen → Überleben und höherer Fortpflanzungser-
folg der am besten angepassten Individuen → Nachkommen eher besser angepasst → natürliche Selektion bewirkt allmähliche
Veränderung über Generationen.
$ 2 Beschreibe, wie nach Darwins Evolutionstheorie die Evolution der Giraffen (Abb. 3) weitergehen könnte.
Die am besten angepassten Individuen definieren sich nicht allein über die Halslänge. Mit einem langen Hals könnten zwar noch
weiter oben liegende Blätter erreicht werden, aber gleichzeitig sorgt ein langer Hals für Kreislaufprobleme. Durch die natürliche
Selektion werden sich die Tiere am besten fortpflanzen, die insgesamt am besten an die Umwelt angepasst sind.

Moderne Evolutionstheorie (Seite 374/375)


$ 1 Erkläre die unterschiedliche Zusammensetzung der Birkenspannerpopulation in Abb. 4.
Offensichtlich hat sich das dunkle Individuum in der ersten Generation sehr erfolgreich fortgepflanzt. So enthält die zweite Gene-
ration mehr rot markierte allele Gene und damit auch mehr dunkle Individuen.
$ 2 Stelle eine begründete Vermutung an, wie sich die Populationen in Abb. 3 weiterentwickeln könnten.
Solange sich die Umweltbedingungen nicht verändern, werden auf den dunklen Birkenstämmen vermehrt helle Birkenspanner
erbeutet. Die Population könnte schließlich nur noch aus dunklen Individuen bestehen. Entsprechend könnte auf den hellen Stäm-
men eine Population aus hellen Birkenspannern entstehen. (Genau genommen bildet sich jeweils ein Gleichgewicht aus hellen
und dunklen Individuen aus, das dem Nachteil bzw. Vorteil der Färbung entspricht.)
. 3 Seit 1960 steigt in vielen Populationen wieder der Anteil der hellen Birkenspanner. Erkläre.
Durch Filteranlagen und andere Maßnahmen zur Luftreinhaltung ist die Rußbelastung zurückgegangen. Die Umweltbedingungen
ändern sich also dahingehend, dass die Stämme weniger dunkel sind. In der Folge nehmen die hellen Individuen in den Populati-
onen wieder zu.

Wie neue Arten entstehen (Seite 376/377)


0 1 Erkläre, warum Filtis und Zilpzalp zwei Arten sind, obwohl sie sich sehr ähnlich sehen.
Sie zeigen ein unterschiedliches Verhalten und haben insbesondere unterschiedliche Gesänge. So finden sich nur Partner inner-
halb der Art und Kreuzungen werden vermieden. Die Genpools der beiden Arten sind durch eine Fortpflanzungsbarriere getrennt.
$ 2 Erkläre die unterschiedlichen Anteile von allelen Genen in den Teilpopulationen in Abb. 2.
Durch eine Barriere sind die Teilpopulationen getrennt und entwickeln sich in unterschiedlicher Weise weiter. Die verschiedene
Entwicklung kann unterschiedliche Umweltbedingungen als Ursache haben oder zufällig entstehen.
. 3 Stelle eine begründete Vermutung auf, wie sich das Zugverhalten von Mönchsgrasmücken weiterentwickeln könnte.
Wenn die Populationen, die nach England ziehen einen größeren Bruterfolg haben, wird der Anteil solcher Mönchsgrasmücken
weiter ansteigen.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
12. 3 Evolution der Arten

Vom Wasser ans Land (Seite 378/379)


0 1 Nenne Voraussetzungen, die Tieren und Pflanzen das Leben an Land ermöglichen.
Für ein dauerhaftes Leben an Land sind Stützgewebe (z. B. Skelett) und ein effektiver Verdunstungsschutz erforderlich.
$ 2 Erläutere die Rolle des Nahrungsangebots bei der Besiedlung des Landes durch Tiere.
Landpflanzen ermöglichten es einfachen Insekten das Land zu besiedeln, die sich von verrottenden Pflanzenteilen ernährten.
Einfache Landtiere wiederum ermöglichten die Entstehung von räuberisch lebenden Landtieren (Insekten und Wirbeltiere).

Zeit der Saurier (Seite 380)


$ 1 Beschreibe die unterschiedlichen Angepasstheiten von Diplodocus und Rind an die Ernährung von Pflanzen.
Während das Rind durch Wiederkäuen und raue Mahlzähne das harte Pflanzenmaterial zerkleinert, nutzte Diplodocus vermutlich
einen muskulösen Magen und Magensteine zum Zermahlen der Nahrung.
$ 2 Erkläre, inwiefern die Lebendgeburt bei Fischsauriern eine Angepasstheit an das Leben im offenen Meer darstellt.
Da im offenen Meer keine Eiablage möglich ist, stellt die Lebendgeburt eine gute Angepasstheit an das Leben im offenen Meer
dar. Die Jungtiere schlüpfen bei der Eiablage aus dem Ei (Ovoviviparie) und können sofort schwimmen.
. 3 Kenntnisse über den Zusammenhang von Struktur und Funktion bei heutigen Lebewesen ermöglichen, die Lebensweise fossi-
ler Arten besser zu verstehen. Erläutere.
Die Lebensweise eines Fossils kann aufgrund von Strukturen abgeleitet werden, wenn die Funktion von speziellen Strukturen
bekannt ist. Der Vergleich mit Strukturen von heutigen Lebewesen und deren Funktionsweise ist dabei hilfreich. So sind beispiels-
weise Magensteine bei manchen Vögeln bekannt. Sie dienen dort der Zerkleinerung von Pflanzennahrung. Das Wissen über diese
Struktur-Funktionsbeziehung ermöglicht die Deutung von Magensteinen bei Diplodocus.

Material: Archaeopteryx (Seite 381)


0 1 Vergleiche in einer Tabelle Archaeopteryx mit Sauriern und Vögeln.
siehe Tabelle
Dinosaurier Archaeopteryx Vogel
bezahnter Kiefer bezahnter Kiefer unbezahnter Kiefer
kleines Brustbein kleines Brustbein großes Brustbein
freie Fingerglieder freie Fingerglieder verwachsene Fingerglieder
lange Schwanzwirbelsäule lange Schwanzwirbelsäule kurze Schwanzwirbelsäule
keine Federn Federn Federn

$ 2 Erläutere, warum Archaeopteryx vermutlich kein guter Flieger war.


Das Skelett von Archaeopteryx ähnelt noch stark den Dinosauriern und war recht schwer. Auch die Flugmuskulatur kann nicht
kräftig gewesen sein, da ein entsprechend großes Brustbein als Ansatzstelle fehlt. Vermutlich konnte Archaeopteryx keinen Ruder-
flug, sondern nur einen Gleitflug nutzen.
. 3 Federn entstanden vermutlich zur Wärmedämmung und dienten erst später als Flughilfe. Erläutere.
Dinosaurier waren vermutlich wechselwarm und insofern scheinen Federn zur Wärmedämmung zunächst wenig sinnvoll. Aller-
dings wird durch Muskelaktivität Wärme freigesetzt. Durch ein dämmendes Federkleid kann also der Körper bei Aktivität auf
höhere Temperaturen gebracht werden und damit die Aktivität der Tiere wiederum verbessert werden. Später könnten sich dann
lange und stabile Federn an Armen und Schwanz als sinnvolle Hilfe bei Sprüngen entwickelt haben. Dies könnte schließlich zum
Gleitflug mit Flügeln aus Federn geführt haben.

Entwicklung der Säugetiere (Seite 382)


0 1 Nenne das Problem der Stammesgeschichte, auf das die Karikatur in Abb. 2 hinweist.
Übergangsformen
$ 2 Erläutere, warum erst nach dem Aussterben der Saurier viele neue Säugetierarten entstanden.
Offensichtlich waren nach dem Aussterben vieler Saurierarten neue Lebensformen bei den Säugetieren möglich. Unter den Säuge-
tieren setzte eine adaptive Radiation ein, die zur Besetzung von ökologischen Nischen führte, die zuvor von Saurierarten genutzt
wurden.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 3 Manche der Säugetiere in Abb. 1 ähneln in Aussehen und Lebensweise bestimmten Saurierarten. Beschreibe Ähnlichkeiten
und Unterschiede.
Delfine ähneln Ichtyosauriern. Beides sind schnell schwimmende Hochseetiere mit großen Augen und Zähnen. Die Lage der
Schwanzflosse ist unterschiedlich.
Elefanten ähneln großen Pflanzenfressern wie Diplodocus. Der stämmige Körperbau folgt aus der großen Körpermasse. Rüssel,
Schwanz und Ohren zeigen deutliche Unterschiede.
Fledermäuse können wie Flugsaurier fliegen. Sie haben jeweils Flughäute.
Ein Jaguar oder Löwe ähnelt in Aussehen und Jagdweise in etwa einem Tyrannosaurus. Sie können jeweils schnell laufen, haben
ein kräftiges Gebiss mit scharfen Zähnen zum Zerkleinern von Fleisch und krallenbewehrte Vorderextremitäten zur Jagd.

Der Stammbaum der Wirbeltiere (Seite 383)


$ 1 Reptilien gehen nicht auf einen nur ihnen gemeinsamen Vorfahren zurück und stellen daher keine Verwandtschaftsgruppe
dar. Erkläre mithilfe von Abb. 1.
Der gemeinsame Vorfahr aller Reptilien ist gleichzeitig auch ein gemeinsamer Vorfahr der Reptilien und Vögel. Vögel sind Nach-
fahren der Dinosaurier. Sie gehören zusammen mit den Krokodilen, Echsen, Schlangen und Schildkröten zu einer Verwandtschafts-
gruppe. Wissenschaftlich werden daher diese Tiergruppen unter dem Begriff „Sauropsida“ zusammengefasst.

Stammbaum der Pferde (Seite 384)


$ 1 Erkläre die Unterschiede zwischen heutigen und fossilen Pferden durch deren Lebensweise.
Im Wald ist ein kleiner Körperbau mit relativ kurzen Beinen sinnvoll. So konnten die Tiere sich schneller in strauchreichen Wäldern
fortbewegen. Die Mehrzehigkeit ist vorteilhaft auf feuchtem Waldboden und beim Überwinden von Ästen. Für das Kauen von
weichem Laub sind kleine Zähne mit wenigen Schmelzfalten ausreichend.
In der Savanne ist der Boden hart und die Pferde sind von weitem für Räuber sichtbar. Große Tiere mit langen Beinen und Hufen
(einzehig) können schneller laufen und besser flüchten. Große Zähne mit vielen Schmelzfalten sind vorteilhaft für das Zerkauen
von hartem Gras.
. 2 Erläutere, warum das „Urpferd“ der Grube Messel kein direkter Vorfahre heutiger Pferde ist.
Eurohippus zeigt zwar die üblichen Merkmale früher Vertreter aus der Stammeslinie der Pferde. Aber der Fund stammt aus
Europa und gleichzeitig gibt es noch viele ähnliche Funde aus anderen Erdteilen. Da die Entwicklung zu den heutigen Pferden
in Amerika stattfand, ist Eurohippus kein direkter Vorfahr. (Ergänzung: Aus Nordamerika wanderten immer wieder Pferde nach
Asien und Europa ein. In Amerika rottete der Mensch vor 15 000 Jahren alle Pferde aus. Die heutigen Mustangs in Amerika sind
Nachfahren von Pferden, die von Europäern in der Neuzeit auf Schiffen mitgebracht wurden.)

Praktikum: Selektion simulieren (Seite 385)


1 Stelle die Ergebnisse in einem geeigneten Diagramm dar.
Da nur einzelne Werte für jeden Durchgang vorliegen, ist ein Säulendiagramm sinnvoll. Die Werte können aber auch als Kurven-
diagramm veranschaulicht werden.
2 Vergleiche das Modell-Experiment mit der Selektion von Beutetieren durch Beutegreifer.
So wie im Modell auffallende Farben stärker gesammelt werden, können auch in der Natur schlecht getarnte Tiere von Beutegrei-
fern häufiger erbeutet werden.
3 Plane Abwandlungen des Simulations-Experiments mit veränderten Umweltbedingungen.
Denkbar wäre die Simulation unterschiedlicher Umweltbedingungen durch verschiedene Unterlagen oder die Spezialisierung von
Beutegreifern durch unterschiedliche Fangwerkzeuge (wie in dem nebenstehendem Modell-Experiment zur Angepasstheit).
4 Vergleiche die „Beute“ der Mitspieler und erkläre.
Es ist zu erwarten, dass Mitspieler mit verschiedenen Werkzeugen auch unterschiedliche „Beute“ gefangen haben. Je nach Werk-
zeug können bestimmte Nudelformen leichter ergriffen werden.
5 Erläutere, inwiefern das Experiment ein Modell für Angepasstheiten in der Natur darstellt.
Auch in der Natur sind Tiere durch ihre speziellen Mundwerkzeuge an ihre Nahrungsaufnahme angepasst.
6 Beschreibe, wie Angepasstheiten durch Selektion über viele Generationen entstehen können.
Wenn über viele Generationen bestimmte Strukturen wie beispielsweise spezielle Mundwerkzeuge vorteilhaft sind, werden zuneh-
mend Individuen entstehen, die besonders gut an eine bestimmte Lebensweise angepasst sind.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Vom Land ins Wasser (Seite 386/387)
0 1 Erläutere, warum die Wale früher zu den Fischen gezählt wurden.
Weil Wale im Wasser leben, wurden sie mit den Fischen in eine systematische Gruppe gestellt. Durch die stromlinienförmige Form
und auffallende Flossen erinnern sie auch auf den ersten Blick an Fische. Allerdings finden sich bei genauerem Betrachten auch
Unterschiede zu den Fischen und stattdessen Merkmale der Säugetiere (Lungen, Extremitäten, Haare).
$ 2 Erkläre die Zuordnung der Wale zu den Paarhufern.
Neben molekularbiologischen Hinweisen gibt es einige morphologische Merkmale, die eine enge Verwandtschaft der Wale mit
den Flusspferden belegen (z. B. verdickte Knochen).
. 3 Schreibe einen Bericht, wie die Wale sich von Land- zu Wassertieren entwickelt haben.
Individueller Bericht mit folgenden wichtigen Entwicklungen: Reduktion der Hinterextremitäten; Ausbildung einer horizontalen
Schwanzflosse; Umbildung der Vorderextremitäten zu Flossen; Nasenlöcher verschließbar und nach oben verlagert (Echoortung
bei Zahnwalen und Barten bei Bartenwalen).

Verwandtschaft erkennen (Seite 388/389)


0 1 Nenne ein ursprüngliches und ein abgeleitetes Merkmal der Säugetiere.
Ursprüngliche Merkmale: Wirbelsäule, vier Beine, Lungen; abgeleitete Merkmale: Fell, Milchdrüsen.
$ 2 Die Flügel von Fledermaus und Vogel bestehen jeweils aus Knochen und einer Flügelfläche (Abb. 3). Erläutere, welche Struktu-
ren homolog und welche analog sind.
Das Skelett der Vorderextremitäten von Vogel und Fledermaus sind homolog, da die Knochen das Kriterium der Lage erfüllen. Die
Flügelfläche ist jedoch das Ergebnis einer konvergenten Entwicklung. Die Flügelflächen sind analoge Organe.
. 3 Sowohl Maulwurf als auch Maulwurfsgrille haben einen zylinderförmigen Körper. Erkläre diese Ähnlichkeit.
Der längliche Körperbau ist vorteilhaft beim Laufen durch die Erdgänge. Er ist ein Ergebnis einer konvergenten Entwicklung und
findet sich auch bei vielen anderen Tieren, die im Boden leben (z. B. Regenwurm).

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
12. 4 Evolution des Menschen

Verwandtschaft des Menschen (Seite 390/391)


0 1 „Der Mensch stammt vom Affen ab.“ Erkläre, warum diese Aussage so nicht stimmt und korrigiere sie.
Heutige Affen und Menschen stammen von einem gemeinsamen Vorfahren ab. Aber natürlich stammt der Mensch nicht von
heutigen Affen ab.
$ 2 Ein gewölbter Fuß ist vorteilhaft beim aufrechten Gehen. Erkläre an diesem Beispiel den Zusammenhang von Struktur und
Funktion.
Durch die Wölbung des Fußskeletts ergibt sich eine Federung beim Gehen. Dies schont die Wirbelsäule.

Die Entwicklung zum Menschen (Seite 392/393)


0 1 Ordne in einer Tabelle wichtige Entwicklungsschritte den in Abb. 2 genannten Arten zu.
siehe Tabelle
Orrorin tugenensis aufrechter Gang
Ardipithecus ramidus
Australopithecus anamensis
Australopithecus afarensis
Australopithecus africanus
Paranthropus boisei kräftiges Gebiss
Homo erectus Verwendung von Werkzeugen und Feuer, Jäger und Sammler, großes Gehirn
Homo neanderthalensis Weiterentwicklung von Werkzeugen, sehr großes Gehirn
Homo sapiens sehr große Intelligenz, Kunst und Musik

$ 2 Nenne Unterschiede zwischen den Gattungen Australopithecus und Homo.


Die Verwendung von Werkzeugen und Feuer und das große Gehirn unterscheidet die Gattung Homo von Australopithecus.
. 3 Homo erectus wanderte aus Afrika nach Asien und Europa aus. Beschreibe Eigenschaften, die ihm diese Leistung ermöglich-
ten.
Sowohl die Verwendung von Werkzeugen und Feuer, als auch die Intelligenz der Gattung Homo, ermöglichte das Erschließen von
neuen Nahrungsquellen und das Zurechtkommen in neuer Umwelt. So konnte sich Homo erectus über viele Kontinente ausbreiten.

Neandertaler und moderner Mensch (Seite 394)


0 1 Stelle in einer Tabelle Unterschiede zwischen Neandertaler und modernem Menschen zusammen.
siehe Tabelle
Neandertaler flacher Gehirnschädel, flache Stirn, fliehendes Kinn, Lücke hinter Backenzähnen
moderner Mensch rundlicher Gehirnschädel, hohe Stirn, vorspringendes Kinn, keine Lücke hinter Backenzähnen, Kunst und Musik

$ 2 Neandertaler und moderne Menschen bestatteten ihre Toten mit Grabbeigaben. Stelle eine Hypothese auf, was dies über
ihre Gedankenwelt aussagt.
Grabbeigaben könnten zur Versorgung in einem Leben nach dem Tod gedient haben. Sie lassen daher auf religiöse Vorstellungen
und Bräuche schließen.
$ 3 Stelle begründete Hypothesen zum Verschwinden des Neandertalers auf.
Verschiedene Hypothesen möglich:
– Ausrottung durch moderne Menschen in kriegerischen Auseinandersetzungen
– Verdrängung durch zunehmende Nahrungskonkurrenz mit modernen Menschen
– Kreuzung und Vermischung mit modernen Menschen

Material: Neandertaler und moderner Mensch (Seite 395)


0 1 Bewerte die beiden Hypothesen anhand von Funddaten des Homo sapiens.
Die Funddaten von Homo sapiens lassen auf eine Wanderbewegung von Ost nach West schließen. Die Funddaten stützen also die
Out-of-africa-Hypothese.
$ 2 Erläutere, wann und wo Neandertaler und moderner Mensch sich begegnet sein könnten.
Vor etwa 100 000 Jahren könnten sich Neandertaler und moderne Menschen im östlichen Mittelmeerraum begegnet sein. Begeg-
nungen in Mitteleuropa in der Zeit zwischen 50 000 und 30 000 Jahren sind sehr wahrscheinlich.
0 3 Vergleiche die frühere Darstellung eines Neandertalers auf dieser Seite mit der modernen Rekonstruktion auf Seite 394.
Alte Darstellungen des Neandetalers zeigen oft einen dunkelhäutigen Menschen mit wildem Gesichtsaudruck. Die neue Rekonst-
ruktion stellt einen eher hellhäutigen Menschen dar, der freundlich wirkt.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
$ 4 Erläutere auf der Grundlage der beiden Darstellungen, wie sich die Vorstellungen über den Neandertaler verändert haben.
Das Bild vom Neandertaler war früher eng an die Vorstellung von affenähnlichen Menschen gebunden. Heute stellen wir uns den
Neandertaler als Europäer vor, der an die Eiszeit angepasst war. Er war vermutlich hellhäutig und verfügte sicher über soziale
Fähigkeiten und Intelligenz.

Kulturelle Evolution (Seite 396/397)


$ 1 Stelle die letzten 10 Millionen Jahre in Form einer Uhr dar (10 Mio. Jahre entsprechen 12 Stunden). Trage die wichtigsten Ereig-
nisse der biologischen und kulturellen Entwicklung als Uhrzeiten ein.
(1 Minute entspricht 10 Mio Jahre : 720 = 13 889 Jahre)
2 h 24 min: aufrechter Gang (10 Mio. Jahre : 720 min x 2 Mio. Jahre)
7 h 12 min: großes Gehirn, Verwendung von Feuer und Werkzeugen
11 h 24 min: Kochen
11 h 59 min: Ackerbau und Viehzucht
11 h 59 min 30 s: Milchviehhaltung
11 h 59 min 59 s: industrielle Revolution
0 2 Unsere Getreidesorten stammen ursprünglich aus der Region des „fruchtbaren Halbmonds“ im vorderen Orient. Erkläre den
Zusammenhang.
In der Region des fruchtbaren Halbmonds begannen Menschen mit Ackerbau und Viehzucht. Dies ermöglichte eine starke Bevöl-
kerungszunahme und Auswanderungen, bei denen die Menschen ihre Tiere und Nutzpflanzen mitnahmen und weiterzüchteten.
$ 3 In Asien und Afrika ist der Anteil von erwachsenen Menschen mit Lactose-Unverträglichkeit deutlich höher als in Europa.
Erkläre.
Da in Asien und Afrika Milchviehhaltung seltener ist als in Europa, tritt dort bei Erwachsenen eine Lactose-Unverträglichkeit auch
häufiger auf. Die Milchviehhaltung in Europa sorgte über viele Generationen dafür, dass in Europa allele Gene, die eine Lactose-
Verträglichkeit bewirken, im Genpool häufiger wurden.

Teste dich selbst (Seite 399)


0 1 Erläutere die Artbildung von Grün- und Grauspecht.
Vermutlich wurden Populationen des letzten gemeinsamen Vorfahren während der Eiszeit räumlich getrennt. Die getrennten
Populationen entwickelten sich auseinander, bis eine Fortpflanzungsbarriere und damit zwei Arten entstanden waren.
$ 2 In Mitteleuropa kommen heute beide Spechtarten vor. Erkläre, warum sie sich nicht vermischen.
Offensichtlich besteht eine wirkungsvolle Fortpflanzungsbarriere. Die beiden Arten bleiben daher genetisch getrennt und vermi-
schen sich nicht.
0 3 Vergleiche die beiden Hypothesen zur Abstammung beider Giraffenarten und beschreibe den Unterschied.
Die erste Hypothese geht davon aus, dass der gemeinsame Vorfahr von Wald- und Steppen-Giraffe einen kurzen Hals besaß.
Dies würde bedeuten, dass der lange Hals der Steppen-Giraffe später entstanden ist und ein abgeleitetes Merkmal darstellt. Die
zweite Hypothese geht von einem langhalsigen Vorfahren aus. Dies würde bedeuten, dass der kurze Hals der Wald-Giraffe ein
abgeleitetes Merkmal ist.
$ 4 Die beiden Hypothesen nehmen verschiedene Lebensräume für den jeweiligen Vorfahren an. Erläutere.
Einen kurzhalsigen Vorfahren würde man wie die heutige Wald-Giraffe im Wald vermuten. Dies würde bedeuten, dass die Steppe
erst später von Nachfahren dieser Wald-Giraffe besiedelt wurde. Der langhalsige Vorfahr lebte eher in einer Steppe. In diesem Fall
wären seine Nachfahren in den Wald vorgedrungen.
0 5 Nenne Merkmale des Neandertalers, in denen er sich vom modernen Menschen unterscheidet.
Unterschiede des Neandertalers zum modernen Menschen: kleinwüchsig und kräftiger Körperbau, flacher Hirnschädel, ausge-
prägte Überaugenwülste, flache Stirn, fliehendes Kinn.
$ 6 Von Neandertalern sind vor allem Knochen fossil erhalten. Erkläre, welche Strukturen der obigen Rekonstruktion gesichert
sind und welche auf Vorstellungen beruhen.
An gut erhaltenen Knochenfunden sind Ansatzstellen von Muskeln erkennbar, mit denen sich Größe und Lage von Muskeln ab-
schätzen lassen. Die äußere Form von Körper und Gesicht lässt sich damit einigermaßen sicher rekonstruieren. Allerdings liefern
Fossilfunde keine Erkenntnisse über die Färbung von Haaren und Haut. Da Neandertaler an das eiszeitliche Klima in Europa
angepasst waren, nimmt man an, dass sie heller waren als andere Menschen in Afrika.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Basiskonzepte

Basiskonzept: Struktur und Funktion (Seite 400/401)


1 Nenne ein weiteres Beispiel für die Abwandlung einer Grundform, die die Erweiterung einer Funktion ermöglicht.
Mögliche Beispiele sind: Abwandlung der Grundform einer Pflanzen-/ Tierzelle in andere, je nach Funktion spezialisierte Zellen;
Abwandlung der Grundform der Mundwerkzeuge der Insekten (kauend-beißend) in andere Formen je nach Funktion; Abwandlung
der Grundform der Insektenextremitäten in andere Formen; usw.
2 Bei der Immunabwehr unterscheidet der Körper zwischen körpereigenen und körperfremden Strukturen: Erläutere mithilfe
des Schlüssel-Schloss-Prinzips.
Rezeptoren auf der Oberfläche bestimmter Immunzellen erkennen Oberflächenbestandteile von Erregern wie ein Schlüssel, der in
ein Schloss passt. Diese Oberflächenbestandteile weisen körpereigene Zellen nicht auf.
3 Erläutere die Vorgänge bei der Brustatmung, indem du auf das Gegenspielerprinzip eingehst.
Zwischen den Rippen verlaufen schräg die inneren und die äußeren Zwischenrippenmuskeln. Zieht sich die eine Muskelgruppe
zusammen, so wird die andere passiv gedehnt und umgekehrt. Da die Rippen beweglich mit der Wirbelsäule verbunden sind, kann
durch Zusammenziehen der äußeren Zwischenrippenmuskeln der Brustkorb angehoben werden. Daraus ergibt sich wegen einer
Dehnung der Lunge ein geringerer Druck als in der Außenluft und Luft strömt in die Luge ein. Das Ausatmen erfolgt analog und
wird durch das Zusammenziehen der inneren Zwischenrippenmuskeln eingeleitet.
4 Die innere Oberfläche der Dünndarmwand ist sehr groß. Erkläre.
Eine große Oberfläche bedeutet eine große Kontaktfläche zwischen Darmwand und Darminhalt. Dadurch kann die Resorption der
Bausteine der Kohlenhydrate, Eiweiße und Fette ins Blutgefäß- bzw. Lymphgefäßsystem schneller und effektiver erfolgen.

Basiskonzept: Kompartimentierung und Wechselwirkung (Seite 402/403)


1 Vergleiche Bakterien- und Pflanzenzelle im Hinblick auf ihre Kompartimentierung.
Gemeinsamkeiten: Bei beiden Zelltypen wird durch Zellwand und Zellmembran das Zellplasma von der Umgebung abgegrenzt.
Unterschiede: In der Pflanzenzelle sind der Zellkern und die Mitochondrien durch Membranen abgetrennt (bei grünen Pflan-
zenzellen zusätzlich die Chloroplasten), was eine stärkere Arbeitsteilung ermöglicht. Dies ist bei Bakterienzellen nicht so; das
genetische Material liegt frei in der Zelle.
2 Beim sogenannten Kammerflimmern ist die rhythmische Erregung des Herzens stark gestört. Es führt dazu, dass die Kam-
mermuskulatur praktisch permanent kontrahiert. Erläutere die Folgen und gehe dabei auf die Bedeutung der Wechselwirkung
zwischen den Teilen des Herzens ein.
Folgen des Kammerflimmerns sind, dass das Blut nicht mehr gleichmäßig in eine Richtung strömt, sodass nicht mehr alle Berei-
che der Körpers ausreichend versorgt werden können. Die Folgen können tödlich sein.
Hierin zeigt sich die Bedeutung der Wechselwirkung der einzelnen Teile des Herzens. Beim Gesunden bewirken die Teile, dass das
Blut gleichmäßig und gerichtet fließt. So bewirkt der Wechsel von Kontraktion und Erschlaffen der rechten Herzhälfte den Trans-
port des Blutes in die Lunge, die der linken Herzhälfte in den Körper. Segelklappen verhindern dabei, dass das Blut zurück in die
Vorhöfe fließen kann, Taschenklappen verhindern dies bei den Kammern. So wird ein gerichteter Blutstrom erzeugt.
3 Vergleiche unter dem Aspekt der Kompartimentierung die Bienen im Bienenstaat mit den Organen unseres Körpers.
Gemeinsamkeiten: Bienen ermöglichen durch ihre Arbeitsteilung im Stock eine höhere Leistungsfähigkeit des gesamten Volkes,
als wenn die Bienen alleine lebten. Unsere Organe eröffnen auf eben diese Weise unserem Körper Möglichkeiten, die die Organe
alleine nicht vollbringen könnten. In ihrer Gesamtheit erbringen sie also jeweils höhere Leistungen, die die Einzelstrukturen nicht
erbringen könnten.
Unterschiede: Die Bienen eines Volkes – zumindest die Arbeiterinnen – sind alle identisch, wohingegen die Organe unseres Körpers
sehr verschieden sind. Die Arbeitsteilung der Arbeiterinnen eines Bienenvolkes ist daher möglich, weil sie im Laufe ihres Lebens je
nach Alter verschiedene Tätigkeiten wahrnehmen.

Basiskonzept: Steuerung und Regelung (Seite 404/405)


1 Der angestrebte Gehalt für Blutzucker im menschlichen Blut beträgt 0,7–0,99 g/l. Schwangere haben einen erhöhten Bedarf.
Erläutere an diesem Beispiel das Prinzip der Steuerung.
Wird ein Soll-Wert wie die Konzentration des Blutzuckers verschoben, so verändert sich daraufhin auch der Ist-Wert des Blutzu-
ckers, der im Blut vorhanden ist. Es läuft also eine gerichtete Veränderung ab. Hierbei handelt es sich um Steuerung.
2 Erläutere am Beispiel der Regulation des Gehalts der Atemgase im Blut die im Schema angeführten Begriffe „Sensor“, „Stör-
größe“, „Erfolgsorgan“ und „Stellgröße“.
Sensor: Zellen in der Halsschlagader
Störgröße: z. B. körperliche Aktivität, die die Konzentration der Atemgase im Blut verändert.
Erfolgsorgan: Bei der Atmung handelt es sich um die Atemmuskulatur.
Stellgröße: Bei der Atmung ist damit das Atemzeitvolumen gemeint, also vereinfacht gesagt, die durch die Intensität der Atmung
ausgetauschte Menge an Atemgasen pro Zeit.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
3 Fieber ist ein Beispiel für eine Steuerung. Erläutere dies.
Normalerweise ist als Soll-Wert für die Körpertemperatur eine Temperatur von ca. 37 °C vorgegeben. Bei Fieber wird dieser Soll-
Wert nach oben verschoben, sodass durch Vorgänge im Körper der Ist-Wert steigt. Man hat Fieber.

Basiskonzept: Geschichte und Verwandtschaft (Seite 406/407)


1 Überprüfe, ob die Flügel der Insekten mit denen der Vögel homolog sind.
Die Flügel sind nicht homolog. Sie sind ganz unterschiedlich gebaut: Die Flügel der Insekten beinhalten keine Knochen wie bei
Vögeln und weisen keine Federn auf.
2 Vergleiche die Verwandtschaft in der Familie mit den stammesgeschichtlichen Stammbaum.
Gemeinsamkeiten: Verwandte haben einen gemeinsamen Vorfahren. Je mehr Zeit seit dem letzten gemeinsamen Verwandten
vergangen ist, desto geringer ist der Grad der Verwandtschaft.
Unterschiede: In Familienstammbäumen werden für den Grad der Verwandtschaft andere Begriffe verwendet als bei Stamm-
bäumen, die die Verwandtschaft verschiedener Arten ausdrücken. Bei der Verwandtschaft zwischen Arten werden viel größere
Zeitspannen betrachtet.
3 Erläutere, welche Merkmale ein gemeinsamer Vorfahr von Rind und Stockente gehabt haben könnte.
Gemeinsames Merkmal eines Vorfahren von Rind und Stockente ist in jedem Fall die Wirbelsäule, weil beide zu den Wirbeltieren
gehören.

Basiskonzept: Variabilität und Angepasstheit (Seite 408/409)


1 Erläutere die Bedeutung der Variabilität für die Züchtung.
Durch Variabilität treten immer wieder neue Varianten auf, die Merkmale aufweisen, die für einen Züchter interessant sein könn-
ten. Er kann diese durch gezielte Auswahl der Lebewesen für die Zucht weiter verstärken.
2 Wenn Antibiotika nicht richtig eingesetzt werden, kann es vorkommen, dass ein Teil der bekämpften Bakterien überlebt.
Langfristig können so Bakterienstämme entstehen, gegen die das Antibiotikum nicht mehr wirkt; dann sind Bakterien resis-
tent. Erkläre, indem du auf Variabilität und Angepasstheit eingehst.
Bereits vor dem Einsatz von Antibiotika treten immer wieder Bakterien auf, die in Gegenwart des Antibiotikums überleben
können. Werden nun die Antibiotika nicht lange genug eingesetzt, überleben diese Varianten. Da sich nun gerade diese Bakterien
teilen und ihr genetisches Material weitergeben, werden in den nächsten Generationen vorrangig Bakterien vorkommen, gegen
die das Antibiotikum nur noch bedingt oder gar nicht mehr wirkt.
3 Erläutere beispielhaft einige Angepasstheiten von je zwei Pflanzen- und Tierarten, die im bzw. am Wasser leben.
Beispiel 1: Seerose: angepasst durch Schwimmblätter; Luftkanäle in den Stängeln; wasserabweisende Wachsschicht auf der Blatt­
oberfläche; Auftrieb gebende Hohlräume in den Blättern; Wassertrinker an der Blattunterseite; flexible Stängel, die bei Strömung
weder reißen noch brechen.
Schwarzerle: angepasst vor allem durch Symbiose mit Bakterien, sodass auch bei mineralstoffarmen Böden die Versorgung mit
Stickstoff gewährleistet ist.
Beispiel 2: Die Körper im Wasser lebender Insektenlarven der Eintagsfliege haben einen stromlinienförmigen Körper, sodass sie
auf Steinen nicht von der Strömung fortgerissen werden. Larven der Köcherfliege bauen sich ihr eigenes „Haus“, sodass sie von der
Strömung nicht fortgetragen werden.
Beispiel 3: Bestimmte Insekten (Gelbrandkäfer, Wasserskorpion, usw.) oder deren Larven kommen an die Oberflächen und holen
sich dort einen Luftvorrat oder hängen mit einer Art „Schnorchel“ unter der Wasseroberfläche.

Basiskonzept: Fortpflanzung und Entwicklung (Seite 410/411)


1 Viele Pflanzenarten können durch Stecklinge oder Ausläufer vermehrt werden. Liegen diesen Vorgängen meiotische oder
mitotische Teilungen zugrunde? Erläutere.
Stecklinge und Ausläufer sind Formen ungeschlechtlicher Vermehrung, da sie durch Mitosen aus Zellen der Mutterpflanze hervor-
gegangen sind.
2 Kleinere Veränderungen an der DNA, sogenannte Genmutationen, können von Vorteil, aber auch von Nachteil sein. Erläutere
dies.
Kleinere Mutationen können unter Umständen zum Einbau anderer Aminosäuren in den Proteinen führen. Dadurch kann deren
dreidimensionale Form besser oder schlechter an die Funktion angepasst sein, die sie ausüben. Dies kann sich vorteilhaft oder
nachteilig in der Ausprägung von Merkmalen äußern.
3 Pantoffeltierchen vermehren sich ungeschlechtlich. Treten ungünstige Bedingungen wie z. B. Hunger auf, so kommt es zur
sexuellen Vermehrung. Erkläre.
Ungeschlechtliche Vermehrung führt nicht zur Variabilität. Die so entstandenen Individuen sind nahezu identisch. Stirbt unter
ungünstigen Bedingungen ein Tier, so werden mit großer Wahrscheinlichkeit alle Tiere diese Bedingungen nicht überleben. Findet
nun aber Vermehrung mithilfe von Sexualität statt, so besteht die Chance, dass wegen der Neukombination des genetischen
Materials Individuen entstehen, die an diese ungünstigen Bedingungen besser angepasst sind als andere und diese Bedingungen
nun überleben können.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen
Basiskonzept: Stoff- und Energieumwandlung (Seite 412/413)
1 Erkläre die Bedeutung von Pflanzen für das Leben der Tiere und Pilze.
Pflanzen sind autotroph, sie stellen aus energiearmen Stoffen (Wasser und Kohlenstoffdioxid) unter Verwendung des Sonnen-
lichts im Vorgang der Fotosynthese Glucose und Sauerstoff her. Die Glucose kann durch die Pflanzenzellen in andere energie­
reiche Stoffe umgewandelt werden. Diese energiereichen Stoffen werden von anderen Lebewesen (Konsumenten 1. und höherer
Ordnung und Destruenten) zur Aufrechterhaltung ihrer eigenen Lebensvorgänge verwendet. Sie sind heterotroph.
2 Die Verbrennung von Holz ist klimafreundlich, weil dabei keine Erhöhung des Kohlenstoffdioxidgehaltes der Atmosphäre
auftritt. Erkläre.
Holz wird gebildet, indem Pflanzen Fotosynthese betreiben. Dabei wird Kohlenstoffdioxid aus der Luft aufgenommen. Bei der
Verbrennung des Holzes wird wieder genauso viel Kohlenstoffdioxid freigesetzt, sodass in der Bilanz kein zusätzliches Kohlen-
stoffdioxid entstanden ist.
3 Vergleiche Fotosynthese und Zellatmung hinsichtlich der Stoff- und Energiegewinnung.
Gemeinsamkeiten: Es finden chemische Reaktionen bei Tieren, Pflanzen und Pilzen in speziellen Organellen statt.
Unterschiede: Bei der Fotosynthese entsteht aus energiearmen Stoffen (Wasser und Kohlenstoffdioxid) Glucose und Sauerstoff.
Die Energie des Sonnenlichts wird in den Produkten gespeichert. Bei der Zellamtung läuft der umgekehrte Vorgang ab. Die in
Glucose und Sauerstoff steckende Energie wird zum Teil als Wärmeenergie frei; ein Teil kann aber auch für die Lebensvorgänge
von Lebewesen genutzt werden.

Basiskonzept: Information und Kommunikation (Seite 414/415)


1 Bienen, die einen für sie fremden Stock anfliegen, werden nicht in diesen hineingelassen, sondern verjagt oder getötet.
Erläutere, wie die Bienen eines Stocks die fremden Bienen erkennen können.
Bienen können stockfremde Bienen vor allem am Geruch erkennen. Am Duftstoff erkennen sich die Bienen eines Stocks.
2 Hund und Katze verstehen sich nicht, wie bereits ein Sprichwort zum Ausdruck bringt. Erkläre dies.
Das Sprichwort und der Zusammenhang lässt sich mit dem Sender-Empfänger-Modell erklären. Hund und Katze senden durch
ihr Verhalten jeweils Signale aus. Allerdings kann der Empfänger dieser Signale sie nicht verstehen, weil sie nicht den Signalen
der eigenen Art entsprechen. Daher kommt es zu „Missverständnissen“.
3 An unseren Fingerkuppen befinden sich besonders viele Tastsinneszellen. Am Rücken hingegen finden sich auf derselben
Fläche deutlich weniger. Erkläre den Vorteil, der damit verbunden ist.
Gerade mit der Hand und speziell mit den Fingerkuppen befühlen wir Gegenstände und beurteilen so deren Eigenschaften. Sind
viele Taststinneszellen pro Hautfläche vorhanden, so ist der entstehende Sinneseindruck besonders genau und unser Gehirn
kann so einen besonders genauen Eindruck des Gegenstandes bilden. Mit dem Rücken nehmen wir unsere Umwelt auf diese
Weise nicht wahr. Hier geben wenige Tastsinneszellen Auskunft über Berührungen.
4 Vergleiche die Informationsweitergabe mithilfe von Hormonen mit der Erregungsleitung durch Nervenzellen.
Gemeinsamkeiten: Durch beide wird Information im Körper an andere Körperstellen weitergegeben.
Unterschiede: Die Weitergabe durch Hormone ist relativ langsam verglichen mit der durch Nervenzellen. Hormone wirken sehr
spezifisch an bestimmten Zielzellen im Körper, mit denen keine unmittelbare Leitungsverbindung besteht, wohingegen Nerven-
zellen nur an denjenigen Zellen eine Veränderung hervorrufen können, mit denen sie durch Nervenbahnen verbunden sind.

© Ernst Klett Verlag GmbH, Stuttgart 2014 | www.klett.de | Alle Rechte vorbehalten Natura 2 Biologie Lösungen