Plant Cell Rep

DOI 10.1007/s00299-013-1527-x

ORIGINAL PAPER

Identification and validation of sugarcane streak mosaic virus-

encoded microRNAs and their targets in sugarcane
Chandran Viswanathan • Jeyaraj Anburaj •

Gajjeraman Prabu

Received: 29 July 2013 / Revised: 4 October 2013 / Accepted: 9 October 2013

Ó Springer-Verlag Berlin Heidelberg 2013

Abstract considerably broaden future investigation of the SCSMV-

Key message Identification of miRNAs encoded by encoded miRNA function during viral pathogenesis and
sugarcane streak mosaic virus and understanding their might be applied as a new strategy for controlling mosaic
host target genes might be used as a new strategy to disease in sugarcane.
study viral pathogenesis and controlling mosaic disease
in sugarcane. Keywords Computational prediction  Expression
Abstract Plants have developed several defense mecha- analysis  MicroRNA  Sugarcane streak mosaic virus 
nisms to cope with various pathogens (bacteria, fungi, Target genes
virus, and phytoplasma). Among these, RNA interference
(RNAi)-mediated defense against viral infection was found Abbreviations
to be a major innate immune response. As a counter attack Bp Base pair
strategy against the host defense, viruses produce sup- DIG Digeoxigenin
pressors of host RNAi pathway. MicroRNAs (miRNAs) are EtBr Ethidium bromide
an abundant class of short (*18–22 nucleotide) non-cod- FW Fresh weight
ing single-stranded RNAs involved in RNAi pathway GO Gene ontology
leading to post-transcriptional regulation of gene expres- miRNA MicroRNA
sion. Sugarcane streak mosaic virus (SCSMV) is a distinct RNAi RNA interference
strain of Potyviridae family which has a single-stranded RT-qPCR Reverse transcription-quantitative PCR
positive-sense RNA genome causing mosaic disease in UTR Untranslated region
sugarcane. In this study, we computationally predicted and
experimentally validated the miRNA encoded by the
SCSMV genome with detection efficiency of 99.9 % in
stem-loop RT-qPCR and predicted their potential gene
targets in sugarcane. These sugarcane target genes Introduction

Plants often encounter various pathogens (bacteria, fungi,

Communicated by P. Lakshmanan.
Electronic supplementary material The online version of this
article (doi:10.1007/s00299-013-1527-x) contains supplementary
material, which is available to authorized users.
C. Viswanathan  J. Anburaj  G. Prabu (&)
Plant Functional Genomics Unit, Department of Biotechnology,
Karpagam University, Eachanari Post, 641021 Coimbatore,
Tamil Nadu, India
e-mail: prabugajjeraman@gmail.com
virus, and phytoplasma) invasions and show hypersensitive
response through a series of resistance mechanisms.
Among them, virus infection is a major threat to crops
worldwide with loss of billions of US dollars in agricultural
productivity every year (Thompson and Tepfer 2010). To
protect from viral diseases, plants have developed patho-
gen-specific defense mechanisms either through patho-
genesis-related (PR) proteins or by RNA interference-
mediated gene silencing (Pantaleo 2011). Over the course

123

of evolution, many viruses have developed sophisticated
counter-defensive mechanisms such as post-transcriptional
gene silencing (PTGS) suppressor proteins and small-
interfering (siRNA) and microRNA (miRNA)-mediated
RNAi silencing pathways (Singh et al. 2010; Song et al.
2011). These mechanisms play a crucial role during viral
infection cycle which leads to increased viral genome
translation, replication, cell-to-cell movement, symptom-
atology and pathogenicity.
MicroRNAs (miRNAs), a class of endogenously tran-
scribed single-stranded non-coding small RNA species that
are *21 nt in length. These are known to regulate the
levels of transcripts to which they bind either by cleavage
or translational repression and control diverse develop-
mental processes and defense responses (Thiebaut et al.
2012). These are present in a broad range of organisms
(prokaryotes, eukaryotes) including viruses and to-date 251
and 324 virus-encoded miRNAs have been reported as per
the miRNA registry, miRBase (Release 19, August 2012)
and miRNEST resource (Szcześniak et al. 2012), respec-
tively. Present research advances reveal that the virus-
encoded miRNAs are the key players in modulating the
antiviral host defense machinery by regulating both host
cellular and their own gene expression (Song et al. 2011).
However, a recent study has predicted five and experi-
mentally demonstrated one viral miRNA (hcrsv-miR-H1-
5p) from an (?)-sense ss RNA virus, Hibiscus chlorotic
ringspot virus (HCRSV, Carmovirus) infecting kenaf plant
(Hibiscus cannabilis L.) using the vir-miRNAs prediction
database (Gao et al. 2012). Sugarcane represents third
largest crop in terms of value next to rice and wheat in
India. Among the sugarcane diseases, mosaic is an
important viral disease of sugarcane with significant yield
losses (30–80 %) in India. Sugarcane mosaic virus
(SCMV) and sugarcane streak mosaic virus (SCSMV) are
the two major RNA viruses causing mosaics that are
widely prevalent in most of the Asian countries including
India (Bagyalakshmi et al. 2012).
Recent reports showed SCMV and SCSMV and/or
sugarcane grassy shoot phytoplasma (SCGS) and SCSMV
are omnipresent (Prabu et al. 2008; Bagyalakshmi et al.
2012). Further, analysis of the single-stranded positive-
sense RNA genome of SCSMV isolates from different
geographical regions and lack of serological cross-reac-
tions between SCSMV and other potyviruses supports that
SCSMV represents a new genus, namely Poacevirus, as
approved by International Committee on Taxonomy of
Viruses (ICTV) in the family Potyviridae (Li et al. 2011).
At present, limited experimental information is available
on SCSMV pathogenicity and SCSMV serine protease (P1)
gene as suppressors of PTGS (Tatineni et al. 2012). Hence,
it is important to identify and understand the intricate
details regarding the silencing suppressors of SCSMV.
123
Plant Cell Rep
Thus, we computationally predicted and experimentally
validated the expressed miRNAs encoded by SCSMV
genome. In addition, the specific host target transcripts of
viral miRNAs were predicted and discussed in relation to
host–pathogen interaction.
Materials and methods
Plant material
Non-symptomatic and streak mosaic disease symptomatic,
10-month-old sugarcane (Saccharum spp.) plants of culti-
var-Co86032 were collected from sugarcane fields of
Tamil Nadu Agricultural University, Coimbatore, Tamil
Nadu, India, and maintained in plastic pots containing soil
mix (soil: vermiculite: organic fertilizer, 3:2:1, w/w/w)
under greenhouse conditions (16/8-h photoperiod; 26 °C).
To confirm the SCSMV infection and to rule out other
prevalent and co-existing diseases (Prabu et al. 2008), the
collected plant samples were tested for SCSMV, SCMV,
and SCGS infection by RT-PCR and PCR using the
reported specific primers (Prabu et al. 2008; Viswanathan
et al. 2009). Presence of SCSMV infection in the plant
materials used in this study has been confirmed (data not
shown).
RNA isolation
Total RNA and small RNA fraction enriched with miRNAs
were isolated from healthy and SCSMV-infected sugarcane
leaf tissues using miRNeasy mini kit (QIAGEN, Germany)
according to the manufacturer’s protocol. RNA quality and
quantity was determined by spectrophotometry and using
electrophoresis. RNA samples were stored at -80 °C for
analyses.
Prediction of potential miRNAs and their precursors
Figure 1 summarizes the major steps involved in identi-
fying potential miRNAs in the full-length nucleotide
sequence (9782 base) of SCSMV genome (GenBank
accession no. NC_014037.1; http://www.ncbi.nlm.nih.gov/
). We used the dedicated viral pre-miRNA prediction
algorithm, VMir (Grundhoff 2011) for the initial screening
with the following default parameters: (1) genome scan-
ning window of 500 nt; (2) advancing each window of step
size (10 nt) in both the orientations; (3) score-based hairpin
structure prediction to each window by RNAFold algo-
rithm. The predicted hairpin structures were then scored
based on the size of the terminal loop, number of base pairs
and size of the bulges for each hairpin in the sliding win-
dow (Grundhoff 2011). Further, the predicted hairpin
Plant Cell Rep
Fig. 1 Schematic representation of the steps involved in prediction of
SCSMV-encoded miRNAs
sequences were screened using miRPara (Wu et al. 2011),
MiPred (Jiang et al. 2007) and Virgo (Kumar et al. 2009) in
order to reduce the false predictions and redundancy
elimination.
Prediction of secondary structure
Selected pre-miRNA candidates were used for secondary
structure prediction with publically available program,
MFOLD 3.1 (http://www.bioinforpi.edu/applications/
mfold/old/rna/). The following parameters were used in
predicting the secondary structure: (1) linear RNA
sequence; (2) folding temperature fixed at 37 °C, ionic
condition of 1 M NaCl and with no divalent ions; (3)
percent sub-optimality number of five; and (4) maximum
interior/bulge loop size of 30. All the other parameters
were set with default values.
In brief, the following criteria were applied in desig-
nating the RNA sequence as an miRNA homolog: (1) pre-
miRNA sequence can fold into an appropriate stem-loop
hairpin secondary structure; (2) it contains the *22 nt
mature miRNA sequence within one arm of the hairpin; (3)
predicted secondary structures had higher negative mini-
mal free energies and minimal free energy index (MFEI)
than other different types of RNAs; (4) 30–70 % A?U
content; (5) predicted mature miRNAs had no more than
six mismatches with the opposite miRNA* sequence in the
other arm; (6) maximum size of three nucleotide for a
bulge in the miRNA sequence and (7) no loop or break in
the miRNA sequence was allowed.
Experimental validation
To experimentally validate the predicted precursor and
mature miRNA encoded by SCSMV, reverse transcription-
PCR (RT-PCR) and stem-loop end-point pulse RT-qPCR
were performed as described below using the isolated total
RNA and small RNA fractions, respectively, from the
collected healthy and SCSMV-infected sugarcane leaf
tissues.
Reverse transcription-PCR
To analyze the predicted pre-miRNA, 1 lg of isolated total
RNA was used for single-strand cDNA synthesis as
described in First strand cDNA synthesis kit (Clontech).
Synthesized single-strand cDNAs (50 ng) were subjected
to PCR amplification using specific primer pairs (FP 50 -
CGTATCTACGTATCAA-30 , and RP 50 -AACAGGGT
GAGCAATC TC-30 ) that amplify the predicted precursor
region of miRNA for 30 cycles each with 94 °C for 45 s,
63 °C for 45 s and 72 °C for 45 s, followed by final
extension at 72 °C for 5 min.
Stem-loop end-point pulse RT-qPCR
In order to confirm the expression of predicted mature
miRNA, stem-loop pulse RT-qPCR (Gasic et al. 2007) was
performed using the designed stem-loop containing RT and
forward primer containing the 50 end of mature miRNA
(forward and reverse) designed according to Gasic et al.
(2007). In brief, single-stranded cDNA templates were
synthesized in 25 ll reaction volume containing 59 first
strand reverse transcription buffer, 10 mM DTT, 50 lM
dNTP, 200 U of SMARTScribeTM reverse transcriptase
(Clontech), 1.0 lg of miRNA-enriched small RNA,
50 pmol stem-loop containing RT primer (50 -CTCACAGT
123

ACGTTGGTATCCTTGTGATGTTCGATGCCATATTGT
ACTGTGAGATCTGCC-30 ) and the reaction was per-
formed as one cycle of 16 °C for 30 s; followed by 60
cycles of pulse RT at 30 °C for 30 s, 42 °C for 30 s, and
50 °C for 1 s.
Quantitative PCR (qPCR) amplification was performed
using a MX3005P thermocycler (Stratagene/Agilent
Technologies) in 20 ll reaction consisting of 1 ll single-
strand cDNA, 0.4 ll each of forward primer (50 -ACACTC
CAGCTGGGTGGTGGTTCTCTTGGATA-30 ) specific to
50 end of mature miRNA and universal reverse primer (50 -
CTCACAGTACGTTGGTATCCTTGTG-30 ) complemen-
tary to the stem-loop part of the RT primer, respectively,
10 ll of RealQ-PCR 2X master mix (Ampliqon) with the
following reaction conditions of 95 °C for 15 min, fol-
lowed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and
70 °C for 45 s. The RT reaction mix without reverse
transcriptase served as a negative control. For internal
control, primers specific to U6 snRNA as described by
Turner et al. (2013) was used for amplification. The dis-
sociation curves were generated at 95 °C to verify the PCR
specificity after completion of PCR cycling.
The specificity of detection and efficiency (RT products
of mature miRNA and the internal control) were deter-
mined by examining the quality of the amplification, dis-
sociation and standard curve using 10-1–10-5 dilutions of
cDNA template and MxPro software (version1.0; Strata-
gene/Agilent Technologies). All qPCR reactions were
performed in two technical replicates.
The final PCR products of pre- and mature miRNA
encoded by SCSMV were analyzed on 4 % agarose gel,
purified using QIAquick Gel extraction kit (QIAGEN),
cloned into pTZ57R/T cloning vector (Fermentas), trans-
formed into E. coli strain DH5a, and sequenced at the
DNA sequencing service of Eurofins, Bengaluru, India.
Sequence analysis
The obtained sequences of mature miRNA and the pre-
dicted precursor were analyzed by BLAST search in NCBI
(http://blast.ncbi.nlm.nih.gov/). Alignment of the identified
sequences and other SCSMV sequences published in
GenBank were performed using ClustalW program (http://
www.ebi.ac.uk/Tools/clustalw2). Phylogenetic tree was
generated by neighbor-joining method with 1,000 bootstrap
replications using Molecular Evolutionary Genetics Ana-
lysis (MEGA) software program version 5.0 (http://www.
megasoftware.net).
Reverse RNA blot hybridization
The isolated small RNAs from healthy and SCSMV-
infected sugarcane leaf tissues were analyzed for the
123
Plant Cell Rep
predicted SCSMV-encoded miRNA by reverse RNA dot
blot hybridization as further validation. Small RNA (3 lg)
fractions were dot blotted on to Hybond-N? membrane and
UV cross-linked to the membrane. The digoxigenin-labeled
reverse complementary oligonucleotide of predicted
SCSMV-encoded miRNA (50 -ATCAGCCTATCCAAGAG
AACCA-30 ) was prepared using DIG Oligonucleotide 30 -
end labeling kit (Roche) and used for hybridization with
small RNAs at 37 °C in the DIG Easy Hyb solution
(Roche). Washing and detection were performed according
to the manufacturer’s instructions (DIG Northern starter
and detection kit, Roche).
Prediction of target transcripts
To predict the potential target genes by SCSMV-encoded
miRNA, we used the psRNATarget (http://plantgrn.noble.
org/psRNATarget/) against the pre-loaded transcript/
genomic library of Arabidopsis, Oryza, Zea mays, Sorghum
bicolor and Saccharum datasets present in the library of
psRNATarget server. The following parameters were
adjusted; three as score for each 20 nt, six for G:U wobble
pairs, zero for indel and three for other mismatches.
According to the previously reported standard bioin-
formatics criteria (Dai and Zhao 2011), target transcripts
were predicted. The criteria used was as follows: (1) no
gaps; (2) no more than four mismatches between miRNA
and target mRNA; (3) only one allowed mismatch in the
region complementary to nucleotide positions 2–12 from 50
end of the miRNA; (4) no mismatch in the cleavage point
at position 10 or 11; (5) three additional mismatches and no
more than two continuous mismatches at nucleotide posi-
tions 12–22; (6) consideration of non-canonical pairs as
mismatches; (7) half mismatch score for G:U pair; (8)
threshold mismatch score of B3 for mismatched patterns in
the miRNA:mRNA duplexes. The predicted target tran-
scripts were removed if the mismatch score was greater
than the threshold.
The target transcript results were then analyzed by
BLAST against the NCBI non-redundant (NR), SwissProt
databases, respectively, and the location of miRNA hit, i.e.,
50 UTR, coding region, 30 UTR was determined.
Gene ontology of target genes
In order to better understand the functions of target genes
and their metabolic regulatory network during the SCSMV
infection, annotation of target function was performed
based on the GO database and the KEGG pathway data-
base. The target genes were annotated based on sequence
similarity using BLASTX against the NCBI NR, and
SwissProt database. For each unigene with a significant
SwissProt hit, the accession of the most significant hit was
Plant Cell Rep
selected and assigned a Level 4 of gene ontology (GO)
classification using the BLAST2GO tool (Conesa and Gotz
2008). Classification of each gene to a pathway/function
was based on survey of scientific literature available
regarding the gene. The target genes were grouped
according to the GO terms of biological processes,
molecular functions and cellular components using the
Term Enrichment Tool at AmiGO (version 1.7; http://
amigo.geneontology.org/cgi-bin/amigo/go.cgi).
Carotenoid and chlorophyll analysis
The pigments, chlorophylls and carotenoids were extracted
from healthy and SCSMV-infected sugarcane leaves using a
method described by Page et al. (2004). Leaf tissues from
healthy and SCSMV-infected sugarcane plant were ground to
a fine powder using liquid nitrogen. One hundred milligram
portions were extracted with 300 ll of methanol for 5 min at
48 °C followed by the addition of 300 ll of 50 mM Tris–HCl
(pH 7.5) containing 1 M NaCl and further mixing for 5 min at
48 °C. Chloroform (800 ll) was added and the solution
mixed for 10 min at 48 °C. The aqueous and organic phases
were separated by centrifugation at 3,000g for 5 min and
500 ll of the lower organic phase was transferred to a
microcentrifuge tube. The solvent was removed by SpeedVac
and the residue stored in the dark at -20 °C. For spectro-
photometric analysis, pigment residues were dissolved in
500 ll of acetone. Chlorophyll and carotenoid concentrations
(lg/g of fresh weight) were calculated using the equations
(Chl a = 11.75A662 - 2.350A645; Chl b = 18.61A645
-3.960A662; Car = (1000A470-2.270Chla-81.4Chlb)/227)
Fig. 2 a Diagrammatic representation of SCSMV genome structure,
showing the position of SCSMV pre-miR16 within the 30 UTR of
SCSMV genome from nt 9620 to 9729. b Folded hairpin structure of
pre-miR16. The region of mature miRNA sequence is shown in bold
and highlighted in grey. c Stem-loop end point pulse RT-qPCR.
as described in Lichtenthaller (1987) using a UV–visible
spectrophotometer (Carywin) at 470, 645, and 662 nm.
Results and discussion
Prediction and validation of a miRNA in SCSMV
genome
Plant viruses invade and cause infections by utilizing the
biosynthetic pathways of host cell, but plants have evolved
strategies to resist virus and other pathogen attacks. RNA
silencing is one of the main adaptive defense mechanisms
against pathogens including viruses (Pantaleo 2011). To
counteract this host defense, viruses encode specific RNA
silencing suppressor mechanisms.
Many studies have revealed that viruses can also encode
miRNAs, which are proposed to be involved in RNA
silencing suppressor mechanisms, viral replication and
persistence (Kumar et al. 2009; Song et al. 2011; Gao et al.
2012). SCSMV is a pathogenic Poacevirus that severely
affects sugarcane in Southeast Asia. Studies on virus-
encoded miRNAs and their function have profound insights
for understanding the infection and the pathogenic mech-
anisms. Therefore, we focused our research on computa-
tional prediction, isolation and characterization of putative
miRNA stem-loop precursors encoded by an SCSMV.
Figure 1 shows an overview of the computational data
analysis pipeline. The SCSMV genome (9,782 nt) was
screened for hairpin-structured miRNA precursors in the
sense strand of the genome using VMir Analyzer
d Northern blot confirmation of SCSMV-encoded mature miR16
expression. U6 was used as internal control. Lane –ve negative
control of RT, Lane H miRNA-enriched fraction extracted from
healthy sugarcane leaf tissue, Lane In miRNA-enriched fraction
extracted from SCSMV-infected sugarcane leaf tissue
123
 Plant Cell Rep

123
 Plant Cell Rep
b Fig. 3 Validation of the identified SCSMV miR16 by stem-loop
qRT-PCR. a Amplification; b dissociation; and c standard curve of
miR16. The detection quality, linearity (Rsq), and detection efficiency
values were obtained by analyzing the identified miR16 in serially
diluted cDNA templates, ranging from 10-1 to 10-5 as indicated in
each panel
(Grundhoff 2011). A total of 30 sequences with potential
hairpin-like structures were predicted as candidate mi-
RNA precursors. In order to reduce the false predictions,
the predicted candidates were further screened using
Virgo, miRPara and MiPred. Then candidates within or
antisense to protein-coding regions were removed
according to the NCBI genome annotations. Finally, only
one non-protein-coding sequence (CDS) located at 30
UTR region was selected as miRNA precursor’s candi-
date and the secondary structure was predicted using
MFOLD 3.1 program. At the last step, the mature
sequence was predicted using miRPara. The predicted
precursor designated as SCSMV pre-miR16 was of 110
nucleotide (nt) in length with the nucleotide percentage
compositions of 20 % adenine, 32.73 % uracil, 25.45 %
guanine and 21.82 % of cytosine and found within the 30
UTR region from nt 28 to 137, corresponding to genomic
nt 9620 to 9729 (Fig. 2a). Uracil is dominant (32.73 % of
total nucleotide composition) in the identified pre-miR16
followed by guanine (25.45 %), cytosine (21.82 %) and
adenine (20 %).
According to MFold, the predicted secondary structure
of pre-miR16 (Fig. 2b) has the minimum free energy
(MFE) of -28.5 kcal/mol which is in consistence with the
reported viral pre-miRNAs (miRBase Release 19, August
2012). The mature miRNA (nt 18–39 in pre-miR16), des-
ignated as SCSMV miR16 have the 22 nt length and the
AU and GC nucleotide composition of 54.54 and 45.46 %,
respectively (Fig. 2b).
In order to validate and evaluate the expression levels of
the predicted SCSMV miR16, we performed stem-loop
end-point pulse RT-qPCR and reverse northern blot
approaches using the enriched miRNA fractions isolated
from healthy and SCSMV-infected sugarcane leaf tissues
as adopted for validating the HCRSV-encoded miRNAs in
the infected kenaf plant (Gao et al. 2012). Stem-loop RT-
qPCR has proved to be a very sensitive method for
detection and discrimination of mature miRNAs (Gasic
et al. 2007; Gao et al. 2012). The expected length of 110
and 65 bp PCR product of predicted pre-miR16 (data not
shown) and mature miR16 (Fig. 2c), respectively, were
amplified only in SCSMV-infected sample and was then
analyzed on 4 % agarose gel with EtBr staining. The
purified PCR product was cloned, sequenced for confir-
mation and excluding the non-specific products of expected
size like primer–dimer or other artifacts. In addition,
reverse northern dot blot showed no positive signal specific
to the candidate miR16 in uninfected sugarcane sample
(Fig. 2d).
The qPCR results indicated that mature miR16 was
detected only in SCSMV-infected sample with Ct value of 21
(Fig. 3a) and a single peak detection specificity at 81.9 °C as
observed in the dissociation curve profile (Fig. 3b). This
detection quality and efficiency were further validated by
generating the standard curve (Fig. 3c) of serially diluted
template which had R2 value of 0.999, detection efficiency
(E = 10-1/slope - 1) of 99.9 %, and slope of -3.324.
The experimentally validated SCSMV pre- and mature
miR16 sequences were submitted in EMBL with the
accession numbers of HF675185 and HF675186, respec-
tively. The isolated SCSMV-encoded pre-miR16 sequence
was analyzed by BLASTn search and compared with
sequences of six and nine isolates of SCSMV originated
from different countries (Pakistan, Japan, Thailand, and
Indonesia) and India, respectively. As shown in Fig. 4a,
analyzed isolates revealed 95–99 % nucleotide sequence
identity in the precursor region of miR16. Further, the
comparative analysis of the miR16 mature sequence iden-
tified in this study demonstrated 100 % conservation in the
genomic location among the isolates of Indian and Paki-
stan, whereas 86–91 % identity were found with the iso-
lates from Japan, Thailand and Indonesia (Fig. 4a). Similar
evolutionary conservation was also reported in miRNAs of
Bombyx mori nucleopolyhedrosis virus (BomaNPV),
Autographa californica nucleopolyhedrosis virus (Ac-
MNPV), Plutella xylostella multiple nucleopolyhedro virus
(PxMNPV), gamma herpes viruses (Singh et al. 2010).
Based on the comparative sequence analysis, a phylogram
was constructed which revealed that SCSMV isolates are
grouped into three major clusters (Fig. 4b). The isolates
from Japan, Thailand, and Indonesia formed cluster one,
those from Indian and Pakistan, and isolates of Indian
formed cluster two and three, respectively (Fig. 4b). This
evolutionary relationship (Fig. 4b) clearly indicates that the
viral miRNAs are under strong selection pressure and play
potentially critical role against the host defense mecha-
nisms and in viral infection cycle.
Further, we also performed a seed region homology
search between the SCSMV miR16 and all other known
plant miRNAs reported in miRBase (release 19) and no
significant similarities were found with the plant miRNAs in
general and sugarcane miRNAs in particular which give
additional support considering the identified miR16 as spe-
cific to SCSMV. These observations are in consistent with
the Bombyx mori-specific baculovirus (Singh et al. 2010).
Prediction of SCSMV miR16 target genes
To understand the biological function of SCSMV-encoded
miR16 in mosaic disease infection, it is necessary to
123

identify their targets in viral and host genome. The pre-
sence of near-perfect complementarities between miRNA
and their target mRNAs facilitated computational searches,
which have been successful in plants, animal, insect and
virus (Dai and Zhao 2011). Many computational tools like
PatScan (Dai et al. 2011), miRNEST (Szcześniak et al.
2012) and miRU/psRNATarget (Dai and Zhao 2011) are
available for identifying miRNA targets. The predicted
123
Plant Cell Rep
targets can be subsequently verified by adopting PCR-
based strategies.
Taking advantage of this unique property, we identified
antisense hits of SCSMV miR16 on mRNA/cDNA data-
base of sugarcane and other plant species such as arabi-
dopsis, rice, sorghum, maize using the screening criteria as
described in ‘‘Materials and methods’’. In this study, we
identified a total of 19 gene targets for SCSMV miR16.
 Plant Cell Rep
b Fig. 4 a Comparison of the identified nucleotide sequence of pre-
miR16 obtained in this study (Isolate_86032) with those of isolates
from India and other countries. The mature sequence of SCSMV
miR16 region is indicated by arrow. The Sugarcane Streak Mosaic
virus isolates used in comparison were as follows: isolates from India,
[AM749393 (SCSMV isolate Co94012-3); AM749394 (SCSMV
isolate Co94012-4); JN941985 (SCSMV isolate IND671);
GQ386845 (SCSMV isolate TN1); GQ386843 (SCSMV isolate
AP1); Y17738 (SCSMV isolate Andra pradesh); AY193784 (SCSMV
isolate SCSMV tn); GQ386844 (SCSMV isolate KA1); GQ246187
(SCSMV isolate TPT)]; isolates from Pakistan, [GQ388116 (SCSMV
isolate PAK); NC014037 (SCSMV isolate PAK)]; isolates from
Japan, [JF488064 (SCSMV isolate JP1); JF488065 (SCSMV isolate
JP2)]; isolates from Thailand, [JN163911 (SCSMV isolate THA-
NP3)]; and isolates from Indonesia, [JF488066 (SCSMV isolate ID)].
b Unrooted phylogram of SCSMV pre-miR16. Phylogenetic tree
derived from the nucleotide sequence comparison. The tree was
generated using MEGA 5 by the CLUSTAL W method. The NCBI
accession number of the sequences used in the comparison is shown
in parentheses. The phylogram was generated as a consensus of 1,000
bootstrap replicates by the neighbor-joining method (the bootstrap
values are indicated close the branch divisions, when [50 %). The
scale bar indicates the relative amount of change along branches
These targets belong to several gene families with different
biological functions (Fig. 5) and are presented in Supple-
mental Table S1.
To get better view of the target gene function, the
obtained target sequences were annotated according to the
three main ontology, i.e., cellular component, molecular
function and biological process (Fig. 5). For the biological
process, we grouped sequences into three sub groups: (1)
cell growth and maintenance (35 %); (2) metabolism
(35 %) and (3) unknown (30 %) (Fig. 5a). As far as
molecular functions, the genes were assigned to 12 cate-
gories and grouped as four main groups: (1) regulatory
function (25 %); (2) macromolecular binding (15 %),
enzymatic functions (30 %), and hypothetical functions
(30 %; Fig. 5b). In case of cellular components, the genes
were assigned in four main categories with majority of
them participating in cell organelles (55 %), unknown
cellular components (20 %), membrane (20 %) and cyto-
plasmic components (5 %; Fig. 5c).
Recently, many reports demonstrated that miRNA binds
to 30 UTR of the target gene in general but they also bind to
50 UTR (Lytle et al. 2007) or CDS (Forman et al. 2008),
and repress the expression of target mRNAs by cleavage
and translation inhibition. In this study, SCSMV miR16
binds mostly to coding (75 %), followed by 30 UTR (20 %)
and 50 UTR (5 %) regions of target genes and regulates
gene activity by cleavage.
General observations of target gene activity
in virus–host interactions
To obtain a general overview of the target gene function in
sugarcane during SCSMV infection, individual target gene
functions were analyzed for enrichment of GO terms using
the Term Enrichment Tool at AmiGO (http://amigo.
geneontology.org/cgi-bin/amigo/term_enrichment). The
predicted cellular targets are involved in different antiviral
host defense mechanisms.
The identified target gene encoding isopentenyl pyro-
phosphate:dimethylallyl pyrophosphate isomerase 2 (Gen-
Bank accession no. TC111997) is involved in central rate-
limiting step of plastidial isoprenoid biosynthesis. In
plants, carotenoids and long-chain isoprenoids are central
metabolites for the biosynthesis of sterols, growth factors,
C15 and C20 prenyl anchors, phytol moiety of chlorophyll
and some quinines. They are synthesized from the C5
precursors isopentenyldiphosphate (IPP) and dimethylallyl
pyrophosphate (DMAPP) via cytoplasmic mevalonate
(MVA) and plastidial methylerythritol 4-phosphate (MEP)
pathway (Shimura et al. 2011).
The MEP pathway and isoprenoids are important for the
functioning of membrane compartments, membrane pro-
tein trafficking and localization. Recent reports demon-
strated that isoprenoids are required for the membrane
association of argonaute 1-containing silencing complexes
in Arabidopsis (Brodersen et al. 2011) and are also
involved in antiviral defense, plant hormones biosynthesis
(Page et al. 2004). The reduced level of total chlorophyll
(95.3 lg/g of FW), carotenoids (20.1 lg/g of FW) and
decreased chlorophyll to carotenoids ratio (58.2 %) in the
SCSMV-infected leaves suggest that plastidial isoprenoid
biosynthesis is metabolically targeted by the SCSMV-
encoded miRNA (Fig. 6). In addition, carotenoids, play a
role in protecting the membrane lipids and storage lipids
from lipid peroxidation (Page et al. 2004).
Plant viruses interact with a broad range of host proteins
and cellular factors for their infection, replication, accu-
mulation, cell-to-cell movement and folding of viral pro-
teins within host cells (Cho et al. 2012). Among the host
components, the interaction of the identified target heat
shock protein DnaJ (GenBank accession no. TC418762) is
required for its efficient molecular chaperon function and
as a negative effectors of viral replication and movement of
Potato virus X (Cho et al. 2012) and Y (Hofius et al. 2007),
Tomato spotted wilt virus (TSWV, Soellick et al. 2000),
Rice stripe virus (Lu et al. 2009).
Plant-derived RNA silencing signals and a series of PR
resistance proteins against the pathogen were initiated
spontaneously or induced in localized infection region.
Subsequently, silencing signals and PR proteins initiate the
downstream components of the plant defense signaling
pathway. Many studies demonstrated that the signals were
spread locally through plasmodesmata and long distance
systemic spread through the phloem by lipid transfer pro-
teins (Sarowar et al. 2009) and SNF2 domain-containing
helicases (Smith et al. 2007). In our predictions, genes
123
 Plant Cell Rep

Fig. 5 Functional
categorization of predicted
target genes for SCSMV-
encoded miR16. The relative
frequencies of assigned Gene
Ontology (GO) hits viz.
a Biological process;
b molecular functions and
c cellular components were
presented as a percentage of
GO-annotated target genes

encoding non-specific lipid transfer protein 1 (GenBank
accession no. BP839069) and SNF2 domain-containing
helicase (GenBank accession no. AT2G02090), disease
resistance protein (GenBank accession no. TC455181) and
disease resistance RPP13 like protein 3 (GenBank acces-
sion no. TC402335) were being targeted and cleaved by
SCSMV miR16. Thus, the systemic spread of host silenc-
ing signals and systemic acquired resistance (SAR) may be
lost in infected sugarcane plant and leading to the pro-
gression of SCSMV infection.
Similarly, target genes encoding 3-ketoacyl (acyl-carrier
protein) reductase (GenBank accession no. CA106607),
phospholipase D beta 1 (GenBank accession no.
AT2G42010), TPR-containing UDP-N-acetylglucosamine
(GenBank accession no. TC306545), leaf senescence
protein (GenBank accession no. TC459518), and F-box
protein (GenBank accession no. NP278550) were involved
in various antiviral activities of other plants (Espinoza et al.
2007; Cao et al. 2008; Canonne et al. 2011). F-box proteins
are known to play an important role in plant growth and
development and disease resistance via up-regulating var-
ious disease-related gene expression (Cao et al. 2008).
Eight of the identified potential target genes (Table S1)
encoding transposable element (GenBank accession no.
AT4G06523), spore germination protein (GenBank acces-
sion no. DV168002), WEB family protein (GenBank
accession no. AT2G17940), glycine-rich Dom3z homolog
(GenBank accession no. NM_001187481) and other
annotated hypothetical proteins, having unknown function
in relation to SCSMV pathogenesis in sugarcane. These

123
Plant Cell Rep
Fig. 6 Photosynthetic pigment (chlorophyll a, chlorophyll b and
Carotenoid) concentration in healthy and SCSMV-infected sugarcane
leaf tissue. The results are expressed as mean values of three-
independent estimations ± SD
identified targets considerably broadened future investiga-
tions that help understand SCSMV-encoded miRNA
functions during viral pathogenesis.
To the best of our knowledge, the present study provides
the first experimental demonstration of miRNA encoded by
SCSMV infecting sugarcane. Further, SCSMV miR16 was
found to target many cellular transcripts to establish a
favorable environment for virus life cycle and evade the
host defense. These results provide a useful resource for
further in-depth studies on streak mosaic disease in sug-
arcane and targeting the SCSMV miR16 might be a new
strategy for controlling SCSMV in sugarcane.
Acknowledgments Authors are thankful to Dr. R. Vasanthakumar,
Shri. K. Murugaiah, Dr. P. Lakshmanaperumalsamy, Karpagam
University, Coimbatore, Tamil Nadu, India, for their encouragement
and support during the course of study. The financial support in terms
of research fellowship to Mr. Viswanathan Chandran by Department
of Biotechnology, Government of India, New Delhi, India (BT/
PR2402/AGR/36/698/2011) is also gratefully acknowledged.
References
Bagyalakshmi K, Parameswari B, Chinnaraja C, Karuppaiah R,
Ganesh Kumar V, Viswanathan R (2012) Genetic variability and
potential recombination events in the HC-Pro gene of sugarcane
streak mosaic virus. Arch Virol 157:1371–1375
Brodersen P, Achard LS, Schaller H, Khafif M, Schott G, Bendah-
mane A, Voinnet O (2011) Isoprenoid biosynthesis is required
for miRNA function and affects membrane association of
ARGONAUTE 1 in Arabidopsis. Proc Natl Acad Sci USA
109:1778–1783
Canonne J, Nicolas SF, Rivas S (2011) Phospholipases in action
during plant defense signaling. Plant Signal Behav 6:13–18
Cao Y, Yang Y, Zhang H, Li D, Zheng Z, Song F (2008)
Overexpression of a rice defense-related F-box protein gene
OsDRF1 in tobacco improves disease resistance through poten-
tiation of defense gene expression. Physiol Plant 134:440–452
Cho SY, Cho WK, Sohn SH, Kim KH (2012) Interaction of the host
protein NbDnaJ with Potato virus X minus-strand stem-loop 1
RNA and capsid protein affects viral replication and movement.
Biochem Biophys Res Comm 417:451–456
Conesa A, Gotz S (2008) Blast2GO: a comprehensive suite for
functional analysis in plant genomics. Int J System Bioinfor
4:343–362
Dai X, Zhao PX (2011) psRNATarget: a plant small RNA target
analysis server. Nucl Acids Res W155–159
Dai X, Zhuang Z, Zhao PX (2011) Computational analysis of miRNA
targets in plants: current status and challenges. Brief Bioinform
12:115–121
Espinoza C, Medina C, Somerville S, Arce-Johnson P (2007)
Senescence-associated genes induced during compatible viral
interactions with grapevine and Arabidopsis. J Exp Bot
58:3197–3212
Forman JJ, Miller AL, Coller HA (2008) A search for conserved
sequences in coding regions reveals that the let-7 microRNA
targets Dicer within its coding sequence. Proc Natl Acad Sci
USA 105:14879–14884
Gao R, Liu P, Wong SM (2012) Identification of a plant viral RNA
genome in the nucleus. PLoS ONE 7:e48736
Gasic EV, Wu R, Wood M, Walton EF, Hellens RP (2007) Protocol: a
highly sensitive RT-PCR method for detection and quantification
of microRNAs. Plant Methods 3:12
Grundhoff A (2011) Computational prediction of viral miRNAs.
Methods Mol Biol 721:143–152
Hofius D, Maier AT, Dietrich C, Jungkunz I, Bornke F, Maiss E,
Sonnewald U (2007) Capsid protein-mediated recruitment of
host DnaJ-like proteins is required for potato virus Y infection in
tobacco plants. J Virol 81:11870–11880
Jiang P, Wu H, Wang W, Ma W, Sun X, Lu Z (2007) MiPred:
classification of real and pseudo microRNA precursors using
random forest prediction model with combined features. Nucl
Acids Res 35:339–344
Kumar S, Ansari FA, Scaria V (2009) Prediction of viral microRNA
precursors based on human microRNA precursor sequence and
structural features. Virol J 6:129
Li W, He Z, Li S, Huang Y, Zhang Z, Jiang D, Wang X, Luo Z (2011)
Molecular characterization of a new strain of sugarcane streak
mosaic virus (SCSMV). Arch Virol 156:2101–2104
Lichtenthaller HK (1987) Chlorophylls and carotenoids, pigments of
photosynthetic biomembranes. Methods Enzy 148:350–382
Lu L, Du Z, Qin M, Wang P, Lan H, Niu X, Jia D, Xie L, Lin Q, Xie
L, Wu Z (2009) Pc4, a putative movement protein of Rice stripe
virus, interacts with a type I DnaJ protein and a small Hsp of
rice. Virus Genes 38:320–327
Lytle JR, Yario TA, Steitz JA (2007) Target mRNAs are repressed as
efficiently by microRNA-binding sites in the 50 UTR as in the 30
UTR. Proc Natl Acad Sci USA 104:9667–9672
Page JE, Hause G, Raschke M, Gao W, Schmidt J, Zenk MH,
Kutchan TM (2004) Functional analysis of the final steps of the
1-Deoxy-D-xylulose 5-phosphate (DXP) pathway to isoprenoids
in plants using virus-induced gene silencing. Plant Physiol
134:1401–1413
Pantaleo V (2011) Plant RNA silencing in viral defence. Adv Exp
Med Biol 722:39–58
Prabu GR, Kawar PG, Dixit GB, Theerthaprasad D (2008) First report
of a phytoplasma and virus pathogens associated with sugarcane
grassy shoot disease in India. Sugarcane Int 26:14–16
Sarowar S, Kim YJ, Kim KD, Hwang BK, Ok SH, Shin JS (2009)
Overexpression of lipid transfer protein (LTP) genes enhances
resistance to plant pathogens and LTP functions in long-distance
systemic signaling in tobacco. Plant Cell Rep 28:419–427
Shimura H, Pantaleo V, Ishihara T, Myojo N, Inaba J, Sueda K,
Burgyan J, Masuta C (2011) A viral satellite RNA induces
123

yellow symptoms on tobacco by targeting a gene involved in
chlorophyll biosynthesis using the RNA silencing machinery.
PLoS Pathog 7:e1002021
Singh J, Singh CP, Bhavani A, Nagaraju J (2010) Discovering
microRNAs from Bombyx mori nucleopolyhedrosis virus. Virol
407:120–128
Smith LM, Pontes O, Searle I, Yelina N, Yousafzai FK, Herr AJ,
Pikaard CS, Baulcombea DC (2007) An SNF2 protein associated
with nuclear RNA silencing and the spread of a silencing signal
between cells in Arabidopsis. Plant Cell 19:1507–1521
Soellick TR, Uhrig JF, Bucher GL, Kellmann JW, Schreier PH (2000)
The movement protein NSm of tomato spotted wilt tospovirus
(TSWV): RNA binding, interaction with the TSWV N protein,
and identification of interacting plant proteins. Proc Natl Acad
Sci USA 97:2373–2378
Song L, Gao S, Jiang W, Chen S, Liu Y, Zhou L, Huang W (2011)
Silencing suppressors: viral weapons for countering host cell
defenses. Protein Cell 2:273–281
Szcześniak MW, Deorowicz S, Gapski J, Kaczyński Ł, Makalowska I
(2012) miRNEST database: an integrative approach in micro-
RNA search and annotation. Nucl Acids Res 40:D198–D204
123
Plant Cell Rep
Tatineni S, Feng Q, Ruhui L, Jack MT, Roy F (2012) Triticum mosaic
poacevirus enlists P1 rather than HC-Pro to suppress RNA
silencing-mediated host defense. Virology 433:104–115
Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic
M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PCG
(2012) Computational identification and analysis of novel
sugarcane microRNAs. BMC Genomics 13:1–14
Thompson JR, Tepfer M (2010) Assessment of the benefits and risks
for engineered virus resistance. Adv Virus Res 76:33–56
Turner M, Adhikari S, Subramanian S (2013) Optimizing stem-loop
qPCR assays through multiplexed cDNA synthesis of U6 and
miRNAs. Plant Signal Behav 8:e24918
Viswanathan R, Karuppaiah R, Balamuralikrishnan M (2009) Iden-
tification of new variants of SCMV causing sugarcane mosaic in
India and assessing their genetic diversity in relation to SCMV
type strains. Virus Genes 39:375–386
Wu Y, Wei B, Liu H, Li T, Rayner S (2011) MiRPara: a SVM-based
software tool for prediction of most probable microRNA coding
regions in genome scale sequences. BMC Bioinf 12:107