Sie sind auf Seite 1von 401

Auf einen Blick

Einführung und Zeittafel 1


Grundlagen 15
Molekulare Grundlagen 16
Veränderungen in DNA und Genen 50
Eukaryote Zellen 62
Formale Genetik 82
Chromosomen 112
Regulation von Genfunktion 144
Epigenetische Modifikationen 160
Genetische Signalwege 168
Gene in der Embryonalentwicklung 178
Genomik 187
Genetik in der Medizin 211
Homeostase 212
Stoffwechsel 228
Immunsystem 248
Entstehung von Tumoren 264
Zell- und Gewebestruktur 284
Hämoglobin-Krankheiten 296
Sex-Determination und Differenzierung 308
Atypische Genetische Mechanismen 316
Sinneswahrnehmung 322
Chromosomenkrankheiten (Beispiele) 334
Grundlagen genetischer Diagnostik 340
Pathologische Anatomie des Humanen Genoms 350
Tabellen 360
Glossar 369
Sachverzeichnis 382
Taschenatlas
Humangenetik
Eberhard Passarge

3., vollständig überarbeitete


Auflage

170 Farbtafeln von Jürgen Wirth

Georg Thieme Verlag


Stuttgart · New York
IV

Prof. Dr. med. Wichtiger Hinweis: Wie jede Wissenschaft ist


Eberhard Passarge die Medizin ständigen Entwicklungen unterwor-
ehem. Direktor des Instituts für Humangenetik fen. Forschung und klinische Erfahrung erwei-
Universitätsklinikum Essen tern unsere Erkenntnisse, insbesondere was Be-
Hufelandstr. 55 handlung und medikamentöse Therapie anbe-
45122 Essen langt. Soweit in diesem Werk eine Dosierung
oder eine Applikation erwähnt wird, darf der Le-
Bibliografische Information der ser zwar darauf vertrauen, dass Autoren, Heraus-
Deutschen Bibliothek geber und Verlag große Sorgfalt darauf verwandt
haben, dass diese Angabe dem Wissensstand
Die Deutsche Bibliothek verzeichnet diese
bei Fertigstellung des Werkes entspricht.
Publikation in der Deutschen Nationalbiblio-
Für Angaben über Dosierungsanweisungen
grafie; detaillierte bibliografische Daten sind
und Applikationsformen kann vom Verlag je-
im Internet über http://dnb.ddb.de abrufbar.
doch keine Gewähr übernommen werden. Jeder
Benutzer ist angehalten, durch sorgfältige Prü-
1. deutsche Auflage 1994
fung der Beipackzettel der verwendeten Präpa-
1. englische Auflage 1995
rate und gegebenenfalls nach Konsultation eines
1. französische Auflage 1995
Spezialisten festzustellen, ob die dort gegebene
1. japanische Auflage 1996
Empfehlung für Dosierungen oder die Beachtung
1. chinesische Auflage 1998
von Kontraindikationen gegenüber der Angabe
1. italienische Auflage 1999
in diesem Buch abweicht. Eine solche Prüfung ist
1. türkische Auflage 2000
besonders wichtig bei selten verwendeten Prä-
2. englische Auflage 2001
paraten oder solchen, die neu auf den Markt ge-
2. französische Auflage 2003
bracht worden sind. Jede Dosierung oder Appli-
1. portugiesische Auflage 2003
kation erfolgt auf eigene Gefahr des Benut-
1. polnische Auflage 2004
zers. Autoren und Verlag appellieren an jeden
1. spanische Auflage 2004
Benutzer, ihm etwa auffallende Ungenauigkeiten
2. deutsche Auflage 2004
dem Verlag mitzuteilen.
1. griechische Auflage 2005
3. englische Auflage 2007
1. arabische Auflage 2008

© 1994, 2008 Georg Thieme Verlag KG Geschützte Warennamen (Warenzeichen) wer-


Rüdigerstraße 14 den nicht besonders kenntlich gemacht. Aus
D-70469 Stuttgart dem Fehlen eines solchen Hinweises kann also
Telefon: +49/07 11/89 31-0 nicht geschlossen werden, dass es sich um einen
Unsere Homepage: http://www.thieme.de freien Warennamen handele.
Das Werk, einschließlich aller seiner Teile, ist
Printed in Germany
urheberrechtlich geschützt. Jede Verwertung au-
Gestaltung der Farbtafeln: Prof. Jürgen Wirth ßerhalb der engen Grenzen des Urheberrechts-
Fachbereich Gestaltung, Fachhochschule Darmstadt gesetzes ist ohne Zustimmung des Verlages un-
Umschlaggestaltung: Thieme Verlagsgruppe zulässig und strafbar. Das gilt insbesondere für
Umschlagbild: Kevin Curtis/SPL/Agentur Focus Vervielfältigungen, Übersetzungen, Mikroverfil-
Satz: Mitterweger & Partner, Plankstadt mungen und die Einspeicherung und Verarbei-
Druck: Firmengruppe APPL, aprinta druck, tung in elektronischen Systemen.
Wemding

ISBN 978-3-13-759503-8 1 2 3 4 5 6
V

Für Elizabeth, Christian und Katrin


VI

Vorwort

Diese Neuauflage ist gänzlich umgestaltet und text zu den Farbtafeln aufgenommen werden
überarbeitet. Dies soll die humangenetischen konnten. Ein Glossar am Ende erklärt oder defi-
Aspekte deutlicher zum Ausdruck zu bringen niert wichtige Fachbegriffe.
als in den bisherigen beiden Auflagen. Gegen- Jede Tafel entspricht einem eigenen kleinen Ka-
über der 2007 erschienenen 3. englischen Auf- pitel. Text und Abbildung sind unmittelbar auf-
lage (Color Atlas of Genetics, 3rd Edition, Thieme einander abgestimmt. Nach einer kurzen Ein-
Verlag) wurden der Prolog (Taxonomie leben- führung beschreibt der Text die einzelnen Ab-
der Organismen, Evolution des Menschen, Die bildungsteile. Der knappe Raum pro Seite
Zelle und ihre Bestandteile) und der Abschnitt zwingt zur Beschränkung auf das Wichtigste,
Prokaryote Zellen und Viren nicht in diese Auf- aber Literaturangaben und Online-Informatio-
lage übernommen. Von den Farbtafeln sind nen eröffnen dem Leser den Zugang zu weiter-
22 gänzlich neu. In viele andere Tafeln wurden führenden Informationen. In den Tafeln wird
neue Teile eingefügt, mehrere wurden entfernt, ein Farbcode für ähnliche Strukturen verwen-
so dass diese Auflage 170 Farbtafeln anstatt der det, z. B. dunkelblau für codierende DNA, hell-
bisherigen 189 enthält. Auch der Gesamtum- bau für nicht-codierende, türkis für RNA, braun
fang ist vermindert. für Genprodukte etc.
Der Begriff Atlas wurde zuerst 1594 von Gerhar- Krankheiten sind beispielhaft nach ihrer Be-
dus Kremer (1512–1594) aus Duisburg geprägt, deutung für das Verständnis grundlegender ge-
als Mathematiker und Kartograph bekannt un- netischer Funktionen und Mechanismen ausge-
ter dem Namen Mercator. Er veröffentlichte wählt. Die engen Beziehungen zwischen Gene-
1594 ein Buch mit 107 Landkarten mit Begleit- tik und Evolution werden hervorgehoben. Wo
texten. Die Titelseite ziert eine Abbildung des immer es sich anbot, habe ich für ein Thema
Titanen Atlas mit dem Globus auf seinen Schul- den historischen Hintergrund angedeutet oder
tern. Als das Buch erschien, waren viele Teile die erste Beschreibung zitiert. Dieses Buch ist
der Erde noch nicht kartiert. Dieser Taschenat- nicht ein Ersatz, sondern eine visuell gestaltete
las führt durch visuelle Darstellung in ein nicht Ergänzung bestehender Lehrbücher.
leicht zu überblickendes Gebiet unter Verwen- Aus Platzgründen konnte ich Krankheiten nicht
dung genetischer Karten (maps) ein. detailliert beschreiben, manche gar nicht. Je-
Der Inhalt des aus den Farbtafeln bestehenden doch ist allen als weiterführende Information
Haupteils ist wie bisher gegliedert in Grundla- die sechsstellige Zuordnung zum genetischen
gen (Teil I), Genomik (Teil II) und Genetik in der Klassifikationssystem beigefügt: Mendelian In-
Medizin (Teil III). Neu sind Abschnitte über heritance in Man, 1966 von V.A. McKusick, Johns
Zellkommunikation, wichtige genetische Sig- Hopkins University School of Medicine, Balti-
nalwege, epigenetische Modifikation, program- more, begründet. Diese unverzichtbare, prak-
mierter Zelltod, vergleichende Genomhybridi- tisch vollständige Informationsquelle ist online
sierung und Mikroarrays, genetische Aspekte frei verfügbar (www.ncbi. nlm.nih.gov/Omim).
der Krebsentstehung, Grundzüge ausgewählter Hier findet der Leser zu jeder der in diesem
metabolischer Krankheiten, Grundlagen der Buch genannten Krankheiten umfangreiche In-
Gen- und Stammzelltherapie und andere The- formationen zur Definition, Klinik, Klassifika-
men. tion, Genetik, molekularen Biologie, Pathophy-
Dem Hauptteil geht eine Einführung mit einer siologie, Tiermodellen etc.
Zeittafel wichtiger Fortschritte voraus. Auf die Die Farbtafeln wurden nach computergestütz-
Tafeln folgen 14 Tabellen mit ergänzenden Da- ten Vorlagen des Autors von Herrn Professor
ten, die aus Platzgründen nicht in den Begleit- Jürgen Wirth, Professor für Visuelle Kommuni-
VII

kation, Fachbereich Gestaltung der Fachhoch- medizinisches Lehrbuch Vorklinik, sowie Frau
schule Darmstadt, als druckfertige Computer- Anja Renz, Herstellerin, mit guten Ratschlägen
grafiken gestaltet. Ich bin Herrn Kollegen Wirth und sorgfältiger Arbeit unterstützt. Mitterwe-
für die perfekte Ausführung in harmonischer ger & Partner, Plankstadt, haben das Lehrbuch
Zusammenarbeit, wie in den früheren Aufla- in gewohnt hoher Qualität gesetzt. Meiner
gen, zu besonderem Dank verpflichtet. Beim Frau, Mary F. Passarge, M.D., danke ich für Un-
Georg Thieme Verlag haben mich Frau Simone terstützung und nützliche Hinweise.
Claß (Projektmanagement) und Frau Marianne
Mauch (Programmplanung) aus dem Segment Essen, im Juli 2008 Eberhard Passarge

Danksagung an Kollegen
Ich danke folgenden Kolleginnen und Kollegen Pennsylvania), Thomas Cremer (München), An-
am Institut für Humangenetik, Universitätskli- dreas Gal (Hamburg), Evan E. Eichler (Seattle),
nikum Essen, für Unterstützung, Ratschläge, Wolfgang Engel (Göttingen), Robin Edison (NIH,
Photographien oder Prüfung von Textteilen und Bethesda, Maryland), Gebhard Flatz (Bonn, frü-
Abbildungen: Beate Albrecht, Stefan Böhringer, her Hannover), James L. German (New York),
Karin Buiting, Sven Fischer, Stephanie Gkalym- Cornelia Hardt (Essen), Reiner Johannisson (Lü-
poudis, Bernhard Horsthemke, Alma Küchler, beck), Dorothea Haas (Heidelberg), Richard I.
Dietmar Lohmann, Herrmann Josef Lüdecke, Kelley (Baltimore), Christian Kubisch (Köln), Ni-
Diana Mitter, Kirsten Siberg, Nicholas Wagner, cole McNeill und Thomas Ried (NIH, Bethesda,
Michaela Wawrzik, Dagmar Wieczorek, Mi- Maryland), Clemens Müller-Reible (Würzburg),
chael Zeschnigk, Corinna Zogel. Arne Pfeufer (München), A. Raisonnier (Paris),
Folgende auswärtige Kolleginnen und Kollegen David L. Rimoin (Los Angeles), Gerd Scherer
haben für diese Auflage und die 3rd Edition (Freiburg), Evelin Schröck (Dresden), Heredith
Bildmaterial zur Verfügung gestellt oder Text- Schüler (Aachen), Gesa Schwanitz (Bonn), Mi-
teile und Abbildungen geprüft, und mit Rat- chael Speicher (Graz), Peter Steinbach (Ulm),
schlägen verbunden: Alireza Baradaran (Mash- Manfred Stuhrmann-Spangenberg (Hannover),
had, Iran), John Barranger (Pittsburgh), Claus R. Gerd Utermann (Innsbruck), Michael Weis
Bartram (Heidelberg), Laura Carrel (Hershey, (Cleveland), Johannes Zschocke (Heidelberg).
VIII

Über den Autor

1961–1962 am Allgemeinen Krankenhaus


Hamburg-Harburg und 1962–1963 als Stipen-
diat der Ventnor Foundation am Memorial Hos-
pital Worcester, Massachusetts/USA, gefolgt
von einer Ausbildung in Kinderheilkunde und
Humangenetik an der Universitäts-Kinderkli-
nik Cincinnati, Ohio/USA (1963–66) bei Josef
Warkany. Von 1966–1968 arbeitete er als Re-
search Fellow in Humangenetik am Cornell Me-
dical Center New York bei James L. German.
Von 1968–1976 leitete er die von ihm aufge-
baute Abteilung für Zytogenetik und Klinische
Genetik am Institut für Humangenetik der Uni-
versität Hamburg. Dort habilitierte er sich 1969
für das Fach Humangenetik. Er ist Facharzt für
Humangenetik und für Kinderheilkunde, hat
das American Board of Pediatrics und ist Mit-
glied des American College of Medical Genetics.
Er war Generalsekretär der Europäischen Ge-
sellschaft für Humangenetik (1989–1991), Prä-
sident der Deutschen Gesellschaft für Human-
genetik (1990–1996), Prorektor für Forschung
und wissenschaftlichen Nachwuchs der Univer-
sität Essen (1983–1988), Vorsitzender der
Der Autor hat von 1976 bis zur Emeritierung im Ethik-Kommission der Medizinischen Fakultät
Jahr 2001 das von ihm begründete Institut für Essen (1980–2001), Vorsitzender der Ventnor
Humangenetik am Universitätsklinikum Essen Foundation Deutsch-Amerikanische Ärztever-
geleitet. Er ist weiterhin in der Humangenetik einigung (seit 1984), sowie Koordinator der
als Autor und in der Lehre tätig. Seine wesentli- Reihe Musik in der Uni an der Universität Duis-
chen wissenschaftlichen Interessengebiete sind burg-Essen (seit 1984). Er erhielt 1978 den Hu-
die molekularen und zellulären Grundlagen ge- felandpreis, 1979 die Mendel-Medaille, 1980
netisch bedingter Krankheiten, angeborene die Ehrenmitgliedschaft der Purkinye-Gesell-
Fehlbildungen, Genetische Diagnostik und Be- schaft Prag und 1996 der Akademie der Medizi-
ratung, sowie akademische Lehre. Am 22. De- nischen Wissenschaften in Rumänien. Er ist
zember 1935 geboren, hat er von 1955–1960 in Mitglied im Herausgeberausschuss internatio-
Freiburg, Kiel, Würzburg und Berlin Medizin naler Zeitschriften. Der Autor hat über 230 wis-
studiert. Er beendete das Studium 1960 in Frei- senschaftliche Arbeiten, überwiegend in inter-
burg mit einer Promotion am Institut für Ana- nationalen Zeitschriften, sowie zahlreiche Lehr-
tomie bei A. von Kügelgen. Die medizinische buchbeiträge veröffentlicht.
Ausbildung als Medizinalassistent erfolgte
IX

Inhaltsverzeichnis

Einführung 1 Rekombination . . . . . . . . . . . . . . . . . . . . . . . . 72
Bildung der Gameten . . . . . . . . . . . . . . . . . . 74
Zeittafel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 Zellzyklus-Kontrolle . . . . . . . . . . . . . . . . . . . 76
Programmierter Zelltod (Apoptose) . . . . 78
Zellkultur . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
Grundlagen 15
Formale Genetik
Molekulare Grundlagen Die Mendelschen Merkmale . . . . . . . . . . . 82
DNA als Träger genetischer Information 16 Aufspaltung (Segregation) Mendelscher
DNA und ihre Bausteine . . . . . . . . . . . . . . . 18 Merkmale . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
DNA-Struktur . . . . . . . . . . . . . . . . . . . . . . . . . 20 Verteilung von zwei unabhängigen
Alternative DNA-Strukturen. . . . . . . . . . . . 22 Merkmalspaaren (Allelen) . . . . . . . . . . . . . 86
DNA-Replikation . . . . . . . . . . . . . . . . . . . . . . 24 Phänotyp und Genotyp . . . . . . . . . . . . . . . . 88
Die Übertragung genetischer Segregation elterlicher Genotypen . . . . . 90
Information . . . . . . . . . . . . . . . . . . . . . . . . . . . 26 Monogene Vererbung . . . . . . . . . . . . . . . . . . 92
Gene und Mutation . . . . . . . . . . . . . . . . . . . . 28 Kopplung und Rekombination . . . . . . . . . 94
Genetischer Code . . . . . . . . . . . . . . . . . . . . . . 30 Kopplungsanalyse . . . . . . . . . . . . . . . . . . . . . 96
Struktur eukaryoter Gene . . . . . . . . . . . . . . 32 Quantitative Unterschiede genetischer
Restriktionsenzyme. . . . . . . . . . . . . . . . . . . . 34 Merkmale . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
DNA-Klonierung . . . . . . . . . . . . . . . . . . . . . . . 36 Multifaktorielles Schwellenwert-
cDNA-Klonierung . . . . . . . . . . . . . . . . . . . . . . 38 modell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
DNA-Bibliotheken . . . . . . . . . . . . . . . . . . . . . 40 Verteilung von Genen in einer
DNA-Amplifikation Population . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
(Polymerase-Kettenreaktion, PCR) . . . . . . 42 Hardy-Weinberg-Äquilibrium . . . . . . . . . . 104
DNA-Sequenzierung . . . . . . . . . . . . . . . . . . . 44 Genetische Folgen von Blutsverwandt-
Automatisierte DNA-Sequenzierung . . . . 46 schaft . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106
Southern-Blot-Hybridisierung. . . . . . . . . . 48 Zwillinge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108
Unterschiedliche geographische
Veränderungen in DNA und Genen Verteilung von Genen. . . . . . . . . . . . . . . . . . 110
DNA-Polymorphismus . . . . . . . . . . . . . . . . . 50
Mutationen . . . . . . . . . . . . . . . . . . . . . . . . . . . 52 Chromosomen
Mutationen durch verschiedene Chromosomen in Metaphase. . . . . . . . . . . 112
Basen-Modifikationen . . . . . . . . . . . . . . . . . 54 Sichtbare funktionelle Strukturen in
Transposition. . . . . . . . . . . . . . . . . . . . . . . . . . 56 Chromosomen. . . . . . . . . . . . . . . . . . . . . . . . . 114
Trinukleotid-Repeat-Expansion . . . . . . . . 58 Chromosomenorganisation . . . . . . . . . . . . 116
Reparatur von DNA-Schäden . . . . . . . . . . . 60 Funktionelle Elemente von
Chromosomen. . . . . . . . . . . . . . . . . . . . . . . . . 118
Eukaryote Zellen DNA und Nukleosomen . . . . . . . . . . . . . . . . 120
Zellkommunikation. . . . . . . . . . . . . . . . . . . . 62 DNA in Chromosomen . . . . . . . . . . . . . . . . . 122
Hefe: Eukaryote Zellen mit diploider Das Telomer . . . . . . . . . . . . . . . . . . . . . . . . . . . 124
und haploider Phase . . . . . . . . . . . . . . . . . . . 64 Das Bandenmuster menschlicher
Zellteilung: Mitose . . . . . . . . . . . . . . . . . . . . 66 Chromosomen. . . . . . . . . . . . . . . . . . . . . . . . . 126
Meiose in Keimzellen . . . . . . . . . . . . . . . . . . 68 Das Bandenmuster II: Mensch und
Crossing-over in der Prophase I . . . . . . . . 70 Maus. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128
X

Chromosomenanalyse . . . . . . . . . . . . . . . . . 130 Identifizierung eines Gens . . . . . . . . . . . . . 190


Fluoreszenz-in-situ-Hybridisierung Identifizierung eines codierenden
(FISH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132 DNA-Abschnitts . . . . . . . . . . . . . . . . . . . . . . . 192
Numerische Chromosomenaber- Ansätze zur Genomanalyse . . . . . . . . . . . . 194
rationen. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134 Architektur des menschlichen
Translokation. . . . . . . . . . . . . . . . . . . . . . . . . . 136 Genoms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196
Chromosomen-Strukturaberrationen . . . 138 Genomische Struktur des menschlichen
Vielfarb-Chromosomen-Identifi- X- und Y-Chromosoms. . . . . . . . . . . . . . . . . 198
zierung. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140 Analyse des Genoms mittels DNA-
Molekularzytogenetische Analyse . . . . . . 142 Mikroarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 200
Genom-Scan und Array-CGH . . . . . . . . . . . 202
Regulation von Genfunktion Evolution von Genen und Genomen . . . . 204
Zellkern, ribosomale RNA, Potein- Vergleichende Genomik . . . . . . . . . . . . . . . 206
synthese . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 144 Das mitochondriale Genom des
Transkription . . . . . . . . . . . . . . . . . . . . . . . . . . 146 Menschen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208
Transkriptionskontrolle . . . . . . . . . . . . . . . . 148
Regulation der Genexpression . . . . . . . . . 150
DNA-bindende Proteine. . . . . . . . . . . . . . . . 152
Andere Transkriptions-Aktivatoren . . . . . 154 Genetik in der Medizin 211
Genabschaltung durch RNA-Interferenz
(RNAi). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 156 Homeostase
Gezielte Gen-Inaktivierung bei Defekter Chlorid-Ionenkanal:
transgenen Mäusen. . . . . . . . . . . . . . . . . . . . 158 Cystische Fibrose . . . . . . . . . . . . . . . . . . . . . . 212
Genetische Defekte in Ionenkanälen:
Epigenetische Modifikationen Beispiel Herzarrhythmie . . . . . . . . . . . . . . . 214
DNA-Methylierung . . . . . . . . . . . . . . . . . . . . 160 Protease-Inhibitor a1-Antitrypsin . . . . . . 216
Reversible Veränderungen im Blutgerinnungsfaktor VIII und
Chromatin. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162 Hämophilie . . . . . . . . . . . . . . . . . . . . . . . . . . . 218
Genomisches Imprinting. . . . . . . . . . . . . . . 164 Bluterkrankheit von Willebrand. . . . . . . . 220
X-Chromosom-Inaktivierung . . . . . . . . . . . 166 Pharmakogenetik . . . . . . . . . . . . . . . . . . . . . . 222
Cytochrom-P450-Gene (CYP). . . . . . . . . . . 224
Genetische Signalwege Mitochondriale Erkrankungen beim
Zelluläre Signalübertragung. . . . . . . . . . . . 168 Menschen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226
Signaltransduktionswege . . . . . . . . . . . . . . 170
TGF-b- und Wnt/b-Catenin-Signalwege 172 Stoffwechsel
Hedgehog und TNF-a-Signalwege. . . . . . 174 Diabetes mellitus . . . . . . . . . . . . . . . . . . . . . . 228
Notch/Delta-Signalweg . . . . . . . . . . . . . . . . 176 Phenylketonurie/Harnstoffzyklus. . . . . . . 230
Cholesterol-Biosynthese . . . . . . . . . . . . . . . 232
Gene in der Embryonalentwicklung Distaler Cholesterol-Biosyntheseweg . . . 234
Entwicklungsmutanten bei Drosophila Familiäre Hypercholesterolämie. . . . . . . . 236
melanogaster . . . . . . . . . . . . . . . . . . . . . . . . . . 178 Mutationen im LDL-Rezeptor . . . . . . . . . . 238
Musterbildung in der Embryonal- Lysosomen . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
entwicklung . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 Krankheiten durch Enzymdefekte in
Entwicklungsgenetik bei einem Lysosomen . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242
Vertebraten: Der Zebrafisch . . . . . . . . . . . . 182 Mucopolysaccharid-Speicher-
Entwicklungsprogramm für einzelne krankheiten . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
Zellen (C. elegans) . . . . . . . . . . . . . . . . . . . . . 184 Peroxisomale Krankheiten . . . . . . . . . . . . . 246

Genomik 187 Immunsystem


Komponenten des Immunsystems . . . . . 248
Genomik Immunglobulin-Moleküle. . . . . . . . . . . . . . 250
Genomik, die Analyse der Organisation Genetische Diversität durch genomische
von Genomen . . . . . . . . . . . . . . . . . . . . . . . . . 188 Umstrukturierung . . . . . . . . . . . . . . . . . . . . . 252
XI

Mechanismen der Umordnung der Krankheiten mit Atypischen Genetischen


Immunglobulin-Gene . . . . . . . . . . . . . . . . . . 254 Mechanismen
T-Zell-Rezeptoren . . . . . . . . . . . . . . . . . . . . . 256 Krankheiten durch unstabile
Die MHC-Region. . . . . . . . . . . . . . . . . . . . . . . 258 Trinukleotid-Wiederholungen. . . . . . . . . . 316
Die Immunglobulin-Superfamilie . . . . . . 260 Fragiles-X-Syndrom. . . . . . . . . . . . . . . . . . . . 318
Hereditäre Immundefizienz-Krank- Imprinting-Krankheiten . . . . . . . . . . . . . . . 320
heiten. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 262
Sinneswahrnehmung
Entstehung von Tumoren Rhodopsin, ein Lichtrezeptor. . . . . . . . . . . 322
Genetische Ursachen von Tumoren. . . . . 264 Pigmentäre Degeneration der Retina . . . 324
Kategorien von Tumor-Genen . . . . . . . . . . 266 Farbsehen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 326
Das Tumorsuppressor-Gen p53. . . . . . . . . 268 Genetische Hörstörungen . . . . . . . . . . . . . . 328
APC-Gen und Polyposis coli . . . . . . . . . . . . 270 Rezeptoren für Duftstoffe . . . . . . . . . . . . . . 330
Für Brustkrebs disponierende Gene . . . . 272 Geschmacks-Rezeptor-Gen-Familien
Retinoblastom . . . . . . . . . . . . . . . . . . . . . . . . . 274 bei Säugetieren . . . . . . . . . . . . . . . . . . . . . . . . 332
Chromosomentranslokation und
Leukämie . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276 Chromosomenkrankheiten (Beispiele)
Neurofibromatose . . . . . . . . . . . . . . . . . . . . . 278 Autosomale Trisomien . . . . . . . . . . . . . . . . . 334
Genomische Instabilitäts-Krankheiten . . 280 Andere numerische Chromosomen-
Defekte Nukleotid-Exzisions- aberrationen . . . . . . . . . . . . . . . . . . . . . . . . . . 336
Reparatur . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282 Mikrodeletionen. . . . . . . . . . . . . . . . . . . . . . . 338

Zell- und Gewebestruktur Grundlagen genetischer Diagnostik


Zytoskelett-Proteine in Erythrozyten . . . 284 Prinzipien der genetischen
Neuromuskuläre Krankheiten . . . . . . . . . . 286 Diagnostik . . . . . . . . . . . . . . . . . . . . . . . . . . . . 340
Muskeldystrophie Typ Duchenne . . . . . . 288 Segregationsanalyse mittels genetischer
Collagen-Moleküle . . . . . . . . . . . . . . . . . . . . 290 Marker . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 342
Osteogenesis imperfecta . . . . . . . . . . . . . . . 292 Indirekte DNA-Analyse. . . . . . . . . . . . . . . . . 344
Molekulare Grundlagen der Knochen- Nachweis von Mutationen ohne
bildung . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 294 Sequenzierung . . . . . . . . . . . . . . . . . . . . . . . . 346
Grundlagen einer Gentherapie . . . . . . . . . 348
Hämoglobin-Krankheiten
Normales Hämoglobin . . . . . . . . . . . . . . . . . 296
Hämoglobin-Gene . . . . . . . . . . . . . . . . . . . . . 298 Pathologische Anatomie des 350
Sichelzell-Anämie . . . . . . . . . . . . . . . . . . . . . 300 humanen Genoms
Typen von Mutationen in Hämo-
globin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 302
Thalassämien. . . . . . . . . . . . . . . . . . . . . . . . . . 304 360
Tabellen
Hereditäre Persistenz von Fetalhämo-
globin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 306

Sex-Determination und Differenzierung Glossar 369


Sex-Determination . . . . . . . . . . . . . . . . . . . . 308
Geschlechtsdifferenzierung . . . . . . . . . . . . 310
Genetische Störungen der Geschlechts- 382
Sachverzeichnis
entwicklung . . . . . . . . . . . . . . . . . . . . . . . . . . . 312
Störungen der Androgen-Biosynthese . . 314
Einführung
2 Einführung

Jede der etwa 1013 Zellen eines erwachsenen tur umgeschrieben werden (Transkription).
Menschen enthält im Zellkern ein genetisches Dieses Molekül, RNA, enthält als Zucker Ribose
Programm mit lebenserhaltenden Informatio- (Ribonukleinsäure, abgekürzt RNS oder RNA.
nen. Diese werden bei jeder Zellteilung kopiert Aus RNA werden die Introns durch spezielle En-
und auf beide Tochterzellen übertragen. Etwa zyme entfernt und die Exons zusammengefügt
200 verschiedene Arten von Zellen differenzie- (ein als Spleißen bezeichneter Vorgang). Da-
ren sich nach genetischen Signalen und führen durch entsteht Boten-RNA (mRNA, messenger
die verschiedenen zellulären und molekularen RNA). Sie dient als Vorlage für die Übersetzung
Funktionen aus. in eine dem Code entsprechende Sequenz von
Zellen sind die kleinsten vollständigen, von ei- Aminosäuren (Translation).
ner äußeren Membran abgegrenzten Einheiten Abhängig von der organisatorischen Komplexi-
der lebenden Welt. Es existieren zwei grund- tät eines Organismus schwankt die Zahl der
sätzlich verschiedene Typen, prokaryote und Gene von wenigen wie bei Viren, mehreren
eukaryote Zellen. Prokaryote Zellen (Bakterien) Tausend bei Bakterien (4289 Gene bei Escheri-
haben keinen Zellkern und andere interne chia coli), 6241 Gene in Zellen der Bäckerhefe,
Strukturelemente. Eukaryote Zellen haben ei- 13.601 bei Drosophila, 18.424 bei einem Wurm
nen Zellkern und komplexe innere Strukturen. (dem Nematoden C. elegans) und etwa 22 000
Die Integrität ihres genetischen Programms Genen beim Menschen. Da viele Gene Teil eines
muss zuverlässig gewahrt werden, aber ande- bestimmten Funktionskreises sind, kann man
rerseits darf es nicht unveränderlich sein um sie Gruppen zuordnen, die als Gen-Familien be-
langfristig auf verschiedene Bedingungen der zeichnet werden. Es wird geschätzt, dass die
Umwelt angemessen reagieren zu können. Gene des Menschen etwa 1000 Familien bilden.
Die Gesamtheit aller Gene und der DNA einer
Gene Zelle wird als Genom bezeichnet, die Gesamt-
Ein Gen entspricht einer Informationseinheit heit aller Proteine als Proteom. Die korrespon-
wie ein Satz in einem Text. Gene sind im Zell- dierenden Wissenschaftsgebiete sind Genomik
kern linear in Chromosomen angeordnet. Jedes und Proteomik. Die Größe eines Genoms wird
Gen hat eine definierte Position (Genlocus) und in Zahl der Nukleotid-Basen ausgedrückt.
eine individuelle Struktur und Funktion. Gene
höherer Organismen bestehen aus Abschnitten Genetik und DNA
mit codierender Information (Exons) und Ab- Es war ein bedeutsamer Fortschritt, als 1944
schnitten ohne codierende Information (In- Avery, MacLeod und McCarty am Rockefeller
trons). Sie variieren in ihrer Größe, von einigen Institute in New York nachwiesen, dass eine
Tausend bis zu über einer Million Nukleotid- chemisch relativ einfache, langkettige Nuklein-
Basen. Gene unterscheiden sich nach Anzahl säure (Deoxyribonukleinsäure, DNS, oder in der
und Größe der Exons, sowie vorgeschalteten angelsächsischen Abkürzung DNA) Träger ge-
Abschnitten, die ihre Aktivität festlegen (regu- netischer Information sein muss. A. D. Hershey
latorische DNA-Sequenzen). Chromosomen und M. Chase bewiesen 1952, dass genetische
sind während der Zellteilung im Lichtmikro- Information ausschließlich in DNA enthalten
skop sichtbare Strukturen aus DNA und speziel- ist. Die Struktur der DNA wurde 1953 von Ja-
len Proteinen. Chromosomen bei eukaryoten mes D. Watson und Francis H. Crick, am Caven-
Organismen kommen in homologen Chromo- dish Laboratory der Universität Cambridge
somenpaaren vor, eines von der Mutter, das an- gelöst. In einer am 25. April 1953 in Nature er-
dere vom Vater (beim Menschen 23 Paare). schienenen Arbeit von einer dreiviertel Seite
Während die Anzahl und Größe bei verschiede- beschreiben Watson und Crick die Struktur der
nen Organismen variiert, ist die Gesamtmenge DNA als Doppelhelix.
der DNA und die Anzahl der Gene innerhalb Im Gegensatz zu früheren Vorstellungen liegen
gleicher Klassen von Organismen gleich. im Watson-Crick-Modell Nukleotid-Basen in-
Der lineare Text der genetischen Informationen nen, jeweils ein Purin gegenüber einem Pyrimi-
eines Gens ist in der Sequenz der Bausteine der din und durch Wasserstoff-Brücken verbunden.
DNA (Deoxyribonukleinsäure) codiert und Außen verläuft ein langkettiges Gerüst aus mit-
nicht direkt lesbar. Die codierende Sequenz einander verbundenen Zucker-(Deoxyribose)
muss zunächst in ein Molekül ähnlicher Struk- und Phosphat-Molekülen. Die entscheidende
Einführung und Zeittafel 3

Erkenntnis liegt darin, dass die Basenpaare in- Auch wenn nach der Aufklärung der Struktur
nen liegen. Sie wurde gewonnen durch die der DNA fast ein Jahrzehnt verging bis DNA im
Konstruktion eines Modells auf der Grundlage Titel von wissenschaftlichen Arbeiten auftrat,
röntgen-kristallographischer Ergebnisse an sie hat ein neues Zeitalter der Biologie begrün-
DNA von Rosalind Franklin und Maurice Wil- det: die molekulare Biologie und Genetik. Wat-
kins. son (1968) und Crick (1988), haben die Entde-
ckung der DNA-Struktur auf sehr unterschiedli-
che Weise eindrucksvoll beschrieben, Judson
(1996) hat sie im Detail dokumentiert.

Genetischer Code
Für jede der 20 Aminosäuren, die von lebenden
Organismen genutzt werden, existiert ein im
Jahr 1966 vollständig aufgeklärter genetischer
Code. DNA ist ein Read-Only Memory Speicher
des genetischen Informationssystems. Im Ge-
gensatz zum binären System aus Reihen der
Ziffern Eins und Null, wie es in Computern ge-
nutzt wird („bits“, die zu acht binären Stellen
als „bytes“ zusammengefasst werden), besteht
der genetische Code der lebendigen Welt aus
einem quaternären System von vier Nukleotid-
Basen, deren chemischer Name mit den Buch-
staben A, C, G und T beginnt (siehe Teil I,
Grundlagen). Bei dem quaternären Code, wie er
in lebendigen Zellen vorkommt, bestehen die
Röntgendiffraktionsmuster von DNA (Franklin & Bytes aus drei Nukleotid-Basen, z. B. dem Tri-
Gosling, 1953) plet-Code ACG. Je drei Nukleotid-Basen bilden
ein Codon. Die Sequenz der Codons legt die li-
neare Sequenz der Aminosäuren eines Proteins
fest.

Genetische Individualität
Der englische Internist Archibald Garrod
(1857 – 1936) ist der erste Arzt, der die Bedeu-
tung der Mendelschen Gesetzmäßigkeiten für
Krankheiten des Menschen erkennt. In Zusam-
menhang mit seiner Beschreibung von Alkapto-
nurie hat Garrod 1901 die Idee einer biochemi-
schen Individualität des Menschen gefasst und
darüber einen intensiven Briefwechsel mit Bat-
son geführt. In einem Brief vom 11. Januar 1902
schreibt Archibald Garrod an William Bateson
„. . . I believe that no two individuals are
exactly alike chemically any more than structu-
rally“ (Bearn, 1993, S. 61). Die sich in diesem
Konzept offenbarende Verbindung von geneti-
schen und biochemischen Erkenntnissen war
jedoch der Zeit voraus. Die umfassende Bedeu-
tung für die genetisch determinierte Individua-
lität des Menschen wurde nicht erkannt. Heute
haben sich Erkenntnisse über die genetische
DNA-Struktur 1953 Individualität des Menschen in nicht erwarte-
4 Einführung

tem Umfang bestätigt. Individuelle Varianten mente im Klostergarten Brünn (Brno) an der
des Genoms können zu bestimmten Krankhei- Gartenerbse gezeigt, dass Vererbung auf defi-
ten disponieren. Individuelle genetische Unter- nierten, voneinander unabhängigen Faktoren
schiede sind das Ziel neuer Therapieverfahren beruht. Ihre Weitergabe an die nächste Pflan-
mit speziell entwickelten Pharmaka, die auf zengeneration und die Verteilung verschiede-
hohe Effizienz bei minimalem Risiko von Ne- ner Merkmale unterliegen bestimmten Gesetz-
benwirkungen zielen (vgl. Pharmokogenetik mäßigkeiten, die allgemeine Gültigkeit haben.
und Pharmakogenomik). Jeder Faktor ist für ein bestimmtes Merkmal
verantwortlich. Der dänische Biologe Wilhelm
Gene und Evolution Johannsen (1857 – 1927) führte 1909 dafür die
Gene mit denselben oder ähnlichen Funktionen Bezeichnung Gen ein.
bei verschiedenen Lebewesen ähneln sich, weil Bis etwa 1902 bestanden keine Beziehungen
sie durch ihre Evolution verwandt sind. Alle le- zwischen Erkenntnissen durch genetische Ana-
benden Organismen sind miteinander in unter- lyse und der Lehre von den Zellen, der Zytolo-
schiedlichen Graden verwandt, weil ihre Gene gie. Chromosomen in Mitose (Flemming 1879)
verwandt sind. Wie für Lebewesen wird auch und Meiose (Strasburger 1888) wurden beob-
für ihre Gene eine Herkunft von einem gemein- achtet und der Begriff Chromosom geprägt
samen Vorläufer während der Evolution ange- (Waldeyer 1888), aber funktionelle Beziehun-
nommen. Der Abstand kann in geschätzten gen zwischen Chromosomen und Genen wur-
Zeitabschnitten oder in der Zahl von Tren- den nicht vermutet. Eine Ausnahme bilden
nungsschritten ausgedrückt werden. Die ersten 1902 die vorausschauenden Bemerkungen von
lebenden Zellen dürften vor etwa 3,5 Milliar- Theodor Boveri und Walter S. Sutton über die
den Jahren aufgetreten sein, unter Bedingun- Individualität von Chromosomen.
gen, die in den Einzelheiten unklar sind. We- Ab etwa 1902 wurden die Mendelschen Gesetz-
sentliche, spezielle Funktionen sind in der Re- mäßigkeiten bei Tieren, Pflanzen und auch
gel nur einmal entstanden und werden in mehr beim Menschen systematisch analysiert. Bate-
oder weniger abgewandelter Form von allen son und Saunders führten 1902 den Begriff alle-
Lebewesen verwendet. Deshalb erkennen wir lomorph für variante Formen eines genetischen
für fundamentale Funktionen die benötigten Faktors ein (später Allel genannt). Gleiche Alle-
Genstrukturen bei vielen verschiedenen Orga- lomorphe am selben Genlocus bezeichneten sie
nismen wieder. als homozygot, verschiedene als heterozygot.
Gene mit fundamentaler Bedeutung tolerieren Auch Erkrankungen beim Menschen wurden
keine ihre Funktion beeinträchtigenden Ände- als erblich bedingt erkannt. Eine Form von
rungen (Mutationen). Alle lebenden Organis- Kurzfingrigkeit (Brachydaktylie Typ A 1) wurde
men besitzen mehrere Systeme, die Fehler in 1903 als erstes autosomal dominant erbliches
der Integrität der DNA und der Gene erkennen Merkmal von W. C. Farabee in einer großen
und reparieren können (DNA-Reparatur). Es Sippe aus Pennsylvania beschrieben.
existieren Mechanismen, die eine Zelle durch Als 1906 der englische Biologe William Bateson
programmierten Zelltod (Apoptose) opfern, (1861 – 1926) die Bezeichnung Genetik für diese
wenn ein Schaden nicht erfolgreich behoben neue biologische Wissenschaftsrichtung vor-
werden kann. Gene, die in gleicher oder ähnli- schlug, konnte niemand vorhersehen, dass
cher Struktur bei verschiedenen Organismen knapp 100 Jahre später die vollständige Se-
vorkommen, bezeichnet man als evolutionär quenz der Bausteine des Genoms des Men-
konserviert. Anders als die wichtigen Struktu- schen bekannt sein würde (IHGSC, 2001 und
ren, die in der Evolution konserviert wurden, 2004; Venter et al, 2001). Die von Bateson ge-
unterscheiden sich DNA-Sequenzen ohne oder nannten Hauptziele des neuen Faches waren
von geringer Bedeutung zwischen Individuen die Untersuchung der Gesetzmäßigkeiten von
der gleichen Spezies. Individuelle Unterschiede Erblichkeit (Heredity) und Variation, vor allem
sind häufig (genetischer Polymorphismus). auch im Hinblick auf die Evolution der ver-
schiedenen Arten von Lebewesen. Mit dem Be-
Wege in die moderne Genetik griff Erblichkeit bezog sich Bateson auf die
Der Augustinermönch Gregor Mendel Ähnlichkeit zwischen genealogisch verwand-
(1822 – 1884) hat 1865 durch Züchtungsexperi- ten Organismen, mit dem Begriff Variation auf
Einführung und Zeittafel 5

die Unterschiede. Bateson hat die Bedeutung bolism erkennbar, als 1941 Beadle und Tatum
der im Jahr 1900 von Correns, Tschermak und bei einem Pilz (Neurospora crassa) nachweisen,
DeVries wieder entdeckten Mendelschen Ge- dass jeweils ein Gen für die Bildung eines be-
setzmäßigkeiten besonders klar erkannt, auch stimmten Enzyms verantwortlich ist („ein Gen
für den Menschen. Die Bezeichnung Genomik – ein Enzym“). Der Nachweis genetischer Re-
(McKusick & Ruddle, 1987) bezieht sich auf die kombination bei Bakterien (Lederberg und Ta-
Gesamtheit aller biologischen und genetischen tum, 1946) und Viren (Delbrück und Bailey,
Informationen einer Species, eines Individu- 1947), sowie die Beobachtung spontaner Muta-
ums, oder einer Zelle. tionen bei bakteriellen Viren (Bakteriophagen)
durch Hershey (1947) führen zu einer systema-
Klassische Genetik zwischen 1910 und tischen genetischen Analyse von Mikroorganis-
1940 men mit ähnlich großen Auswirkungen für die
Entwicklung der Genetik wie die Analyse von
Genetik als eigenes Wissenschaftsgebiet be-
Drosophila 35 Jahre zuvor.
ginnt 1910 an der Columbia University New
Die Sequenzierung von Insulin (Feststellung
York mit der Einführung der Fruchtfliege (Dro-
der Sequenz der Aminosäuren) durch F. Sanger
sophila melanogaster) durch Thomas H. Morgan
(1955) und Hämoglobin im Jahr 1957 durch
(1866 – 1945) und seine Mitarbeiter Calvin
V. Ingram bewiesen, dass ein Protein aus einer
B. Bridges (1889 – 1938), A. H. Sturtevant
definierten Abfolge von Aminosäuren besteht.
(1891 – 1970) und H. J. Muller (1890 – 1967). Die
Da Proteinsynthese im Cytoplasma stattfindet,
sich anschließenden mehrjährigen systemati-
DNA sich jedoch im Zellkern befindet, konnte
schen genetischen Studien an Drosophila füh-
DNA nicht unmittelbar die Proteinsynthese
ren zu der Erkenntnis, dass Gene linear auf
steuern. Es zeigte sich, dass DNA zunächst in
Chromosomen angeordnet sind. Die erste gene-
ein chemisch ähnliches Boten-Molekül (Ribo-
tische Karte erstellt A. H. Sturtevant 1913 für
nukleinsäure, RNA) überschrieben wird (Crick,
sechs X-chromosomale Gene (noch als Faktoren
Barnett, Brenner, Watts-Tobin, 1961), das als
bezeichnet und nicht Karte [map] genannt). Die
Vorlage für die vorgesehene Sequenz von Ami-
Untersuchungen der Morgan-Schule begründet
nosäuren dient. Die Aufklärung des geneti-
die Chromosomentheorie der Vererbung (Mor-
schen Code folgte in den Jahren 1963 bis 1966.
gan, Sturtevant, Muller, Bridges, 1915).
Der genetische Code ist universell und wird
Dass Gene nicht unveränderlich sind, hatte H.
von allen lebenden Zellen verwendet, ein-
de Vries (1848 – 1935) bereits im Jahr 1901 er-
schließlich der Pflanzen, Bakterien, sowie Vi-
kannt. Er führte für die Veränderbarkeit die Be-
ren. Genetische Information entspricht einem
zeichnung Mutation ein. H. J. Muller be-
Text und wird in Datenbanken gespeichert.
stimmte 1927 die spontane Mutationsrate bei
Drosophila und wies nach, dass Mutationen
durch Röntgenstrahlen induziert werden kön- Methodische Voraussetzungen für die
nen. C. Auerbach und J. M. Robson (1941) sowie weitere Entwicklung ab 1953
unabhängig F. Oehlkers (1943) wiesen dies
Wie Biologie und Naturwissenschaften ist Ge-
auch für bestimmte chemische Substanzen
netik ein von der Entwicklung neuer Methoden
nach. Jedoch blieb unklar, was eine Mutation
geprägtes Fach. Dazu gehörten zuverlässige,
ist, solange die materielle Grundlage der ge-
aber relativ einfache Verfahren für die Tren-
netischen Informationsübertragung unbe-
nung komplexer Moleküle durch verschiedene
kannt war.
Formen der Elektrophorese, DNA-Synthese in
vitro (Kornberg, 1956), immunologischen Me-
Moderne Genetik zwischen 1940 und thoden und anderen. Vor allem die Entwick-
1957 lung von Methoden der Zellkultur war eine ent-
Neue Ansätze führen ab 1940 zu neuen Er- scheidende Voraussetzung für die genetische
kenntnissen, die als Vorläufer der molekularen Analyse beim Menschen. Insbesondere die ge-
Genetik gelten können. Zum ersten Mal wird netische Analyse von fusionierten Zellen in der
eine enge Beziehung zwischen genetischen und Kultur (Zellhybridisierung) 1962 und die Ent-
biochemischen Vorgängen entsprechend dem wicklung eines Zellkulturmediums zur Selek-
Garrodschen Konzept des Inborn Error of Meta- tion mutanter Zellen in Kultur förderten die
6 Einführung

Entwicklung der Genetik bei Säugetieren mit 1977) wurden Ende der 80er-Jahre durch auto-
zunehmender Bedeutung für den Menschen. matisierte Verfahren ersetzt, die eine Sequen-
Die Feststellung der richtigen Chromosomen- zierung großer Abschnitte in kurzer Zeit erlau-
zahl des Menschen 1956, die Einführung von ben. Dies gipfelte in der im April 2003 abge-
Lymphozytenkulturen zur Analyse von Chro- schlossenen Sequenzierung des Genoms des
mosomen, sowie die Beschreibung des Replika- Menschen. Die raschen Fortschritte in der
tionsmusters der Chromosomen des Menschen Kenntnis des Genoms bei verschiedenen Orga-
waren weitere grundlegende Voraussetzungen nismen haben früher bestehende Grenzen in
für die Entwicklung einer modernen Genetik der genetischen Analyse verschiedener Orga-
des Menschen (Humangenetik). Die seit nismen mit einer Einteilung in Sparten wie
1971 mögliche individuelle Identifizierung aller Drosophila-Genetik, Säugetiergenetik, Hefege-
Chromosomen des Menschen durch spezifische netik, Bakteriengenetik etc. weitgehend aufge-
Färbung legte die Grundlage für die Kartierung hoben. Seit einigen Jahren tritt eine ausgespro-
von Genen. Dies wurde insbesondere durch die chene Vielfalt von RNA Molekülen zu Tage.
1986 eingeführte Fluoreszenz-in situ-Hybridi- Kleine, nicht für Proteine codierende RNA Mo-
sierung gefördert. Heute existieren zahlreiche leküle spielen eine wichtige biologische Rolle.
Verfahren, das Genom als Ganzes zu analysie-
ren. Humangenetik
Zwei wegweisende Entdeckungen 1949 und
Molekulare Genetik 1952 lenkten das Interesse auf die Genetik des
Moderne Genetik ist molekulare Genetik. Sie Menschen und deren medizinische Aspekte:
hat sich auf der Grundlage der direkten Analyse – der Nachweis, dass Sichelzellanämie erblich
von DNA ab ca. 1970 rasch entwickelt. Die Ent- ist (Neel, 1949) und auf einer molekular de-
deckung eines neuen Enzymkomplexes, Re- finierten Veränderung von normalem Hä-
verse Transkriptase, bei RNA-Viren (Retroviren) moglobin beruht (Pauling, Itano, Singer und
im Jahr 1970 erschütterte das bis dahin gültige Wells, 1949).
Dogma, dass der Weg der genetischen Informa- – Carl F. Cori und Gerty T. Cori beschrieben
tion ausschließlich von DNA zu RNA und von 1952 den ersten Enzymdefekt beim Men-
dort zum Genprodukt (Protein) führt. Die Ent- schen als Ursache einer hereditären Stoff-
deckung spezifischer Enzyme (Restriktions-En- wechsel-Krankheit beim Menschen: Glyko-
donukleasen) in Bakterien, die DNA an definier- gen-Speicherkrankheit Typ I oder von
ten Stellen schneiden, bildet die Grundlage der Gierke-Krankheit als Folge von Glucose-6-
rekombinanten DNA-Technik. Mit ihrer Hilfe Phosphatase-Defizienz in der Leber.
kann DNA reproduzierbar in Fragmente defi-
nierter Größe zerlegt werden. Zahlreiche Me- Zwar war die Entdeckung der normalen Chro-
thoden zur Vervielfältigung (Klonierung) von mosomenzahl im Jahr 1956 zunächst ohne Wi-
DNA in verschiedenen zellgebundenen Vekto- derhall geblieben, aber die Beschreibung der
ren, künstlichen Chromosomen und zellfreien ersten Chromosomenaberrationen beim Men-
Systemen wurden entwickelt. Durch eine Kom- schen 1959 (Trisomie 21 als Ursache von
bination von Methoden der Zellkultur und der Down-Syndrom [damals noch Mongolismus
spezifischen Identifizierung einzelner Ab- genannt] durch J. Lejeune, M. Gautier, R. Tur-
schnitte von Chromosomen des Menschen und pin; ein fehlendes Chromosom beim Turner-
im Vergleich mit anderen Organismen wurde Syndrom [45,X0] durch Ford et al. 1959 ; ein
ab 1980 eine rasch zunehmende Zahl von Ge- zusätzliches X-Chromosom beim Klinefelter-
nen kartiert (einer definierten chromosomalen Syndrom [47,XXY] durch Jacobs & Strong 1959)
Region zugeordnet). Gene konnten allein aus begründeten ein neues Gebiet, die Cytogenetik.
der Kenntnis ihrer chromosomalen Lage identi- Aus ihrer weiteren Entwicklung während der
fiziert werden (Positionsklonierung). In ande- folgenden 30 Jahre folgten die Grundlagen für
ren Fällen dient Information über ein bereits die Kartierung von Genen auf Chromosomen.
identifiziertes Gen mit ähnlicher Funktion als Neue Krankheitsbilder durch numerische und
Basis (Kandidaten-Gen Klonierung). Die 1977 strukturelle Chromosomenaberration wurden
beschriebenen Methoden der Sequenzierung seit 1960 beschrieben. Beziehungen zwischen
von DNA (F. Sanger, 1977; Maxam & Gilbert, Chromosomenveränderungen und Tumoren
Einführung und Zeittafel 7

wurden 1960 erkannt. Instabilität des Genoms, die genetische Information in den entsprechen-
sichtbar als Brüche in Metaphase-Chromoso- den Genen. Sie werden nach den Mendelschen
men, als Krankheitsursache wurde zuerst 1964 Gesetzmäßigkeiten vererbt und gehen auf eine
beobachtet (German; Schroeder). strukturelle Veränderung eines Gens zurück.
Seither hat die systematische Analyse gene- Zwischen rein endogenen (genetischen) und
tisch bedingter Krankheiten mit molekularge- umweltbedingten Ursachen von Krankheiten
netischen Methoden in früher nie geahntem gibt es ein breites Spektrum von genetisch be-
Umfang neue Erkenntnisse über die normale dingter Prädisposition und auslösender Fakto-
Funktion vieler Gene des Menschen und ande- ren (multifaktoriell bedingte Erkrankungen).
rer Organismen geliefert. Die Genetik des Men- Viele relativ häufige, chronisch verlaufende Er-
schen (Humangenetik) ist in der Gesamtheit krankungen gehören zu dieser wichtigen Kate-
der Kenntnisse heute weiter vorangeschritten gorie, z. B. erhöhter Blutdruck, erhöhte Blut-
als bei jeder anderen Spezies. Humangenetik fette, Diabetes mellitus, Gicht, psychiatrische
hat sich zu einem eigenständigen Fach entwi- Erkrankungen, bestimmte angeborene Fehlbil-
ckelt, mit einer Basis in der Medizin einerseits dungen. Weitere Kategorien genetisch beding-
und der Biologie andererseits. Ein guter Über- ter Krankheiten sind nicht-hereditäre Störun-
blick zur Entwicklung des Faches Humangene- gen in Körperzellen (verschiedene Formen von
tik findet sich bei Vogel & Motulsky (1997), Krebs) und Chromosomenaberrationen (vgl.
Childs (1999) und Rimoin et al. (2007). Weatherall, 1991; Rimoin et al, 2007; Scriver
et al, 2001). Genetisch bedingte Krankheiten
Genetik und Medizin sind keine Randgruppe der Medizin, sondern
Die meisten Krankheitsprozesse können als stellen einen wesentlichen Anteil aller Krank-
Folge der Interaktion von Umwelteinflüssen heitsursachen. Etwa ein Drittel aller stationä-
mit individuellen genetischen Gegebenheiten ren Aufnahmen im Kindesalter gehen auf Er-
des betreffenden Individuums aufgefasst wer- krankungen und Entwicklungsstörungen mit
den. Eine Erkrankung ist genetisch bedingt, zumindest teilweiser genetischer Ursache zu-
wenn sie vorwiegend oder ausschließlich durch rück (Weatherall, 1991). Die Gesamthäufigkeit
Störungen im genetischen Programm von Zel- genetisch bedingter Erkrankungen der ver-
len und Geweben verursacht wird. Mehr als schiedenen Kategorien wird auf etwa 3,5 – 5 %
3000 definierte Erkrankungen sind bekannt, der Bevölkerung geschätzt (vgl. Tabelle 1).
die monogen durch eine einzelne Mutation ver-
ursacht werden, von mehr als 2000 ist die ge- Das genomische Zeitalter
naue molekulargenetische Ursache bekannt Eine neue Ära der biomedizinischen Forschung
(McKusick, 1998 und Online-Ausgabe OMIM: begann 1990 mit dem international konzipier-
www.ncbi.nlm.nih.gov/Omim). Monogen ver- ten Humangenom-Projekt (HGP, s. Teil II. Geno-
ursachte Krankheiten sind so verschieden wie mik). Nur durch die Möglichkeit, ab 1997 auto-

Tabelle 1 Geschätzte Häufigkeit von genetisch bedingten Krankheitsursachen

Genetische Kategorie von Krankheit Häufigkeit auf 1000

Monogen gesamt 4,5 – 15


Autosomal dominant 2 – 9,5
Autosomal rezessiv 2 – 3,5
X-chromosomal 0,5 – 2
Chromosomenaberrationen 5–7

Somatische Mutationen bei Tumoren 250


Angeborene Fehlbildungen 10 – 40
Multifaktoriell bedingt praktisch alle anderen

(Daten modifiziert nach Weatherall, 1991)


8 Einführung

matisierte Verfahren zur DNA-Sequenzierung gen Jahrhunderts hat zu einer unheilvollen Ent-
einzusetzen, konnte das Ziel überhaupt er- wicklung beigetragen. Unter dem 1863 von
reicht werden. Auch wenn große Teile der Francis Galton (1822 – 1911) geprägten Begriff
(3 × 109) Nukleotid-Basenpaare der DNA des „Eugenik“ wurde ab 1907 in zahlreichen Län-
Genoms des Menschen auf nicht-codierende dern diskutiert, wie vermeintlich der Anteil
Abschnitte entfällt, ist die Aufgabe gewaltig, „guter“ Gene erhöht und der „schlechter“ Gene
etwa vergleichbar mit der Dechiffrierung eines vermindert werden könne und zu Krankheiten
Texts aus einzelnen Buchstaben von 1 mm führende Mutationen ausgemerzt werden
Breite über eine Distanz von 3000 km. Die Se- könnten. Im Jahr 1935 hatten mehrere Länder
quenzierung wurde im April 2003 im Wesentli- (Dänemark, Deutschland, Schweiz, Norwegen,
chen beendet. Die abgeschlossene Sequenzie- Schweden, USA und Canada) durch Eugenik be-
rung des Genoms des Menschen bedeutet kei- gründete Gesetze zur Sterilisierung eingeführt.
neswegs, dass die Funktion aller Gene bekannt Am schlimmsten jedoch entwickelte sich die
wäre. Eine auch noch so vollständige Kenntnis Situation im nationalsozialistischen Deutsch-
der Gene des Menschen wird das Wesen des land. Das Gesetz „zur Verhütung erbkranken
Menschen nicht erklären können. Nachwuchses“ vom 14. Juli 1933 führte direkt
Jetzt befinden wir uns in der „postgenomischen zur gesetzlich verankerten Diskriminierung
Ära“. Dazu zählen Funktionelle Genomik, Pro- von Erkrankten, die tatsächlich oder vermeint-
teomik (Analyse aller Proteine), Analyse des lich an einer Erbkrankheit litten. Im ersten Jahr
Transkriptoms (Gesamtheit der mRNA-Expres- wurden 80 000 Menschen zwangssterilisiert,
sion des gesamten Genoms), Kartierung aller insgesamt bis zum Ende der Schreckensherr-
SNPs (Single Nucleotide Polymorphism) und schaft 400 000. Viele Millionen Menschen, vor
anderes. Ähnliche Programme existieren für allem jüdischer Herkunft, Sinti und Roma und
andere Organismen. Unter der Bezeichnung Menschen mit geistiger Behinderung wurden
ENCODE (Encyclopedia of DNA Elements) Pro- unter diesem Gesetz mit eugenischem Vor-
ject werden die für die Transkription wichtigen wand ermordet. Jedoch gibt es weder eine mo-
regulatorischen Sequenzen analysiert (ENCODE ralisch noch eine wissenschaftliche Grundlage
Project Consortium, 2007). Sie entsprechen für gesetzliche Bestimmungen mit dieser Ziel-
etwa 1 % des Genoms. Das internationale Hap- setzung. Im Lichte heutiger Kenntnis ist erwie-
Map Projekt untersucht systematisch die sen, dass genetisch bedingte Krankheiten nicht
Grundlagen und Muster von DNA Sequenzvari- generell vermieden werden können. Menschen
anten in verschiedenen Populationen (Interna- können nicht in „erbgesunde“ und „erbkranke“
tional HapMap Consortium, 2007). eingeteilt werden.

Ethische und soziale Aspekte Epigenetik


Die Möglichkeit, durch genetische Untersu- Zahlreiche genetische Beobachtungen und
chungen zu Ergebnissen mit weit reichenden Krankheitszustände beanspruchen Interesse
Folgen zu gelangen, wirft eine Reihe von Fragen unter dem Begriff Epigenetik. Epigenese be-
für die ethische und soziale Bewertung auf. zieht sich auf Variationen des Phänotyps, die
Dazu zählt die Vertraulichkeit und Zuverlässig- nicht auf einer Änderung der Nukleotidbasen-
keit genetischer Daten. Mittels genetischer sequenz beruhen. Zahlreiche normale und ge-
Tests (prädiktiver genetischer Test) kann unter störte Funktionen beruhen auf epigenetischen
individuell gegebenen Umständen lange vor Modifikationen bestimmter Teile des Genoms.
dem zu erwartenden Zeitraum der Manifesta-
tion einer Krankheit geprüft werden, ob sie ein-
treten werden wird oder nicht. In vielen Fällen Weiterführende Literatur
ist diese Aussage jedoch mit Unsicherheiten Bearn AG: Archibald Garrod and the Individua-
behaftet. Dies ist eine neue Situation, auf die lity of Man. Oxford Univ Press, Oxford, 1993.
Ärzte künftig vorbereitet sein müssen. Childs B: Genetic Medicine. A Logic of Disease.
Johns Hopkins Univ Press, Baltimore, 1999.
Ein unheilvoller Irrweg: Eugenik Cooper D, ed: Nature Encyclopedia of the Hu-
Die Unkenntnis der Struktur und Wirkungs- man Genome. Nature Publ Group, London,
weise von Genen in der ersten Hälfte des vori- 2003.
Einführung und Zeittafel 9

Crick F: What Mad Pursuit: A Personal View of Morgan TH, Sturtevant AH, Muller HJ, Bridges
Scientific Discovery. Basic Books, New York, CB: The Mechanism of Medelian Inheritance.
1988. Henry Holt & Co, New York, 1915
Dubos RJ: The Professor, the Institute, and DNA: Passarge E: Color Atlas of Genetics. 3rd Thieme
O. T. Avery, his life and scientific achieve- Verlag Stuttgart-New York, 2007.
ments. Rockefeller Univ Press, New York, Passarge E, Kohlhase J: Genetik, pp 4-66. In:
1976. Klinische Pathophysiologie, 9. Aufl, W Sie-
ENCODE Project Consortium: Identification and genthaler & HE Blum, eds. Thieme Verlag,
analysis of functional elements in 1 % of the Stuttgart-New York, 2006.
human genome by the ENCODE pilot project. Rimoin DL, Connor JM, Pyeritz RE, Korf BK, eds:
Nature 447: 799-816, 2007. Emery and Rimoin’s Principles and Practice
Harper PS: Practical Genetic Counselling. 6th ed. of Medical Genetics, 5th edn. Churchill-Liv-
Edward Arnold, London, 2004. ingstone-Elsevier, Philadelphia, 2007 (mit
IHGSC (International Human Genome Sequen- Online Zugang über: www.genetics-
cing Consortium): Initial sequencing of the text.com).
human genome. Nature 409: 860 – 921, 2001. Scriver CR, Beaudet AL, Sly WS, Valle D, eds: The
IHGSC (International Human Genome Sequen- Metabolic and Molecular Bases of Inherited
cing Consortium): Finishing the euchromatic Disease, 8th edn. McGraw-Hill, New York,
sequences of the human genome. Nature 2001.
431: 931-945, 2004. Strachan T, Read AP: Human Molecular Gene-
Judson HF: The Eighth Day of Creation. Makers tics, 3rd edn. Garland Science, London-New
of the Revolution in Biology. Expanded Edi- York, 2004.
tion. Cold Spring Harbor Laboratory Press, Venter JC et al: The sequence of the human ge-
New York, 1996. nome. Science 291: 1304 – 1351, 2001.
King RC, Stansfield WD, Mulligan PK: Dictio- Vogel F, Motulsky AG: Human Genetics: Pro-
nary of Genetics. 7th ed. Oxford University blems and Approaches, 3rd edn. Springer
Press, 2006. Verlag, Heidelberg, 1997.
McKusick VA: Mendelian Inheritance in Man: A Watson JD: The Double Helix. A Personal Ac-
Catalog of Human Genes and Genetic Disor- count of the Discovery of the Structure of
ders, 12th edn. Johns Hopkins Univ Press, Bal- DNA. Atheneum, New York – London, 1968.
timore, 1998. Online Version OMIM: Watson JD, Crick FHC: A structure for deoxyri-
(http://www.ncbi.nlm,nih.gov/Omim/). bonucleic acid. Nature 171: 737, 1953.
Maddox B: Rosalind Franklin. Dark Lady of Weatherall DJ: The New Genetics and Clinical
DNA. Harper Collins, London, 2002. Practice, 3rd edn. Oxford Univ Press, Oxford,
McCarty M: The Transforming Principle. WW 1991.
Norton, New York, 1985. Wilkins M: The Third Man of the Double Helix.
McKusick VA, Ruddle FH: Genomics, a new Oxford University Press, Oxford, 2003.
name and a new journal. Genomics 1: 1-3,
1987.
10 Zeittafel zur Entwicklung der Genetik

Zeittafel zur Entwicklung 1905 Meiose (Farmer & Moore)


1906 Genetik als Bezeichnung für ein neues
der Genetik Wissenschaftsgebiet (W. Bateson)
Die folgende Zeittafel enthält ausgewählte Er- 1908 Populationsgenetik (G. H. Hardy,
kenntnisse, die wesentlich zur wissenschaftli- W. Weinberg, unabhängig)
chen Entwicklung der Genetik beigetragen ha- 1909 Inborn Errors of Metabolism (A. Garrod).
ben. Begriffe Gen, Genotyp, Phänotyp einge-
1839 Zellen als Grundlage lebender Organis- führt (W. Johannsen).
men (M. J. Schleiden, T. Schwann) Chiasmabildung in der Meiose (F. A.
1859 Charles Darwin, On the Origin of Species Janssens).
by Means of Natural Selection, or The Erster Inzuchtstamm der Maus, DBA
Preservation of Favoured Races in the (C. Little)
Struggle for Life begründet die Evolu-
1910 Beginn der Drosophila-Genetik (T. H.
tionstheorie
Morgan).
1865 Gregor Mendel, Versuche über Pflanzen-
Erste Mutation, weiße Augen bei Droso-
hybriden beschreibt Vererbung durch
phila melanogaster
bestimmte „Faktoren“, die sich entwe-
1911 Sarcoma Virus (Peyton Rous)
der dominant oder rezessiv verhalten
1869 „Nuclein“, ein neues, saures und Phos- 1912 Crossing-over (Morgan & Cattell).
phor enthaltendes, langes Molekül Genetische Kopplung (Morgan & Lynch).
(F. Miescher) Erste Gen-Karte, X-chromosomale Loci
1872 Charles Darwin prägt den Begriff Evolu- bei Drosophila (A. H. Sturtevant)
tion 1913 Nondisjunction (C. B. Bridges).
1879 Chromosomen in Mitose, Begriff Chro- Cytologische Beobachtung der zufälli-
matin (W. Flemming) gen Verteilung von Chromosomen (E. E.
1882 Mitose (W. Flemming) Carothers).
1883 Quantitative Aspekte der Heredität Langzeitkultur 30 Jahre aus Hühnerherz
(F. Galton) (Alexis Carrel)
1884 Prophase, Metaphase, Anaphase Stadien 1915 Gene auf Chromosomen (Chromoso-
der Mitose (E. Strasburger) mentheorie der Vererbung, T. H. Mor-
1888 Chromosom als Begriff geprägt (W. Wal- gan, A. H. Sturtevant, H. J. Muller, C. B.
deyer) Bridges)
1889 „Nukleinsäure“ als Begriff eingeführt 1922 Charakteristische Phänotypen von ver-
(R. Altmann) schiedenen Trisomien bei der Pflanze
1900 Mendels Entdeckungen werden erkannt Datura stramonium (A. F. Blakeslee)
(H. deVries, E. Tschermak, K. Correns, 1924 Blutgruppengenetik (F. Bernstein). Sta-
unabhängig). ABO-Blutgruppensystem tistische Analyse (R. A. Fisher)
(K. Landsteiner)
1927 Mutation durch Röntgenstrahlen (H. J.
1901 Eine Erkrankung des Menschen (Alkap-
Muller). Genetische Drift (S. Wright)
tonurie) wird autosomal rezessiv ver-
erbt (A. Garrod, W. Bateson) 1928 Euchromatin/Heterochromatin
1902 Individualität von Chromosomen (T. Bo- (E. Heitz).
veri). Genetische Transformation bei Pneu-
Beziehungen zwischen Chromosomen mokokken (F. Griffith)
und den Mendelschen Faktoren (W. Sut- 1933 Stammbaumanalyse (J. B. S. Haldane,
ton). F. Hogben, R. A. Fisher, F. Lenz, F. Bern-
Begriffe allelomorph, homozygot, hetero- stein).
zygot (W. Bateson & E. R. Saunders). Ge- Polytäne Chromosomen (E. Heitz &
schlechtschromosomen (C. E. McClung) H. Bauer; T. S. Painter)
1903 Autosomal dominante Vererbung beim 1935 Erste cytogenetische Karte bei Droso-
Menschen (Brachydaktylie Typ 1 A, phila (C. B. Bridges).
W. C. Farabee) Somatisches Crossing-over (C. Stern).
Zeittafel zur Entwicklung der Genetik 11

Erster Versuch, die Größe eines Gens zu Zellzyklus (Howard & Pelc). Diätbe-
bestimmen (M. Delbrück, N. W. Timo- handlung bei Phenylketonurie (H. Bi-
féef, K. G. Zimmer) ckel)
1937 Maus H2 Genlocus (P. Gorer). 1954 DNA-Repair (H. J. Muller).
Erste Kopplungsgruppe beim Men- Leukozyten-Drumsticks (Davidson &
schen: Hämophilie A und Rotgrünblind- Smith).
heit (J. Bell & J.B.S. Haldane) Turner-Syndrom ist X-Chromatin nega-
1940 Polymorphismus (E. B. Ford). tiv (P. E. Polani)
Rhesus-Blutgruppe (K. Landsteiner & 1955 Aminosäure-Sequenz von Insulin
A. S. Wiener) (F. Sanger).
1941 Evolution durch Genduplikation (E. B. Lysosomen (C. de Duve). Buccalsmear
Lewis). (Moore, Barr, Marberger).
Genetische Kontrolle biochemischer Re- Feinstruktur eines Gens und genetische
aktionen (G. W. Beadle & L. Tatum). Karte beim Phagen T4 (S. Benzer)
Mutationen durch Senfgas (C. Auerbach)
1956 46 Chromosomen beim Menschen (Tjio
1944 DNA als materielle Grundlage geneti- & Levan; Ford & Hamerton).
scher Information (O. T. Avery, C. M. DNA-Synthese in vitro (A. Kornberg).
MacLeod, M. McCarty). Genetische Heterogenität (Fraser, Har-
E. Schrödinger, What is Life? The Physi- ris)
cal Aspects of the Living Cell.
1957 Aminosäure-Sequenz von Hämoglobin
1946 Genetische Rekombination bei Bakte-
(V. M. Ingram).
rien (J. Lederberg & L. Tatum).
Cistron, die kleinste nicht-rekombi-
Genetische Rekombination bei Viren
nante Einheit eines Gens (S. Benzer).
(M. Delbrück & L. H. Bailey; A. D. Her-
DNA-Replikation ist semikonservativ
shey)
(Meselson & Stahl, Taylor, Delbrück,
1949 Sichelzellanämie, eine genetisch be- Stent).
dingte molekulare Krankheit (J. M. Neel;
L. Pauling). 1958 Somatische Zellgenetik (Pontecorvo).
Veränderungen in Hämoglobin gehäuft Ribosomen (Roberts, Dintzis). HLA-An-
in Malariagebieten (J. B. S. Haldane). tigene (Dausset).
X-Chromatin (M. L. Barr & E. G. Bert- Klonierung einzelner Zellen (Sanford,
ram) Puck).
Synaptonemaler Komplex in der Meiose
1950 Nukleotid-Basenrelation (E. Chargaff)
(Moses)
1951 Mobile genetische Elemente bei Mais
(Zea mays) (B. McClintock) 1959 Erste Chromosomenaberrationen beim
Menschen: Trisomie 21 (Lejeune, Gau-
1952 Gene bestehen aus DNA (A. D. Hershey
tier, Turpin).
& M. Chase).
Turner-Syndrom 45,X0 (Ford et al). Kli-
Plasmide (J. Lederberg). Transduktion
nefelter-Syndrom: 47,XXY (Jacobs &
bei Bakterien (N. Zinder)
Strong).
Erster Enzymdefekt beim Menschen
DNA-Polymerase isoliert (A. Kornberg).
(C. F. Cori & G. T. Cori).
Isoenzyme (E. S. Vesell, C. L. Markert).
Erste autosomale Kopplungsgruppe
Pharmakogenetik (F. Vogel, A. G. Mo-
beim Menschen (J. Mohr).
tulsky)
Chromosomenanalyse (Colchicin und
hypotone Behandlung, T. C. Hsu & C. M. 1960 Philadelphia-Chromosom (Nowell &
Pomerat). Hungerford)
Exogene Faktoren als Ursache für ange- Phytohämagglutinin-stimulierte
borene Fehlbildungen (J. Warkany) Lymphocytenkulturen (Nowell, Moor-
1953 DNA-Struktur (J. D. Watson & F. H. C. head, Hungerford).
Crick; R. Franklin, M. Wilkins). Hämoglobin-Struktur (MF Perutz)
Nicht-Mendelsche Vererbung (B. Eph- 1961 Genetischer Code in Triplets (Crick,
russi). Brenner, Barnett, Watts-Tobin).
12 Zeittafel zur Entwicklung der Genetik

Entzifferung des genetischen Codes Repetitive DNA (Britten & Kohne).


(Nirenberg, Mathaei, Ochoa). DNA-Excisions-Repairdefekt bei Xero-
X-Chromosom-Inaktivierung (M. F. derma pigmentosum (Cleaver).
Lyon; 1962 Bender, Russell, Ohno). Erste Zuordnung eines autosomalen
Genregulation, Operon (Jacob & Mo- Genlocus beim Menschen (Donahue,
nod). McKusick). Synthese eines Gens in vitro
Galaktosämie in Zellkultur (Krooth). (Khorana)
Zellhybridisierung (Barski, Ephrussi). 1970 Reverse Transkriptase (Baltimore; Te-
Thalidomid-Embryopathie (Lenz, min, unabhängig).
McBride) Chromosomenidentifizierung durch
1962 Blutgruppe Xg, eine X-chromosomale Bandenfärbung (L. Zech, T. Caspersson).
Blutgruppe beim Menschen (Mann, Y-Chromatin (Pearson, Bobrow, Vosa).
Race, Sanger). 1971 Zweitreffer-Theorie bei Retinoblastom
PKU-Screening (Guthrie, Bickel). (A. G. Knudson)
Identifizierung von Chromosomen Embryonale Stammzellen des Men-
durch 3H-Autoradiographie (J. German, schen (M. Evans)
O. J. Miller). 1972 Hohe durchschnittliche Heterozygotie
Replicon (Jacob & Brenner). (Harris & Hopkinson; Lewontin).
1963 Lysosomale Speicherkrankheiten Assoziation von HLA-Antigenen und
(C. de Duve) Krankheiten
Erste Krankheit durch autosomale Dele- 1973 Rezeptordefekte in der Ätiologie geneti-
tion (Cri-du-chat-Syndrom, J. Lejeune) scher Defekte, genetische Hyperlipidä-
mien (Brown & Goldstein; Motulsky).
1964 Excisionsreparatur (Setlow).
Nachweis von Schwesterchromatidaus-
MLC-Test (Bach & Hirschhorn; Bain &
tausch mit BrdU (S. A. Latt).
Lowenstein).
Philadelphia-Chromosom als Transloka-
Mikrolymphotoxizitätstest (Terasaki &
tion (J. D. Rowley)
McClelland).
1974 Chromatinstruktur, Nukleosom (Olins &
Selektives Nährmedium HAT für Zell-
Olins, Kornberg).
kultur (Littlefield).
Spontane Chromosomeninstabilität Erste Klonierung eines eukaryoten DNA-
(German, Schroeder). Segments, das einer bestimmten chro-
Zellfusion in Kultur (W. Szybalski & E. K. mosomalen Region zugeordnet wird
Szybalska; Harris & Watkins). (D. S. Hogness)
Zellkultur aus Zellen aus der Amnion- 1975 Asilomar-Konferenz über mögliche Fol-
flüssigkeit (H. P. Klinger) gen der rekombinanten DNA-Techniken.
Nachweis hereditärer Erkrankungen in Southern-Blot-Hybridisierung (E. Sou-
Zellkulturen (Danes, Bearn, Krooth, thern).
Mellman). Monoklonale Antikörper (Köhler &
Populationscytogenetik (W. Court Milstein)
Brown). 1976 Überlappende Gene beim Phagen
Fetale Chromosomenaberrationen bei ¤ X174 (Barell, Air, Hutchison).
spontanen Aborten (Carr, Benirschke) Erste transgene Maus (R. Jaenisch).
Genloci kartiert auf jedem Autosom des
1965 Somatisches Crossing-over in Zellkultu-
Menschen (Baltimore-Konferenz)
ren des Menschen (J. German).
Begrenzte Lebensspanne von Fibroblas- 1977 Gene bestehen aus codierenden und
ten in Kultur (Hayflick & Moorhead) nicht-codierenden DNA-Abschnitten
(„split genes“, R. J. Roberts; P. A. Sharp,
1966 Genetischer Code vollständig aufgeklärt. unabhängig).
Katalog Mendelscher Merkmale beim Erstes rekombinantes DNA-Molekül, das
Menschen (McKusick) Säugetier-DNA enthält.
1968 Restriktionsenzym aus E. coli (Linn & Methoden zur Sequenzierung von DNA
Arber; Meselson & Yuan). (Sanger, Maxam & Gilbert).
Zeittafel zur Entwicklung der Genetik 13

1978 b-Globulin-Genstruktur (Leder, Weiss- 1990 Hinweise auf ein familiären Brustkrebs
mann, Tilghman u. a.). verursachendes Gen (Mary-Claire King).
Begriffe Exon und Intron (W. Gilbert). 1991 Trinukleotid-Expansion als neue Klasse
Mechanismus der Transposition bei von krankheitsauslösenden Mutationen.
Bakterien. Klonierung des Gens für Cystische Fi-
1979 Erste Diagnostik mittels DNA-Techniken brose (Collins et al).
(Y. H. Kan). Odorantrezeptor-Multigen-Familie
1980 Restriktions-Fragment-Längen-Polymor- (Buck & Axel).
phismus (D. Botstein, R. White, M. Skol- Mikrosatelliten als polymorphe DNA-
nick) Marker
Gene für die embryonale Entwicklung 1992 Hochauflösende Karte von DNA-Mar-
von Drosophila (C. Nüsslein-Volhard & kern auf Chromosomen des Menschen.
E. Wieschaus) Zentrum für die X-chromosomale Inak-
1981 Sequenzierung des mitochondrialen Ge- tivierung identifiziert.
noms des Menschen (Anderson et al.) p53-Knockout-Maus (O. Smithies)
1982 Tumor-Suppressor-Gene (H. P. Klinger). 1993 Klonierung des Gens für Chorea Hun-
Prionen (infektiöse, proteinartige Parti- tington
kel) als Auslöser für einige chronisch 1994 Physikalische Karte des menschlichen
progressive Erkrankungen des zentralen Genoms in hoher Auflösung.
Nervensystems (Kuru, Scrapie, Creutz- Mutationen im Fibroblasten Wachs-
feldt-Jakob-Krankheit) (S. B. Prusiner) tumsfaktor-Rezeptor als Ursache für
1983 Zelluläre Onkogene (H. E. Varmus u. a.). Achondroplasie und andere Erkrankun-
gen.
1984 Lokalisierung des Gens für Chorea Hun-
Identifikation der Gene BRCA1 BRCA2
tington (Gusella).
bei Brustkrebs
Variable DNA-Sequenzen als „Geneti-
scher Fingerabdruck“ (A. Jeffreys). 1995 Sequenz eines frei lebenden Bakteri-
ums, Haemophilus influenzae.
1985 Polymerase-Kettenreaktion (Mullis,
Master-Gen für das Auge bei Wirbeltie-
Saiki).
ren (small-eye, W. J. Gehring).
Lokalisierung des Gens für Cystische Fi-
STS-Karte des Genoms des Menschen
brose. Hypervariable DNA-Abschnitte.
(T. J. Hudson et al.)
1986 Klonierung von Genen des Menschen
1996 Sequenzierung des Genoms von Bäcker-
beginnt. Erste Strukturanalyse eines
hefe S. cerevisiae (A. Goffeau et al.).
menschlichen Gens aufgrund der chro-
Genom-Karte der Maus mit über 7000
mosomalen Lage (Royer-Pokora et al).
Markern (E. S. Lander)
1987 Klonierung des Gens für Duchenne-
Muskeldystrophie (R. G. Worton, L. M. 1997 Sequenz von E. coli (F. R. Blattner et al.)
Kunkel, A. P. Monaco). und Helicobacter pylori (J. F. Tomb et al.).
Knockout-Maus (M. Capecchi). Klon eines Säugetiers (das Schaf Dolly)
Genetische Karte, Genom des Menschen durch Transfer eines adulten Zell-Nu-
(H. Donis-Keller et al.). kleus in eine enukleierte Oozyte (Wil-
mut)
1988 Beginn des Humangenom-Projekts.
Erfolgreiche Gentherapie in vitro. 1998 Embryonale Stammzellen des Men-
Molekulare Struktur von Telomeren am schen in Kultur (J. Thomson).
Ende von Chromosomen (E. Blackburn Sequenz des Genoms des Nematoden
und andere). C. elegans (C. elegans Consortium).
RNA-Interferenz (RNAi)
1989 Hox-Gene (Homeobox-Gene).
Klonierung einer definierten Region aus 1999 Sequenz von Chromosom 22, das erste
einem Chromosom des Menschen durch beim Menschen.
Mikrosezierung (Lüdecke, Senger, Claus- 2000 Sequenz des Genoms von Drosophila
sen, Horsthemke) melanogaster.
14 Zeittafel zur Entwicklung der Genetik

2001 Sequenz des Genoms des Menschen, 2007 Genom-weite Assoziationsstudien bei
Homo sapiens als Entwurf (draft) häufigen Erkrankungen

2002 Genom-Sequenz von Reis (Oryza sativa). 2008 Strukturelle Variationen des mensch-
Sequenz der Maus Mus musculus als lichen Genoms (E. E. Eichler u. a.)
Entwurf (draft).
Sequenz des Malaria-Parasiten Plasmo- Literaturhinweise zur Zeittafel
dium falciparum und des Überträgers
Dunn LC: A Short History of Genetics. McGraw-
Anopheles gambiae
Hill, New York, 1965.
2003 Vollständige Sequenz des Genoms des King RC, Stansfield WD, Mulligan, PK:
Menschen. A Dictionary of Genetics. 7th ed. Oxford Uni-
Sequenz des Y-Chromosoms des Men- versity Press, Oxford, 2006.
schen (D. C. Page u. Mitarb.).
Haplotyp-Karte (HapMap) des Men- Lander ES, Weinberg RA: Genomics. A journey
schen to the center of biology. Science 287:
1777 – 1782, 2000.
2004 Segmentale Duplikationen im Genom
McKusick VA: Human genetics: The last 35
von Mensch und Schimpanse
years. Am J Hum Genet 50: 663 – 670, 1992.
2005 Alle Chromosomen des Menschen se- Stent G, Calendar R: Molecular Genetics. An
quenziert. Introductory Narrative. 2nd ed. W. H. Free-
Neue, effiziente Methoden der DNA-Se- man, San Francisco, 1978.
quenzierung (M. Margulies, J. Shendure,
D. Bentley u. andere) Sturtevant AH: A History of Genetics. Harper &
Genom des Schimpansen sequenziert Row, New York, 1965.
Vogel F, Motulsky AG: Human Genetics. 3rd ed.,
2006 Variation der Anzahl von repetitiven
Springer, Heidelberg – New York, 1997.
Kopien im menschlichen Genom (copy
number variation, CNV). Whitehouse, HKL: Towards an Understanding
Genomische Krankheiten (J. R. Lupski u. of the Mechanism of Heredity. 3rd ed., Ed-
andere) ward Arnold, London, 1973.
Grundlagen
16 Molekulare Grundlagen

DNA als Träger genetischer Stammes in Pneumokokken des S-Stammes er-


Information halten (transformierendes Prinzip) (3).
Nach weiteren Untersuchungen stellten Avery
Als Friedrich Miescher 1869 DNA als neue, und Mitarbeiter fest, dass dies allein auf die
saure, phosphathaltige hochmolekulare Sub- DNA zurückzuführen war. Also musste DNA die
stanz („Nuclein“) beschrieb, konnte man ihre entsprechende genetische Information enthal-
tatsächliche biologische Bedeutung nicht ab- ten. Dies erklärte auch die Beobachtungen von
schätzen. Zu einfach erschien ihre Struktur, um Griffith. Hitze-Inaktivierung hatte die DNA des
für komplexe biologische Funktionen geeignet Bakterien-Chromosoms intakt gelassen. Des-
zu sein. Den Begriff „Nukleinsäure“ führte Ri- halb konnte ein Abschnitt des Chromosoms mit
chard Altmann 1889 ein. Eine zufällige, aber ge- dem für die Bildung der Hülle verantwortlichen
naue Beobachtung durch Fred Griffith (1928) Gen (S-Gen) aus der zerstörten S-Zelle freige-
und gezielte, präzise Untersuchungen von Os- setzt und während der anschließenden Kultivie-
wald Avery und Mitarbeitern (1944) zeigten, rung in einige R-Zellen aufgenommen werden.
dass DNA Träger genetischer Information ist. Nach Einbau des S-Gens in deren DNA wurde
Die Gene aller Zellen und einiger Viren beste- eine R-Zelle in eine S-Zelle transformiert (4).
hen aus DNA, einem fadenähnlichen langketti- (Abb. in A und B nach Stent & Calendar, 1978)
gen Molekül.
C. Genetische Information wird nur
A. Die Beobachtungen von Griffith von DNA übertragen
Der englische Mikrobiologe Fred Griffith
Der endgültige Beweis, dass DNA und kein an-
machte 1928 eine bemerkenswerte Beobach-
deres Molekül genetische Information über-
tung. Bei der Untersuchung verschiedener
trägt, erbrachten 1952 A. D. Hershey und
Stämme von Pneumokokken stellte er fest, dass
M. Chase. Sie markierten das Hüllprotein von
mit Stamm S (Smooth) injizierte Mäuse getötet
Bakteriophagen mit radioaktivem Schwefel
wurden (1). Mit Stamm R (Rough) injizierte
(35S) und deren DNA mit radioaktivem Phos-
Tiere dagegen überlebten (2). Wenn er den töd-
phor (32P). Bei der Infektion von Bakterien mit
lichen S-Stamm durch Hitze inaktivierte, hatte
markierten Bakteriophagen gelangte lediglich
dies keine Folgen und das Tier überlebte (3). 32
P (DNA) in die Zelle, nicht aber 35S (Hüllpro-
Jedoch erzielte eine Mischung des nicht tödli-
tein). Da anschließend in der Zelle vollständige
chen R-Stammes und des hitze-inaktivierten S-
neue Phagenpartikel (mit Hüllprotein) gebildet
Stammes eine tödliche Wirkung wie der S-
werden konnten, war erwiesen, dass aus-
Stamm (4). Im Blut der Tiere fand er normale
schließlich DNA Träger der für die Bildung
lebende Pneumokokken vom S-Stamm. Offen-
neuer Phagenpartikel erforderlichen geneti-
bar waren Zellen des R-Stammes in Zellen des
schen Information ist.
S-Stammes übergegangen (transformiert). Die-
ses überraschende Ergebnis konnte zunächst Avery OT, MacLeod CM, McCarty M: Studies on the
nicht erklärt werden und wurde mit Skepsis chemical nature of the substance inducing transfor-
mation of pneumococcal types. J Exp Med 79: 137-
aufgenommen. Eine Beziehung zur Genetik war
158, 1944.
nicht erkennbar. Dahm R: Discovering DNA: Friedrich Miescher and the
early years of nuclei acid research. Hum Genet 122:
B. DNA, das transformierende Prinzip 565-581, 2008.
Griffith F: The significance of pneumoccocal types.
Die Befunde von F. Griffith bildeten die Grund- J Hyg 27: 113-159, 1928.
lage für Untersuchungen von O. T. Avery, C. M. Hershey AD, Chase M: Independent functions of viral
MacLeod und M. J. McCarty (1944). Avery und protein and nucleic acid in growth of bacterio-
Mitarbeiter am Rockefeller-Institut in New York phage. J Gen Physiol 36: 39-56, 1952.
Judson MF: The Eigth Day of Creation. Makers of the
klärten die chemische Grundlage des transfor- Revolution in Biology. Expanded Edition. Cold
mierenden Prinzips. Aus Kulturen eines S- Spring Harbor Laboratory Press, New York, 1996.
Stammes (1) stellten sie einen Extrakt aus auf- McCarty M: The Transforming Principle. Discovering
gelösten Zellen (zellfreier Extrakt) her (2). Ob- that Genes are made of DNA. WW Norton & Co.,
New York–London, 1985.
wohl sämtliche Proteine, Lipide und Polysac- Stent G, Calendar R: Molecular Genetics. An Introduc-
charide entfernt waren, blieb die Fähigkeit zur tory Narrative. 2nd ed. WH Freeman, San Francisco,
Transformation von Pneumokokken des R- 1978.
DNA als Träger genetischer Information 17

1.

Pneumokokken-S-Stamm tot

2. 3.

R-Stamm lebt S-Stamm hitze-inaktiviert lebt

4.
R-Stamm

hitze-
S-Stamm inaktiviert tot

A. Die Beobachtung von Griffith

1. 2. 3.

Lyse, Präzipitation R-Stamm


in Kultur

zellfreier
Extrakt

Auftreten einiger S-Zellen


S-Stamm in Kultur zellfreier Extrakt in der Kultur (Transformation)
4. Hülle
S-Gen
Chromosom S-Gen

S-Zelle Hitze R-Zelle S-Hülle


Aufnahme von
S-Zelle zerstört, DNA-Fragment Transformation einer
DNA-Fragmente bleiben erhalten mit S-Gen R-Zelle in eine S-Zelle

B. Das transformierende Prinzip ist DNA


Phagen-DNA
32P-markiert 35S bleibt draußen

Hülle
35S-markiert

Phage nur 32P (DNA) gelangt in die Bakterienzelle Bildung neuer Phagen
C. Genetische Information wird nur von DNA übertragen
18 Molekulare Grundlagen

DNA und ihre Bausteine ruht auf der Verbindung der Zuckerreste unter-
einander. Die Hydroxy-Gruppen an Position C5
Die Information für die Entwicklung und spezi-
(5’) eines Zuckerrestes ist über eine Phospho-
fischen Funktionen von Zellen und Geweben
diester-Brücke mit der Hydroxy-Gruppe des
liegt in den Genen. Ein Gen ist ein nach Funk-
nächsten Zuckerrestes in Position C3 (3’) ver-
tion und Struktur definierbarer Teil der geneti-
bunden. Deshalb hat das eine Ende eine 5’-OH-
schen Information. Gene liegen auf Chromo-
Gruppe (5’-Ende bzw. 3’-Ende). Nach Konven-
somen im Kern der Zelle und in Mitochondrien
tion wird die Sequenz von DNA-Nukleotidba-
(s. S. 208). Sie bestehen aus einem komplexen
sen in 5’- nach 3’-Richtung geschrieben.
langkettigen Molekül, Deoxyribonukleinsäure
(DNS). Im Folgenden werden die Bausteine die- C. Räumliche Beziehung
ses Moleküls vorgestellt, das wie international
Die chemische Struktur der Nukleotidbasen be-
üblich mit DNA (Deoxyribonucleic acid) abge-
dingt eine definierte räumliche Beziehung. Ei-
kürzt wird. DNA ist eine Nukleinsäure. Ihre
nem Purin (Adenin oder Guanin) liegt im DNA-
chemischen Bausteine sind Nukleotidbasen, ein
Doppelstrang (s. u.) stets ein Pyrimidin (Thymin
Zucker (Deoxyribose) und Phosphatreste. Sie
oder Cytosin) gegenüber. Zwischen Cytosin und
bestimmen die dreidimensionale Struktur der
Guanin werden drei, zwischen Thymin und
DNA, aus der sich ihre funktionelle Bedeutung
Adenin zwei Wasserstoff-Brücken gebildet.
ergibt.
D. Doppelstrang
A. Nukleotidbasen
DNA bildet einen Doppelstrang. Infolge der
DNA enthält ein Purin und ein Pyrimidin als
räumlichen Beziehungen der innen liegenden
Nukleotidbasen. Zwei Arten von Purinen kom-
Nukleotidbasen liegen sich stets ein Cytosin
men vor: Adenin (A) und Guanin (G), und zwei
und ein Guanin bzw. ein Thymin und ein Ade-
Arten von Pyrimidinen: Thymin (T) und Cytosin
nin gegenüber (komplementäre Basenpaare
(C). Die Nukleotidbasen sind Teil einer DNA-
C–G und T–A). Die Sequenz der Nukleotidbasen
Untereinheit, einem Nukleotid. Es besteht aus
eines Stranges der DNA (in 5’- nach 3’-Rich-
einer der vier Nukleotidbasen, einem Zucker
tung) entspricht komplementär der Nukleotid-
(Deoxyribose) und einer Phosphat-Gruppe. Das
basensequenz (oder einfach Basensequenz) des
Stickstoff-Atom in Position 9 eines Purins bzw.
anderen Stranges in 3’- nach 5’-Richtung. Die
das Stickstoff-Atom in Position 1 eines Pyrimi-
Spezifität der Basenpaarung ist das wichtigste
dins ist mit dem Kohlenstoff in Position 1 des
strukturelle Merkmal der DNA.
Zuckerrestes verbunden (N-glycosidische Bin-
dung). Alberts B et al: Molecular Biology of the Cell. 5th ed.
Ribonukleinsäure (RNS, oder international üb- Garland Publishing, New York, 2008.
liche Abkürzung RNA, ribonucleic acid) unter- Alberts B et al: Molekularbiologie der Zelle, 4. Aufl.,
Wiley–VCH, Weinheim, 2002.
scheidet sich von DNA in zweierlei Hinsicht:
Koolman J, Röhm KH: Taschenatlas der Biochemie,
RNA enthält als Zucker Ribose (enthält im Ge- 3. Aufl., Thieme, Stuttgart–New York, 2003.
gensatz zu Deoxyribose eine Hydroxy-Gruppe Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
am Kohlenstoff-Atom in Position 2) und Uracil man, New York, 2004.
Stryer L: Biochemistry, 4th ed., WH Freeman, New York,
(U) anstelle Thymin. Uracil enthält keine Me-
1995.
thyl-Gruppe in Position C5.

B. Nukleotidkette
DNA ist ein Polymer von Deoxyribonukleotid-
Einheiten. Die Nukleotidkette entsteht durch
Verbindung der Hydroxy-Gruppe eines Zuckers
über eine Phosphat-Verbindung zum nächsten
Zuckerrest. Die über die Phosphat-Gruppen
miteinander verbundenen Zuckerreste bilden
den invariablen Teil der DNA. Variabel ist die
Sequenz der Nukleotidbasen A, T, C und G. Eine
DNA-Nukleotidkette ist polar. Die Polarität be-
DNA und ihre Bausteine 19

Purine NH2 Cytosin Guanin


6
C 5 7 H
1N N H
C 8
CH N H
2C C C C O
H N 4 N9 H C 3.00 Å
N
C C C H
3
H N H
Adenin (A) N C N
C N
2.90 Å
C N

zu
O

tte
H

rK
N

Ke

ett
O

e
zu
7
1 6C 5 H
N drei Wasserstoff-Brücken
HN C 8
CH
2C C
N9 Thymin Adenin
H2N N 4
3
H H3C H
Guanin (G) O H N
C C
H C N
Pyrimidine C C H
N C
O O H
N C N
4 4 C N
3 C 5 CH3 3 C 5
C N

zu
HN C HN CH O
tte

rK
H
Ke

ett
2 2
C CH
r

C CH

e
zu

O N1 6 O N1 6 zwei Wasserstoff-Brücken
Thymin (T) H Uracil (U) H C. Räumliche Beziehungen
5' Ende 3' Ende
NH2 C
4
G
3 C 5
N CH
2
C CH
O N1 6 G C
Cytosin (C) H
A. Nukleotidbasen
5' Ende O– T
A
O P O CH2 O Base
O– Zucker
O– H

O P O CH2 O Base
C G
O–

O– H
Phosphat O P O CH2 O Base
A
O–
T
O– H

O P O CH2 O Base
O–
3' Ende 5' Ende

B. DNA-Nukleotid-Kette OH H 3' Ende D. Doppelsträngige DNA


20 Molekulare Grundlagen

DNA-Struktur mentären Einzelstränge können sich wieder


zum ursprünglich doppelsträngigen Molekül
Die Aufklärung der DNA als Doppelhelix durch
vereinen (Renaturierung). Nicht komplemen-
James D. Watson und Francis H. Crick 1953, gilt
täre Einzelstränge vereinen sich nicht. Dies ist
als die bahnbrechende Grundlage der moder-
die Grundlage einer wichtigen Erkennungsme-
nen molekularen Genetik. Die Struktur der
thode von Nukleinsäuren durch molekulare
DNA erklärt die beiden grundlegenden funktio-
Hybridisierung: hat man einen Einzelstrang de-
nellen Aspekte:
finierter Herkunft, so kann man prüfen, mit
– Genetische Informationsübertragung durch
welchem anderen Einzelstrang er sich verbin-
ein lineares, lesbares System und
det (hybridisiert). Die Prüfung, ob komplemen-
– Replikation für die zuverlässige Übertragung
täre Abschnitte von DNA hybridisieren, ist ein
der Information von einer Generation zur
wichtiges Prinzip bei der Analyse von Genen.
nächsten. Die DNA-Doppelhelix macht die
Genstruktur und -funktion molekular ver- D. Genetische Informations-
ständlich. übertragung
A. DNA-Doppelhelix Die Sequenz der Nukleotidbasenpaare (A–T
u. C–G) bestimmt den Inhalt der genetischen
Die beiden helikalen Polynukleotidketten sind
Information wie ein linearer Text aus Buch-
um eine gemeinsame Achse umeinander ge-
staben und Wörtern. Jeweils drei Basenpaaren
wunden. Innen liegen die Nukleotidbasenpaare
bilden ein Codewort (Codon) für eine Amino-
(oder einfach Basenpaare, bp), entweder A–T
säure. Deren Abfolge bildet ein Polypeptid
oder G–C. Der Durchmesser der Helix ist 20 Å.
(Genprodukt).
Benachbarte Basen liegen 3,4 Å auseinander.
Die Sequenz der Nukleotidbasen wird zunächst
Die helikale Struktur wiederholt sich in Abstän-
von dem einen DNA-Strang in 3’- nach 5’-Rich-
den von 34 Å oder alle 10 Basenpaare. Wegen
tung in ein weiteres informationstragendes
der festgelegten räumlichen Beziehung der sich
Molekül (mRNA, Messenger- oder Boten-RNA)
innen gegenüberliegenden Nukleotidbasen
übertragen (Transkription, S. 26). Danach wird
sind die beiden Ketten der Doppelhelix exakt
die Nukleotidbasensequenz der mRNA in eine
komplementär. Die hier gezeigte Form ist die
der Abfolge der Codons entsprechende Sequenz
sog. B-Form (B-DNA). Unter bestimmten Vo-
von Aminosäuren übertragen (Translation,
raussetzungen kann DNA auch andere helikale
S. 26).
Formen annehmen (Z-DNA, A-DNA, vgl.
Ein Gen kann als ein Abschnitt in der DNA defi-
nächste Seite).
niert werden, der für die Bildung eines Poly-
B. Replikation peptids verantwortlich ist (ein Gen – ein Poly-
peptid). Ein oder mehrere Polypeptide bilden
Da die sich in der Doppelhelix gegenüberlie-
ein Protein. Deshalb können mehrere Gene an
genden Nukleotidketten strikt komplementär
der Bildung eines Proteins beteiligt sein.
sind, kann nach Öffnung jede der beiden als
Vorlage (Template) für die Bildung (Replika- Crick F: What Mad Pursuit. A Personal View of Scienti-
tion) eines neuen Strangs dienen. DNA-Replika- fic Discovery. Basic Books, Inc, New York, 1988.
tion ist semikonservativ, d. h. ein Strang wird Judson HF: The Eighth Day Creation. Makers of the Re-
volution in Biology. Expanded Edition. Cold Spring
gänzlich neugebildet, einer bleibt erhalten.
Harbor Laboratory Press, New York, 1996.
Stent GS, ed: The Double Helix. Weidenfeld & Nicolson,
C. Denaturierung und Renaturierung London 1981.
Die nicht kovalenten Wasserstoff-Brücken zwi- Watson JD: The Double Helix. A Personal Account of
schen den Nukleotidbasenpaaren sind the Structure of DNA. Atheneum, New York, 1968.
Watson JD, Crick FHC: Molecular structure of nucleic
schwach. Dennoch ist DNA unter physiologi- acid. Nature 171: 737-738, 1953.
schen Temperaturen stabil, weil es ein sehr lan- Watson JD, Crick FHC: Genetic implications of the
ges Molekül ist. Durch relativ schwache chemi- structure of DNA. Nature 171: 964-967, 1953.
sche Einwirkung (z. B. Alkali, Formamid oder Wilkins MFH, Stokes AR, Wilson HR: Molecular struc-
ture of DNA. Nature 171: 738-740, 1953.
Urea) oder vorsichtiges Erhitzen können die
beiden komplementären Stränge reversibel ge-
trennt werden (Denaturierung). Die komple-
DNA-Struktur 21
22 Molekulare Grundlagen

Alternative DNA-Strukturen C. Physiologische Dimensionen der


Die DNA-Doppelhelix kommt nicht in einer
Doppelhelix
einzigen Struktur vor, sondern stellt eine Struk- B-DNA ist eine perfekte reguläre Doppelhelix
turfamilie mit verschiedenen Typen dar. Die mit einem Durchmesser von 20 Å (2 nm). Eine
von Watson und Crick beschriebene Struktur helikale Windung wiederholt sich mit einem
ist die B-DNA-Form. Daneben kann DNA andere Abstand von 10,5 Basenpaaren pro Windung.
helikale Formen annehmen, A-DNA, Z-DNA. Benachbarte Basen auf einem Strang liegen je-
Unter physiologischen Bedingungen kommt weils 36 Å (0,36 nm) voneinander entfernt.
DNA in prokaryoten und eukaryoten Genomen
Ha SC et al: Crystal structure of a junction between B-
als B-DNA vor. DNA and Z-DNA reveals two extruded bases. Nature
437: 1183-1186, 2005.
A. Drei Formen von DNA Koolman J, Röhm KH: Color Atlas of Biochemistry. 2nd
B-DNA ist eine rechtshändig verlaufende Helix ed. Thieme Verlag Stuttgart-New York, 2005.
Rich A, Zhang S: Z-DNA: the long road to biological
mit 10,5 Basen pro Windung. Sie bildet zwei
function. Nature Rev. Genet. 4: 566-572, 2003.
Furchen, eine große Furche (major groove) und Stryer L: Biochemistry, 4th ed., WH Freeman, New York,
eine kleine Furche (minor groove). Die B-Struk- 1995.
tur kann in A-DNA übergehen. Diese seltene Watson JD et al.: Molecular Biology of the Gene, 5th
edition, Coldspring Habor Laboratory Press, 2004.
Form hat 11 Basenpaare pro Windung. Die
Wojciechowska M, Wells RD et al: Non-B DNA structu-
große Furche ist tief, die kleine flach. Sie exis- res formed by long DNA repeats of DM1, DM2, and
tiert nur im dehydrierten Zustand und unter- FRDA genes, not the sequences per se, promote mu-
scheidet sich von der B-Form durch Drehung tagenesis in flanking DNA. J Biol Chem 281: 24531-
der Perpendikularachse der Helix um 20 Grad. 24543, 2006.
Wojciechowska M, Wells RD et al: The involvement of
Die thermodynamisch instabile Z-DNA besitzt Non-B DNA structures in gross chromosomal rear-
eine linkshändige Konformation. Dies führt rangements. DNA Repair, Lieber M, Editor, Elsevier
dazu, dass die Abstände zwischen den Basen- Press 5, 1161-1170, 2006.
paaren größer sind (0,77 nm) als in B-DNA und
das Zucker-Phosphat-Gerüst einen Zickzack-
kurs nimmt (dies hat zur Bezeichnung Z-DNA
geführt). Ein Abschnitt B-DNA kann durch Rota-
tion um 180 ° in Z-DNA überführt werden. Z-
DNA und zugehörige Z-DNA bindende Proteine
haben biologische Bedeutung (Ha et al, 2005).
Der Übergang von B- und Z-DNA ist erleichtert,
wenn Cytosin in Position 5 methyliert ist
(5'mCyt). (Abb. modifiziert nach Koolman &
Röhm, 2005)

B. Große und kleine Furche


Die Basenpaarung in B-DNA (Adenin–Thymin
bzw. Guanin–Cytosin) führt zur Bildung einer
großen und einer kleinen Furche, weil die gly-
cosidischen Bindungen an den Deoxyribose-
Resten (dRib) sich nicht diametral gegenüber-
liegen. In B-DNA liegen die Purin- und Pyrimi-
din-Ringe 0,34 nm auseinander. B-DNA hat
zehn Basenpaare pro Windung der Doppelhe-
lix. Der Abstand einer vollständigen Windung
zur nächsten beträgt 3,4 nm. Dadurch entste-
hen lokalisierte Kurven in der Helix, die in ei-
ner etwas größeren und einer etwas kleineren
Furche resultieren.
Alternative DNA-Strukturen 23

3' 5' 3' 5'


Grundgerüst
Nukleotidbasen

3'

5'

5'
5' 3' 3'
5'
B-DNA Z-DNA

3'
A-DNA
A. Drei Formen von DNA

5' 3'
Base
große Furche 5' 3'
G C
Eine Windung auf 3,6 nm ca. 10,5 Basenpaare

A T Zucker-
kleine Phosphat
Furche A Grund-
gerüst
A T G C
3,4 nm

G C T A
kleine Furche
C G G C
Adenin – Thymin
große T A
Furche
0,34 nm

große Furche G C

T A

G C

C G

kleine große A T
Furche Furche
T A
kleine Furche
Guanin – Cytosin
20 Å (2 nm)
Basenpaarung in DNA Doppelstrang
C. Physische Dimensionen
B. Große und kleine Furche in B-DNA der Doppelhelix
24 Molekulare Grundlagen

DNA-Replikation C. Replikationsgabel
DNA-Replikation ist ein Kopiervorgang, bei Während der Replikation bildet sich an der
dem von jedem der beiden Stränge der DNA- Stelle der Öffnung der Doppelhelix eine charak-
Doppelhelix aus ein neuer, komplementärer teristische Struktur: die Replikationsgabel (1).
DNA-Strang gebildet wird. Da der ursprüngli- Hier dient jeder der beiden DNA-Stränge als
che Strang als Vorlage dient und nicht verän- Vorlage für die Synthese eines neuen DNA-
dert wird, der neue Strang jedoch gänzlich neu Strangs. Zuvor wird die Windung der Doppel-
gebildet wird, wird dies als semikonservative helix durch ein Enzymsystem (Topoisomera-
Replikation bezeichnet. DNA-Replikation ist sen) im Bereich der Replikationsgabel entwun-
biochemisch komplex, aber genetisch relativ den (2). Da die Elternstränge antiparallel sind,
einfach. kann die DNA-Replikation nur an einem DNA-
Die für die Replikation erforderliche Synthese Strang (5’-nach 3’-Richtung) kontinuierlich er-
von neuer DNA erfordert ein streng koordinier- folgen (führender Strang, leading strand). Ent-
tes Zusammenwirken vieler Proteine. Im E. coli- lang des 3’-nach 5’-Strangs (nachfolgender
Bakterium werden die beiden neuen DNA- Strang, lagging strand) wird die neue DNA zu-
Stränge mit einer Geschwindigkeit von ca. 1000 nächst in kleinen Abschnitten von ca.
Nukleotiden pro Sekunde gebildet. Wichtige 1000–2000 Basen bei Prokaryoten, 200 bei Eu-
Enzyme sind Polymerasen für die Synthese, He- karyoten (Okazaki-Fragmente) gebildet. In die-
licasen zur Trennung der beiden Stränge für die sem Strang ist für den Beginn der Replikation
Bildung der Replikationsgabel, Primasen für ein kurzes Stück RNA als Primer erforderlich.
den Beginn an der richtigen Stelle, Initiations- Dies wird durch eine RNA-Polymerase (Pri-
proteine zur Erkennung der Replikationsstelle, mase) gebildet. Der RNA-Primer wird anschlie-
sowie Proteine zur Wiederherstellung der Dop- ßend entfernt, mittels Polymerase I die Lücke
pelhelix. Der gesamte Komplex wird Replisom durch DNA ersetzt und abschließend werden
genannt. die DNA-Fragmente durch DNA-Ligase mitein-
ander verbunden. Das für DNA-Synthese ver-
A. Prokaryote Replikation beginnt an antwortliche Enzym (DNA-Polymerase III) ist
einer Stelle komplex und besteht aus mehreren Unterein-
In prokaryoten Zellen beginnt die Replikation heiten. Für den führenden und den nachfolgen-
an einer festgelegten Stelle (origin of replica- den Strang existieren bei Eukaryoten verschie-
tion, ORI) des ringförmigen Bakterien-Chromo- dene Enzyme. Während der Replikation wer-
soms (1). Von hier wird neue DNA in beiden den mittels eines komplexen Proof-Reading-
Richtungen mit gleicher Geschwindigkeit ge- Mechanismus Fehler eliminiert: falsch einge-
bildet bis die DNA verdoppelt und zwei Chro- baute Basen werden wieder entfernt und durch
mosomen entstanden sind. Replikation kann die richtigen ersetzt. (Abb. in 1 nach Alberts,
autoradiographisch sichtbar gemacht werden, 2003)
indem die neu replizierte DNA mit Tritium
Alberts B: DNA replication and recombination. Nature
(3H)-haltigem Thymidin markiert wird (2). 421: 431-435, 2003.
Cairns J: The bacterial chromosome and its manner of
B. Eukaryote Replikation beginnt an replication as seen by autoradiography. J Mol Biol 6:
mehreren Stellen 208-213, 1963.
Lodish H et al: Molecular Cell Biology, 5th ed. Scientific
In eukaryoten Zellen findet die DNA-Synthese American Books, WH Freeman & Co, New York,
in einer definierten Phase des Zellzyklus statt 2004.
(S-Phase). Es würde sehr lange dauern, wenn Marx J: How DNA replication originates. Science 270:
sie nur an einem Punkt beginnen würde. Tat- 1585-1587, 1995.
Meselson M, Stahl FW: The replication of DNA in
sächlich beginnt die Replikation eukaryoter Escherichia coli. Proc Natl Acad Sci 44: 671-682,
DNA an zahlreichen Stellen (Replikons) (1). Sie 1958.
schreitet von jedem Replikon aus in beiden Watson JD et al.: Molecular Biology of the Gene, 5th ed.
Richtungen fort, bis benachbarte Replikons in- Coldspring Harbor Laboratory Press, 2004.
einander übergehen (2) und die gesamte DNA
verdoppelt ist (3). Das elektronenmikroskopi-
sche Bild zeigt Replikons an drei Stellen (4).
DNA-Replikation 25

DNA-
Doppelhelix

neue
DNA

neue
DNA
1. DNA-Replikation im 2. Prokaryote Replikation
1. Bakterien-Chromosom 2. im Autoradiogramm bei E. coli (J. Cairns)
A. Prokaryote Replikation beginnt an einer Stelle

DNA-
Doppel-
helix Replikationsbeginn

neue
DNA

1. Bildung
1. von Replikons

2. Ausbreitung
2. der Replikons

neuer
DNA-
Strang

3. Replikation beendet 4. Eukaryote Replikation


B. Eukaryote Replikation beginnt an mehreren Stellen im EM (D.S. Hogness)

führender
Zucker DNA-Strang
3' 3'
3' HO 5'-Triphosphat
Base 5'
5'
Primer
HO 3'
Doppelhelix
geöffnet DNA
5' Polymerase III
HO 5' RNA-Primer
3' Primer
3' 3' 5' entfernt
OH 3' Lücke gefüllt
Topoisomerase 5' durch DNA
5' 3'
5'
3' Okazaki-
Fragmente 3'

5' 5'
1. 2. Rückwärts-
C. DNA-Replikationsgabel strang
26 Molekulare Grundlagen

Die Übertragung genetischer C. Stadien der Translation


Information Die Translation (Proteinsynthese) erfolgt in drei
Die in der Nukleotidbasensequenz enthaltene aufeinanderfolgenden Stadien. Sie findet bei
genetische Information wird in zwei prinzipiel- Eukaryoten außerhalb des Zellkerns im Cyto-
len Schritten in biologische Information umge- plasma an den Ribosomen statt. Ribosomen be-
wandelt: Transkription und Translation. Da- stehen aus Untereinheiten zahlreicher assozi-
durch entsteht ein Polypeptid mit spezifischer ierter Proteine und RNA-Moleküle (ribosomale
Struktur und Funktion (Genprodukt). Da DNA RNA, rRNA, Seite 144). Die Translation beginnt
dafür nicht direkt als Vorlage dienen kann, wird mit der Initiation (1) eines durch Bildung aus
die Abfolge der Basenpaare in DNA zunächst in mRNA, Ribosom und tRNA bestehenden Initia-
ein Botenmolekül aus RNA übertragen (Tran- tionskomplexes. Dazu sind eine Reihe von Initi-
skription). Dieses dient anschließend als Vor- ationsfaktoren (IF1, IF2, IF3 etc.) erforderlich.
lage für das Genprodukt (Translation). Die Ab- Dann folgt die Elongation (2). Es wird eine wei-
folge von Aminosäuren des gebildeten Poly- tere durch das nächste Codon festgelegte Ami-
peptids entspricht der Abfolge der Codons in nosäure angeheftet. Ein Elongationszyklus be-
der DNA. steht aus drei Phasen: Codon-Erkennung, Pep-
tidbindung zum nächsten Aminosäure-Rest
A. Transkription und Weiterbewegung (Translokation) des Ribo-
Bei der Transkription wird die Nukleotid-Se- soms um drei Nukleotide in 3’-Richtung der
quenz eines Strangs der DNA-Doppelhelix in mRNA. Die Translation endet mit der Termina-
ein komplementäres Molekül aus RNA (Mes- tion (3), wenn eines von drei Stopp-Codons
senger-RNA, mRNA, Boten-RNA) umgeschrie- (UAA, UGA oder UAG) in der mRNA erreicht
ben. Die DNA-Doppel-Helix wird zuvor durch wird. Die gebildete Polypeptid-Kette verlässt
Zusammenwirken zahlreicher Proteine geöff- nun das Ribosom, das wieder in seine Unterein-
net. Der codierende DNA-Strang (Sinnstrang) heiten dissoziiert. Die hier gezeigten Stadien
wird in 3’- nach 5’ -Richtung gelesen. sind in ihrem biochemischen Ablauf stark ver-
Die RNA-Synthese erfolgt gleichzeitig in 5’- einfacht.
nach 3’- Richtung. Die RNA hat deshalb die- D. Struktur von Transfer-RNA (tRNA)
selbe Orientierung wie der codierende DNA-
Strang. Der gegenläufige Strang ist der Anti- Transfer-RNA hat eine charakteristische, einem
sense-Strang. Die Transkription erfolgt enzy- Kleeblatt ähnliche Struktur, dargestellt am Bei-
matisch durch einen Komplex von Enzymen spiel Phenylalanin-tRNA in Hefe (1). In drei Be-
(RNA-Polymerasen, vgl. S. 146). reichen bilden sich einsträngige Schleifen, in
vier Bereichen ist die tRNA doppelsträngig. Die
B. Translation dreidimensionale Struktur (2) ist komplex und
Bei der Translation erfolgt die Übersetzung der lässt verschiedene Bereiche unterscheiden, wie
Nukleotid-Basensequenz der mRNA in eine die Erkennungsstelle der tRNA für das Codon
entsprechende Sequenz von Aminosäuren. Dies der mRNA (Anticodon) und die Bindungsstelle
geschieht durch Zwischenschaltung einer wei- für die jeweilige Aminosäure (Akzeptorstamm)
teren Klasse von RNA, der Transfer-RNA (tRNA). am 3’-Ende (Akzeptorende). (Abb. modifiziert
Für jede Aminosäure gibt es eine eigene tRNA nach Alberts et al [2008] und Lodish et al
mit einem Bereich, der komplementär zum Co- [2004])
don der mRNA ist (Anticodon). Das Anticodon Alberts B et al: Molecular Biology of the Cell. 5th ed.
CCG der tRNA für Glycin passt zum mRNA-Co- Garland Publishing, New York, 2008.
don GGC. Zu dem gezeigten Beispiel kann Brenner S, Jacob F, Meselson M: An unstable interme-
deshalb an dieser Stelle nur Glycin angehängt diate carrying information from genes to ribosomes
for protein synthesis. Nature 190: 576-581, 1961.
werden. Die Codons 1, 2, 3 und 4 der mRNA
Ibba M, Söll D: Quality control mechanisms during
sind in die Aminosäure-Sequenz Methionin translation. Science 286: 1893-1897, 1999.
(Met), Glycin (Gly), Serin (Ser) und Isoleucin Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
(Ile) übersetzt etc. Als 5 und 6 werden Glycin man, New York, 2004.
Watson JD et al: Molecular Biology of the Gene. 5th ed.
und Alanin (Ala) folgen. Codon 1 ist stets AUG
Coldspring Harbor Laboratory Press, 2004.
(Start-Codon).
Die Übertragung genetischer Information 27

mRNA
5' 3'

Transkription 3'

3' 5'
DNA-Doppelhelix Schließung Öffnung
A. Transkription

Glycin Alanin
Methionin Glycin Serin Isoleucin

tRNA

tRNA
Polypeptidkette

C C G C G U
A U G G G C U C C A U C G G C G C A G C A A G C
5' 1 2 3 4 5 6 7 8 3'
mRNA
Codons
B. Translation

H2N 1 2 H2N 1 2 3
H2N 1 2 3
3
4 4
4 5 5 5
4

E E A

5' 3' 5' 3' 5' 3'


1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6

Schritt 1 Schritt 2 Schritt 3


Elongation
C. Stadien der Translation

A 3'-Ende T-Stamm 64 Akzeptorstamm


C 54 76
C T-Schleife 4
A
5'-Ende G C
72
C G 3'
G C modifizierte
G U Nukleotide
A U
Akzeptor-
U A
D-Schleife 69 ende
U A U 7
G A C A C
C 20
G A U
A G 12
C U C
U G U G D-Stamm
G
C U C Variable
G A G C U Schleife
G
G A A G Schleife 3
C G 44 26
Schleife 1 C G
A U
Anticodon-
G C
stamm 38
A Schleife 2
C A 32
1. Kleeblatt- U
Anticodon- Anticodon
1. struktur G A A Anticodon schleife

D. Struktur von Transfer-RNA (t-RNA) 2. Dreidimensionale Struktur


28 Molekulare Grundlagen

Gene und Mutation der DNA-Basensequenz kann jedoch ein Codon


ändern. Die Position der daraus resultierenden
Die durch die Doppelhelix-Struktur der DNA er-
Änderung der Aminosäuresequenz entspricht
möglichte Weitergabe der genetischen Infor-
der Position der Mutation. Die Abbildung zeigt
mation an die Tochterzellen geschieht während
schematisch das Protein Tryptophan-Synthe-
der Replikation. Die bei der Transkription und
tase A des Bakteriums E. coli mit Mutationen an
Translation verwendete Information ist in ein-
vier Positionen. An Position 22 ist Phenylalanin
zelnen Einheiten niedergelegt, den Genen. Der
(Phe) durch Leucin (Leu) ersetzt, an Position 49
Begriff Gen wurde 1909 von dem dänischen
Glutaminsäure (Glu) durch Glutamin (Gln), an
Biologen Wilhelm Johannsen geprägt. DeVries
Position 177 Leu durch Arginin (Arg), an Posi-
erkannte 1901, dass genetische Information
tion 211 ein Glycin durch Arginin (Arg) oder
nicht unveränderlich ist, sondern sich ändern
Glutaminsäure (Glu). Jede Mutation hat eine
kann. Dafür führte er den Begriff Mutation ein.
definierte Position. Ob sie zum Einbau einer an-
Allerdings blieb in Unkenntnis der Struktur der
deren Aminosäure führt, hängt davon ab, ob die
DNA die Frage offen, wie Mutationen struktu-
Aminosäure-Zuordnung des entsprechenden
rell erklärt werden können. Die systematische
Codons geändert wurde oder nicht.
Analyse von Mutationen hat wesentlich zur
Entdeckung der Grundlagen der Genetik beige- C. Mutationstypen
tragen. Dies gilt insbesondere für die Entde-
Grundsätzlich gibt es drei Typen von Mutatio-
ckung von Mutationen bei Bakterien und Viren.
nen: 1. Substitution (Austausch), 2. Deletion
A. Transkription bei Prokaryoten und (Verlust), 3. Insertion (Einschub). Bei einer Sub-
Eukaryoten stitution werden Transition (Austausch eines
Purins bzw. Pyrimidins gegen ein anderes) und
Die Transkription verläuft bei kernlosen einzel-
Transversion (Austausch eines Purins gegen ein
ligen Organismen wie Bakterien (Prokaryoten,
Pyrimidin oder umgekehrt) unterschieden.
1) anders als bei vielzelligen Organismen (Eu-
Während eine Substitution keine Auswirkung
karyoten, 2) mit einem Zellkern. Bei Prokaryo-
auf den Leserahmen hat (Missense-Mutation),
ten wird eine mRNA gebildet, die unmittelbar
wird durch eine Deletion oder Insertion der Le-
als Vorlage zur Bildung eines Genprodukts
serahmen verschoben, so dass in der Regel die
dient. Die Sequenzen von DNA und mRNA ent-
anschließenden Sequenzen kein funktionelles
sprechen sich in strikter 1:1-Beziehung, d. h. sie
Genprodukt codieren (Nonsense-Mutation).
sind kolinear zueinander. Das Transkript dient
direkt als mRNA. Die Translation beginnt, noch D. Verschiedene Mutationen an einer
bevor die Transkription beendet ist. Position
Bei eukaryoten Zellen dagegen wird zunächst
Verschiedene Mutationen sind an einer Stelle
ein primäres Transkript aus RNA gebildet (vor-
(einem Codon) möglich. Beispielsweise wurden
läufige mRNA). Es ist eine Vorstufe der endgül-
an Position 211 zwei verschiedene Mutationen
tigen mRNA. Diese entsteht durch Entfernung
beobachtet: das normale (Wildtyp) Codon GGA
nicht-codierender Anteile aus dem primären
(Glycin) war nach AGA (Arginin) bzw. nach GAA
Transkript. Anschließend verlässt sie den Zell-
(Glutaminsäure) mutiert.
kern und dient als Vorlage für die Bildung eines
Polypeptids. Der Grund für diesen wichtigen Alberts B et al: Molecular Biology of the Cell. 5th ed.
Unterschied ist, dass bei Prokaryoten funktio- Garland Publishing, New York, 2008.
nell verwandte Gene direkt aufeinander folgen Alberts B et al: Essential Cell Biology. An Introduction
to the Molecular Biology of the Cell. Garland Publis-
und bei Eukaryoten nicht-codierender Ab-
hing, New York, 1998.
schnitte (Introns) in den Genen vorhanden sind Lodish H et al.: Molecular Cell Biology. 5th ed. Scientific
(vgl. S. 32). American Books, WH Freeman & Co., New York,
2004.
B. DNA und Mutation Watson JD et al: Molecular Biology of the Gene, 5th ed.
Coldspring Harbor Laboratory Press, 2004.
Die systematische Analyse von Mutationen bei Yanofsky C et al: On the colinearity of gene structure
Bakterien zeigte, dass codierende DNA und das and protein structure. Proc Nat Acad Sci USA 51:
entsprechende Polypeptid colinear sind (Ya- 261-272, 1964.
nofsky et al, 1964). Eine Änderung (Mutation)
Gene und Mutation 29

Zellmembran

DNA

Zellkern 3'
3' 5' primäres
Cytoplasma Transkript
5' 3'

mRNA Transport

5' 3'
Ribosomen

5' Polypeptid

1. Prokaryot 2. Eukaryot
A. Transkription und Translation bei Prokaryoten und Eukaryoten

Wildyp
1 22 49 177 211 267
NH 2 COOH
Phe Glu Leu Gly

Mutant
NH 2 COOH
Leu Gln Arg Arg/Glu
DNA 22 49 177 211
5' 3'

B. Position von Mutationen

A T G G C T G G A
Wildtyp
T A C C G A

A T T G C T 210 211 212


Substitution
T A A C G A Glycin
Wildtyp

A T G C T A G A G A A
Deletion
T A C G A

A T A G G C T 211 211
Insertion
T A T C C G A
Arginin Glutaminsäure

C. Mutationstypen D. Verschiedene Mutationen an einer Position


30 Molekulare Grundlagen

Genetischer Code B. Abgekürzter alphabetischer Code


Der genetische Code definiert die biologischen Zur Angabe von Aminosäure-Sequenzen wer-
Regeln, nach denen die Sequenz von Nukleotid- den aus nur einem Buchstaben bestehende Ab-
Basenpaaren der DNA in eine ihrer Sequenz kürzungen verwendet („alphabetischer Code“).
entsprechende Abfolge von Aminosäuren über- Zwei kürzlich entdeckte, Nichtstandard-Ami-
tragen wird. Ein Code-Wort für die Aminosäure nosäuren, Selenocystein und Pyrrolysin, wer-
besteht aus der Sequenz von drei Nukleotid-Ba- den bei einigen Organismen (Eubakteria, Ar-
senpaaren (Triplet-Codon). Der genetische chea) durch die bei Eukaryoten als Stopp-Co-
Code enthält ferner Sequenzen für den Beginn dons fungierenden RNA-Triplets UGA bzw. UAG
(Start-Codon) und für das Ende der codieren- codiert. Man nimmt an, dass dadurch die Deco-
den Region (Stopp-Codon). Der genetische dierung von Sequenzen jenseits eines Stopp-
Code ist universal; die gleichen Codons werden Codons erleichtert wird (Atkins & Gesteland,
von verschiedenen Organismen benutzt. 2002).

A. Genetischer Code in mRNA für alle C. Leserahmen


Aminosäuren Ein Abschnitt einer Nukleotid-Sequenz kann ei-
Ein Codon entspricht jeweils einer Aminosäure. nem von drei Leserahmen entsprechen (z. B. A,
In jedem Codon ist in 5’ nach 3’-Richtung die B oder C), jedoch nur einer ist richtig (offener
erste, die zweite und die dritte Base definiert. Leserahmen, ORF). In dem gezeigten Beispiel
Der genetische Code ist redundant, weil viele werden die Leserahmen B und C nach 3 bzw.
Aminosäuren durch mehr als ein Codon festge- 5 Codons durch ein Stopp-Codon unterbrochen.
legt werden. Beispielsweise gibt es für die Co- Sie können deshalb nicht als Leserahmen einer
dierung der Aminosäure Phenylalanin zwei codierenden Sequenz dienen. Dagegen muss A
Möglichkeiten: UUU und UUC oder für die Ami- der richtige Leserahmen sein, weil er ohne
nosäure Serin sechs: UCU, UCC, UCA, UCG, so- Stopp-Codon läuft (hier nur ein kurzes Stück
wie AGU und AGC. Die größte Variation liegt in gezeigt).
der dritten Position (am 3’-Ende des Triplets).
Alberts B et al: Molecular Biology of the Cell. 5th ed.
Zwei Aminosäuren sind nur durch ein einziges Garland Publishing, New York, 2008.
Codon festgelegt: Methionin (AUG) und Trypto- Atkins JF, Gesteland R: The 22nd amino acid. Science
phan (UGG). Das Start-Codon ist AUG (Methio- 296: 1413-1414, 2002.
nin). Stopp-Codons sind UAA, UAG und UGA. Crick FHC et al: General nature of the genetic code for
proteins. Nature 192: 1227-1232, 1961.
Der genetische Code wird meistens in mRNA- Lodish H et al: Molecular Cell Biology. 5th ed. Scientific
Sprache notiert, d. h. Uracil (U) wird für Thymin American Books, WH Freeman & Co., New York,
(T) verwendet. 2004.
Der genetische Code war 1966 aufgeklärt, im Rosenthal N: DNA and the genetic code. New Eng
J Med 331: 39-41, 1995.
Wesentlichen dank der Erkenntnis, dass mRNA Singer M, Berg P: Genes and Genomes: a changing per-
der Informationsüberträger zwischen Genen spective. Blackwell Scientific Publications, Oxford-
und Proteinen war. Zugefügte mRNA konnte in London, 1991.
Bakterien direkt in entsprechende Proteine
umgesetzt werden. Synthetische RNA-Poly-
mere wie Polyuridylat (PolyU), Polyadenylat
(PolyA) und Polycytidylat (PolyC) konnten in
Extrakten von E. coli-Bakterien in Poly-Phenyl-
alanin, Poly-Lysin und Poly-Prolin übersetzt
werden. Dies bewies, dass UUU für Phenylala-
nin, AAA für Lysin und CCC für Prolin codieren
muss. Durch weitere Experimente mit ge-
mischten Polymeren verschiedener Anteile von
zwei oder drei Nukleotiden konnte der geneti-
sche Code für sämtliche Aminosäuren und
sämtliche Nukleotid-Kombinationen aufgeklärt
werden.
Genetischer Code 31

Nukleotidbase
Erste Zweite Dritte

Uracil (U) Cytosin (C) Adenin (A) Guanin (G)

F Phenylalanin (Phe) S Serin (Ser) Y Tyrosin (Tyr) C Cystein (Cys) U


F Phenylalanin (Phe) S Serin (Ser) Y Tyrosin (Tyr) C Cystein (Cys) C
Uracil L Leucin (Leu) S Serin (Ser) A
(U) Stopp-Codon Stopp-Codon
L Leucin (Leu) S Serin (Ser) Stopp-Codon W Tryptophan (Trp) G

L Leucin (Leu) P Prolin (Pro) H Histidin (His) R Arginin (Arg) U


L Leucin (Leu) P Prolin (Pro) H Histidin (His) R Arginin (Arg) C
Cytosin
(C) L Leucin (Leu) P Prolin (Pro) Q Glutamin (Gln) R Arginin (Arg) A
L Leucin (Leu) P Prolin (Pro) Q Glutamin (Gln) R Arginin (Arg) G

I Isoleucin (Ile) T Threonin (Thr) N Asparagin (Asn) S Serin (Ser) U


Adenin I Isoleucin (Ile) T Threonin (Thr) N Asparagin (Asn) S Serin (Ser) C
(A) I Isoleucin (Ile) T Threonin (Thr) K Lysin (Lys) R Arginin (Arg) A
Start (Methionin) T Threonin (Thr) K Lysin (Lys) R Arginin (Arg) G

V Valin (Val) A Alanin (Ala) D Asparaginsäure (Asp) G Glycin (Gly) U


Guanin V Valin (Val) A Alanin (Ala) D Asparaginsäure (Asp) G Glycin (Gly) C
(G) V Valin (Val) A Alanin (Ala) E Glutaminsäure (Glu) G Glycin (Gly) A
V Valin (Val) A Alanin (Ala) E Glutaminsäure (Glu) G Glycin (Gly) G

A. Genetischer Code für alle Aminosäuren in mRNA

Start AUG F (Phe) UUU L (Leu) CUU R (Arg) CGU V (Val) GUU
UUC CUC CGC GUC
Stopp UAA
CUG CGG GUG
UAG
G (Gly) GGU CUA CAA GUA
UGA
GGC UUG AGG
A (Ala) GCU GGG UUA AGA W (Trp) UGG
GCC GGA
GCG M (Met) AUG S (Ser) UCU Y (Tyr) UAU
GCA UCC UAC
H (His) CAU N (Asn) AAU
UCG
CAC AAC
C (Cys) UGU UCA
B (Asx) Asn
UGC P (Pro) CCU AGU
I (Ile) AUU oder
CCC AGC
AUC Asp
D (Asp) GAU
AUA CCG
GAC T (Thr) ACU
CCA
ACC Z (Glx) Gln
E (Glu) GAG K (Lys) AAG Q (Gln) CAG ACG oder
GAA AAA CAA ACA Glu

B. Alphabetischer Code

GCA AAU AAG GUA GAC CAU


A ORF nicht unterbrochen
Ala Asn Lys Val Asp His

B GGC AAA UAA GGU AGA CCA UAG ORF unterbrochen durch Stopp-Codon
Stopp
C UGG CAA AUA AGG UAG ACC AUC ORF unterbrochen durch Stopp-Codon
Stopp
C. Leserahmen
32 Molekulare Grundlagen

Struktur eukaryoter Gene Splicing geschieht in einem großen Ribonukle-


oprotein-Komplex, dem Spliceosom. Das erste
Die codierenden Sequenzen in eukaryoten Ge-
und das letzte Exon enthalten in 5’- bzw. 3’-
nen werden durch nicht-codierende DNA-Ab-
Richtung nicht translatierte Abschnitte, 5’UTR
schnitte unterbrochen. Ein codierender Ab-
und 3’UTR (Untranslated Region). Die Exons
schnitt bildet ein Exon, ein nicht-codierender
und Introns werden von 5’- nach 3’-Richtung
ein Intron (zwei 1978 von W. Gilbert einge-
des codierenden Strangs nummeriert. Die
führte Begriffe). Beide sind unterschiedlich
nicht-codierenden Abschnitte (Introns) werden
lang, je nachdem, um welches Gen es sich han-
aus dem primären Transkript entfernt und die
delt. Das entsprechende Muster aufeinander
Exons auf beiden Seiten miteinander verbun-
folgender Exons und Introns wird als Exon/In-
den. Das Splicing muss äußerst präzise vonstat-
tron-Struktur eines Gens bezeichnet. Introns
ten gehen, um ungewollte Veränderungen im
werden nach der Transkription aus der vorläu-
Leseraster zu vermeiden. Introns beginnen im-
figen RNA entfernt. Daraus resultiert die fertige
mer mit den Nukleotiden GT im 5’-3’-Strang
mRNA, bevor die Translation beginnt.
(GU in der RNA) und enden mit AG. Die mit GT
A. Exons und Introns beginnende Sequenz am 5’-Ende des Introns
nennt man Splice-Donorstelle. Das 3’-Ende, das
Im Jahre 1977 stellte sich überraschenderweise
mit AG endet, nennt man Splice-Akzeptorstelle
heraus, dass die DNA eukaryoter Gene länger
(alternatives Splicing, s. S. 150). Die reife mRNA
ist als die entsprechende mRNA. Der Grund da-
wird modifiziert, indem am 5’-Ende eine stabi-
für ist, dass bestimmte Teile der ursprünglich
lisierende Struktur (CAP) angefügt wird und am
transkribierten primären RNA vor der Transla-
3’-Ende viele Adenin-Nukleotide angehängt
tion entfernt werden. Elektromikroskopische
werden (Polyadenylierung).
Aufnahme zeigen, dass die DNA und ihr korre-
spondierendes Transkript (RNA) unterschied- D. Splice-Weg bei GU-AG-Introns
lich lang sind (1). Wenn die mRNA und der
Das Spliceosom besteht aus fünf Arten kleiner
komplementäre DNA-Einzelstrang hybridisie-
nukleärer RNA-Moleküle (snRNA) und mehr als
ren, entstehen Schleifen aus Einzelstrang-DNA,
50 Proteinen (kleine nukleäre Riboprotein-Par-
weil die mRNA nur mit bestimmten Teilen der
tikel). Der prinzipielle Vorgang beim Spleißen
Einzelstrang-DNA hybridisiert. In (2) sieht man
besteht aus autokatalytischer Spaltung am 5’-
sieben dieser Schleifen (A–G) und acht hybridi-
Ende des Introns. Dies resultiert in einer Lariat-
sierte Teile (1–7, sowie den Startteil L). Von ins-
Bildung. Es handelt sich um eine vorüberge-
gesamt 7700 Basenpaaren dieses Gens (3) hy-
hende intermediäre Struktur, die durch Verbin-
bridisieren nur 1825 mit der mRNA. Die Ab-
dung des 5’-Terminus (GU) mit der Base (A) im
schnitte, die hybridisieren, sind die Exons.
Intron entsteht (Verzweigungsstelle). Der
(Elektronenmikroskopische Aufnahme aus
nächste Schritt besteht aus einer Spaltung am
Chambon, 1981)
3’-Ende. Dies setzt die Lariat-Formation frei, die
B. Intervenierende DNA-Sequenzen anschließend abgebaut wird. Gleichzeitig wer-
(Introns) den das rechte und das linke Exon miteinander
verbunden (gespleißt). Die Verzweigungsstelle
Bei Prokaryoten ist DNA mit mRNA colinear
identifiziert exakt das 3’-Ende im Bereich der
und enthält keine Introns (1). Bei Eukaryoten
Akzeptorstelle (etwa 18–40 Nukleotide in 5’-
ist reife mRNA nur zu bestimmten Abschnitten
Richtung). (Abb. nach Strachan & Read, 2004)
der DNA komplementär, weil die DNA Introns
enthält (2). (Abb. nach Stryer, 1995) Chambon P: Split genes. Scient Amer 244 (5): 60-71,
1981.
C. Verarbeitung von RNA durch Lewin B: Genes IX. Jones & Bartlett, Sudbury, Mary-
Spleißen land, 2008.
Strachan T, Read AP: Human Molecular Genetics. 3rd
Nach der Transkription in die vorläufige RNA ed. Garland Science, London-New York, 2004.
werden die Introns durch einen komplexen, als Stryer L: Biochemistry, 4th ed. WH Freeman & Co., New
Spleißen bezeichneten Vorgang entfernt. Nach York, 1995.
Watson JD et al.: Molecular Biology of the Gene, 5th ed.
erfolgtem RNA-Spleißen entsteht die endgül- Coldspring Harbor Laboratory Press, 2004.
tige mRNA als Vorlage für die Translation. RNA-
Struktur eukaryoter Gene 33

1. Duplex-
DNA
mRNA

1. keine Introns (Prokaryote)

2.
A 1 3 6 RNA
Duplex- Intron
C D Poly-(A)-
F Schwanz DNA

5' B G

7
E Einzel- mRNA
DNA 2 4 5 3' strang-
DNA
3. L 1 2 3 4 5 6 7
Einzel-
A B C D E F G strang-
DNA
47 185 129 143 1043
51 118 156
7700 Basenpaare (bp) 2. mit Introns (Eukaryote)

A. Exons und Introns B. Intervenierende DNA-Sequenzen (Introns)

Promotor DNA
5' UTR Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3' UTR
5' GT AG GT AG 3'

Primäres Transkript RNA


GU AG GU AG
Splicing

A A A...Poly (A)

C. Eukaryote Gen-Struktur mRNA

Splice-Stellle Splice-Stellle

5' GU A AG 3'
Donor Akzeptor

Hydroxyl-Spaltung am 3'-Ende
und Lariat-Bildung
UG

5' A AG 3'

U
G
A AG
5' 3' degradiert
gespleißte mRNA
D. Splice-Weg bei GU – AG Introns
34 Molekulare Grundlagen

Restriktionsenzyme schneiden nicht, wenn die DNA an definierten


Stellen methyliert ist (methylierungsempfindli-
Die natürlich vorkommenden DNA-Moleküle
che Enzyme). (Abb. nach Strachan & Read,
sind viel zu lang um untersucht werden zu kön-
2004)
nen. Sie müssen in Fragmente von untersuch-
barer Größe zerlegt werden. Bei Bakterien C. Bestimmung der Lage von
kommen DNA-schneidende Enzyme vor, die Schnittstellen
DNA an definierten Sequenzen (Erkennungsse-
Die Größe der Fragmente spiegelt die relative
quenzen) spalten: Restriktions-Endonukleasen
Lage der Schnittstellen wider. Diese Tatsache
oder kurz Restriktionsenzyme. Da jedes Enzym
kann man zur Charakterisierung eines DNA-
die DNA nur an einer spezifischen Erkennungs-
Abschnitts verwenden (Restriktionskarte). Ent-
sequenz spaltet, kann die DNA reproduzierbar
stehen auf einem DNA-Abschnitt von 10 kb
in Fragmente definierter Größe zerteilt werden.
Länge nach Einwirkung von zwei Enzymen A
Etwa 400 Restriktionsenzyme sind für Untersu-
und B drei Fragmente von 2 kb, 3 kb und 5 kb
chungszwecke verfügbar. Die typische Länge
Größe, kann man die relative Lage der Schnitt-
einer Erkennungssequenz beträgt etwa 4–8 Nu-
stellen feststellen, indem man in einem weite-
kleotide.
ren Experiment nur Enzym A bzw. nur Enzym B
A. Spezifische Erkennungssequenzen einwirken lässt. Wenn Enzym A zwei Frag-
mente von 3 kb und 7 kb, Enzym B zwei Frag-
Viele Restriktionsenzyme schneiden die DNA-
mente von 2 kb und 8 kb entstehen lässt, müs-
Doppelhelix asymmetrisch, so dass an beiden
sen die beiden Schnittstellen von Enzym A und
Enden eines Fragments ein kurzer Abschnitt
B 5 kb auseinander liegen. Links von der
einzelsträngiger DNA überhängt. Andere
Schnittstelle von Enzym A befinden sich 3 kb,
schneiden symmetrisch, so dass stumpfe Enden
rechts von der Schnittstelle von Enzym B 2 kb
entstehen. Das Restriktionenzym EcoRI (Esche-
(1 kb entspricht 1000 Basenpaaren).
richia coli Restriktionsenzym I) schneidet an
der Erkennungssequenz 5'-GAATTC-3' in dem D. Restriktionskarte
einen Strang und 3'-CTTAAG-5' im dazu kom-
Eine Restriktionskarte ist eine lineare Sequenz
plementären Strang (1). Da die überhängenden
von Schnittstellen mit definierten Abständen.
Einzelstränge 5'-AATT und TTAA-3' komple-
Ein gegebener DNA-Abschnitt kann durch das
mentär sind (2), wird dieses Schnittmuster pa-
Verteilungsmuster der Schnittstellen charakte-
lindromisch genannt (griech. rückwärts lau-
risiert werden. Hier ist ein DNA-Abschnitt
fend, d. h. es kann in beiden Richtungen gelesen
durch Verteilung der Schnittstellen für die En-
werden). Ein Beispiel für eine symmetrische
zyme E (EcoRI) und H (HindIII) gekennzeichnet.
Spaltung ist HaeIII. Es schneidet an der Sequenz
5'-GGCC-3' und 3'-CCGG-5' (3). Es entstehen Strachan T, Read AP: Human Molecular Genetics. 3rd
stumpfe Enden (4). DNA-Fragmente mit über- ed. Garland Science, New York, 2004.
hängenden Einzelsträngen können miteinan- Brown TA: Genomes. 3rd ed. Garland Science, New
York, 2007.
der verknüpft (ligiert) werden, unabhängig von
ihrer Herkunft (rekombinante DNA Fragmente).

B. Beispiele für Restriktionsenzyme


Es werden die Erkennungssequenzen von vier
Enzymen gezeigt, die jeweils zu verschiedenen
Mustern an den Enden führen: ein 5'-Überhang
(3'-TTAA-5', 1), ein 3'-Überhang (5'-TGCA-3', 2),
stumpfe Enden (3) und nicht-palindrome Se-
quenzen (4).
Bei einigen Enzymen sind einzelne Nukleotide
nicht für die Erkennungssequenz essentiell. Bei
HindII z. B. genügt es, dass in der Mitte ein Pyri-
midin-Nukleotid gefolgt von einem Purin-Nu-
kleotid steht (GTPyPuAC). Einige Enzyme
Restriktionsenzyme 35

5' 3' 5' 3'


GAA T TC G AA T TC
C T T AA G
CT TAAG DNA-Spaltung 3' 5'
3' 5'
Einzelstrang
1. Erkennungssequenz eines Restriktions- 2. Fragmente mit Einzelstrangenden
enzyms
5' GG CC 3' 5' GG CC 3'
3' CC GG 5' 3' CC GG 5'

3. Erkennungsstelle von HaeIII 4. stumpfe Enden


A. DNA-Spaltung durch Restriktionendonucleasen

5'-Überhang
EcoRI (Eschericia coli R Faktor) G AAT T C 5' AATTC G 3'
CTTAAG 3' G CTTAA 5'
1.

3'-Überhang
PstI (Providencia stuarti) CTGC AG 5' G CTGCA 3'
GACGTC 3' ACGTC G 5'
2.

stumpfe Enden
AluI (Arthrobacter luteus) AGCT 5' CT AG 3'
TC GA 3' GA TC 5'
3.

Nicht-palindrome Sequenzen
MlnI (Moraxella nonliquefaciens) 5' CCTCNNNNNNN 5' CCTCNNNNNNN 3'
3' G G AG N N N N N N N 3' N GGAGNNNNNN 5'
4.
B. Beispiele von Restriktionsenzymen
Experiment: Einwirkung von zwei Enzymen A und B auf einen DNA-Abschnitt

Enzym A und B nur Enzym A


2 kb 3 kb
7 kb
3 kb
nur Enzym B
5 kb 2 kb
8 kb
A A B

3 kb 5 kb 2 kb
Interpretation:

C. Bestimmung der Lage von Schnittstellen


E H H E H E H E

D. Restriktionskarte
36 Molekulare Grundlagen

DNA-Klonierung rung aufwendig ist, werden heute andere Klo-


nierverfahren außerhalb von Zellen benutzt.
Um für eine molekulargenetische Untersu-
(Abbildung nach Strachan & Read, 2004)
chung eine ausreichende Menge einer spezifi-
schen DNA-Sequenz zu erhalten, muss diese se- B. Ein Plasmidvektor (pBR322) zur
lektiv amplifiziert (vermehrt) werden. Dies Klonierung
wird durch DNA-Klonierung erreicht. Dazu
Einer der früher am häufigsten verwendeten
wird aus einem Gemisch verschiedener DNA-
Plasmidvektoren ist pBR322 mit einer Länge
Fragmente eine Menge gleichartiger DNA-Frag-
von 4363 Basenpaaren (Bolivar et al, 1977). Er
menten produziert. Die gesuchten DNA-Ab-
enthält Schnittstellen für die Restriktionsen-
schnitte müssen identifiziert und von der übri-
zyme Pst I, EcoRI und SalI, sowie Gene für Am-
gen DNA getrennt werden. Danach kann man
picillin- und Tetracyclin-Resistenz, sowie ORI
sie selektiv vervielfältigen (klonieren). Zur
(Origin of Replication) (1). Wird ein fremdes
Identifizierung der korrekten DNA-Fragmente
DNA-Fragment im Bereich der BamHI-Schnitt-
nutzt man die komplementäre Einzelstrang-
stelle eingebaut, so geht die Tetrazyklin-Resis-
Hybridisierung. Ein kurzer Abschnitt Einzel-
tenz verloren. Entsprechend können solche
strang-DNA (eine Sonde) aus der zu untersu-
Fragmente selektiv in einer Kultur vermehrt
chenden Sequenz wird nach der Denaturierung
werden (Abb. nach Brown, 2007).
mit der komplementären Sequenz hybridisiert.
Die Klonierung in Plasmiden (Bakterien) hat an
Nachdem die hybridisierte Sequenz von der
Bedeutung verloren, seit künstliche Hefechro-
restlichen DNA getrennt wurde, kann sie jetzt
mosomen (YACs) zur Verfügung stehen (vgl.
kloniert werden. Die selektierten DNA-Sequen-
S. 118).
zen können grundsätzlich auf zwei Wegen
amplifiziert werden: in Zellen (zellbasierte Klo- Bolivar F et al: Construction and characterization of
nierung) oder durch zellfreie Klonierung (vgl. new cloning vectors. II. A multi-purpose cloning
PCR, S. 42). system. Gene 2: 95-113, 1977.
Brown TA: Genomes. 3rd ed. Garland Science, New
A. Zellbasierte Klonierung York, 2007.
Strachan T, Read AP: Human Molecular Genetics. 3rd
Die zellbasierte Klonierung besteht aus folgen- ed. Garland Science, London-New York, 2004.
den Schritten: Fragmente der Ziel-DNA (1) mit
replizierbarer DNA (diese besitzt ORI Sequen-
zen, Origin of Replication) verbinden (2), Trans-
fer in Wirtszellen und Vermehrung (Propagie-
rung, 3), selektives Wachstum der transfor-
mierten Zellen (4) und deren Isolierung (5),
Vermehrung rekombinanter DNA-Klone (6),
Aufbau einer Sammlung aller klonierten DNA-
Fragmente zu einer Klon-Bibliothek (7).
Da die Fragmente durch die Spaltung des glei-
chen Restriktionsenzyms (vgl. S. 48) entstan-
den sind, haben sie kurze Einzelstrang-Enden
mit einer spezifischen Sequenz und können so
mit Fragmenten verbunden werden, die in Zel-
len repliziert werden können. Zusätzlich wer-
den Fragmente angehängt, die ein Antibiotika-
Resistenz-Gen enthalten. Dies erlaubt eine se-
lektive Vermehrung in einer Bakterienkultur
mit antibiotika-haltigem Nährmedium. Rekom-
binante DNA-Fragmente bestehen aus den ur-
sprünglichen DNA-Fragmenten, die zusätzlich
Sequenzen mit Antibiotika-Resistenz und ORI-
Sequenzen enthalten. Sie werden als Vektor-
moleküle bezeichnet. Da zellbasierte Klonie-
DNA-Klonierung 37
38 Molekulare Grundlagen

cDNA-Klonierung ker) des zu klonierenden DNA-Fragments sind


(z. B. AATT und TTAA). Nach Einbau eines sol-
cDNA ist ein Abschnitt einsträngiger DNA, der
chen Fragments entsteht ein rekombinantes
komplementär zur mRNA eines codierenden
Plasmid. Bakterien, die rekombinante Plasmide
DNA-Abschnittes oder eines ganzen Gens ist.
aufgenommen haben, müssen sich von Bakte-
Man kann cDNA als Sonde für das entspre-
rien unterscheiden, die keine Plasmide aufge-
chende Gen verwenden, indem man die Kom-
nommen haben. Das ist möglich, wenn das ver-
plementarität durch DNA/DNA-Hybridisierung
wendete Plasmid ein Gen für eine Antibiotika-
ausnutzt. Ist das Gen an einer entsprechenden
Resistenz enthält, z. B. Ampicillin-Resistenz
Stelle durch strukturelle Umordnungen, z. B.
(AmpR). Nur Bakterien mit Plasmid wachsen
Deletion, verändert, so kann man zwischen
auf antibiotikahaltigem Medium. Dadurch ist
normaler und veränderter DNA unterscheiden.
eine Selektion für Bakterien möglich, die das
Aus der Sequenz von cDNA lassen sich wesent-
rekombinante Plasmid aufgenommen haben.
liche Rückschlüsse auf die codierenden Ab-
Der Nachweis für die Aufnahme des Inserts er-
schnitte eines Gens und das Genprodukt zie-
folgt durch die Unterbrechung eines Indikator-
hen, aber nicht auf die Exon/Intron-Struktur
Gens (b-Galactosidase) durch das Insert. Kolo-
und Größe eines Gens.
nien mit intaktem b-Galactosidase-Gen er-
A. Präparation von cDNA scheinen nach Zugabe von X-Gal, einem farblo-
sen, modifizierten Galactosemolekül, das zu ei-
cDNA wird aus mRNA mittels Reverser Tran-
nem Farbstoff gespalten wird, blau. Kolonien
skriptase präpariert. Man muss deshalb von ei-
mit Insert können durch die Inaktivierung der
nem Gewebe ausgehen, in dem das Gen tran-
b-Galactosidase X-Gal nicht spalten. Die Farb-
skribiert und mRNA gebildet wird. Zunächst
reaktion bleibt aus und die Kolonien bleiben
wird mRNA isoliert. Bevor das Enzym Reverse
blass.
Transkriptase aus mRNA eine komplementäre
DNA (cDNA) bilden kann, muss zuvor ein Pri- C. cDNA-Klonierung
mer angefügt werden. Da mRNA am 3’-Ende
Es werden nur Bakterien Ampicillin-resistent,
Poly-A enthält, kann man einen Primer aus Po-
die ein rekombinantes Plasmid aufgenommen
ly-T anfügen, von dem aus durch das Enzym Re-
haben. Rekombinante Plasmide, die das Gen für
verse Transkriptase cDNA in 5’- nach 3’-Rich-
Ampicillin-Resistenz enthalten, transformieren
tung gebildet wird. Dann wird die RNA mittels
Ampicillin-empfindliche Bakterien zu Ampicil-
Alkali entfernt. Die cDNA dient als Vorlage für
lin-resistenten Bakterien. In einem Ampicillin-
die Bildung eines neuen DNA-Strangs durch das
haltigen Medium wachsen nur Bakterien, die
Enzym DNA-Polymerase. Das Ergebnis ist ein
das rekombinante Plasmid mit dem gewünsch-
DNA-Doppelstrang, dessen einer Strang kom-
ten DNA-Fragment enthalten. Durch weitere
plementär zur ursprünglichen mRNA ist. An
Vermehrung in diesen Bakterien kann es belie-
diese DNA werden Einzelsequenzen (Linker)
big vervielfältigt (kloniert) werden, bis man ge-
angehängt, die komplementär zu den Einzel-
nügend Material für die vorgesehenen Untersu-
strang-Enden des zu verwendenden Restrikti-
chungen hat. (Abb. modifiziert nach Watson et
onsenzyms sind. Mit diesem Enzym wird der
al, 2004, und Brown, 2007)
Vektor, z. B. ein Plasmid, geschnitten um die
cDNA zur Klonierung zu verwenden. Brown TA: Genomes. 3rd ed. Garland Science, New
York, 2007.
B. Vektoren für die cDNA-Klonierung Watson JD et al: Molecular Biology of the Gene, 5th ed.
Coldspring Harbor Laboratory Press, 2004.
Da nur ein geringer Anteil der Plasmide Fremd-
DNA aufnimmt, müssen diejenigen Bakterien
selektioniert werden können, die rekombi-
nante Plasmide enthalten. Die DNA des ringför-
migen Plasmids wird mit einem Restriktions-
enzym eingeschnitten und geöffnet. Dadurch
entstehen an beiden Enden kurze, einzelsträn-
gige DNA-Sequenzen, die komplementär zu der
zuvor angefügten einsträngigen Sequenz (Lin-
cDNA-Klonierung 39

Ausgangsgewebe mit exprimiertem Gen Ampicillin-Resistenz-Gen (Amp+) Amp+


Poly(A) Schwanz
mRNA
5' AAAAAA 3'

Oligo(dT)-Primer hinzufügen Klonierungs- Rekombinanter


Vector Vektor
5' AAAAAA 3'
TTTTTT
DNA-Synthese
mehrere spezifische
Reverse Transkriptase kein DNA-Insert Restriktionsstellen DNA-Insert
(nicht-
rekombinant) lac Z' Gen
5' AAAAAA 3'
3' T T T T T T 5'
neue DNA
Ribonuklease degradiert
die meiste RNA
5' 3' β-Galactosidase β-Galactosidase
3' T T T T T T 5' aktiv inaktiv
Synthese des zweiten Strangs
durch DNA Polymerase I

5' 3' Kolonie blau Kolonie blass


3' T T T T T T 5' Wachstum in
Amp+
zweiter Strang wird ergänzt haltigem
cDNA Medium,
5' AAAAAA 3' Konstruktion
3' T T T T T T 5' einer
Klon-Bibliothek

A. Präparation von cDNA (Schema) B. Klonierungs-Vektoren

A
TT A TT A
AA

TT
TTA

AA

rekombinantes
Plasmid
(AmpR)

Bakterien ohne
rekombinantes
Plasmid sind
Wachstum Aufnahme in Bakterien Ampcillin-
transformierter empfindlich
Bakterien in Ampicillin- und wachsen nicht
haltigem Medium

Bakterien mit
rekombinantem Plasmid
sind Ampicillin-resistent

C. cDNA-Klonierung
40 Molekulare Grundlagen

DNA-Bibliotheken scher Aktivität. Weil cDNA-Klone den codieren-


den Sequenzen eines Gens entsprechen (Exons)
Eine DNA-Bibliothek ist eine Ansammlung von
und keine Sequenzen aus nicht-codierenden
DNA-Klonen, die aus einem komplexen Pool
Teilen (Introns) enthalten, ist klonierte cDNA
von DNA-Fragmenten stammen. In ihrer Ge-
bevorzugtes Ausgangsmaterial, wenn man
samtheit können sie ein Genom repräsentieren,
durch Analyse eines Gens nähere Kenntnis über
also das gesuchte Gen und die gesamte übrige
das Genprodukt erhalten möchte. Aus sequen-
DNA. Eine ausreichende Zahl Klone muss vor-
zierter cDNA kann man die Sequenz der Ami-
liegen, damit jeder Abschnitt mindestens ein-
nosäuren eines Proteins ableiten.
mal vertreten ist. Es gibt zwei grundsätzlich
verschiedene Bibliotheken: genomische DNA- C. Screening einer DNA-Bibliothek
Bibliotheken und cDNA-Bibliotheken.
Bakterien, die Vektoren mit DNA-Bibliothek-
A. Bibliothek aus genomischer DNA Fragmenten enthalten, werden in einer Petri-
schale auf Agar angezüchtet. Dort bilden sie Ko-
Klone genomischer DNA sind Kopien von DNA-
lonien (1). Nun wird mit einer Membran ein
Fragmenten aus allen Chromosomen (1). Sie
Abklatsch-Abdruck erstellt (2) und die DNA der
enthalten codierende und nicht-codierende Se-
an der Membran haftenden Bakterien wird mit
quenzen. Mittels Restriktionsenzymen wird die
einer alkalischen Lösung denaturiert (3). Die
genomische DNA in viele Fragmente gespalten
gesuchten DNA-Fragmente werden mit einer
(2). Diese werden in einen Vektor eingebaut,
radioaktiv (oder anders) markierten Sonde
z. B. in die DNA von Phagen (3), und anschlie-
identifiziert (4). Nach der Hybridisierung wird
ßend in Bakterien vermehrt (4). Die Gesamt-
die Position der gesuchten Kolonien auf der
kollektion rekombinanter DNA-Moleküle, die
Membran sichtbar (5). Dadurch kann man den
alle DNA-Sequenzen einer Spezies oder eines
im Abdruck markierten Stellen die entspre-
Individuums enthält, nennt man eine genomi-
chenden Kolonien in der Petrischale zuordnen.
sche Bibliothek.
Diese enthalten die gesuchten Fragmente aus
B. cDNA-Bibliothek der DNA-Bibliothek und können in Bakterien
weiter vervielfältigt (kloniert) werden (6). Auf
Eine cDNA-Bibliothek ist eine Ansammlung von
diese Weise kann das DNA-Fragment angerei-
cDNA-Molekülen (komplementäre DNA, S. 38).
chert werden, so dass für die weitere Untersu-
Im Gegensatz zu einer genomischen Bibliothek,
chung genügend Material zur Verfügung steht.
die zwar vollständig ist, aber codierende und
nicht-codierende DNA enthält, besteht eine Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
cDNA-Bibliothek nur aus codierenden DNA-Se- man, New York, 2004.
quenzen. Strachan T, Read AP: Human Molecular Genetics. 3rd
ed. Garland Science, London-New York, 2004.
Nach der Transkription wird durch das bei eu-
karyoten Organismen übliche RNA-Splicing
mRNA gebildet (vgl. S. 146). Anschließend syn-
thetisiert man mittels Reverser Transkriptase
cDNA. Diese dient als Vorlage zur Synthese ei-
nes komplementären DNA-Strangs, so dass
vollständige doppelsträngige DNA entsteht
(cDNA-Klone). Da ihre Sequenz den codieren-
den Sequenzen entspricht, kann man sie als
Sonden verwenden (cDNA-Sonden). Die an-
schließenden Schritte, Einbau in einen Vektor
und Vermehrung in Bakterien, entsprechen
dem Vorgehen bei der Herstellung einer geno-
mischen Bibliothek.
Da cDNA-Klone nur aus codierenden Regionen
eines aktiven (mRNA bildenden) Gens gewon-
nen werden können, unterscheiden sich cDNA-
Klone verschiedener Gewebe je nach geneti-
DNA-Bibliotheken 41

Genomische DNA Genomische DNA

Gen A Gen B Gen A Gen B


1 1

Transkription
Spaltung mit
Restriktions-
Enzym 2

2
RNA-
Splicing

Klonierung
(multiple 3
Fragmente)

Reverse
3 Transkription
und Klonierung

4
Genomische DNA-Klone in
einer genomischen Bibliothek DNA-Klone in
einer cDNA-Bibliothek

A. Genomische DNA-Bibliothek B. cDNA-Bibliothek

Filterpapier

1 2 3

Bakterienkultur mit Transfer auf Filterpapier Bakterienlyse,


rekombinanten Plasmiden Denaturierung DNA

Hybridisierung
mit markierter Sonde
6 5 4

Identifizierte Kolonien Position der Identifizierung von


aufnehmen und testen identifizierten Kolonien Kolonien mit Klonen,
C. Screening einer DNA-Bibliothek die hybridisiert haben
42 Molekulare Grundlagen

DNA-Amplifikation (Polymerase- und 3’-Ende an den Anheftungsstellen der Pri-


Kettenreaktion, PCR) mer, so dass die neue DNA der Ziel-DNA ent-
spricht. Jeder Zyklus dauert etwa 3–5 Minuten
Die Einführung einer zellfreien Methode zur und läuft in einem eigens dafür konstruierten
Vervielfältigung von DNA-Fragmenten im Jahr Gerät (Thermocycler) ab. In jedem Zyklus wird
1985 hat die molekularbiologische Analyse von die vorhandene DNA verdoppelt. Nach etwa 25
DNA ebenso nachhaltig beeinflusst wie die Zyklen endet die Kettenreaktion durch Mangel
DNA-Sequenzierung (vgl. S. 44). Im Gegensatz an einer der Komponenten der Reaktion. Aus
zu den verschiedenen Methoden der DNA-Klo- einem einzigen Ausgangsmolekül können etwa
nierung (Vervielfältigung, vgl. S. 36) benötigt 105 DNA-Fragmente entstehen.
man keine Zellen und Vektoren. Das Verfahren
wird PCR (Polymerase Chain Reaction) genannt, B. Reverse PCR (RT-PCR)
weil es sich um eine Serie aufeinander folgen- Bei diesem Verfahren dient mRNA als Aus-
der, wiederkehrender, von DNA-Polymerase ge- gangsmaterial. Nach Anheftung der Primer
steuerter DNA-Syntheseschritte handelt. Das wird zunächst cDNA gebildet. Diese wird mit-
Ergebnis einer PCR kann auf verschiedene tels PCR vermehrt.
Weise analysiert werden, meistens mittels ei-
ner Agarose-Gel-Elektrophorese. Diese zeigt C. Allel-spezifische PCR
eine der Größe des vervielfältigten DNA-Frag- Dieses Verfahren resultiert in Vermehrung nur
ments entsprechende Bande. Zusätzlich kann eines von zwei verschiedenen Allelen. Wenn
das PCR-Produkt sequenziert werden. Die PCR z. B. Allel 1 das Basenpaar AT enthält (1) und Al-
ist eine extrem empfindliche Reaktion, die lel 2 CG (2), so können diese durch allel-spezifi-
leicht durch Kontamination mit unerwünschter sche Primer unterschieden werden. Die PCR
DNA gestört werden kann. findet nur dann statt, wenn die oligospezifi-
A. Die Polymerase-Kettenreaktion schen Primer genau zu der vorhandenen Se-
(PCR) quenz passen. Andernfalls läuft die Reaktion
nicht ab.
Ausgangsmaterial für eine PCR ist ein DNA-
Fragment von etwa 5 bis 40 kb Größe, zwei Oli- Brown TA: Genomes. 3rd ed. Garland Science, New
gonukleotide (etwa 15–25 Nukleotide) als Pri- York, 2007.
Strachan T, Read AP: Human Molecular Genetics. 3rd
mer für die DNA-Synthese, DNA-Polymerase
ed. Garland Science, London-new York, 2004.
und Nukleotide. Die Primer müssen komple- Volkenandt M, Löhr M, Dicker AP: Gen-Amplifikation
mentär zu den beiden 3’-Enden der zu amplifi- durch Polymerase-Kettenreaktion. Dtsch. Med.
zierenden DNA (Ziel-DNA) sein, um anheften Wschr. 17: 670-676, 1990.
White TJ, Arnheim N, Erlich HA: The polymerase chain
zu können. Deshalb muss die Sequenz an bei-
reaction. Trends Genet. 5: 185-189, 1989.
den Enden der DNA bekannt sein. Die DNA wird
nicht durch zelluläre Enzyme synthetisiert,
sondern durch eine gereinigte thermostabile
DNA-Polymerase aus dem Bakterium Thermo-
philus aquaticus (Taq), das bei Temperaturen
von 70–75 °C überleben kann.
Eine PCR besteht aus drei sich etwa 25–30-mal
wiederholenden Zyklen von DNA-Synthesen:
1. Denaturierung des zu amplifizierenden DNA-
Fragments bei etwa 93–95 °C, 2. Anheftung der
Primer zur DNA-Synthese bei 50–60 °C, 3. Taq-
Polymerase-gesteuerte DNA-Synthese bei
70–75 °C. Nach dem ersten Zyklus werden neue
DNA-Stränge gebildet, die länger als die Ziel-
DNA sind, weil die Synthese an den 3’-Enden
zufällig und variabel endet (gezeigt als rote
Pfeile nach Zyklus 1). Jedoch bereits nach Zy-
klus 2 enden die neuen DNA-Stränge am 5’-
DNA-Amplifikation (Polymerase-Kettenreaktion, PCR) 43

mRNA
3' 5'
5' Primer
ersten
Primer 5' Primer anheften
5' 3' erster
DNA-Synthese Primer
neue DNA angeheftet
3' 5' reverse
5' Transkription
neue DNA
5' RNA
5' 3' cDNA
komplementäre DNA-Einzelstränge als zweiten
Vorlage zur DNA-Synthese Primer
anheften
3' 5' zweiter
Primer
angeheftet
DNA zu amplifizieren PCR

5' 3' multiple


Denaturierung cDNA
3' 5' Zyklus 1 3' 5' Klone
Primer
neue
DNA

B. Reverse PCR (RT-PCR)


Primer
DNA-
Synthese 5' 3' 5' 3'
1 A Allel 1
T
3' 5' 3' 5' 3' 5' 3' 5'

2 C Allel 2
G
Zyklus 2

Allel-1-
3 T spezifische
A Amplifi-
5' 3' 5' 3' 5' 3' 5' 3' kation
4 A
3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' C keine
Amplifikation

Allel-2-
5 G spezifische
Zyklus 3 Amplifi-
C
kation

6 G
5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' A keine Amplifikation
Allel-spezifische Primer
usw. (für Allele 1 in 3 und 4;
ca. 25 Zyklen produzieren ~105 Kopien für Allele 2 in 5 und 6)
A. Polymerase-Kettenreaktion (PCR) C. Allel-spezifische PCR
44 Molekulare Grundlagen

DNA-Sequenzierung Richtung zur „Wanderung“ ab, und erhält so die


Sequenz in 5’-3’-Richtung. In dem gezeigten
Die Kenntnis der Nukleotid-Sequenz eines
Beispiel ist dies die Sequenz TAGTCGCAGTAC-
Gens enthält wichtige Informationen über
CGTA (6).
seine Struktur, Funktion und seine evolutions-
biologischen Beziehungen. Deshalb hatte die B. Sequenzierung durch
Entwicklung relativ einfacher Methoden der Kettenabbruch
DNA-Sequenzierung in den 70er Jahren großen
Diese Methode beruht auf dem Prinzip, dass
Einfluss auf die molekulare Analyse von Genen.
die DNA-Synthese abgebrochen wird, wenn an-
Es wurden zwei prinzipielle Methoden der
stelle eines normalen Deoxynukleotids (dATP,
DNA-Sequenzierung entwickelt: eine chemi-
dTTP, dGTP, dCTP) ein Dideoxynukleotid
sche (A. M. Maxam & W. Gilbert, 1977) und eine
(ddATP, ddTTP, ddGTP, ddCTP) eingebaut wird.
enzymatische (F. Sanger et al, 1977). Hier wer-
Ein Dideoxynukleotid (ddNTP) ist ein Analogon
den die zugrunde liegenden Prinzipien darge-
zum normalen dNTP, jedoch fehlt ihm die Hy-
stellt.
droxyl-Gruppe am 3’-Kohlenstoff-Atom. Da-
A. Sequenzierung durch chemische durch ist keine Bindung zwischen dem 3’-Koh-
Einwirkung lenstoff-Atom und dem nächsten Nukleotid
möglich, wenn ein ddNTP eingebaut wird. Dies
Diese Methode beruht auf DNA-basenspezifi-
bricht die Synthese des neuen Strangs an dieser
scher Spaltung durch bestimmte Chemikalien.
Stelle ab. Das zu sequenzierende DNA-Frag-
Ein Doppel- oder Einzelstrang, der sequenziert
ment muss ein Einzelstrang sein (1). Die DNA-
werden soll, wird weiter verarbeitet, um einen
Synthese wird mit einem Primer und einem der
DNA-Einzelstrang zu erhalten, der mit radioak-
vier ddNTPs gestartet (2), die mit 32P in der
tiven Isotopen am 5’-Ende markiert ist (1). Die-
Phosphat-Gruppe markiert sind. Hier ist ein
ser DNA-Strang wird mit je einem von vier Che-
Beispiel eines Kettenabbruchs mit ddATP ge-
mikalien behandelt, entsprechend vier Reaktio-
zeigt. Überall wo ein Adenin (A) in der Sequenz
nen, je eine für jede der vier Nukleotidbasen. In
vorkommt, verursacht das ddATP einen Ab-
jedem der vier Reaktionsgefäße entsteht ein
bruch des neu synthetisierten Stranges (3). Da-
Gemisch von DNA-Fragmenten unterschiedli-
durch entstehen DNA-Fragmente unterschied-
cher Größe. Hier wird die Reaktion vom Dime-
licher Größe – entsprechend der Position von
thyl-Sulfat (DMS) mit Guanin (G) gezeigt. Di-
Adenin in dem zu sequenzierenden Fragment.
methyl-Sulfat methyliert den Purinring von Gu-
Die vier parallelen Reaktionen (4) ergeben eine
anin. Durch Verwendung einer begrenzten
Ansammlung von DNA-Fragmenten bestimm-
Konzentration von DMS wird im Durchschnitt
ter Größe, je nach der Position der Nukleotide,
nur ein G-Nukleotid pro DNA-Strang methyliert
an der die Neusynthese abgebrochen wurde.
(hier an vier verschieden Positionen gezeigt, 2).
Die Fragmente werden jetzt wie bei der chemi-
Wird nun eine zweite Chemikalie, Piperidin,
schen Methode in einer Gelelektrophorese auf-
hinzugefügt, wird der Purinring entfernt und
getrennt (5). Ein Beispiel für ein Sequenzier-Gel
die DNA an der Phosphodiester-Brücke ober-
ist zwischen den Tafeln A und B gezeigt.
halb der depurinierten Stelle gespalten. Dies
resultiert in markierten Fragmenten definierter Brown TA: Genomes. 3rd ed. Garland Science, New
Größe, abhängig von den Positionen der G in York, 2007.
der zu sequenzierenden DNA (3). Ähnliche Re- Maxam A, Gilbert W: A new method of sequencing
DNA. Proc Nat Acad Sci USA 74: 560-564, 1977.
aktionen werden für die anderen drei Basen
Rosenthal N: Fine structure of a gene – DNA sequen-
durchgeführt (A, T und C, hier nicht gezeigt). cing. New Eng. J. Med. 332: 589-591, 1995.
Die vier Reaktionsgemische (4) werden an- Sanger F et al: DNA sequencing with chain-terminating
schließend in getrennten Bahnen durch eine inhibitors. Proc Nat Acad Sci USA 74: 5463-5467,
1977.
Polyamidgel-Elektrophorese aufgetrennt (5).
Strachan T, Read AP: Human Molecular Genetics. 3rd
Jede der vier Bahnen repräsentiert eine der vier ed. Garland Science London-New York, 2004.
Basen G, A, T, oder C. Das kleinste Fragment
wandert in der Elektrophorese am weitesten,
das nächstgrößere ein Stückchen weniger weit,
etc. Man liest die Sequenz in entgegengesetzter
DNA-Sequenzierung 45

3' 5'
G A T T A C G C A T C A T
1. zu sequenzierende DNA 1. zu sequenzierende DNA

3' 5'
T A G T C G C A G T A C C G TA Primer

2. markierter Einzelstrang 2. Beginn der Synthese Synthese


(markierte DNA)
Dimethylsulfat
CH3
G G G G T
3' 5'
CH3 A
G G G G T
CH3
3' 5'
A
G G G G
T
CH3 3' 5'
A
G G G G
(gleiche basenspezifische Reaktionen für C, G, und A)

3. teilweise gespalten Piperidin 3. Abbruch bei A

DNA-Polymerase I,
dATP, dTTP, dGTP, dCTP

ddGTP ddATP ddTTP ddCTP


4. markierte Fragmente
1 2 3 4

G G+A T+C C
5. Vier Reaktionsgefäße GA T C 4. Vier parallele Reaktionen
G A T C
G
Wanderung

Wanderung

A
T A
G
C T
C T
A
T A
G C
A
C G
G
Leserichtung

C
Leserichtung

C
T A
G T
A
T C
6. Gel-Elektrophorese (Sequenzier-Gel)
5. Visualisierung der Sequenz durch
TAG T C G C AG TAC C G TA
Polyacrylamid-Gel-Elektrophorese
7. Sequenz ermittelt und Autoradiographie
A. Sequenzierung durch chem. Degradation B. Sequenzierung durch Kettenabbruch
46 Molekulare Grundlagen

Automatisierte DNA-Sequenzierung tids wird durch Dideoxynukleotide (ddNTP) be-


wirkt (s. S. 44). Da jedes dNTP spezifisch fluo-
Die Sequenzierung langer Abschnitte von DNA,
reszenzmarkiert ist, kann ihre Sequenz an einer
insbesondere eines ganzen Genoms, erfordert
entsprechenden Farbsequenz erkannt werden.
die Anwendung automatisierter Verfahren.
Hier ist ddATP grün, ddCTP blau, ddGTP orange
Diese wurden in den 80er Jahren entwickelt
und ddTTP rot fluoreszierend (1). Überall, wo in
und sind heute die Grundlage für zahlreiche auf
die neue DNA-Kette ein ddATP eingebaut wird,
dem Markt erhältliche DNA-Sequenziergeräte.
führt dies zum Kettenabbruch an einem Adenin
Sie basieren auf basenspezifischer Fluoreszenz-
(A) und löst im Detektor eine durch Laser indu-
Markierung und entsprechenden Erkennungs-
zierte grüne Fluoreszenz aus (2). In den Se-
systemen. Dabei wird die Fluoreszenz-Markie-
quenzierkapillaren wird die Sequenz automa-
rung direkt oder indirekt verwendet. Direkte
tisch abgelesen (3), computerisiert aufgezeich-
fluoreszenzmarkierte Moleküle werden als Flu-
net und anschließend als Serie von farbig mar-
orophore bezeichnet. Dies sind Moleküle, die
kierten Peaks sichtbar gemacht (4). Ihre Ab-
bei Exposition durch ultraviolettes Licht einer
folge entspricht der DNA-Sequenz. Die Peaks
spezifischen Wellenlänge bestimmte sichtbare
für G sind schwarz anstatt orange ausgedruckt.
Farben ausstrahlen. Bei der DNA-Sequenzie-
Moderne Sequenzgeräte können in 96 Kanälen
rung verwendete Fluorophore sind z. B. Fluo-
96 Sequenzen in etwa zwei Stunden analysie-
rescein, das eine blasse grüne Farbe bei Exposi-
ren, das sind mehrere tausend Basenpaare pro
tion mit UV-Licht von 494 nm abgibt. Andere
Tag. (Abb. nach Brown, 2007; Strachan & Read,
Fluorochrome sind Rhodamin (rot bei 555 nm)
2004; Abb. in 5 von D. Lohmann, Essen)
oder Aminomethylcumarinsäure (blau bei
399 nm). Eine Kombination verschiedener B. Thermalzyklus-Sequenzierung
Fluorochrome resultiert in einer vierten Farbe.
Dieses Verfahren hat zwei Vorteile. Es kann
Auf diese Weise kann jede der vier DNA-Nukle-
doppelsträngige DNA anstatt einzelsträngiger
otidbasen spezifisch und unterschiedlich ge-
verwendet werden. Deshalb wird sehr wenig
färbt werden. Andere Verfahren beruhen auf
DNA als Vorlage für eine Neusynthese benötigt,
PCR-amplifizierten Produkten (Thermalzyklus-
so dass die Ausgangs-DNA nicht kloniert wer-
Sequenzierung, s. Teil B). Bei der Pyro-Sequen-
den muss. Die zu sequenzierende DNA wird
zierung wird die Reihenfolge der vier Dideo-
amplifiziert. Die Reaktion wird ähnlich durch-
xynukleotid-Triphosphate (dNTPs, d. h. dATP,
geführt wie bei der Amplifizierung mittels PCR
dTTP, dCTP und dGTP) in einem neu syntheti-
(vgl. S. 42). Abweichend wird jedoch nur ein
sierten DNA-Strang mittels chemisch induzier-
Primer verwendet (bei größeren Fragmenten
ter Illumineszenz durch Freisetzung des Pyro-
von etwas mehr als 750 bp werden interne
phosphat des dNTP festgestellt. Dieses Verfah-
Primer benötigt, 1). Jede Reaktion enthält ein
ren hat den Vorteil, dass keine Elektrophorese
Dideoxynukleotid (ddNTP), um die Reaktion
oder eine andere Form der Fragmenttrennung
basenspezifisch zu beenden (2). Dadurch ent-
erforderlich ist. Hier wird das Prinzip der auto-
steht eine Ansammlung von Fragmenten unter-
matisierten DNA-Sequenzierung (A) und das
schiedlicher Größe, die von der Position des
der Thermal-Sequenzierung (B) gezeigt. Gänz-
jeweiligen Nukleotids bestimmt wird (3). Da-
lich neue, automatisierte Sequenzierverfahren
raus kann nach zahlreichen Zyklen, elektropho-
mit hoher Kapazität existieren (hier nicht ge-
retischer Auftrennung und Identifizierung ihre
zeigt).
Sequenz ermittelt werden (4).

A. Automatisierte DNA-Sequenzierung Brown TA: Genomes. 3rd ed. Garland Science, New
(Prinzip) York, 2007.
Margulies M et al: Genome sequencing in microfabri-
Sie erfordert vier Fluorophore, eins für jede der cated high-density picolitre reactors. Nature 337:
vier DNA-Nukleotidbasen. Das von ihnen aus- 376-380, 2005.
Shendure J et al: Accurate multiplex polony sequen-
gehende Fluoreszenzsignal wird an einem fi-
cing of an evolved bacterial genome. Science 309:
xierten Punkt registriert, wenn die DNA-Frag- 1728-1732, 2005.
mente im Mikrobereich durch eine Kapillare Strachan T, Read AP: Human Molecular Genetics. 3rd
wandern. Der Abbruch der DNA-Synthese ed. Garland Science London-New York, 2004.
durch die Anwesenheit des jeweiligen Nukleo-
Automatisierte DNA-Sequenzierung 47

ddATP ddCTP ddGTP ddTTP


1. ddNTPs markiert mit verschiedenen fluoreszierenden Farbstoffen

C
A
G
C
A
G
T
2. Sequenzier-Reaktionen 3. Kapillaren, die Sequenziergel
mit NTPs enthalten

60 70 80 90 100

Laser
Detektor 5. Automatisierter Ausdruck der Sequenz
4. Detektionsystem

A. Automatisierte DNA-Sequenzierung (Prinzip)

Vektor-DNA zu sequenzierende DNA Vektor-DNA


3' 5'

1.
universeller Primer
interne Primer

2. Verschiedene Typen von Primern für die Sequenzierung durch Kettenabbruch

Template-DNA
(Doppelstrang)

Dideoxynukleotide
3. Thermal-Zyklus-Sequenzierung hinzufügen (hier ddATP)

ddA
dasselbe mit
ddA anderen ddNTPs

ddA
4. Abgebrochene DNA-Stränge viele Zyklen, Elektrophorese, Identifizierung

B. Thermal-Zyklus-Sequenzierung
48 Molekulare Grundlagen

Southern-Blot-Hybridisierung B. Restriktionsfragment-
Die Southern-Blot-Hybridisierung ist ein 1975
Längenpolymorphismus
von E. M. Southern, Edinburgh, entwickeltes Restriktionsfragment-Längenpolymorphismus
Verfahren, mit dem DNA-Fragmente aus einem (RFLP) ist ein auf individuellen Unterschieden
Gemisch verschiedener anderer Fragmente von spezifischen DNA-Fragmenten beruhender
identifiziert und isoliert werden können. Man DNA-Polymorphismus (s. S. 50). Diese individu-
verwendet einen kurzen, radioaktiv markierten ellen Unterschiede in der DNA-Basensequenz
Abschnitt einzelsträngiger DNA (DNA-Sonde) führen bei einzelnen Individuen zu einer unter-
um komplementäre DNA-Fragmente zu finden. schiedlichen Verteilung der Restriktions-Erken-
Mit Varianten der Methode kann RNA durch nungssequenzen. An- oder Abwesenheit resul-
Northern-Blot-Hybridisierung (Wortspiel auf tiert in DNA-Fragmenten unterschiedlicher
Southern-Blot) und Proteine durch Immunob- Größe. Dies kann dazu verwendet werden, die
lot (Western-Blot) identifiziert werden. elterliche Herkunft eines entsprechenden DNA-
Abschnitts festzustellen.
A. Prinzip der Methode Etwa alle 100 Basenpaare unterscheidet sich
Ausgangspunkt der Analyse ist Gesamt-DNA die Nukleotidsequenz eines DNA-Abschnitts
aus weißen Blutzellen (1). Die DNA wird iso- verschiedener Individuen (DNA-Polymorphis-
liert und mit einem Restriktionsenzym gespal- mus). Deshalb kann die Erkennungssequenz ei-
ten (2). In einem dieser zunächst noch nicht nes Restriktionsenzyms auf einem der homolo-
identifizierten Fragmente befindet sich das ge- gen Chromosomen vorhanden sein, auf dem
suchte Gen oder Teil des Gens. In einem elektri- anderen aber nicht. In diesem Fall unterschei-
schen Feld (Elektrophorese) werden die Frag- den sich die Größen der jeweiligen Restrikti-
mente in einem Gel (meist Agarose) nach onsfragmente. In dem gezeigten Beispiel hat
Größe sortiert (3). Je kleiner ein Fragment, Allel 1 (links) in dem von der Sonde durch Sou-
desto rascher läuft es, je größer, desto langsa- thernblot-Hybridsierung erkannten Bereich
mer. Dann folgt der eigentliche Southern-Blot: eine polymorphe Schnittstelle, die Allel 2
die im Gel enthaltenen DNA-Fragmente wer- (rechts) nicht hat. Nach Spaltung mit einem
den auf eine Membran aus Nitrocellulose oder Restriktionsenzym entstehen bei Allel 1 zwei
Nylon übertragen (geblottet 4). Dort wird die Fragmente von ca. 2000 und 3000 Basenpaaren
DNA mit Alkali denaturiert (einsträngig ge- (2 und 3 kb). Bei Allel 2 entsteht ein Fragment
macht) und unter Einwirkung mäßiger Hitze von 5 kb. Für jedes Individuum kann unter-
(ca. 80 °C) oder UV-Vernetzung auf der Mem- schieden werden, ob zwei Allele 1 (1-1 homo-
bran fixiert. Anschließend wird mit einer Sonde zygot), zwei Allele 2 (2-2 homozygot) oder je
aus komplementärer einsträngiger DNA (geno- ein Allel 1 und Allel 2 (1-2 heterozygot) vorlie-
mische DNA oder cDNA aus dem Gen) inkubiert gen. Wenn man weiß, dass eine krankheitsaus-
(5). Die Sonde hybridisiert nur mit dem gesuch- lösende Mutation nahe der polymorphen
ten, komplementären Fragment, nicht mit an- Schnittstelle liegt, so kann man durch Vergleich
deren. Da die Sonde markiert ist (meist radio- von erkrankten und nicht erkrankten Familie-
aktiv 32P, aber unter bestimmten Voraussetzun- mitgliedern feststellen, wer die Mutation trägt
gen auch nicht-radioaktiv markiert), kann das und wer nicht (vgl. S. 342). Heute werden meis-
gesuchte Fragment mit einem auf die Membran tens andere, einfacher durchzuführende, auf
gelegten Röntgenfilm identifiziert werden, wo PCR (S. 42) beruhende Verfahren für solche Fra-
es nach Entwicklung des Films (Autoradio- gestellungen verwendet.
gramm) als schwarze Bande erscheint (6). Die
Botstein D et al: Construction of a genetic linkage map
der Position entsprechende Größe wird bei der in man using restriction fragment length plymor-
Elektrophorese durch mitgelaufene DNA-Frag- phism. Am J Hum Genet 32: 314-331, 1980.
mente bekannter Größe bestimmt. Brown TA: Genomes. 3rd ed. Garland Science, New
York, 2007.
Housman, D.: Human DNA polymorphism. New Engl. J.
Med. 332: 318-320, 1995.
Strachan T. Read AP: Human Molecular Genetics. 3rd
ed. Garland Science London-New York, 2004.
Southern-Blot-Hybridisierung 49

Wanderung

große
Fragmente

kleine
Fragmente
gesuchtes Gen

2. Verdauung mit
1. Gesamt-DNA 2. Restriktionsenzym 3. Gelelektrophorese

Gel

Sonde hybridisiert nur


mit komplementären Hybridisierung markierte DNA-Sonde
DNA-Fragmenten

6. Entwickelter Röntgenfilm; 5. Hybridisierung der 4. Denaturieren und


identifiziert Fragmente, markierten Ziel-DNA mit Transfer auf Nylon
die mit der Sonde hybridi- komplementärer DNA. Membran
sieren Röntgenfilm
A. Southern-Blot-Hybridisierung

polymorphe Stelle Allel 2


Allel 1
3 kb 2 kb 5 kb

Sonde Sonde
3 kb 2 kb 5 kb

zwei Fragmente ein Fragment


Person mit einem Allel 1
Person mit zwei Allelen 1 und einem Allel 2 Person mit zwei Allelen 2

5 kb 5 kb

3 kb 3 kb
2 kb 2 kb

1–1 1–2 2–2


homozygot heterozygot homozygot
B. Restriktionsfragment-Längenpolymorphismus (RFLP)
50 Veränderungen in DNA und Genen

DNA-Polymorphismus C. Genetische Variabilität


Die Sequenz der DNA-Nukleotidbasen ist nicht Dieses Schema zeigt ein Beispiel für die hohe
bei allen Menschen gleich. Es gibt in bestimm- Variabilität entlang eines 100000 Basenpaare
ten Abständen individuelle Unterschiede in der langen Abschnitts. (Abb. nach Cichon et al,
Abfolge. Diese sind das Ergebnis eines in frühe- 2002)
ren Generationen oder neu aufgetretenen Aus-
tausch von einer oder mehreren Nukleotidba-
D. CEPH-Familien
sen. Es gibt verschiedene Typen von Unter- DNA von Familienmitgliedern über drei Gene-
schieden, die unter dem Begriff DNA-Polymor- rationen und großen Familien mit mindestens
phismus zusammengefasst werden. acht Kindern steht am Centre Jean Dausset in
Paris zur Verfügung (ursprünglich Centre pour
A. Einzel-Nukleotid-Polymorphismus l’Etude du Polymorphisme Humain, CEPH).
(SNP) Jede CEPH-Familie besteht aus vier Großeltern,
Bei dieser Form betrifft der Unterschied eine zwei Eltern und acht Kindern. Die vier großel-
einzelne Nukleotidbase (Single Nucleotide Po- terlichen Allele im Stammbaum links oben
lymorphism, SNP). Zum Beispiel kann an einer wurden als A und B (beim Großvater) und C
gegebenen Stelle ein Adenin (A) oder ein Gua- und D (bei der Großmutter) bezeichnet. In dem
nin (G) vorliegen. Für jedes Individuum gibt es gezeigten Beispiel unterscheiden sie sich durch
für die homolgen Chromosomenpaare drei unterschiedlich große DNA-Fragmente am un-
mögliche Varianten: zwei A, je ein A und ein G, tersuchten polymorphen Locus. Allel A ent-
oder zwei G. Man kann innerhalb einer Familie spricht dem größten Fragment und wandert in
ermitteln, von welchem der beiden Eltern ein der schematisch gezeigten Gel-Elektrophorese
Kind die bei ihm vorlegende Konstellation ge- am langsamsten und liegt deshalb am weites-
erbt hat. Mehr als 3 Millionen SNPs sind im Ge- ten oben nahe des Startpunkts, B ist etwas klei-
nom des Menschen im Rahmen des Internatio- ner, C noch kleiner und D am kleinsten. Diese
nal HapMap (Haplotyp Map) Projekts kartiert Unterschiede erlauben eine präzise Festlegung
worden. SNPs haben Bedeutung für die Erken- des Genotyps jedes Individuums in dieser Fa-
nung von Regionen im Genom des Menschen, milie.
die mit einer Prädisposition von Krankheiten
Cichon S, Freudenberg J, Propping P, Nöthen MM: Vari-
assoziiert sind. abilität im menschlichen Genom. Dtsch Ärztebl 99:
A3091-A3101, 2002.
B. SNP, Mikrosateliten, Minisatelliten Brown TA: Genomes 3rd ed. Bios Scientific Publ. Oxford,
Dies sind die drei wesentlichen Typen von 2007.
Hinds, DA et al: Whole genome patterns of common
DNA-Polymorphismen. Ein SNP betrifft nur ein DNA variation in three human populations. Science
Basenpaar. Die anderen sind kurze oder längere 307:1072-1079. 2005.
Wiederholungen von tandem-artig wiederhol- Strachan T, Read AP: Human Molecular Genetics. 3rd
ten Sequenzen (variable Anzahl von Kopievari- ed. Garland Science London-New York, 2004.
The International HapMap Consortium. A second gene-
ationen). Eine häufige Form sind einfache Tan- ration human haplotype map of over 3.1 million
dem-Wiederholungen (Short Tandem Repeats, SNPs. Nature 449, 851-861. 2007.
STR), z. B. eine dreifache Wiederholung der bei-
den Basen Cytosin und Adenin, CACACA, in ei-
nem Allel (hier als Allel 1 bezeichnet) und fünf-
fache Wiederholung, CACACACACA, in dem an-
deren Allel (hier Allel 2). Diese Art von Poly-
morphismus wird als Mikrosatellit bezeichnet.
Bei einer größeren Anzahl von Tandem-Wie-
derholungen (Repeats) von 20–200 Basenpaa-
ren (bp) spricht man von Minisatelliten oder
variabler Zahl von Tandem-Wiederholungen
(VNTR, Variable Number Tandem Repeats).
(Abb nach Cichon et al, 2002)
DNA-Polymorphismus 51

1 2 3

TGGATCATGTCTA AATCAGCACACACACAGCAGAG CCGGGTTTAGAGATCCAGGGTTAGAGATCCAGGGCACTTT


A A A G G G
SNP Mikrosatellit Minisatellit

TGGATCGTGTCTA AATCAGCACACACACACACAGCAGAG CCGGGTTTAGAGATCCAGGGCACTTT


väterliches mütterliches
Chromosom Chromosom

A. Einzel-Nukleotid
Polymorphismus (SNP) B. SNP, Mikrosatellit, Minisatellit

100 000 bp

DNA-Strang

Mikrosatelliten

SNPs

C. Genetische Variabilität

AB CD BC CC

AD BC

Allele BD AB AC AB AB CD BD CD
A
B
C
D

Allele A, B, C, D am Marker-Locus zeigen alle möglichen paarweisen Kombinationen


D. CEPH-Familie
52 Veränderungen in DNA und Genen

Mutationen um die normale Funktion zu gewährleisten)


oder einem dominant negativen Effekt (das
Als man erkannte, dass Veränderungen (Muta-
mutierte Allel übt eine unerwünschte abnorme
tionen) der DNA spontan auftreten (T. H. Mor-
Funktion aus). Bei einer Gain-of-function Mu-
gan, 1910) oder durch Röntgenstrahlen indu-
tation entsteht eine zusätzliche oder neue
ziert werden können (H. J. Muller, 1927), wurde
Funktion mit unerwünschten Auswirkungen.
die Mutationstheorie der Vererbung ein Eck-
Epigenetische Veränderungen beziehen sich
pfeiler der frühen Genetik. Gene wurden als
auf Auswirkungen, die nicht durch eine Verän-
mutationsfähige Einheiten definiert, solange
derung der Basensequenz verursacht werden.
man die DNA-Struktur von Genen nicht kannte.
Als dynamische Mutation wird eine Expansion
Die systematische Analyse von Mutationen ist
von Nukleotid-Wiederholungen im Bereich be-
aus vielen Gründen wichtig. Mutationen verur-
stimmter Gene bezeichnet (s. S. 58).
sachen Erkrankungen, die alle Formen von
Krebs einschließen. Sie können durch Chemi- g Medizinische Relevanz. Mutationen verursa-
kalien und Strahlung ausgelöst werden. chen mehr als 3000 individuell definierte
Krankheiten beim Menschen. Die Instabilität
A. Fehler bei der Replikation von Mikrosatelliten ist ein typisches Merkmal
Voraussetzung für eine fehlerfreie Replikation des erblichen nicht-polypösen Kolonkarzinoms
ist die exakte Erkennung der richtigen, komple- (HNPCC). Mehrere Gene (z. B. auf Chromosom
mentären Nukleotidbase von der DNA-Vorlage 2p15.22 und 3p21.3 lokalisiert) sind bekannt, in
und deren Einbau. Fehler in der Replikation tre- denen instabile Mikrosatelliten zu HNPCC füh-
ten etwa mit einer Häufigkeit von 1 zu 105 auf. ren. Etwa 15 % aller kolorektalen Karzinome,
Diese Mutationsrate wird durch einen Korrek- Magen- und Endometriumkarzinome zeigen
turlesemechanismus (Proofreading) auf etwa 1 diese Mikrosatelliteninstabilität.
zu 107 bis 109 reduziert. In dem gezeigten Bei-
Antonarakis SE, CooperDN: Mutations in human gene-
spiel wird bei der ersten Replikation ein Cyto-
tic disease. Nature and consequences p. 101-128. In:
sin (C) anstatt eines Adenins (A) falsch einge- Rimoin DL, Connor JM, Pyeritz RE, Korf BK, eds:
baut: ein Replikationsfehler. Bleibt dieser Feh- Emery and Rimoin’s Principles and Practice of Me-
ler unentdeckt, so endet die nächste (zweite) dical Genetics, 5th edn. Churchill-Livingstone-Else-
Teilung mit einem mutierten Molekül. Dieses vier, Philadelphia, 2007 (mit Online Zugang über:
www.geneticstext.com).
enthält ein CG-Basenpaar anstelle eines AT- Brown TA: Genomes 3rd ed. Bios Scientific Publ., Ox-
Paares an dieser Position. Diese Mutation wird ford, 2007.
jetzt an alle Tochterzellen weitergegeben (ver- Lewin B: Genes VIII. Pearson-Prentice Hall, New York,
erbt). Upper Saddle River NJ, 2004.
Strachan TA, Read,AP.: Human Molecular Genetics. 3rd
B. Replikationsverschiebung ed. Garland Science, London-New York, 2004.
Vogel F, Rathenberg R: Spontaneous mutation in man.
Bei Replikationsverschiebung (Replication slip- Adv. Hum. Genet. 5: 223-318, 1975.
page) können sich der neu gebildete DNA-
Strang und der bisherige auf Grund von Ähn-
lichkeiten in der Basensequenz gegeneinander
verschieben. Man unterscheidet Verschiebun-
gen nach rückwärts und nach vorwärts. Das Er-
gebnis ist eine Insertion oder eine Deletion.
DNA-Mikrosatelliten können instabil sein und
sich bei der Replikation verschieben.

C. Funktionelle Konsequenzen von


Mutationen
Verschiedene Klassen von Mutationen können
funktionell unterschieden werden: Verlust der
normalen Funktion eines Allels (Loss-of-Func-
tion). Dies kann entweder in Haploinsuffizienz
resultieren (eine normales Allel genügt nicht,
Mutationen 53

Anfangssequenz erste Teilung zweite Teilung


CCTGAGGAG
GGACTCCTC
CCTGAGGAG normal

GGACTCCTC CCTGAGGAG
normal
CCTGAGGAG GGACTCCTC
normal
Mutation
GGACTCCTC
CCTGCGGAG

CCTGCGGAG G G A CG C C T C
mutantes Molekül
GGA C T C C T C
CCTGAGGAG
GGACTCC TC
normal

A. Fehler in der Replikation führen zu einer Mutation

Insertion
5' C A C A C A C A C A C A 3'

Neue DNA 5' CACACACACA 3' 3' G T G T G T G T G T G T 5'

Elternstrang 3' G T G T G T G T G T 5' 3' GTGTGTGTGT 5'


Rückwärtsverschiebung 5' C A C A C A C A C A 3'
Replikation

5' C A C A C A C A C A 3'

Neue DNA 5' C A C A C A C A C A 3' 3' GTGTGTGTGT 5'

Elternstrang 3' GTGTGTGTGT 5' 3' GTGTGTGT 5'


Vorwärtsverschiebung 5' CACACACA 3'
Deletion
B. Replikationsverschiebung

zwei Allele Genetische Mechanismen:


1. Normal
Typ von Veränderung
2. Funktionsverlust
• Rasterverschiebung durch Deletion /Insertion
Haploinsuffizienz • vorzeitiges Stopp-Codon
Dominant negativer • Nonsense-vermittelter mRNA-Abbau
Effekt • Änderung einer Spleißstelle
• Interferenz mit normalem Genprodukt
3. Funktionsgewinn Unerwünschte Überexpression eines Allels
4. Epigenische Veränderung Veränderung in DNA-Methylierungsmuster
5. Dynamische Mutationen Expansion von Trinukleotid-Repeats

C. Funktionelle Konsequenzen von Mutationen


54 Veränderungen in DNA und Genen

Mutationen durch verschiedene und dem Stickstoff des Guanins an Position 9.


Basen-Modifikationen Es resultiert ein depurinierter Zucker. Wird der
Verlust eines Basenpaares nicht rechtzeitig re-
Die meisten Mutationen entstehen spontan pariert (vgl. DNA-Reparatur S. 60), kommt es
ohne erkennbare Ursache. Andererseits kann nach der nächsten Replikation zur Deletion.
eine Mutation durch physikalische oder chemi-
sche Einwirkungen entstehen. Eine chemische C. Alkylierung von Guanin
Modifikation von Nukleotidbasen erfolgt durch Unter Alkylierung versteht man das Einfügen
DNA-reaktive Chemikalien. Solche Substanzen einer Methyl- oder Ethyl-Gruppe in ein Mole-
werden als Mutagene bezeichnet. Sie ändern kül. Bei der Alkylierung des Guanins wird die
die chemische Struktur von Nukleotidbasen, Wasserstoffbrücken-Bindung des Sauerstoff-
entfernen eine Base oder verknüpfen sie falsch. Atoms an Position 6 aufgebrochen und eine
Die wichtigsten Reaktionen sind spontane Oxi- Methyl-Gruppe eingefügt. Dadurch entsteht 6-
dation, Hydrolyse, unkontrollierte Methylie- Methylguanin, das nur zwei Wasserstoff-Brü-
rung, Alkylierung und Folgen der Einwirkung cken bilden kann. Infolgedessen wird bei der
von ultravioletter Strahlung. Replikation an dieser Stelle Thymin anstatt Cy-
A. Deaminierung und Methylierung tosin eingebaut (Cytosin-nach-Thymin-Transi-
tion, C 1 T). Als Ergebnis findet sich im mutier-
Cytosin, Adenin und Guanin enthalten eine ten Tochtermolekül Thymin und nicht Cytosin.
Amino-Gruppe. Wird diese entfernt (deami- Wichtige alkylierende Stoffe sind Ethylnitroso-
niert), so entsteht eine veränderte Base mit ei- Harnstoff (ENU), Ethylmethan-sulfonat (EMS),
nem anderen Basenpaarungsmuster. Salpeter- Dimethylnitrosamin, und N-Methylnitro-N-ni-
säure entfernt typischerweise die Amino- trosoguanin.
Gruppe. Dies geschieht aber auch spontan mit
einer Häufigkeit von 100 Basen pro Genom pro D. Basen-Analogon
Tag (Alberts et al, 2002). Bei der Deaminierung Basen-Analoga sind Purine oder Pyrimidine, die
von Cytosin wird die Amino-Gruppe in Posi- den regulären DNA-Nukleotiden so ähnlich
tion 4 entfernt (1). Das dadurch entstehende sind, dass sie bei der Replikation anstelle der
Molekül ist Uracil (2). Dieses paart jedoch mit richtigen Nukleotidbase eingebaut werden. 5-
Adenin anstatt mit Guanin. Normalerweise Bromodeoxyuridin ist ein Analogon für Thy-
wird diese Veränderung durch die Uracil-DNA- min. Es enthält anstelle der Methyl-Gruppe an
Glycolase repariert. Deaminierung in der RNA Position 5 ein Brom-Atom. Die Anwesenheit
tritt bei der RNA-Editierung auf (s. S. 150). Die des Brom-Atoms verursacht ungenaue oder fal-
Methylierung des Kohlenstoff-Atoms an Posi- sche Basenpaarung.
tion 5 des Cytosins ergibt 5-Methyl-Cytosin,
mit einer Methyl-Gruppe an Position 5 (3). E. UV-induzierte Thymin-Dimere
Durch Deaminierung von 5-Methyl-Cytosin (4) Ultraviolette Strahlung einer Wellenlänge von
entsteht Thymin (ein Sauerstoff-Atom an 260 nm verursacht kovalente Bindungen zwi-
Position 4 anstelle der Amino-Gruppe). Diese schen benachbarten Thymin-Resten an den
Mutation wird nicht repariert, da es sich bei Kohlenstoff-Atomen 5 und 6. Dadurch können
Thymin um eine natürlich vorkommende Base Replikation und Transkription gestört werden.
handelt. Adenin (5) kann zu Hypoxanthin (Abbildungen nach Lewin, 2000)
deaminiert werden (6). Die daraus resultie-
rende Änderung führt dazu, dass bei der Brown TA: Genomes. 3rd ed. Bios Scientific Publ.,
nächsten Replikation ein Cytosin anstelle eines Oxford, 2007.
Lewin B: Genes IX. Jones & Bartlett, Sunderland, MA,
Thymins eingebaut wird.
2008.
B. Depurinierung
Ungefähr 5000 Purinbasen (Adenin und Gua-
nin) gehen in jeder Zelle pro Tag durch thermi-
sche Fluktuationen verloren. Depurination er-
folgt durch die hydrolytische Spaltung der N-
Glycosyl-Bindung zwischen der Deoxyribose
Mutationen durch verschiedene Basen-Modifikationen 55

1 Cytosin 2 Uracil Guanin O6-Methyl-Guanin


NH2 oxidative O O
Deaminierung
N H CH3
C
C H C C C keine
N3 4 CH N CH 6
N Wasserstoff- O N H
5 Deaminierung H N C Brücke C
C
2
1 6 CH C CH H C C
(Nitrosamid) C N 6
O N O N N C N
zum Zucker

H H H N H
Methylierung (effiziente Alkylierung C N
am 5'-Kohlenstoff Reparatur) H
paart mit H N paart mit
Cytosin H Thymin
3 NH2 4 O
C CH3 H C CH3 entstehende DNA-Veränderung: mutant
N 5C Deaminierung N C CH3
C CH C CH CH3 G
O N O N T
H H G G
5-Methylcytosin Thymidin C C
G
entstehende DNA-Veränderung: mutant C
2 4 C. Alkylierung von Guanin
U A
1 G T
C Thymin Adenin
G 5 CH3
3 C T O
G A C H H
HC C N
falsches Basenpaar
N N
Zucker C H N C C N
5 Adenin 6 Hypoxanthin
CH
NH2 O O HC C
H N N
C C Veränderung in ein
N Deaminierung N Basenanalogon Zucker
N C N C
CH CH
HC C HC C
N N N N Br
BrdU Guanin
Zucker Zucker O H
C
HC C O
entstehende DNA-Veränderung: mutant
N N C
5 6 H Zucker C H N
N C
A H C CH
O C C
T T H
N N N
A Zucker
T D. Basenanalogon H

A. Deaminierung und Methylierung UV-Strahlung bildet Thymin-Dimer


mit kovalenten Bindungen und ändert die
O DNA-Struktur. Korrektur durch DNA-Reparatur
1 2
N H O O
N OH
H P CH2 H 3C H 3C
N O N N
N NH2 Thymin
P CH2
O
Depurinierung N O N O
O O
P
H 3C
P N N
Deletion Thymin-
1 2 N O Dimer N O
G Thymin
C C G
normal Verlust von Basen DNA-Zucker-
C Posphat-
führt zu Deletion
nach der nächsten Replikation Gerüst

B. Depurinierung E. UV-Licht-induzierte Thymin-Dimere


56 Veränderungen in DNA und Genen

Transposition unterscheiden, ob sie von direkten Wieder-


holungen (direct repeats, d. h. in gleicher
Transposition ist das Einfügen einer Kopie von
Richtung, 3) oder von umgedrehten Wieder-
DNA-Sequenzen an einer anderen Stelle. Solche
holungen (inverted repeats, d. h. in Gegenrich-
Sequenzen werden als bewegliche Elemente
tung) flankiert werden (4). Die Häufigkeit von
(Transposable Elements) oder Transposons be-
Transposition liegt bei etwa 10–3 bis 10–4 pro
zeichnet. Es existieren verschiedene Klassen
Element pro Generation (Lewin, 2004).
von Transposons mit mehreren Millionen Ex-
emplaren im Genom des Menschen (S. 194). Sie B. Replikative und nicht-replikative
haben in der Evolution eine wesentliche Rolle Transposition
bei Umstrukturierungen des Genoms gespielt.
Bei der replikativen Transposition (1) verbleibt
Transposons können Krankheiten auslösen,
das ursprüngliche Transposon (Tn) an seiner
wenn sie in funktionierende Gene eingefügt
Stelle (Donor) und erzeugt durch Replikation
werden. Drei Beispiele werden im folgenden
eine Kopie von sich selbst. Diese wird an einer
Text dargestellt: Insertionssequenzen (IS),
anderen Stelle (Target-Stelle) in das Wirtsge-
Transposons (Tn) und Transposition von Retro-
nom eingefügt (Empfänger). Auf diese Weise
elementen durch einen RNA-Vektor.
kommt es zu einer Vermehrung der Transpo-
A. Insertionsequenzen (IS) und sons im Genom. Diese Art der Transposition er-
Transposons (Tn) fordert zwei Enzymaktivitäten: eine Transpo-
sase an den Enden des Original-Transposons
Die einfachsten Transposons (Tn) werden als
und eine Resolvase an den Kopien. Bei der
Insertionsequenzen (IS) bezeichnet. Sie sind
nicht-replikativen Transposition (2) wird das
autonome Einheiten, die für ein Protein (Trans-
gesamte Transposon (Donor) direkt an einer
posase) codieren, das für die Transposition be-
anderen Stelle integriert.
nötigt wird. Die Transposition findet an einer
durch die Sequenz im Genom definierten Stelle C. Transposition von Retroelementen
statt (Ziel-DNA, hier 5 Basenpaare als ATGCA
Retrotransposons (mobile Elemente Klasse II)
gezeigt, 1). Bei der Transposition wird die Ziel-
bewegen sich mittels einer RNA-Kopie des Re-
sequenz des Wirtsgenoms verdoppelt (Target
troelements. Darauf folgt Reverse Transkription
Repeat, 2). Da die verdoppelten Target Repeats
bis zur Polyadenin-Sequenz im langen termina-
in der gleichen Richtung angeordnet sind, wer-
len Repeat am 3’-Ende (3’ long terminal repeat,
den sie als kurze direkte Wiederholungen
3’ LTR). Hier werden drei wichtige Klassen von
(short direct repeats) bezeichnet. Die Bezeich-
Transposons bei Säugern gezeigt. Endogene Re-
nung „direkt“ bezieht sich auf zwei durch Du-
troviren (1) sind Sequenzen, die Retroviren äh-
plikation entstandene Sequenzen, welche die
neln, aber keine neuen Zellen infizieren können
gleiche Richtung beibehalten haben. Sie mar-
und auf ein Genom beschränkt sind. Retro-
kieren die Stelle, an der ein Transposon in das
transposons (2) fehlen die LTRs und meist auch
Wirtsgenom eingebaut wird (3).
andere Teile eines Retrovirus. Jedoch enthalten
Die Insertionssequenz (IS) selbst hat umge-
beide Typen Reverse Transkriptase, durch die
drehte Wiederholungen (Inverted Repeats) mit
sie zur unabhängigen Transposition befähigt
einer konstanten Länge von meistens 9 bp, die
sind. Eine dritte Klasse der Transposition durch
an beiden Enden mit den Zielsequenzen ver-
Retroelemente sind verarbeitete Pseudogene
bunden werden. Sie definieren die Enden einer
(processed pseudogenes, 3). Ihnen fehlt Re-
IS und sind so charakteristisch, dass sie als
verse Transkriptase, so dass ihnen keine unab-
Nachweis einer Transposition dienen können.
hängige Transposition möglich ist.
Die Länge einer IS variiert je nach ihrem Typ
zwischen ca. 700–1500 bp (man unterscheidet Brown TA: Genomes, 3rd ed. Bios Scientific Publ.,
verschiedene Typen, IS1, IS2, IS3, IS4, IS10R und Oxford, 2007.
andere). Jedes Transposon enthält eine ein- Lewin B: Genes VIII. Pearson Prentice Hall, 2004.
Strachan T, Read AP: Human Molecular Genetics. 3rd
zelne codierende Region, das Transposase-Gen.
ed. Garland Science London-New York, 2004.
Es codiert für ein Enzym, Transposase, das für
die Integration der mobilen Sequenz verant-
wortlich ist. Man kann Transposons danach
Transposition 57

Wirts-DNA Zielbereich
1 ATGCA
TACGT
Insertionssequenzen (IS)
700 – 1500 bp
Invertierte
Repeats an
beiden Enden
Transposase Gen

Zielbereich Transposase-Gen Zielbereich

2 ATGCA ATGCA
TACGT TACGT

Invertierte Repeats
(4 – 10bp) (9 bp)

Transposon (Tn) mit anderen Genen


3

und direkten Repeats an beiden Enden

mit invertierten Repeats an beiden Enden

A. Insertionssequenzen (IS) und Transposons (Tn)

Donor Empfänger 1 Endogenes Retrovirus


1 Tn Target-Stelle
Reverse
LTR Transkriptase LTR

replikativ

2 Retrotransposon

AAAAAAAA
TTTTTTTT

2 Donor Empfänger

3 Prozessiertes Pseudogen
nicht-replikativ AAAAAA
TTTTTT

kurze Repeats kurze Repeats


im Zielbereich im Zielbereich

B. Replikative und nicht-replikative


Transposition C. Transposition von Retroelementen
58 Veränderungen in DNA und Genen

Trinukleotid-Repeat-Expansion Krankheitsgruppe wird als Polyglutamin-Stö-


rungen bezeichnet.
Eine neue Klasse von Mutationen wurde 1991
Trinukleotid-Krankheiten vom Typ II sind cha-
beim Menschen entdeckt: instabile Mutatio-
rakterisiert durch Expansion von CTG, GAA,
nen. Die Nukleotidbasen-Sequenz ist dabei
GCC oder CGG Trinukleotid-Repeats außerhalb
nicht verändert, aber die Anzahl natürlich vor-
der codierenden Regionen, also in den Introns
kommender tandemartiger Wiederholungen
des betroffenen Gens. Die expandierten Repe-
von meistens drei Nukleotiden (z. B. CAG) ist
ats können am 5’-Ende (z. B. GCC wie beim Fra-
abnormal erhöht (Trinukleotid-Expansion). Die
gilen-X-Syndrom Typ A, FRAXA) oder am 3’-
normale Anzahl dieser Trinukleotide liegt
Ende (z. B. CGG beim Fragilen-X-Syndrom
meistens bei 5–30 Wiederholungen. Wenn sie
Typ E, FRAXE) oder in einem Intron liegen (z. B.
innerhalb oder nahe eines Gens liegen und ihre
CTG bei Friedreichscher Ataxie). Ein kurzer
Anzahl eine bestimmte Schwelle überschreitet,
Überblick dieser Störungen befindet sich auf
verursacht dies eine Reihe von wichtigen
S. 316.
Krankheiten. Trinukleotid-Repeats werden
nach ihrer Lokalisation in Hinblick auf das be- C. Prinzip der Labordiagnostik
teiligte Gen unterschieden. Neben Trinukleo- instabiler Trinukleotid-Repeats
tid-Repeats gibt es auch Repeats von vier (Te-
Bei der Labordiagnostik vergleicht man die
tranukleotide) und mehr Nukleotiden.
Größe der Trinukleotid-Repeats der beiden Al-
A. Verschiedene Typen von lele des zu untersuchenden Gens. Die Darstel-
Trinukleotid-Repeat-Expansion lung zeigt schematisch 11 Testergebnisse; jede
repräsentiert eine untersuchte Person: drei
Zwei Grundtypen von Trinukleotid-Expansion
normale Kontrollpersonen mit normalen Be-
werden unterschieden: sehr lange Widerho-
funden in den Reihen 1–3, drei erkrankte Per-
lungen außerhalb der codierenden Region ei-
sonen in den Reihen 4–6, sowie eine Familie
nes Gens, z. B. in einem Intron mit bis zu 1000-
mit einem erkrankten Vater (Reihe 7), einem
fachen Wiederholungen (1) und moderater An-
erkrankten Sohn (10), der gesunden Mutter (11)
zahl von Wiederholungen (ca. 35–130) in co-
und zwei weiteren gesunden Kindern (Sohn 8
dierenden Bereichen (2). In einer Anfangsphase
und Tochter 9). Ganz links aufgetragen sind die
von nur geringer Repeat-Expansion führt dies
Größenmarker für die Zahl der vorhandenen
oft noch nicht zu klinisch sichtbaren Zeichen
Trinukleotide.
einer Erkrankung. Es stellt aber eine Prädispo-
Es sind jeweils die beiden Allele als ein Band
sition für erhöhte Repeat-Expansion bei den
sichtbar. Bei den erkrankten Personen liegt das
Nachkommen eines Merkmalträgers dar. Dies
Band oberhalb der Grenze im Bereich expan-
wird als Prämutation bezeichnet.
dierter Allele (in der Praxis sind die Banden
B. Erkrankungen durch instabile nicht so eindeutig abgegrenzt, da die Größen
Trinukleotid-Repeats der Repeats von Zelle zu Zelle verschieden
sind).
Durch Expansion von Trinukleotid-Repeats be-
dingte Krankheiten können nach dem Typ des Antonarakis SE, Cooper, DN: Mutations in human ge-
Trinukleotid-Repeats und der Lokalisation im netic disease. Nature and consequences p. 101-128.
betroffenen Gen unterschieden werden. Allen In: Rimoin DL, Connor JM, Pyeritz RE, Korf BK, eds:
Emery and Rimoin’s Principles and Practice of
ist gemeinsam, dass sie das zentrale oder peri- Medical Genetics, 5th edn. Churchill-Livingstone-El-
phere Nervensystem betreffen. Trinukleotid-Er- sevier, Philadelphia, 2007 (mit Online Zugang über:
krankungen vom Typ I sind durch eine CAG-Tri- www.geneticstext.com).
nukleotid-Expansion innerhalb der codieren- Strachan T, Read AP: Human Molecular Genetics. 3rd
ed. Garland Science, London-New York, 2004.
den Region eines Gens charakterisiert. Das für
Glutamin (Gln) codierende Triplet (CAG)
kommt normalerweise 20 Mal hintereinander
vor. Bei einer Erkrankung mit Trinukleotid-Re-
peat-Verlängerung enthält das Protein eine ab-
norm gesteigerte Anzahl von Glutaminen (z. B.
bei Chorea Huntington, vgl. S. 316). Diese
Trinukleotid-Repeat-Expansion 59

Exon Intron Exon Intron Exon Intron


DNA 5' 3'

normale Anzahl an Repeats

abnorme Anzahl an Repeats (Expansion)

1. Sehr große Expansionen von Repeats außerhalb codierender Sequenzen

Exon Intron Exon Intron Exon Intron


DNA 5' 3'

normale Anzahl an Repeats

abnormale Anzahl an Repeats


(Expansion)
2. Moderate Expansion von CAG-Repeats innerhalb codierender Sequenzen

A. Verschiedene Typen von Trinukleotid-Repeat-Expansion

CGG GAA CAG CTG CGG


(Gln)

AUG AUG
start stopp

Exon Intron Exon Intron Exon Intron


FRAXA Friedreichsche Chorea Huntington Myotone FRAXE
Mentale Ataxia Spinale-bulbäre muskuläre Atrophie Dystrophie Mentale
Retardierung Spinocerebelläre Ataxie 1 Retardierung,
andere neurologische Krankheiten andere

B. Erkrankungen durch instabile Trinukleotide

Größen- Drei normale Drei


Marker Kontrollpersonen erkrankte Personen

1 2 3 4 5 6 7 8 9 10 11
90
Expandierte Allele
Anzahl Trinukleotide-Repeats

75

60

45
30
Normal

15

C. Prinzip der Labordiagnose bei unstabiler Trinukleotid-Repeat-Expansion


60 Veränderungen in DNA und Genen

Reparatur von DNA-Schäden bei der Replikation (vgl. S. 24) ist betroffen.
Große DNA-Abschnitte, die auf den Schaden
Sowohl bei Eukaryoten als auch bei Prokaryo-
folgen (in 3’-Richtung des neuen Stranges),
ten existiert ein breites Spektrum an DNA-Re-
können dann nicht mehr repliziert werden. Der
paratur-Genen. Man kann folgende Typen von
nachfolgende Strang ist nicht so stark betroffen,
DNA-Reparatur unterscheiden: 1. Reparatur
weil die Okazaki-Fragmente des neu syntheti-
durch Exzision (es werden beschädigte DNA-
sierten Stranges auch hinter der beschädigten
Stellen entfernt, z. B. Thymin-Dimere), 2. Repa-
Stelle gebildet werden können (als kleine blaue
ratur eines Mismatch vgl. S. 52), 3. Reparatur
Pfeile gezeigt). Jedoch würde ohne Reparatur
UV-induzierter Schäden während der Replika-
eine asymmetrische Replikationsgabel entste-
tion, 4. transkriptionsgebundene Reparatur in
hen. Eine zentrale Rolle spielt das Protein XPV.
aktiven Genen.
Bei durch Mutation inaktiviertem XPV-Protein
A. Nukleotid Exzisions-Reparatur wird die postreplikative Reparatur verhindert.
Dadurch verbleiben nicht replizierte Abschnitte
Ein durch UV-Strahlung beschädigter DNA-
(sog. Error-prone bypass, Fehler-gesteuerte
Strang ist verformt. Dies wird durch ein koope-
Umgehung).
rierendes System verschiedener spezifischer
Proteine erkannt und der Schaden mittels Nu- D. Doppelstrang-Reparatur
kleotid-Exzisions-Reparatur (NER) repariert.
Doppelstrang-Schäden entstehen meist durch
Dazu gehören UvrA-, UvrB- und UvrC-Endonu-
g-Strahlung. Ein wichtiger Reparatur-Weg beim
kleasen bei Prokaryoten bzw. die homologen
Menschen benötigt drei Proteine, die durch die
Proteine XPA, XPB und XPC in menschlichen
Gene ATM, BRCA1 und BRCA2 codiert sind. Ihre
Zellen. Ein aus diesen Proteinen bestehender
Namen leiten sich von den Krankheiten ab, die
Komplex schneidet den beschädigten DNA-
durch Mutationen in einem dieser Gene entste-
Strang jeweils vor und hinter dem Schaden (ca.
hen (s. S. 276 und 278). ATM codiert für eine
12 bis 13 Nukleotide bei Prokaryoten, ca. 27 bis
Protein-Kinase und wird als Reaktion auf einen
29 Nukleotide bei Eukaryoten). Der geschädigte
DNA-Schaden aktiviert (1). Die aktivierte Form
DNA-Strang wird durch einen Exonuklease-
phosphoryliert BRCA1 an den spezifischen Stel-
Protein-Komplex gespalten und entfernt. Durch
len (2). Durch homologe Rekombination in Ko-
DNA-Reparatur-Synthese wird das fehlende
operation mit BRCA2 und mRAD51 (das Säuge-
Stück ersetzt und die Lücke durch eine DNA-Li-
tier-Homolog des RecA-Reparatur-Proteins bei
gase geschlossen (der tatsächlich ablaufende
E. coli) wird RAD2 induziert und der DNA-Dop-
Vorgang ist komplexer als hier gezeigt).
pelstrang-Bruch repariert (3). Das phosphory-
B. Mismatch-Reparatur lierte BRCA2 kann auch an der Transkription
und der transkriptionsgebundenen DNA-Repa-
Bei der Mismatch-Reparatur (Repair) wird eine
ratur beteiligt sein (4, Abb. nach Ventikaraman,
falsche Basenpaarung (Mismatch) korrigiert.
1999).
Das Mismatch-Reparatur-Protein hMSH2 bindet
an die falsch gepaarte Base. Weitere Proteine g Medizinische Relevanz. Zahlreiche verschie-
spalten und entfernen den die falsche Base ent- dene hereditäre Formen von Krebserkrankun-
haltenden DNA-Strang. Durch DNA-Synthese gen beruhen auf DNA-Reparaturdefekten.
wird der defekte DNA-Strang durch neue DNA
Bootsma D et al: Nucleotide excision repair syndromes:
ersetzt. Prokaryoten benötigen dafür drei Repa-
Xeroderma pigmentosum. Cockayne syndrome, and
ratur-Proteine, MutH, MutL und MutS. Ihre Ho- trichothiodystrophy, p. 211-237. In: The Genetic Ba-
mologe beim Menschen sind hMSH1, hMLH1 sis of Human Cancer, B Vogelstein & KW Kinzler,
und hMSH1. Mutationen in einem dieser Gene editors, 2nd ed. McGraw-Hill, New York, 2002.
führen durch den Defekt des Mismatch-Repara- D’Andrea ADD, Grompe M: The Fanconi anaemia/BRCA
pathway. Nature Rev Cancer 3: 23-34, 2003.
tur-Systems zu bestimmten Formen von Krebs O’Driscoll M , Jeggo PA: The roe of double-strand break
(z. B. Nicht-polypöses Kolonkarzinom). repair – imsights from human genetics. Nature Rev
Genet 7: 45-54, 2006.
C. Replikationsreparatur Ventikaraman AR: Breast cancer genes and DNA repair.
Science 286: 1100-1101, 1999.
DNA-Schäden stören die Replikation und Tran- Wood RD et al.: Human repair genes. Science 291:
skription. Insbesondere der führende Strang 1284-1289, 2002.
Reparatur von DNA-Schäden 61

5' 3' geschädigte Replikation Schaden durch TT-Dimer


DNA 3'
3' 5' repariert durch führender
5'
XPA-G Strang
UV
geschädigte DNA
5' DNA-
3'
Replikation
blockiert
Schaden

UvrABC/XPABC erkennt Reparatur 3' nach-


geschädigte DNA und durch XPV 5' folgender
schneidet DNA Strang

repariert,
Synthese
Entfernung des ge- fortgesetzt
schädigten Stranges

neue DNA
XPV-Mutation
nicht
replizierte
DNA,
Exzisions- langer
Nuklease-Komplex Abschnitt

Ligase schließt Lücke kurz

Fehler-erzeugende Reparatur,
Mutagenese, Karzinogenese

A. Exzisionsreparatur (Schema) C. Replikationsreparatur UV-geschädigter DNA

Mismatch neuer Strang Transkriptionsregulation


5' T 3'

3' G 5'
DNA
alter Strang RNA-Polymerase II
RNA
MutS/hMSH2
bindet an falsch gepaarte BRCA1
Basenpaare
T phosphoryliert 4
2
P P P
G
BRCA1 BRCA2
DNA gespalten, Strang
MutL/hMLH1 mit falschem T RAD51
MutH/hMSH1 ATM-Kinase
entfernt 1 Aktivierung
3
T
Doppelstrang bricht RAD2
G

DNA-Synthese durch
DNA-Polymerase III
reparierter
homologe DNA-Reparatur homologe
Strang
DNA-Stränge durch homologe Reparatur
C Rekombination
G
D. Doppelstrang-Reparatur durch homologe
B. Mismatch-Reparatur (Schema) Rekombination
62 Eukaryote Zellen

Zellkommunikation venzellen zahlreiche Funktionen durch chemi-


sche Signale an der Synapse (Neurotransmit-
Multizelluläre Organismen benötigen eine gut
ter). (Abb. modifiziert nach Lodish et al, 2004)
aufeinander abgestimmte Kommunikation
zwischen Zellen. Embryonale Entwicklung mit g Medizinische Relevanz. Mutationen in zahl-
Wachstum und Differenzierung und andere reichen Genen, welche die Funktion von Protei-
zentrale zelluläre Vorgänge werden durch ein nen der Signaltransduktion beeinträchtigen
großes Repertoire von Proteinen gesteuert, die oder aufheben, verursachen eine große Zahl
zell-spezifische Reaktionen (Signal-Transduk- von genetisch bedingten Krankheiten (vgl.
tion) innerhalb von Zellen und zwischen Zellen Jameson, 2005, S. 168 und Tabelle 4–7 im An-
auslösen. hang S. 362–364).

A. Prinzip der Signaltransduktion Alberts B et al: Molecular Biology of the Cell. 5th ed.
Garland Science, New York, 2008.
Signaltransduktion besteht aus aufeinander Jameson JL: Principles of endocrinology, pp. 2067-
folgenden Signalen, die in ihrer Gesamtheit 2075. In: Kasper DL et al, eds: Harrison’s Principles
eine biologisch sinnvolle zelluläre Reaktion of Internal Medicine. 16th ed. McGraw-Hill, New
auslösen. Ein Signalmolekül (der Ligand) bindet York, 2005.
Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
spezifisch an einen extrazellulären Rezeptor. man, New York, 2004.
Das Rezeptormolekül besteht aus einem extra- Mapping Cellular Signalling. Special Issue. Science
zellulären und einem intrazellulären Anteil. Die 296: 1557-1752, 2002.
verschiedenen Anteile werden Domänen ge-
nannt. Der Rezeptor aktiviert ein intrazelluläres
Signalprotein, das seinerseits ein weiteres Sig-
nalprotein aktiviert. Weitere distal gelegene
Signalproteine werden dadurch aktiviert, so
dass eine Serie aufeinander folgender Aktivie-
rungen entsteht (Signalkaskade). Es kommt
auch vor, dass ein zuvor aktives Protein durch
das Signal inaktiviert wird. Am Ende der Signal-
kaskade stehen verschiedene Proteine, die gen-
regulierende oder enzymatische Funktionen
aufweisen und so die gewünschte zelluläre Re-
aktion auslösen. Typischerweise haben extra-
zelluläre Signalmoleküle eine sehr niedrige
Konzentration (ca. 10–8 molar, M).

B. Signale zwischen Zellen


Verschiedene Arten von Signalen zwischen Zel-
len können nach Art der Übertragung unter-
schieden werden. Das Signal kann von einem
membrangebundenen Signalmolekül durch di-
rekten Bindungskontakt an einen Rezeptor der
Zielzelle aufgenommen werden (kontakt-ab-
hängiges Signal, 1). Diese Art von Signaltrans-
duktion ist während der Embryonalentwick-
lung und im Immunsystem verbreitet. Bei para-
krinen Signalen wird das Signalmolekül in den
extrazellulären Raum freigesetzt (2). Viele
Wachstums- und Differenzierungsfaktoren
funktionieren auf diese Weise. Endokrine Si-
gnalgebung durch Hormone (3) wird von spezi-
alisierten Zellen übernommen, den endokrinen
Zellen. Synaptische Signale übernehmen in Ner-
Zellkommunikation 63

Signaltransduktion andere Proteine,


Zielprotein
intrazellulärer
Signal- Teil des
moleküle Rezeptors

Gen
S regulierende
Proteine
extrazellulärer intrazelluläres intrazelluläres
Rezeptor Signal- Signal-
protein 1 protein 2
Enzym

Zell-
membran

A. Prinzip der Signaltransduktion

Signalmolekül
an Membran
gebunden
Nukleus
1. Kontakt-abhängiges
Signal

signalisierende Zelle Zielzelle

2. Parakrine Signale

signalisierende Zelle Zielzelle

Hormone
3. Endokrine Signale

über den
Blutweg
endokrine Zelle Zielzelle

Synapse

4. Synaptische Signale Axon

Neuro-
Nervenzelle trans- Zielzelle
mitter
B. Signale zwischen Zellen
64 Eukaryote Zellen

Hefe: Eukaryote Zellen mit diploider (vgl. S. 68) wird in diploiden Hefezellen bei Glu-
und haploider Phase cose- und Stickstoffmangel initiiert. Durch Spo-
rulation werden vier haploide Sporen gebildet,
Hefen sind einzellige, eukaryote Pilze mit ei- je zwei vom Typ a und zwei vom Typ a.
nem Genom aus linearen Chromosomen, die
innerhalb eines Nukleus liegen. Sie sind ein B. Wechsel des Paarungstyps
Modell für eukaryote Zellen. Etwa 40 verschie- Eine normale haploide Hefezelle wechselt in je-
dene Arten von Hefen sind bekannt. Die Bä- der Generation ihren Paarungstyp. Der Wechsel
cker-Hefe, Saccharomyces cerevisiae, kann sich des Paarungstyps (Paarungstyp-Determinati-
unter guten Ernährungsbedingungen alle 90 onswechsel) wird durch einen von einer HO-
Minuten durch Sprossung (Knospung) teilen. Endonuklease an spezifischer Stelle bewirkten
S. cerevisiae tritt in drei verschiedenen Zellty- Doppelstrang-Bruch der DNA eingeleitet.
pen auf, diploid oder haploid in zwei Zelltypen,
genannt a und a. Die genetischen Mechanis- C. Paarungstyp-Determination
men, die den jeweiligen Zelltyp bestimmen, Drei Genloci in der Nähe des Centromers (cen)
sind ein Modell für die Determination von dif- von Chromosom III regulieren bei S. cerevisiae
ferenzierten Zellen bei höheren Organismen. den Wechsel des Paarungstyps. Der zentrale Lo-
Das haploide Genom von S. cerevisiae besteht cus ist MAT (Paarungstyp-Locus). Er wird von
aus 1,4×107 DNA Basenpaaren in 16 Chromoso- den Loci HMLa (links) und HMRa (rechts) flan-
men und enthält etwa 6200 Gene (Goffeau kiert. Nur der MAT-Locus ist aktiv und wird in
et al., 1996). Die Proteine können folgenden mRNA transkribiert. Zwei „stille“ (silenced, d. h.
Funktionen zugeordnet werden: Transkription inaktive) Kopien von Genen für die entspre-
und Translation 750 (13 %), biochemischer Me- chenden Transkriptionsfaktoren befinden sich
tabolismus 650 (11 %), Aufrechterhaltung der an den beiden Loci HML und HMR. Der Wechsel
Zellstruktur 250 (4 %), DNA-Metabolismus 175 des Paarungstyps wird durch ein Kassettenmo-
(3 %), Energieproduktion und -speicherung 175 dell erklärt. Dabei werden die DNA-Sequenzen
(3 %) und Transport 250 (4 %). Das Genom von am HMLa- oder am HMRa-Locus auf den MAT-
S. cerevisiae ist, im Gegensatz zu anderen euka- Locus übertragen. Befindet sich am MAT-Locus
ryoten Genomen, mit etwa einem Gen pro 2 kb die Sequenz des HMLa-Locus, so erhält die Zelle
DNA sehr kompakt (zum Vergleich: Drosophila die Spezifität a. Befindet sich am MAT-Locus die
ein Gen pro 9 kb, Mensch ein Gen pro 100 kb). Sequenz des HMRa, so entspricht die Zelle dem
A. Der Lebenszyklus von Hefe Typ a. Zugleich wird der jeweils entgegenge-
setzte Paarungstyp unterdrückt. Die bei Hefe
Zwei haploide Hefe-Zellen mit gegensätzlichem beobachtete Stilllegung (Silencing) bestimmter
Paarungstyp können verschmelzen und eine di- Gene findet sich bei vielzelligen eukaryoten Or-
ploide Zelle bilden. Die Paarung wird durch ein ganismen während der Embryonalentwicklung.
kleines, sezerniertes, als Pheromon oder Paa- (Abb. modifiziert nach Lodish et al, 2004)
rungsfaktor genanntes Polypeptid eingeleitet.
Es gibt zwei als a und a bezeichnete Paarungs- g Medizinische Relevanz. Etwa die Hälfte der als
faktoren. Sie werden von einem Oberflächen- defekt bekannten Proteine bei menschlichen
rezeptor auf der Zelle erkannt. Die Bindung des Erbkrankheiten zeigen Ähnlichkeiten mit der
a- bzw. a-Faktors an den Rezeptor löst intrazel- Aminosäure-Sequenz eines Proteins bei Hefe.
lulär eine Abfolge (Kaskade) von Aktivierungen
Bardwell L: A walk-through of the yeast mating phero-
bzw. Inaktivierungen von den Zelltyp determi- mone response pathway. Peptides 25: 1465-1476,
nierenden Genen aus. Zell-Rezeptoren vom 2004.
Typ a binden nur das Pheromon vom Typ a, Botstein D, Chervitz SA, Cherry JM: Yeast as a model or-
Zell-Rezeptoren vom Typ a nur den a-Faktor. ganism. Science 277: 1259-1260, 1997.
Goffeau A et al: Life with 6000 genes. Science 274: 562-
Die Paarung und die darauf folgende Teilung 567, 1996.
durch Mitose (vgl. S. 66) treten jedoch nur unter Haber JE: A locus control region regulates yeast recom-
guten Wachstumsbedingungen ein. Die mitoti- bination. Trends Genet 14: 317-321, 1998.
sche Zellteilung bei S. cerevisiae führt durch Kofahl B, Klipp E: Modelling the dynamics of the yeast
pheromone pathway. Yeast 21: 831-850, 2004.
Knospung zu zwei verschieden großen Tochter-
Lodish H et al: Molecular Cell Biology, 5th ed. WH Free-
zellen. Es fehlt die G2-Phase der Mitose. Meiose man, New York, 2004.
Hefe: Eukaryote Zellen mit diploider und haploider Phase 65

Haploider Haploider
Zyklus Zyklus

a Zelle α Zelle
haploid haploid

S. pombe α-Faktor bindet


a α a-Faktor bindet S. cerevisiae
an a-Rezeptor an α-Rezeptor

S. pombe Paarung
S. cerevisiae
a α a α
Zell-
Zellteilung a α teilung
a α

a α Knospung a α
Diploid (keine G2-Phase)
arretiert in G1-Phase

Sporulation

vier haploide Sporen


a α
A. Lebenszyklus von Hefe mit einer haploiden und einer diploiden Phase

Chromosom III
α Spore still aktiv still
HMLα MATa HMRa

α a a
cen Paarungstyp a
α Knospung
Wechsel

Teilung

Wechsel α α still aktiv still


HMLα MATα HMRα
des
Paarungs-
HO Gen kein α α a
typs Wechsel
kein Wechsel Paarungstyp α
a α (selten) wechselt zu a

Teilung

still aktiv still


HMLα MATa HMRα
α a a α α a a
cen Paarungstyp a
Wechsel Wechsel
B. Paarungstyp-Determinationswechsel C. Kassettenmodell für Paarungstypwechsel
66 Eukaryote Zellen

Zellteilung: Mitose Mitose. Dies gewährleistet die kompakte Form


der Chromosomen während der Mitose. Con-
Fadenähnliche Strukturen in sich teilenden Zel-
densin ist nach neuen Erkenntnissen auch für
len wurden erstmals 1879 von W. Flemming
die Chromosomen in der Interphase wichtig. Es
beobachtet. Er führte die Bezeichnung Mitosis
verhindert den Eintritt in die Mitose, wenn die
für die Teilung von Zellen ein. Auch die longitu-
DNA-Replikation nicht erfolgreich beendet ist,
dinale Teilung von Chromosomen während der
z. B. infolge eines DNA-Schadens (Aono et al.,
Mitose hat Flemming beobachtet. Strasburger
2002).
prägte 1884 die Begriffe Prophase, Metaphase
und Anaphase für die verschiedenen Stadien C. Condensin-Proteine
der Zellteilung. Das Ergebnis einer Mitose sind
Ein Chromosom in der Mitose ist um etwa das
zwei genetisch identische Tochterzellen.
50-fache kürzer als in der Interphase. Der ent-
A. Mitose sprechende Vorgang wird Chromosomenkon-
densation genannt. Verantwortlich dafür ist
Beim Übergang von der Interphase zur Mitose,
eine als Condensine bezeichnete Gruppe von
in der Prophase, werden die Chromosomen als
Proteinen. Sie sind entlang eines mitotischen
längliche Fäden von 3–7 mm Länge im Licht-
Chromosoms lokalisiert. Cohesine sind ver-
mikroskop (vgl. S. 112) sichtbar. Jedes Chromo-
wandte Proteine. Sie halten die Schwesterchro-
som erscheint in der frühen Prophase als Dop-
matiden bis zur Anaphase zusammen.
pelstruktur (Schwesterchromatiden). Dies ist
das Resultat der zuvor abgelaufenen DNA-Syn- g Medizinische Relevanz. Eine Mutation in ei-
these. Die Chromosomen werden während der nem der fünf Gene, die für die Untereinheiten
späten Prophase durch Kontraktion dicker und von Condensin codieren, resultiert in einem
kürzer (chromosomale Kondensation). In der schweren Wachstums- und Fehlbildungssyn-
späten Prophase verschwindet die Kernmem- drom, Roberts-Syndrom (OMIM 268300; Vega
bran und die Metaphase beginnt. Zu diesem et al, 2005). Mutationen in einem an der chro-
Zeitpunkt wird die Mitosespindel als dünne Fä- mosomensegregation des mitotischen Spindel-
den sichtbar. Sie bildet sich an zwei polartigen apparates beteiligten Proteins, Pericentrin
Strukturen (Centriolen) aus. Die Chromosomen (auch Kendrin genannt, OMIM 605925), verur-
ordnen sich in der Äquatorialebene an, es fin- sachen eine schwere Kleinwuchs-Krankheit mit
det jedoch keine Paarung von homologen Chro- Mikrozephalie (Rauch et al, 2008).
mosomen statt. In der späten Metaphase, beim
Aono N, et al: Cnd2 has dual roles in mitotic condensa-
Übergang in die Anaphase, teilen sich die Chro-
tion and interphase. Nature 417: 197-202, 2002.
mosomen auch im Bereich des Centromers. Je Karsenti E, Vernos I: The mitotic spindle: A self-made
ein Chromatid wandert zum entgegengesetzten machine. Science 294: 543-547, 2001.
Pol. Dies leitet die Telophase ein. Sie beginnt Lewin B: Chromosomes IX. Jones & Bartlett, Sudbury,
mit der Bildung einer Kernmembran. Dann teilt Maryland, 2008.
Nurse P: The incredible life and times of biological
sich auch das Cytoplasma (Cytokinese). In der cells. Science 289: 1711-1716, 2000.
Interphase sind die Chromosomen als Chroma- Rauch A et al: Mutations in the pericentrin (PCNT)
tin bezeichnete (Flemming 1879), mit Kern- gene cause primordial dwarfism. Science 319: 816-
farbstoffen anfärbbare Strukturen im Zellkern. 819, 2008.
Vega H et al: Roberts syndrome is caused by mutations
B. Metaphase-Chromosom in ESCO2, a human homolog of yeast ECO1 that is
essential for establishment of sister chromatid co-
Für die in die Mitose sichtbaren gut anfärbba- hesion. Nature Genet 37: 468-470, 2005.
ren fädigen Strukturen prägte Waldeyer (1888) Strunnikov AV: Condensin and the biological role of
chromosome condensation. Progr Cell Cycle Res 5:
den Begriff Chromosom. Ein Metaphase-Chro-
361-367, 2003.
mosom besteht aus zwei Chromatiden, zwei
Chromosomenarmen, einem Telomer an bei-
den Enden, sowie dem Centromer, an dem die
beiden Schwesterchromatiden zusammenhän-
gen. Der Ansatzpunkt der Mitosespindel ist das
Kinetochor. Condensin-Proteine bilden einen
Komplex aus fünf Untereinheiten während der
Zellteilung: Mitose 67

diploide Zelle mitotische Zellen


Plasmamembran

Kernmembran

homologes
Chromosomen-
paar
(in der Interphase
nicht sichtbar)
Interphase Prophase
Chromosomen Chromosomen
verdoppelt verdickt
(Schwester- und verkürzt
chromatiden)

Zentriole
Mitose-
spindel

Anaphase Metaphase
Chromosomen
in Äquatorial-
ebene
angeordnet

Chromatid

Telomer

Telophase

Cytokinese Zentromer
Kinetochor

B. Metaphase-Chromosom

frühe Chromosom M
Interphase
Condensin M

DNA
replikation

Interphase
(Chromosomen nicht sichtbar) Interphase Mitose

A. Mitose C. Condensin-Proteine
68 Eukaryote Zellen

Meiose in Keimzellen B. Meiose II


Abweichend von der Teilung von Körperzellen Die Meiose II besteht aus einer Längsteilung
findet bei der Bildung von Keimzellen eine be- der verdoppelten Chromosomen (Chromati-
sondere Art der Zellteilung statt. Strasburger den) und einer weiteren Zellteilung. Jede Toch-
führte dafür 1884 die Bezeichnung Meiose (Re- terzelle erhält je ein Chromosom eines Chro-
duktionsteilung oder Reifeteilung) ein. Meiose mosomenpaares und ist deshalb haploid. Durch
unterscheidet sich von der Mitose in zytologi- die in der Prophase I erfolgte Rekombination
scher und genetischer Hinsicht grundlegend. unterscheiden sich die Chromosomen der re-
Erstens, es paaren sich homologe Chromoso- sultierenden haploiden Zellen von den Chro-
men. Zweitens, es kommt zwischen homologen mosomen der Ausgangszelle.
Chromosomenpaaren regelmäßig zu einem In einigen Abschnitten ist durch den Austausch
Austausch (Crossing-over). Dies resultiert in zwischen homologen Chromosomen eine neu-
Chromosomenabschnitten mit neuer Zusam- artige Zusammensetzung entstanden. Deshalb
mensetzung (genetische Rekombination). Drit- sind die Tochterzellen im Gegensatz zur Mitose
tens, der Chromosomensatz wird halbiert. Des- mit der Ausgangszelle genetisch nicht iden-
halb sind die aus dieser Teilung entstehenden tisch. Auf jedem Chromosom kann man rekom-
Tochterzellen haploid (Reduktionsteilung). binante und nicht-rekombinante Abschnitte
Die Meiose ist zellulär und biochemisch ein unterscheiden. Die dafür relevanten geneti-
komplexer Vorgang. Der zytologisch beobacht- schen Vorgänge spielen sich in der Prophase
bare Ablauf der Meiose und die zugrunde lie- der Meiose I ab (vgl. S. 70).
genden genetischen Ereignisse korrespondie- Die Verteilung der Chromosomen in der Meiose
ren zeitlich nicht genau. Der jeweilige geneti- erklärt die Segregation (Trennung oder Auf-
sche Vorgang ist meist erst in einer darauf fol- spaltung) von Merkmalen gemäß den Mendel-
genden Phase zytologisch manifest. schen Gesetzmäßigkeiten (1 : 1 Aufspaltung,
vgl. S. 90).
A. Meiose I Rekombination ist der auffälligste Vorgang bei
Eine vollständige Meiose besteht aus zwei Zell- der Meiose mit komplexen molekularen Me-
teilungen, Meiose I und Meiose II. Die relevan- chanismen. Jedoch gibt es auch mitotische Re-
ten genetischen Vorgänge (genetische Rekom- kombination, u. a. bei der DNA-Reparatur. Als
bination durch Crossing-over) finden in der Gen-Konversion wird ein einseitiger, nicht rezi-
Meiose I statt. proker Austausch bezeichnet. Dabei geht ein
Die Meiose beginnt mit DNA-Replikation. Zu- Allel zugunsten eines anderen verloren.
nächst werden die Chromosomen in der späten g Medizinische Relevanz. Fehlverteilung (Non-
Interphase nur als fädige Strukturen sichtbar, disjunction) von Chromosomen während einer
wie in der Mitose. Zu Beginn der Prophase I der meiotischen Zellteilungen führt zu falscher
sind die Chromosomen verdoppelt, aber dies ist Chromosomenzahl als Krankheitsursache (z. B.
erst in einer späteren Phase der Prophase I zu Trisomie 21, s. S. 334).
erkennen (vgl. S. 70). Anschließend wird auch
die Paarung der homologen Chromosomen Carpenter ATC: Chiasma function. Cell 77: 959-962,
sichtbar. Dies ermöglicht einen Austausch zwi- 1994.
McKim KS, Hawley RS: Chromosomal control of meio-
schen den Chromosomenpaaren (Crossing-
tic cell division. Science 270: 1595-1601, 1995.
over) durch Aneinanderlagerung von homolo- Moens PB, ed: Meiosis. Academic Press, New York,
gen Chromatiden (Chiasmabildung). 1987.
Das Ergebnis des Crossing-over ist ein Aus- Page SL, Hawley RS: Chromosomes choeography: The
tausch zwischen zwei Chromatiden homologer meiotic ballet. Science 301: 785-789, 2003.
Whitehouse LHK: Towards the Understanding of the
Chromosomen (genetische Rekombination). Mechanism of Heredity. 3rd ed. Edward Arnold,
Dieser Austausch ist beendet, wenn die Zelle in London, 1973.
die Metaphase I eintritt. Durch Wanderung der Zickler D, Kleckner N: Meiotic chromosomes: Inte-
homologen Chromosomen zu entgegengesetz- grating structure and function. Ann Rev Genet 33:
603-754, 1999.
ten Polen wird die Anaphase I eingeleitet.
Meiose in Keimzellen 69

DNA- Chromo- Paarung


Replikation somen homologer
verdoppelt Chromo-
somen
Interphase Prophase I

Austausch
zwischen
homologen
Chromo-
somen-
paaren
(Crossing-
over)
Anaphase I Metaphase I

Tochterzellen

Homologe Paare
in verschiedenen
Zellen

A. Meiose I (ersteTeilung)

Vier haploide Zellen


(Gameten)

rekombinant

B. Meiose II (zweiteTeilung)
70 Eukaryote Zellen

Crossing-over in der Prophase I C. Chiasma


Die Prophase der Meiose I ist komplex, mit Bei der Bildung eines Chiasmas können sich
wichtigen zytologischen und genetischen Vor- verschiedene Chromatiden eines homologen
gängen. In dieser Phase kommt es regelmäßig Chromosomenpaares aneinander lagern. Die
zu einem Austausch zwischen homologen Chiasmabildung ist die zytologische Vorausset-
Chromosomen durch Crossing-over, einem zung für Crossing-over und ist wichtig für die
1912 von Morgan und Catell eingeführten Be- abschließende Trennung (Segregation) der
griff. Dies resultiert in neu kombinierten Chro- Chromosomen. Das Centromer (Cen) hat eine
mosomenabschnitten (genetische Rekombina- wichtige Funktion für die Paarung von Chromo-
tion, S. 72). somen.

A. Prophase der Meiose I D. Genetische Rekombination durch


Die Prophase der Meiose durchläuft eine Reihe
Crossing-over
von Stadien, die schematisch voneinander ab- Durch Crossing-over entstehen neu kombi-
gegrenzt werden können, auch wenn sie konti- nierte Chromosomenabschnitte (Rekombina-
nuierlich ablaufen. Im Stadium des Leptotän tion). Man kann deshalb rekombinante und
werden Chromosomen erstmals als feine fä- nicht-rekombinante Chromosomenabschnitte
denartige Strukturen sichtbar (es wird nur ein unterscheiden.
Chromosomenpaar schematisch gezeigt). Im
Zygotän sieht man, dass die Chromosomen
E. Pachytän und Diakinese im Photo
paarweise angeordnet sind. Teilweise sind sie Während der Diakinese und des Pachytäns sind
aneinander angelagert (Bildung von Synapsen). die Chromosomen lichtmikroskopisch (a) und
Zu diesem Zeitpunkt ist jedes Chromosom be- elektronenmikroskopisch (b) gut sichtbar. X-
reits verdoppelt und besteht aus zwei Chro- und Y-Chromosom bilden in der männlichen
matiden, die im Centromer zusammengehalten Meiose eine weitgehend ungepaarte XY-Struk-
werden (jedes Chromatid enthält eine DNA- tur (XY Bivalent). Tatsächlich ist ein kurzer Ab-
Doppelhelix). Die durch Synapsen zusammen- schnitt der kurzen Arme im Bereich homologer
hängenden Chromosomen werden als Bivalent Sequenzen gepaart (pseudoautosomale Region,
bezeichnet. Im Stadium des Pachytän sind die vgl. S. 196). In Teil a befindet sich ein nicht ge-
Bivalente verdickt und verkürzt. Im Diplotän paartes zusätzliches Chromosom 21 (roter
trennen sich die beiden homologen Chromoso- Pfeil). (Photographien freundlicherweise von
men, bleiben aber zunächst in einigen Berei- Dr. R. Johannisson, Lübeck, zur Verfügung ge-
chen miteinander verbunden. Spät im Diplotän stellt)
trennt sich jedes Chromosomenpaar weitge-
Alberts B et al: Molecular Biology of the Cell. 5th ed.
hend, vor allem im Bereich des Centromers, bis Garland Science, New York, 2008.
auf eine oder mehrere distal gelegene Kontakt- Johannisson R et al: Down’s syndrome in the male. Re-
stellen (Chiasmata). Im letzten Stadium der productive pathology and meiotic studies. Hum Ge-
Prophase I, der Diakinese sind die Chromoso- net 63: 132-138, 1983.
Kitajima TS et al: Distinct cohesin complexes organize
men weit auseinander gewichen und hängen
meiotic chromosome domains. Science 300: 1152-
nur noch distal zusammen. Die Chiasmata ha- 1155, 2003.
ben sich distal verlagert (Terminalisation). Mit Miller OJ, Therman E: Human Chromosomes. 4th ed.
dem Ende der Diakinese verschwindet die Nu- Springer, Heidelberg-Berlin-New York, 2001.
Whitehouse LHK: Towards the Understanding of the
klearmembran und die Zelle tritt in die Meta-
Mechanism of Heredity. 3rd ed. Edward Arnold, Lon-
phase I ein. don, 1973.

B. Synaptonemaler Komplex
Kurz vor Beginn des Pachytän-Stadiums lagern
sich homologe Chromosomen eng aneinander
und bilden einen synaptonemalen Komplex.
Dies ist die Voraussetzung für Crossing-over
und daraus folgender Rekombination. (Abb.
nach Alberts et al, 2008)
Crossing-over in der Prophase I 71

Leptotän Zygotän Pachytän Diplotän Diakinese


A. Prophase der Meiose I

Chromatid 1
Chromatid 2

Chromatid 3

Chromatid 4

Interphase Leptotän Zygotän Pachytän Diplotän Diakinese


B. Synaptonemaler Komplex

1+3
Chromatid 1
Chromatid 2
Cen
Chromatid 3
Chromatid 4
2+4 2+3
C. Chiasma

A a A A a a A a A a A a A a

B b B B b b B b B b B b B b

C c C C c c C C c c C C c c

D d D D d d D D d d D D d d

E e E E e e E E e e E E e e

D. Genetische Rekombination durch Crossing-over Rekombination

a b

E. Diakinese und Pachytän im Photo


72 Eukaryote Zellen

Rekombination (s. Schritt 2 oben) exakt an der gleichen Stelle


in beiden Doppelhelix-DNA-Molekülen ent-
Genetische Rekombination ist ein Austausch
steht?
zwischen zwei sich entsprechenden DNA-Mo-
lekülen. Durch Rekombination kann genetische B. Rekombination nach Doppelstrang-
Information geändert werden. Z. B. können un- Brüchen
vorteilhafte Mutationen eliminiert und vorteil-
Dieses Modell basiert auf einem initialen Dop-
hafte Mutationen erhalten werden.
pelstrang-Bruch in einem der homologen DNA-
Rekombination muss zwischen zwei sich exakt
Moleküle. Beide Stränge wurden von einer En-
entsprechenden Bereichen stattfinden. Die neu
donuklease gespalten (1). Jeweils am 3’-Ende
kombinierten (rekombinierten) DNA-Stränge
wird die Lücke durch eine Exonuklease vergrö-
müssen ihre Ausgangsstruktur behalten, damit
ßert, welche die 5’-Enden im Bereich des ur-
keine Basenpaare verloren gehen oder hinzuge-
sprünglichen Doppelstrang-Bruchs entfernt (2).
fügt werden. Man kann zwei Modelle der Re-
Eines der freien 3’-Enden verbindet sich mit ei-
kombination unterscheiden: (1) die generali-
nem homologen Strang des anderen Moleküls
sierte oder homologe Rekombination, die bei
(3). Dabei entsteht eine D-Schleife (displace-
Eukaryoten in der Meiose auftritt (s. S. 68), und
ment loop). Diese D-Schleife wird durch Repa-
(2) eine ortsspezifische (site-specific) Rekom-
ratur-Synthese vom 3’-Ende her verlängert, bis
bination, eine komplexe biochemische Reak-
die gesamte Lücke im Empfänger-Molekül ge-
tion zwischen zwei DNA-Doppelsträngen. Die
schlossen ist (4). Der verdrängte Strang verbin-
homologe Rekombination kann durch Bruch in
det sich mit der komplementären homologen
einem DNA-Einzelstrang oder einem DNA-Dop-
Einzelstrang-Sequenz des Empfängerstrangs
pelstranges initiiert werden.
und schließt die Lücke (5). DNA-Reparatur-Syn-
A. Rekombination nach Einzelstrang- these schließt die verbleibende Lücke (6). Die
Bruch Integrität der beiden DNA-Moleküle wird bei
diesem Modell durch zweifache Einzelstrang-
Nach diesem Modell beginnt der Prozess mit
Reparatur-Synthese wiederhergestellt.
einem Bruch an je einem der homologen DNA-
In Gegensatz zum Einzelstrang-Austausch-Mo-
Stränge (dieselbe Sequenz verschiedenen pa-
dell, entsteht beim Doppelstrang-Modell in der
rentalen Ursprungs, 1). Durch ein Einzelstrang
gesamten Region rekombinante Heteroduplex-
spaltendes Enzym (Endonuklease) wird an glei-
DNA (7). Ein offensichtlicher Nachteil ist der
cher Stelle jedes der beiden Moleküle ein
zeitweise Verlust von Information in der Lücke
Strang gespalten (2). Dadurch kann sich das
nach der initialen Spaltung. Der permanente
freie Ende des geöffneten Stranges mit dem
Verlust der Information wird durch die Mög-
freien Ende des anderen Moleküls verbinden
lichkeit der Resynthese vom anderen Duplex
(Einzelstrang-Austausch, 3). Die Rekombinati-
verhindert. (Abbildungen nach Lewin, 2004)
onsstelle bewegt sich anschließend entlang der
beiden Duplexmoleküle (Branch migration, 4). Alberts B et al: Molecular Biology of the Cell. 5th ed.
Dadurch wird ein Abstand zu einem weiteren Garland Publishing, New York, 2008.
Einschnitt in beiden Strängen hergestellt (5). Brown TA: Genomes. 3rd ed. Garland Science, New
York, 2007.
Dies gewährleistet, dass der Austausch zwi-
Holliday R: A mechanism for gene conversion in fungi.
schen der Duplex-DNA (die beiden Stränge ver- Genet Res 5: 282-304, 1964.
schiedener elterlicher Herkunft) stattfindet (6). Kanaar KS et al: Genetic recombination: from competi-
Nach Schließen der Lücke resultiert ein rezi- tion to collaboration. Nature 391: 335-337, 1998.
Lewin B: Genes IX. Jones & Bartlett, Sudbury, Mary-
prok-rekombinantes Molekül (7).
land, 2008.
Rekombinationen, die DNA-Duplexe einschlie-
ßen, erfordern erhebliche topologische (räum-
liche) Veränderungen, z. B. muss das Molekül
frei drehbar sein und anschließend wieder in
die Ausgangsstruktur gebracht werden (Holli-
day-Model, von R. Holliday, 1964). Dieses Mo-
dell hat eine ungelöste Schwierigkeit: Wie wird
sichergestellt, dass der Einzelstrang-Einschnitt
Rekombination 73

1 DNA-Duplex-Paar 1 DNA-Duplex-Paar, Doppelstrangbruch


in einem Molekül
1 1

2 2
ein Elternstrang
3 3

4 4
anderer Elternstrang
2 Einschnitt in homologen Paaren 2 Bruch vergrößert bis zum Gap mit 3'-Enden
1 5' 3'

2 3' 5'

3 5' 3' 5' 3'

4 3' 5' 3' 5'

3 Einzelstrangaustausch 3 3'-Ende des anderen Duplex


1

2
3 D loop
4

4 Branch-Migration 4 DNA-Synthese vom 3'-Ende


1

2
3

5 Einschnitt in anderen Strängen 5 3'-Ende verdrängt einen Strang


1

2
3

6 Crossover zwischen Duplex-DNA 6 DNA-Synthese vom anderem 3'-Ende


1

2
3

7 Reziproke rekombinante Moleküle 7 Reziproker Einzelstrangaustausch


1 3

2 4

3 1

4 2

Heteroduplex DNA Rekombinante Heteroduplex DNA

A. Rekombination initiiert durch B. Rekombination initiiert durch


Einzelstrangbrüche Doppelstrangbrüche
74 Eukaryote Zellen

Bildung der Gameten Im weiblichen Geschlecht findet sowohl in der


Meiose I als auch der Meiose II eine asymmetri-
Die Bildung der Keimzellen (Gameten) findet in
sche Teilung des Cytoplasmas statt. Das Ergeb-
Keimdrüsen (Gonaden) statt. Dies ist im weibli-
nis sind zwei ungleich große Zellen, eine sekun-
chen Geschlecht die Oogenese (Bildung von Ei-
däre Oocyte und eine als Polkörper bezeichnete
zellen) und im männlichen Geschlecht die
kleine Zelle. Durch Teilung der sekundären Oo-
Spermatogenese (Bildung von Spermatozoen).
cyte während der Meiose II entsteht die haplo-
Die während der Embryonalentwicklung in die
ide Eizelle. Wiederum ist die Zellteilung un-
Gonaden eingewanderten primordialen Keim-
gleich: es entsteht nur eine Eizelle und ein wei-
zellen vermehren sich durch mitotische Tei-
teres Polkörper.
lung. Die eigentliche Bildung der Keimzellen
In der sekundären Oocyte besteht jedes Chro-
(Gametogenese) beginnt mit der Meiose. Die in
mosom noch aus zwei Schwesterchromatiden,
der Meiose stattfindenden Zellteilungen unter-
die sich erst in der darauf folgenden Zellteilung
scheiden sich in Ablauf und Ergebnis im weibli-
(Meiose II) trennen. Die Polkörperchen degene-
chen und männlichen Geschlecht.
rieren. Bei den meisten Wirbeltieren wird die
A. Spermatogenese Reifung der sekundären Oocyte in der Meiose II
arretiert. Erst bei der Ovulation wird die sekun-
Durch wiederholte mitotische Zellteilungen
däre Oocyte aus dem Ovar freigegeben und,
entstehen diploide Spermatogonien. Mit Be-
falls Fertilisation eintritt, die Meiose vollstän-
ginn der Pubertät beginnen Zellen mit der Dif-
dig beendet.
ferenzierung in primäre Spermatocyten. Sie be-
Die maximale Anzahl von Keimzellen im Ovar
ginnen mit der ersten meiotischen Zellteilung.
des menschlichen Fetus um den 5. Monat be-
Aus jedem primären Spermatocyt werden nach
trägt 6,8 × 106. Sie ist bei der Geburt auf 2 × 106
Abschluss der Meiose I zwei sekundäre Sperma-
reduziert und beträgt bei der Pubertät nur noch
tocyten, jeder mit einem haploiden Satz dupli-
etwa 200000. Davon kommen etwa 400 zur
zierter Chromosomen. Jedes Chromosom be-
Ovulation.
steht aus zwei Schwesterchromatiden, die im
Verlauf der Meiose II getrennt werden. Jede der g Medizinische Relevanz. Die lange Phase zwi-
beiden sekundären Spermatocyten teilt sich ein schen Meiose I und Ovulation ist vermutlich
zweites Mal (Meiose II). Insgesamt bildet somit ein ursächlicher Faktor für die Fehlverteilung
jeder primäre Spermatocyt vier Spermatiden, homologer Chromosomen bei älteren Müttern.
jeder mit einem haploiden Satz Chromosomen. Oogenese und Spermatogenese unterscheiden
Die Spermatiden differenzieren in reife Sper- sich bezüglich der Zahl der Zellteilungen bis
matozoen. Spermatogenese ist im männlichen zur reifen Keimzelle. Bei der Oogenese treten
Geschlecht ein kontinuierlich ablaufender Vor- etwa 22 Teilungen ein, bei der Spermatogenese
gang. Zwischen Differenzierung in einen pri- etwa 380 Teilungen bei einem Mann von
mären Spermatocyt bei Eintritt in die Meiose I 30 Jahren, 610 bei einem Mann von 40 Jahren.
und der Bildung der reifen Spermatozoen lie- Die etwa 25fach höhere Anzahl von Zellteilun-
gen beim Menschen etwa sechs Wochen. gen mit der entsprechenden Anzahl von DNA-
Replikationen wird als Ursache für die höhere
B. Oogenese Mutationsrate bei der Spermatogenese gegen-
Zunächst vermehren sich im Ovar die einge- über der Oogenese angesehen, vor allem mit
wanderten Keimzellen durch wiederholte Mit- zunehmendem väterlichen Alter (Crow, 2000).
osen (Bildung von Oogonien). Etwa vier Wo-
Albert B et al: Molecular Bioogy of the Cell. 5th ed Gar-
chen vor der Geburt (beim Menschen) beginnt
land Science New York, 2008.
im weiblichen Geschlecht die Meiose I. Es wer- Crow JF: The origins, patterns and implications of hu-
den primäre Oocyten gebildet. Jedoch wird die man spontaneous mutation. Nature Rev Genet 1:
Meiose I in einem als Diktyotän bezeichneten 40-47, 2000.
Stadium der Prophase arretiert. In diesem Sta- Hurst LD, Ellegren H: Sex biases in the mutation rate.
Trends Genet 14: 446-452, 1998.
dium verharrt die primäre Oocyte bis zur Ovu- Wolgemuth DJ: Making the commitments to meiosis.
lation. Nature Genet 38: 1362-1363, 2006.
Bildung der Gameten 75

männlich (XY) weiblich (XX)

primordiale Keimzellen

Einwanderung in Gonaden

Testis Ovar

Mitosen Mitosen

Spermato- Oogonien
gonien

Meiose I
Meiose I

primärer primäre
Spermatocyt Oocyte

Meiose I
arretiert in
Prophase

sekundäre
Spermato- Diktiotän
cyten

Meiose II Reifung

primäre
Oocyte
gereift

Spermatiden
Fortsetzung
Differenzierung Meiose I

Pol-
körper I sekundäre
Oocyte

Meiose II

Pol-
körper II

reife Spermatozoen Eizelle

A. Spermatogenese B. Oogenese
76 Eukaryote Zellen

Zellzyklus-Kontrolle gen Kinasen (Cdks). Ein zentrales Mitglied die-


ser Familie von Proteinen ist cdc2 (auch Cdk1
Eukaryote Zellen durchlaufen vor und während
genannt). Andere Proteine können den Ablauf
ihrer Teilung eine geordnete Serie von zykli-
an definierten Stadien des Zellzyklus unterbre-
schen Phasen. Howard & Pelc teilten 1953 den
chen (Checkpoints). Dies ist ein wichtiger Me-
Zellzyklus in zwei Hauptphasen, Interphase
chanismus, um die Reparatur eines Schadens
und Mitose, ein. Die Interphase, die Zeit zwi-
zu ermöglichen (vgl. DNA-Reparatur, S. 60),
schen zwei Teilungen, besteht wiederum aus
oder eine nicht reparierbare Zelle dauerhaft an
drei Phasen: G1 (Gap 1), S (DNA Synthese), und
der weiteren Teilung zu hindern.
G2 (Gap 2). Kontrollmechanismen, bestehend
Die wichtigsten Vertreter sind als Cycline D
aus zahlreichen, interagierenden Proteinen,
(Cycline vom Typ D1, D2, D3) bezeichnete Pro-
führen die Zelle durch den Zellzyklus.
teine. Diese assoziieren mit Cdk-Proteinen
A. Hefezellen (cdk4 und 6) und aktivieren diese. Andere,
durch einen DNA-Schaden aktivierte Proteine
Bäcker-Hefe (S. cerevisiae) und S. pombe sind
können einen Stopp in der G1-Phase bewirken.
wichtige Modellorganismen für die Analyse des
Besondere Bedeutung haben das p53-Protein
Zellzyklus bei eukaryoten Zellen. Die Bäcker-
(vgl. S. 268), ATM (vgl. S. 280), NBS und p21. Ist
Hefe, Saccharomyces cerevisiae, besteht aus Zel-
eines dieser Proteine durch eine Mutation des
len von rund 3 mm Durchmesser, die sich unter
entsprechenden Gens inaktiviert, so verliert die
guten Ernährungsbedingungen alle 90 Minuten
Zelle für den Fall eines DNA-Schadens die Mög-
durch Sprossung (Knospung) teilen können.
lichkeit, den Eintritt in die S-Phase bis zur er-
Die Spalthefe Schizosacharomyces pombe ver-
folgreichen Reparatur zu verzögern.
mehrt sich durch Teilung der Zelle in zwei Hälf-
Sobald die Zelle den G1-Restriktionspunkt vor
ten (pombe ist das Suaheli Wort für Hirsebier,
Eintritt in die S-Phase erreicht, wird das Cyc-
aus dem P. Lindner 1893 diese Hefe isoliert
lin E unwirksam und die Zelle kann in die
hat).
S-Phase eintreten. Dies wird von zahlreichen
B. Zellteilungszyklus bei der Hefe anderen Aktivitäten begleitet, wie Bindung von
Cyclin A an Cdk2 und Phosphorylierung des RB-
Bäcker-Hefe (S. cerevisiae, 1) und S. pombe (2)
Proteins (Retinoblastom-Protein, s. S. 274). Bei
haben definierte Kontrollpunkte, an denen der
Eintritt in die G2-Phase bindet cdc2 (Cdk1) an
Fortgang der Teilung gesteuert wird, wie bei al-
die mitotischen Cycline A und B und aktiviert
len eukaryoten Zellen (Checkpoint). Im Gegen-
die Bildung des Mitose-fördernden Faktors MPF
satz zu Wirbeltierzellen bleibt die äußere
(Mitosis Promoting Factor). Erst wenn Kontrol-
Membran des Nukleus während der Mitose in-
len durch Feedback-Mechanismen die Integri-
takt. Die Zelle kann erst in die jeweils nächste
tät des Genoms bestätigt haben, kann die Zelle
Phase des Zellzyklus eintreten, wenn sie eine
in die nächste Phase des Zellzyklus eintreten.
Kontrolle durchlaufen hat.
Ein wichtiger allgemeiner Regulator ist cdc2 g Medizinische Relevanz. Mutationen in Genen,
(cell division cycle) bei S. pombe (3). Er regelt die an der Kontrolle des Zellzyklus beteiligt
den Übergang von der G0- in die G1-Phase. sind, können Krebs verursachen (Weinberg,
Ohne die cdc2-Aktivität (cdc2-Mutante) resul- 2007).
tiert eine Verzögerung des Zellzyklus und der
Hartwell L, Weinert T: Checkpoints: Controls that en-
Eintritt in die Mitose wird verhindert. Gestei-
sure the order of cell cycle events. Science 246:
gerte cdc2-Aktivität (dominante Mutation 629-634, 1989.
cdcD) hingegen resultiert in einer vorzeitigen Howard A, Pelc S: Synthesis of deoxyribonucleic acid in
Mitose mit zu kleinen Zellen (wee-Phänotyp, normal and irradiated cells and its relation to chro-
vom Schottischen Wort für „klein“). (Abbildung mosomes breakage. Heredity 6 (Suppl): 261-273,
1953.
modifiziert nach Lodish et al., 2004) Lodish H et al: Molecular Cell Biology. 5th ed. Scientific
American Books, WH Freeman & Co, New York,
C. Zellzyklus-Kontrollsysteme 2004.
Der eukaryote Zellzyklus wird durch Zellzy- Nurse P: A long twentieth century of the cell cycle and
beyond. Cell 100: 71-78, 2000.
klus-„Motoren“, einem Satz interagierender Weinberg RA: The Biology of Cancer, Garland Science,
Proteine vorangetrieben, den Cyklin-abhängi- New York, 2007.
Zellzyklus-Kontrolle 77

ca. 5μm

Spindel-
pol

Bäcker- G1 S Mitose
hefe
Saccharomyces cerevisiae Start-Checkpoint DNA-Checkpoint Mitose-Eintritt-Checkpoint

1. Bäcker Hefe (Saccharomyces cerevisiae)

G1 S G2 Mitose
ca. 7–15μm

Start-Checkpoint DNA-Checkpoint Mitose-Eintritt-Checkpoint


für unreplizierte DNA

2. Spalt Hefe (Schizosaccharomyces pombe)

cdc2+ Wildtyp cdc– Mutante cdcD Mutante


Spalt- (wee-Phänotyp)
hefe
Schizosaccharomyces pombe 3. Effekt von cdc2 in S. pombe

A. Hefezellen B. Zellteilungszyklus in Hefe

Wachstums- Rezeptoren Signal- p53 DNA-


faktoren Transduktion Aktivierung Schaden
G1
G0
andere
Cycline Gene (z.B. ATM, NBS, p 21)
D ass
cdc2 inaktiv o zii
(Inhibitor Sic1) er
e Zellzyklus arretiert
n
m

M-Cycline RB dephosphoryliert
M Anaphase
it c

degradiert
dk

fördender
Komplex

Mitose- variable Länge


1h abhängig
Checkpoint cdc2 bindet
Replikation

vom Zelltyp
an G1-Cyclin Restriktions-
3–4h punkt
6–8h aktiviert
cdc2 bindet vor Eintritt
an mitotische in S-Phase
G2 Cycline RB phosphoryliert
srep

A/B (MPF)
ara

G1-Cyclin (E)
tu
r

degradiert
on

i
at
plik
- Re
DNA

C. Zellzyklus-Kontrollsysteme S
78 Eukaryote Zellen

Programmierter Zelltod (Apoptose) gocytose. (Abb. Dr. A.J. Cann, University of Lei-
cester, Google Image, 22. März 2005)
In bestimmten Stadien der Entwicklung eines
multizellulären Organismus müssen Zellen C. Regulation der Apoptose
planmäßig absterben. Dieser gut regulierte
Spezielle Cystein-haltige Aspartat-Proteinasen,
Vorgang wird als Apoptose bezeichnet, wie
Caspasen, spielen eine zentrale Rolle. Sie akti-
1972 von Kerr vorgeschlagen. Dass es sich um
vieren oder inaktivieren einander in einer fest-
einen biologischen Vorgang von enormer Be-
gelegten Abfolge. Die Reaktion beginnt mit der
deutung handelt, wurde zuerst durch Untersu-
Bindung eines Liganden, Fas-Ligand, an einen
chungen an einem Nematoden, C. elegans (S.
entsprechenden Rezeptor (Fas) einer cytotoxi-
184), nachgewiesen. Wenn Apoptose nicht re-
schen T-Zelle, auch CD95 genannt (s. S. 256).
gelrecht eintritt, entstehen schwere Defekte in
Diese Bindung aktiviert ein intrazelluläres Ad-
der Entwicklung oder Krebs.
aptorprotein, FADD (Fas associated death do-
Apoptose wird durch einen Apoptose-Signal-
main). Daraufhin wird Caspase 8 aktiviert, was
weg unter Beteiligung zahlreicher Proteine re-
zu einer Freisetzung von Cytochrom c in Mito-
guliert, die entweder Apoptose induzieren oder
chondrien (S. 208) führt. Dadurch werden eine
inhibieren. Apoptose kann durch zahlreiche Sti-
Reihe weiterer Caspasen aktiviert. Unter Betei-
muli induziert werden, die entweder von au-
ligung weiterer Proteine wird der program-
ßerhalb der Zelle stammen (extrinsischer Weg)
mierte Zelltod induziert.
oder von innerhalb der Zelle (intrinsischer
Das Genom von Mensch und Maus enthält 13
Weg). Äußere Faktoren können Röntgenstrah-
Caspase-Gene. Beim Menschen sind die Caspa-
len, Fehlen bestimmter Wachstumsfaktoren
sen 3 sowie 6–10 an der Apoptose beteiligt, die
oder Glucocorticoide sein. Von innen wirkende
anderen an Entzündungsvorgängen. Andere
Faktoren können nicht reparierte Schäden an
Apoptose-regulierende Proteine gehören zur
der DNA sein.
Bcl-2-Familie (Bcl ist von B-Zell-Lymphom ab-
A. Wichtigkeit von Apoptose geleitet) (Abb. nach Koolman & Röhm, 2005).
Apoptose tritt im Wesentlichen während der g Medizinische Relevanz. Mutationen im
Embryonalentwicklung auf. Die Finger eines menschlichen BCL2-Gen (OMIM 151430) verur-
sich entwickelnden Säugetierembryos werden sachen eine Form eines B-Zell-Lymphoms.
durch interdigitale Apoptose geformt (1). Zel-
Alberts B et al: Molecular Biology of the Cell. 5th ed.
len zwischen den Fingern müssen durch Apo-
Garland Science, New York, 2008.
ptose entfernt werden. Besonders große Be- Friedlander RM: Apoptosis and caspases in neurodege-
deutung hat Apoptose bei der Entwicklung des nerative diseases. New Eng J Med 348: 1365-1375,
Zentralnervensystems (2). Fast die Hälfte der 2003.
Nervenzellen müssen nach ihrer Entstehung Gilbert SF: Developmental Biology. 7th ed Sinauer, Sun-
derland, MA, 2003.
durch Apoptose eliminiert werden, wenn das Kerr JF et al: Apoptosis: a basic biological phenomenon
Gehirnwachstum normal verlaufen soll. Bei with wide-ranging implications in tissue kinetics.
Mangel eines Apoptose-regulierenden Proteins, Br J Cancer 26: 239-257, 1972.
Caspase 9, im Gehirn von Mäuseembryonen, Kuida K et al: Reduced apoptosis and cytochrome
c-mediated caspase activation in mice lacking
proliferieren Neurone in bestimmten Bereichen caspase 9. Cell 94: 325-337, 1998.
zu stark. Dies führt zu abnormen Ausstülpun- Koolman J, Roehm KH: Color Atlas of Biochemistry. 2nd
gen des Gehirns. (Abb. 1 aus Alberts et al, 2008 ed. Thieme, Stuttgart-New York, 2005.
und Wood et al, 2000; Abb. 2 aus Gilbert, 2003 Nagata S: DNA degradation in development and pro-
grammed cell death. Ann Rev Immunol 23: 821-
und Kuida et al, 1998)
852, 2005.
Wood W et al: Mesenchymal cells engulf and clear
B. Zelluläre Vorgänge bei Apoptose apoptotic footplate cells in macrophageless PU.1
Das erste sichtbare Zeichen von Apoptose sind null mouse embryos. Development 127: 5245-5252,
2000.
Veränderungen im Zellkern (Chromatinver-
dichtung) und Zusammenschrumpfen der
Zelle. Die Zellmembran sieht gekräuselt aus
und die Zelle beginnt, sich aufzulösen. DNA zer-
fällt in Fragmente. Der Vorgang endet mit Pha-
Programmierter Zelltod (Apoptose) 79

apoptotic cells

1. Apoptose im Mausembryo 2. Gehirnfehlbildung beim Mausembryo mit Caspase-9-Defekt


A. Wichtigkeit von Apoptose

Apoptose-
Signal

Chromatin- Zell- Chromatin- Segmentierung Apoptoti- Phagozytose,


kondensation schrumpfung veränderungen des Nukleus, DNA- sche keine
Fragmentierung Körperchen Entzündung
B. Zelluläre Vorgänge bei Apoptose

zytotoxische
T-Zelle TNF-
TNF-α
Fas -Ligand Rezeptor
Typ I
Fas-Rezeptor

Caspase 8

Mitochondrium

FADD Cytochrom c TRADD


Effektor-
Caspasen

p53-Protein bcl-2-Protein

Spaltung

andere Proteine snRNA-Proteine Laminin Caspase-aktivierte DNAase


DNA-Schaden
Apoptose
C. Regulation von Apoptose
80 Eukaryote Zellen

Zellkultur oder Sendai-Virus beifügt. Wählt man als Aus-


gangszellen („elterliche Zellen“) zwei verschie-
Zellen von Tieren und Pflanzen können außer-
dene Zelltypen A und B, z. B. eine ohne die Fä-
halb des Körpers als Kultur in vitro (im Glas,
higkeit Thymidinkinase zu bilden (TK–) als A (1)
d. h. in einer Zellkultur) leben und sich vermeh-
und eine ohne Aktivität des Enzyms Hypoxan-
ren. Sie benötigen dazu ein geeignetes Medium,
thin-Phosphoribosyl-Transferase (HGPRT–) als
eine Temperatur von 37 °C und eine Atmo-
B (2), so ergeben sich folgende Konsequenzen:
sphäre, die die richtige Konzentration von Sau-
Bei gemeinsamer Kultivierung (Ko-Kultivie-
erstoff und Kohlendioxid enthält. Das Nährme-
rung, 3) fusioniert ein (kleiner) Anteil der Zel-
dium muss verschiedene Vitamine, Zucker,
len vom gegensätzlichen Typ A und Typ B (4).
Salze, die essentiellen Aminosäuren, Glutamin
Bei Kultivierung in einem Hypoxanthin, Ami-
und Cystein sowie Serum enthalten. Zellkultu-
nopterin und Thymidin (HAT) enthaltenden se-
ren, zuerst 1913 für längere Zeit kultiviert
lektiven Nährmedium können nicht-fusio-
(A. Carrel), werden seit etwa 1965 für geneti-
nierte Zellen (5) und fusionierte Zellen vom
sche Untersuchungen verwendet (Somazellge-
selben Typ nicht überleben, wohl aber die ein
netik).
Heterokaryon-bildende fusionierte Zelle (6),
Zellen in Kultur sind üblicherweise einfache
aus denen die Hybridzellen mit zwei verschie-
mesenchymale Zellen (Fibroblasten) ohne Dif-
denen Chromosomensätzen hervorgehen (7).
ferenzierung in spezielle Zellen. Differenzierte
Im weiteren Verlauf der Kultivierung verlieren
Zellen, z. B. Muskelzellen oder Nervenzellen,
die Hybridzellen nacheinander einzelne Chro-
können nur unter speziellen Bedingungen kul-
mosomen bis sie nur noch ein Chromosom ei-
tiviert werden. Die meisten Zellen wachsen am
ner der elterlichen Zellen enthalten (8). Unter-
Boden des Kulturgefäßes angeheftet (Adhäsi-
schiedliche genetische Merkmale können mit
onskultur).
An- und Abwesenheit eines verbliebenen Chro-
Zellen in Kultur haben eine begrenzte Lebens-
mosoms korreliert werden.
spanne (Hayflick 1997). Gelegentlich gewinnen
Zellen in Kultur die Fähigkeit zu permanenter C. Radiations-Hybridzellen
Proliferation, meistens wenn sie aus Tumorzel-
Wenn man Zellen, z. B. menschlicher Herkunft,
len stammen. Daraus können permanente Zell-
einer hohen letalen Dosis von Röntgenstrahlen
linien mit relativ homogener Zellpopulation
(ca. 3–8 Gy) aussetzt (1), werden die Chromo-
entstehen.
somen in kleine Fragmente zerlegt. Solche Zel-
A. Haut-Fibroblasten-Kultur len können nicht überleben, aber mit einer in-
takten Zelle fusionieren (2) und Zellhybride bil-
Um eine Kultur zu beginnen, entnimmt man
den (Strahlenhybride, 3). Bestehen die Zellhy-
unter sterilen Bedingungen ein Stückchen Haut
bride aus Thymidinkinase-defizienten (TK–)
(2 × 4 mm) oberhalb der Kapillarschicht, schnei-
Nagetierzellen, so können die Hybridzellen im
det es in kleine Stücke und bringt sie in ein Kul-
HAT-Medium selektioniert werden (s. Teil B).
turgefäß. Nach etwa 8–14 Tagen beginnen neue
Auf diese Weise kann eine Ansammlung vieler
Zellen (Fibroblasten) vom Rand der Hautstück-
kleiner DNA-Fragmente (meistens etwa
chen (in der Photographie links) aus zu wach-
5–10 Mb Größe) in Hybridzellen gewonnen
sen und sich zu vermehren (rechte Hälfte der
werden (Radiationshybrid Panel, 4). Dies kann
Photographie). Sobald der Boden des Gefäßes
für weitere Untersuchungen verwendet wer-
von einer Schicht von Zellen bedeckt ist, teilen
den (Radiationshybridkarte).
sich die Zellen nicht mehr. Dies wird als Kon-
taktinhibition bezeichnet (bei Tumorzellen be- g Medizinische Relevanz. Zellkulturen sind wich-
steht keine Kontaktinhibition). Die Zellen kön- tig für die Untersuchung zahlreicher genetisch
nen weiter vermehrt werden, indem man sie in bedingter Krankheiten.
ein oder mehrere neue Kulturgefäße bringt (be-
Alberts B et al: Molecular Biology of the Cell. 5th ed.
zeichnet als Anlegen einer Subkultur).
Garland Science New York, 2008.
Hayflick L: Mortality and immortality at the cellular le-
B. Hybridzellen für genetische Analyse vel. Biochemistry 62: 1180-1190, 1997.
Einige Zellen in einer Kultur fusionieren, wenn McCarthy L: Whole genome radiation hybrid mapping.
man dem Nährmedium Polyethylen-Glycol Trends Genet 12: 491-493, 1996.
Zellkultur 81

Stückchen Haut
(2 x 4 mm) aussprossende
Fibroblasten

in Kulturge-
fäß bringen

zerkleinert
Subkultur
Monolayer
A. Haut-Fibroblasten-Kultur

1. Zellkultur 2. Zellkultur
Typ A Typ B
TK- HPRT-
3. Ko-Kultivierung
A
4.
5. 5.
B
nicht fusioniert fusionierte Zellen nicht fusioniert selektives
Medium
HAT
stirbt ab 6. Heterokaryon stirbt ab

7.
Hybridzelle enthält
zwei verschiedene
Chromosomensätze
8. Kultur

Zellen unterscheiden sich durch verbleibende Chromosomen


B. Hybridzellen für genetische Analyse

1. Kern einer 4. Randomisierte Selektion


irradiierten Zelle vom Menschen humaner DNA-Fragmente

3.

Chromosomen- Zell- Kultur


Fragmente fusion in selektivem
Medium

2. intakte Chromosomen
in nicht irradiierter Zelle
(Tierzellen TK-) Radiationshybrid Panel
C. Radiations-Hybridzellen
82 Formale Genetik

Die Mendelschen Merkmale bei der Vererbung, die deutlich von den damals
vorherrschenden Vorstellungen abwichen. Dies
Im Jahre 1865 veröffentlichte der Augustiner-
hat dazu beigetragen, dass ihre Bedeutung zu-
pater Gregor Mendel in den Berichten der Na-
nächst nicht erkannt wurde.
turgeschichtlichen Vereinigung von Brünn
Wir wissen heute, dass genetisch determinierte
(Brno) bemerkenswerte Untersuchungen, die
Merkmale nur dann unabhängig vererbt wer-
aber bis 1900 nicht beachtet wurden. In der
den (segregieren), wenn sie auf verschiedenen
„Versuche über Pflanzenhybriden“ genannten
Chromosomen liegen oder wenn sie auf dem-
Arbeit legt Mendel dar, dass bestimmte Merk-
selben Chromosom weit genug voneinander
male der Gartenerbse (Pisum sativum) als un-
entfernt liegen, um jedes Mal durch Rekombi-
veränderte Merkmale unabhängig voneinander
nation voneinander getrennt zu werden (d. h.,
vererbt werden. Dabei beobachtete Mendel be-
wenn keine genetische Kopplung vorliegt, vgl.
stimmte Regelmäßigkeiten im Auftreten bzw.
S. 94). Dies ist für die von Mendel untersuchten
Nichtauftreten einzelner Merkmale in aufein-
Gene der Fall. Einige dieser Gene sind in den
ander folgenden Generationen. Diese bilden die
vergangenen Jahren näher charakterisiert und
Grundlage der Gesetzmäßigkeiten der Verer-
kloniert worden.
bung. Hier wird die Pflanze mit den von Men-
del beobachteten Merkmalen vorgestellt. C. Abweichungen von den
A. Die von Mendel untersuchte Pflanze Mendelschen Gesetzmäßigkeiten
(Pisum sativum) Nicht immer treten Mendelsche Merkmale in
den erwarteten Proportionen auf (vgl. S. 90).
Die Pflanze, eine Erbse, besteht aus Stamm,
Durch das Phänomen des „Meiotischen Drive“
Blättern, Blüte und Hülsen. In den Blüten kann
kann ein Merkmal viel häufiger auftreten als
man den (weiblichen) Stempel (der die Narbe,
das andere. Beispiele sind t-Komplex der Maus
den Griffel und den Fruchtknoten enthält) und
(etwa 99 % der Nachkommen von heterozygo-
den (männlichen) Staubfaden, der die Staub-
ten t/+ männlichen Mäusen sind ebenfalls hete-
beutel und -fäden enthält, unterscheiden. Die
rozygot anstatt 50 %) und Segregation-Distorter
Gartenerbse vermehrt sich normalerweise
(SD) bei Drosophila. 1993 wurde eine Mauspo-
durch Selbstbefruchtung. Pollen aus dem
pulation in Sibirien beschrieben, bei der 85 %
Staubbeutel können auf die Samenanlagen der-
bzw. 65 % der Nachkommen heterozygoter El-
selben Blüte fallen. Andererseits ist es relativ
tern ebenfalls heterozygot für eine Inversion
einfach, Kreuzbefruchtung durchzuführen.
waren. Homozygotie für diese Inversion führte
Mendel öffnete dazu eine Blüte und entfernte
zu reduzierter Fitness und bedeutet einen se-
die Staubbeutel, bevor Pollen austreten konn-
lektiven Nachteil. Die Verschiebung war aller-
ten. Stattdessen verwendete er die Pollen einer
dings nicht das Ergebnis frühembryonalen Ab-
anderen Blüte. Die fertige Hülse enthält die Sa-
sterbens.
men, aus denen sich neue Pflanzen entwickeln.
Möglicherweise sind Abweichungen von den
B. Die beobachteten Merkmale Mendelschen Gesetzmäßigkeiten häufiger als
(Phänotypen) bisher angenommen. Eine weitere Abweichung
entsteht durch genomisches Imprinting (vgl.
Mendel beobachtete insgesamt 7 charakteristi-
S. 164) und Keimzell-Mosaik.
sche Merkmale: (1) Große und kleine Pflanzen,
(2) axiale und endständige Blüten und Hülsen Brink RA, Styles ED: Heritage from Mendel. Univ. of
entlang der Pflanze, (3) grüne und gelbe Hül- Wisconsin Press, Madison, 1967.
sen, (4) volle und geschrumpfte Form der Hül- Corcos AF, Monaghan FV: Gregor Mendel’s Experi-
ments on Plant Hybrids. Rutgers Univ. Press, New
sen, (5) die Form der Samen, (6) die Farbe der Brunswick, 1993.
Samen und (7) die Farbe der Samenhüllen. Mendel G: Versuche über Pflanzenhybriden. Verh na-
Mendel beobachtete, dass die Vererbung jedes turf Ver Brünn 4: 3-47, 1866.
Merkmalpaares unabhängig von der des ande- Pomiankowski, A., Hurst, D. L.: Siberian mice upset
Mendel. Nature 363: 396-397, 1993.
ren war. Die Vererbung unabhängiger Merk-
Weiling F: Johann Gregor Mendel: Der Mensch und
male in bestimmten Gesetzmäßigkeiten ist Forscher. II. Teil. Der Ablauf der Pisum Versuche
Mendels wesentliche Erkenntnis. Sie lieferte nach der Darstellung. Med. Genetik 2: 208-222,
grundlegend neue Einsichten in die Vorgänge 1993.
Die Mendelschen Merkmale 83

Staubbeutel Schiffchen

Narbe
Kelch-
blatt
Griffel

Samenanlage

Fruchtknoten

Blüte

Samen

Pflanze Hülse

A. Die Erbsenpflanze (Pisum sativum)

Hülsen
1 3 1

grün gelb

voll geschrumpft

Pflanze groß Pflanze klein

Samen
2 2
5 rund runzelig

6 gelb grün

Samenhülle
7
grau weiß
(Blüte violett) (Blüte weiß)

Blätter und Blüten und


Hülsen axial Hülsen endständig
B. Die beobachteten Merkmale (Phänotypen)
84 Formale Genetik

Aufspaltung (Segregation) B. Rückkreuzung einer


Mendelscher Merkmale F1-Hybridpflanze mit einer
Elternpflanze
Mendel beobachtete die verschiedenen Merk-
male der Erbsenpflanze und verfolgte ihr Auf- Wenn Mendel die F1-Hybridpflanze mit der El-
treten in aufeinander folgenden Generationen. ternpflanze des rezessiven Merkmals rück-
Dabei stellten sich bestimmte Gesetzmäßigkei- kreuzte (1), traten in der nächsten Generation
ten heraus (Mendelsche Gesetzmäßigkeiten die beiden Merkmale im Verhältnis 1 : 1 auf
bzw. sog. Mendelsche Gesetze). (106 runde gegenüber 102 runzligen). Dies
wird als zweites Mendelsches Gesetz bezeich-
A. Segregation dominanter und net.
rezessiver Merkmale Die Interpretation (2) dieses Experiments,
In zwei verschiedenen Experimenten beobach- Rückkreuzung einer F1-Hybridpflanze mit der
tete Mendel die Form der Samen (glatt bzw. Elternpflanze, wird dadurch erklärt, dass unter-
runzlig) und die Farbe (gelb bzw. grün). Wenn schiedliche Keimzellen (Gameten) gebildet
er Pflanzen der elterlichen (parentalen) Gene- werden.
ration P kreuzte, also glatt × runzlig bzw. gelb × Die F1-Hybridpflanze (rund) enthält zwei
grün, so beobachtete er in der ersten Filial-(- Merkmale, eines für rund (R, dominant über
Tochter-)Generation F1, dass alle Samen glatt runzlig, r) und eines für runzlig (r, rezessiv ge-
bzw. gelb waren. genüber rund, R). Diese Pflanze ist mischerbig
Die den beiden Merkmalen rund und runzlig (heterozygot) und kann deshalb zwei Arten von
zugrunde liegenden genetischen Merkmale Gameten bilden (R und r).
werden als Allele bezeichnet. Sie sind verschie- Die andere Pflanze dagegen ist reinerbig (ho-
dene Erscheinungsformen desselben Gens (von mozygot) für runzlig (r). Sie kann nur eine Art
Mendel als „Faktor“ bezeichnet, weil der Begriff von Gameten bilden (r, runzlig). Die Hälfte der
Gen noch unbekannt war). Ebenso entsteht das Nachkommen der mischerbigen Pflanze erhält
Merkmalspaar gelb und grün durch verschie- das dominante Merkmal (R, rund), die andere
dene Allele (am selben Genlocus). Hälfte das rezessive Merkmal (r, runzlig). Es re-
Nach einer weiteren Generation (bezeichnet als sultiert eine Verteilung der beobachteten Merk-
F2) durch die bei der Erbse übliche Selbstbe- male im Verhältnis von 1 : 1 oder jeweils 50 %.
fruchtung traten die in der elterlichen Genera- Das beobachtete Merkmal wird als Phänotyp
tion beobachteten Merkmale wieder auf (rund (Erscheinungsbild) bezeichnet. Die Zusammen-
bzw. runzelig und grün bzw. gelb). Unter insge- setzung der beiden Faktoren (Gene) R und r
samt 7324 Samen des einen Experiments fan- (Rr) bzw. (rr) wird als Genotyp bezeichnet. Die
den sich 5474 mit runden und 1850 mit runze- alternativen Formen eines Merkmals (hier rund
ligen Samen. Dies entsprach einem Verhältnis bzw. runzlig) bezeichnet man als Allele. Sie sind
3 : 1. Im Experiment mit unterschiedlichen Far- das Ergebnis unterschiedlicher genetischer In-
ben (gelb bzw. grün) beobachtete Mendel in formationen an einem Genlocus.
der F2-Generation unter insgesamt 8023 Sa- Unterscheiden sich die Allele, so ist der Geno-
men 6022 mit gelber Farbe und 2001 mit grü- typ heterozygot, sind sie gleich, so ist er homo-
ner Farbe, wiederum entsprechend im Verhält- zygot (diese Aussage bezieht sich jeweils nur
nis 3 : 1. auf einen Genlocus).
Das in der F1-Generation allein zu beobach- g Medizinische Relevanz. Nach den von Mendel
tende Merkmal (rund bzw. gelb) nannte Men- beschriebenen Gesetzmäßigkeiten können ca.
del dominant, das in der F1-Generation nicht 3000 definierte Krankheiten beim Menschen
erscheinende Merkmal (runzelig bzw. grün) vererbt werden (vgl. OMIM).
nannte er rezessiv. Diese Aufspaltung (Segrega-
tion) eines dominanten und rezessiven Merk- Griffiths AJF, Miller JH, Suzuki DT, Lewontin RC, Gel-
malpaares im Verhältnis 3 : 1 wird als erstes bart, WM: An Introduction to Genetic Analysis. 7th
ed. (mit CD-ROM und 39 dem Text zugeordneten
Mendelsches Gesetz bezeichnet. Animationen), WH Freeman, New York, 2000.
OMIM: Online Mendelial Inheritance in Man
(www.ncbi.nlm.nih.gov/Omim).
Aufspaltung (Segregation) Mendelscher Merkmale 85

Generation

rund runzelig gelb grün

Kreuzung

F1

alle rund alle gelb


(dominant) (dominant)

Selbstbefruchtung

F2

rund runzelig grün gelb


5474 1850 2001 6022
3 : 1 1 : 3

A. Segregation dominanter und recessiver Merkmale

F1-Hybrid Elternpflanze

Rr r

rund runzelig

R r Gameten r r

Rr r

rund runzelig heterozygot homozygot


106 102 R (rund) r (runzelig)
dominant recessiv
1 : 1

1. Experiment 2. Interpretation
B. Rückkreuzung einer F1-Hybridpflanze mit einer Elternpflanze
86 Formale Genetik

Verteilung von zwei unabhängigen scheiden sie sich (Gr bzw Rr), so ist der Gen-Ort
Merkmalspaaren (Allelen) heterozygot (mischerbig, früher auch hybrid
genannt).
In einem weiteren Experiment beobachtete Die zu erwartenden Genotypen der beiden un-
Mendel, dass zwei verschiedene Merkmale un- abhängigen Merkmalspaare G/g und R/r sind:
abhängig voneinander vererbt werden. Jedes GGRR, GRGr und GrGR, GRgR und gRGR, GRgr
Merkmalspaar zeigt die gleiche 3 : 1-Verteilung und grGR, sowie GrgR und gRGr (alle 9 gelb und
des dominanten über das rezessive Merkmal in rund), drei gelbe und runzlige (Grgr, GrGr und
der F2-Generation, wie er es zuvor beobachtet grGr), drei grüne und runde (gRgr, gRgR, grgR)
hatte. Die Aufspaltung der beiden Merkmals- und einmal grün und runzelig (grgr).
paare ergab jedoch wiederum bestimmte Ge- Die Verteilung (Aufspaltung) der beiden Merk-
setzmäßigkeiten. malspaare gelb/grün und rund/runzlig ist das
A. Mendels Beobachtung Ergebnis der unterschiedlichen Ausstattung der
Gameten. Diese enthalten nur jeweils eines der
Mendel untersuchte in einem Experiment die beiden Allele der beiden Gene, d. h. entweder G
Kreuzung des Merkmalspaares rund/runzlig oder g, sowie entweder R oder r. Das in B ge-
und gelb/grün. Kreuzte er Pflanzen mit runden zeigte Quadrat (Punnettsches Quadrat, benannt
und gelben Samen mit solchen mit runzligen nach einem Genetiker zu Anfang des 20. Jahr-
und grünen Samen, so traten in der F1-Genera- hunderts) zeigt außen die vier in den Gameten
tion nur runde und gelbe Samen auf. Dies ent- möglichen Genotypen (GR, Gr, gR und gr). In-
sprach durchaus dem ursprünglichen Experi- nerhalb des Quadrats sind die möglichen Geno-
ment, wie auf S. 82 gezeigt. Bei 556 Pflanzen typen dargestellt, die in der Zygote nach der Be-
der F2-Generation (zweite Generation) traten fruchtung gebildet werden können. Das bei der
die beiden Merkmalspaare in folgender Häufig- Rückkreuzung beobachtete Verhältnis des do-
keit auf: 315 Samen gelb und rund, 108 gelb minanten Merkmals gelb (G) zum rezessiven
und grün, 101 grün und rund, 32 grün und Merkmal grün (g) beträgt 12 : 4 oder 3 : 1. Auch
runzlig, entsprechend einem Aufspaltungsver- das Verhältnis des dominanten Merkmals rund
hältnis von 9 : 3 : 3 : 1. Dies wird als drittes gegenüber runzlig beträgt 3 : 1, wie für die Se-
Mendelsches Gesetz bezeichnet. gregation bei der Rückkreuzung zu erwarten.
B. Interpretation der Beobachtung Die Bedeutung der Entdeckung von Gregor
Mendel liegt vor allem in der quantitativen
Kennzeichnen wir das dominante Allel gelb mit Auswertung der Ergebnisse (er zählte die Zahl
dem Großbuchstaben G und das rezessive Allel der Pflanzen mit dem jeweiligen Phänotyp)
grün mit dem Kleinbuchstaben g, sowie von ei- und der richtigen Interpretation. Er leitete aus
nem anderen Gen das dominante Allel rund mit den quantitativen Zahlen ab, dass Vererbung
dem Großbuchstaben R und das rezessive Allel auf einzelnen, definierbaren Faktoren (Mendel
runzlig mit dem Kleinbuchstaben r, so ergibt verwendete diesen Ausdruck für Allele) be-
ihre Kombination neun verschiedene Möglich- ruhen muss. Damit zeigte er zum ersten Mal,
keiten (s. unten). Das beobachtbare Merkmal dass Vererbung analytischen Verfahren grund-
gelb oder grün bzw. rund oder runzlig ist der sätzlich zugänglich ist. Die von Mendel beob-
Phänotyp (Erscheinungsbild). Er ist das Ergeb- achteten Zahlen entsprechen den statistisch zu
nis des jeweils vorliegen Genotyps. Dies ist die erwartenden so gut, dass der Genetiker
jeweilige Kombination der den Phänotyp be- R. A. Fisher darauf hingewiesen hat, dass Men-
stimmenden Faktoren (Allele). Ein Allel wird als del seine Ergebnisse den zu erwartenden Zah-
dominant bezeichnet, wenn es für sich allein len angeglichen haben könnte. Mendels bahn-
den Phänotyp bestimmen kann (G, gelb, und R, brechende Arbeit von 1865 wurde erst ab 1900
runzelig), unabhängig davon, welches andere in der Wissenschaft beachtet.
Allel außerdem vorhanden ist. Ein Allel wird als
rezessiv bezeichnet, wenn zwei Allele vom sel- Griffiths AJF, Miller JH, Suzuki DT, Lewontin RC, Gel-
ben Typ vorliegen müssen, um den Phänotyp bart, WM: An Introduction to Genetic Analysis. 7th
ed. (mit CD-ROM und 39 dem Text zugeordneten
zu bestimmen (gg bzw. rr). Liegen zwei gleiche
Animationen), WH Freeman, New York, 2000.
Allele vor (GG oder gg bzw. RR oder rr), so ist
der Gen-Ort homozygot (reinerbig), unter-
Verteilung von zwei unabhängigen Merkmalspaaren (Allelen) 87

P rund runzelig
gelb grün
(homozygot) (homozygot)

rund/runzelig
F1 gelb/grün
(heterozygot)

F2
315 108 101 32
9 : 3 : 3 : 1

A. Mendels Beobachtung: Unabhängige Verteilung von zwei Merkmalen

GRGR

GRGr GrGR

GRgR GrGr gRGR

GRgr GrgR gRGr grGR


GR GR

Grgr gRgR grGr


Gr Gr

gRgr grgR
gR gR

grgr
gr gr

E i z e l l e n Gameten P o l l e n

B. Interpretation der Beobachtung


88 Formale Genetik

Phänotyp und Genotyp sind, bezeichnet man sie als co-dominant (z. B.
Allele A und B des Blutgruppensystems AB0 ;
Bei einer genetischen Diagnostik wird die for-
Null ist rezessiv gegenüber A und B).
malgenetische Analyse in einem Stammbaum
Bei mehr als zwei Allelen an einem Genlocus
dargestellt (Stammbaumanalyse). Ein beobach-
kann es entsprechend mehr Genotypen geben.
tetes Merkmal wird als Phänotyp bezeichnet.
Bei drei Allelen sind es sechs Genotypen, z. B.
Als Genotyp bezeichnet man die dem Phänotyp
beim AB0-Blutgruppensystem AA, A0 (beide
zugrunde liegende genetische Information
Phänotyp A), BB, B0 (beide Phänotyp B), AB und
(s. u.).
00 (tatsächlich gibt es mehr als drei Allele im
A. Symbole zur Aufzeichnung eines AB0-System).
Stammbaumes g Medizinische Relevanz. Die Beziehungen zwi-
Die dargestellten Symbole zeigen ein verbreite- schen Genotyp und Phänotyp (Krankheitsdia-
tes Schema zur Aufzeichnung eines Stammbau- gnose) spielen eine wichtige Rolle in der gene-
mes. Männliche Individuen werden als Qua- tischen Familienberatung. Genetische Beratung
drat, weibliche Individuen als Kreis gezeigt. In- ist ein Kommunikationsprozess, der sich auf
dividuen nicht bekannten Geschlechts (z. B. we- die medizinischen, genetischen, psychologi-
gen unzulänglicher Information) werden mit schen und sozialen Probleme im Zusammen-
einem über Eck stehenden Quadrat gekenn- hang mit der Diagnose und das mögliche Auf-
zeichnet. Es sollte der Grad der Zuverlässigkeit treten einer genetisch bedingten Erkrankung
angegeben werden, mit dem der Phänotyp fest- innerhalb einer Familie und ihrer Verwandt-
gestellt wurde, z. B. ob die Diagnose der zur schaft bezieht. Auf der Grundlage einer gesi-
Diskussion stehenden Krankheit gesichert ist cherten Diagnose wird das individuelle Risiko
oder nur eine Vermutung darstellt. Eine Reihe für eine Erkrankung für die ratsuchende Person
weiterer Symbole wird verwendet, z. B. für he- selbst oder deren Kinder ermittelt. Das Ziel der
terozygote weibliche Individuen bei X-chromo- genetischen Beratung ist eine umfassende In-
somalem Erbgang (vgl. S. 92). formation der Ratsuchenden unter Berücksich-
tigung aller Entscheidungsmöglichkeiten,
B. Genotyp und Phänotyp Krankheitsverlauf, Betreuung und Behandlung.
Die Begriffe Genotyp und Phänotyp beziehen Ärztliche Schweigepflicht und Datenschutz
sich auf die genetische Information an jeweils sind zu beachten. Der Berater trifft keine Ent-
einem Genlocus. Dies ist der Ort auf einem scheidung.
Chromosom, an dem die genetische Informa- Bei der genetischen Beratung unterscheidet
tion für das jeweilige Merkmal liegt. Unter- man Patienten und Ratsuchende, weil es häufig
schiedliche Formen der genetischen Informa- nicht der Patient ist, der eine Information
tion an einem Genlocus werden als Allele be- wünscht, sondern Familienmitglieder, z. B. El-
zeichnet. Bei diploiden Organismen, also allen tern oder Geschwister. Als Index-Patient (oder
Tieren und vielen Pflanzen, gibt es bei zwei Al- Proposita bei weiblichen bzw. Propositus bei
lelen drei mögliche Genotypen: (1) homozygot männlichen Individuen) wird der Patient be-
für ein Allel, (2) heterozygot für zwei verschie- zeichnet, durch den die Aufmerksamkeit des
dene Allele und (3) homozygot für das andere Untersuchers auf das jeweilige Problem gelenkt
Allel. wurde. Kompetente ärztliche (genetische) Be-
Allele können danach unterschieden werden, ratung ist eine unverzichtbare Voraussetzung
ob sie im heterozygoten Zustand oder nur im vor Durchführung jeder genetischen Laborun-
homozygoten Zustand erkannt werden können. tersuchung. Dies gilt insbesondere bei prädikti-
Können sie im heterozygoten Zustand erkannt ver DNA-Diagnostik zur Feststellung eines
werden, bezeichnet man sie als dominant. Kön- möglichen Krankheitsrisikos, bevor Zeichen der
nen sie nur im homozygoten Zustand erkannt Manifestation der entsprechenden Krankheit
werden, sind sie rezessiv. Die Begriffe dominant feststellbar sind.
und rezessiv sind ein Attribut der Beobach-
Harper PS: Practical Genetic Counselling, 6th ed. Ed-
tungsgenauigkeit und auf molekularer Ebene
ward Arnold, London, 2004.
nicht anwendbar. Wenn im heterozygoten Zu-
stand beide Allele nebeneinander beobachtbar
Phänotyp und Genotyp 89

Vater Mutter

Elterliche
Bluts-
Tochter Sohn Geschlecht Schwangerschaft Fehlgeburt verwandtschaft
unbekannt

Tochter Sohn wahrscheinlich vielleicht heterozygot


erkrankt erkrankt erkrankt weiblich
(vollständig dokumentiert) (unvollständig dokumentiert) (nicht dokumentiert)

A. Symbole zur Aufzeichnung eines Stammbaums

Zwei Allele blau bl und rot r an einem Genlocus:

Genotyp

homozygot heterozygot homozygot blau/blau blau/rot rot/rot


blau blau/rot rot

Phänotyp

blau dominant über rot blau rezessiv gegenüber rot


rot rezessiv gegenüber blau rot dominant über blau

B. Genotyp und Phänotyp


90 Formale Genetik

Segregation elterlicher Genotypen Proportionen der zu erwartenden Genotypen


der Nachkommen im Verhältnis 1 : 2 : 1 (AA, Aa,
Die Verteilung (Segregation) elterlicher Geno-
aa). Jeweils 25 % (0,25) der Nachkommen wer-
typen bei den Nachkommen hängt von den al-
den homozygot AA sein, 50 % (0,50) heterozygot
lelen Kombinationen bei den Eltern ab. Bei au-
Aa und 25 % (0,25) homozygot aa. Sind beide El-
tosomaler Vererbung liegt beim Menschen der
tern homozygot für verschiedene Allele, so sind
entsprechende Genlocus auf einem der Chro-
sämtliche Nachkommen heterozygot.
mosomen 1–22 (vgl. S. 126). Bei autosomaler
Vererbung wird zwischen autosomal dominant, C. Genotypen bei dominanter und
autosomal rezessiv und co-dominant unter- rezessiver Vererbung
schieden. Gene auf dem Y-Chromosom werden
Ein dominantes Allel (beim Vater, A) ist bei 50 %
immer vom Vater auf alle Söhne übertragen. Da
der Nachkommen zu erwarten. Sind beide El-
das Y-Chromosom nur wenige Gene enthält,
tern heterozygot, werden 25 % der Nachkom-
kann man die Y-chromosomale Vererbung je-
men homozygot aa sein. Sind beide Eltern ho-
doch vernachlässigen. Die Mendelschen Ge-
mozygot für das dominante Allel A bzw. das re-
setzmäßigkeiten geben die erwartete Kombi-
zessive Allel a, so sind sämtliche Nachkommen
nation von Allelen bei den Nachkommen eines
obligat heterozygot (d. h., sie müssen heterozy-
Elternpaares an.
got sein). Es sei betont, dass es sich um prozen-
A. Paarungskombination bei zwei Allelen tual zu erwartende Verteilungen der Genoty-
Für zwei Allele an einem Genlocus gibt es sechs pen handelt. Bei geringer Kinderzahl kann die
mögliche Kombinationen elterlicher Genoty- tatsächlich auftretende Verteilung von der er-
pen. Hier werden zwei Allele gezeigt, blau (bl) warteten abweichen.
und rot (r). Blau sei dominant über rot. Bei drei g Medizinische Relevanz. Die Bestimmung des
elterlichen Genotyp-Kombinationen (1, 3, 4) Erbgangs ist eine wesentliche Grundlage der
zeigt keiner der Eltern das rezessive Allel rot. genetischen Diagnostik und Beratung. Aller-
An drei elterlichen Kombinationen (2, 5, 6) sind dings kann bei einem einzelnen Patienten der
Eltern beteiligt, die das rezessive Allel manifes- Erbgang nicht bestimmt werden; er muss aus
tieren, weil sie homozygot sind. Daraus folgen der Diagnose abgeleitet werden. Häufig bleibt
bestimmte Gesetzmäßigkeiten für die Vertei- diese Frage ungelöst.
lung der Genotypen und Phänotypen bei den
Nachkommen der Eltern. Erwartete Verteilung der Genotypen bei den
Das Verteilungsmuster der Genotypen und Eltern mit verschiedenen Kombinationen von
Phänotypen bei den Nachkommen der Eltern Genotypen für ein dominantes Allel A und ein
wird in Abbildung B gezeigt. Bei diesen Beispie- rezessives Allel a
len ist das Geschlecht der beiden Eltern jeweils
untereinander austauschbar. Eltern Nachkommen Verteilung
B. Verteilungsmuster elterlicher
AA×AA AA 1
Genotypen
AA×Aa AA, Aa 1:1
Bei drei elterlichen Paarungstypen für zwei Al- Aa×Aa AA, Aa, aa*) 1 : 2 : 1*)
lele A (dominant über a) und a (rezessiv gegen- AA×aa Aa 1
über A) gibt es drei Kombinationen, die zur Se- Aa×aa Aa, aa 1:1
gregation (Aufspaltung) der Allele bei den aa×aa aa 1
Nachkommen führen. Diese entsprechen den in
*) dominanter Phänotyp gegenüber rezessiv 3 : 1
A gezeigten elterlichen Kombinationen 1, 2 und
3. Beim Paarungstyp 1 ist einer der Eltern hete-
Griffiths AJF, Miller JH, Suzuki DT, Lewontin RC, Gel-
rozygot (Aa der Vater) und der andere Elternteil bart, WM: An Introduction to Genetic Analysis. 7th
homozygot (aa die Mutter). Die Verteilung der ed. (mit CD-ROM und 39 dem Text zugeordneten
zu beobachteten Genotypen bei den Nachkom- Animationen), WH Freeman, New York, 2000.
men steht im Verhältnis 1 : 1, d. h., sie beträgt Harper PS: Practical Genetic Counselling, 6th ed. Ed-
ward Arnold, London, 2004.
jeweils 50 % (0,50) für heterozygot Aa und 50 % Murken J, Grimm T, Holinski-Feder E, Herausg.: Ta-
(0,50) für homozygot aa. Wenn beide Eltern he- schenlehrbuch Humangenetik. Thieme, Stuttgart,
terozygot Aa (Paarungstyp 3) sind, stehen die 2006.
Segregation elterlicher Genotypen 91

1. 2. 3.

bl/bl bl/r bl/r r/r bl/r bl/r

4. 5. 6.

bl/bl bl/bl bl/bl r/r r/r r/r

A. Mögliche Paarungskombinationen der Genotypen für zwei Allele (bl dominant über r)

Aa aa Aa Aa AA aa

Aa aa AA Aa Aa aa Aa Aa

1 : 1 1 : 2 : 1
(50%) (50%) (25%) (50%) (25%) (100%)
0,5 0,5 0,25 0,5 0,25 1,0

B. Verteilungsmuster bei den Nachkommen von Eltern mit zwei Allelen A und a

Aa aa Aa Aa AA aa

Aa aa AA Aa Aa aa Aa Aa
C. Phänotypen und Genotypen bei den Nachkommen von Eltern
mit einem Allel A dominant über a
92 Formale Genetik

Monogene Vererbung C. X-chromosomale Vererbung


Bei monogener Vererbung gibt es vier Möglich- Da männliche Individuen ein, weibliche aber
keiten: 1. autosomal dominant, 2. autosomal zwei X-Chromosomen haben, ergibt sich ein
rezessiv, 3. X-chromosomal, 4. Y-chromosomal. charakteristisches Muster von erkrankten und
Da auf dem Y-Chromosom nur wenige Gene lie- nicht erkrankten Individuen in einem X-chro-
gen, spielt dieser Erbgang in der Praxis kaum mosomalen Stammbaum. In der Regel sind nur
eine Rolle. Es werden die Generationen mit rö- männliche Individuen erkrankt (sie sind hemi-
mischen Zahlen, die Individuen mit arabischen zygot), weibliche nicht. Bei allen männlichen
Zeichen gekennzeichnet. Individuen (XY) muss das X-Chromosom von
der Mutter stammen (1, 2); bei weiblichen (XX)
A. Autosomal dominante Vererbung stammt je ein X-Chromosom von jedem der El-
Erkrankte Individuen folgen in den Generatio- tern. Typischerweise ist der Anteil einer durch
nen unmittelbar aufeinander und betreffen so- neue Mutation entstandenen Krankheit bei X-
wohl das männliche wie das weibliche Ge- chromosomalen Loci hoch (3, 4).
schlecht im Verhältnis 1:1 (1). Die erwartete Ein typischer X-chromosomaler Erbgang (5) ist
Aufspaltung erkrankter und nicht erkrankter leicht erkennbar. Erkrankte männliche Indivi-
Nachkommen eines erkrankten Individuums duen treten in aufeinanderfolgenden Generati-
beträgt 50 % (0,50). Es muss zwischen Trans- onen auf, jeweils verbunden über die weibliche
mission von einem betroffenen Elternteil und Linie. Eine Vater-Sohn-Übertragung ist nicht
neuer Mutation unterschieden werden möglich.
(Stammbäume 2 und 3 zeigen eine neue Muta- Weibliche Heterozygote mit einem erkrankten
tion in Generation II). Bei autosomal dominan- Sohn und einem erkrankten Bruder müssen auf
ten Erkrankungen muss man beachten, dass einem X-Chromosom die Mutation tragen: sie
sich die Anwesenheit eines mutanten Allels sind obligat heterozygot. Weibliche Individuen,
nicht immer manifestiert. Dies wird als unvoll- die aufgrund des Stammbaummusters die Mu-
ständige oder fehlende Penetranz bezeichnet. tation tragen könnten, aber nicht müssen, sind
Die Expression (Expressivität) eines Gens be- fakultativ heterozygot (z. B. III-5 und IV-2 in
zieht sich auf den Grad der Manifestation. dem Stammbaum in Feld 5). Dieser Unter-
schied ist für eine genetische Beratung von
B. Autosomal rezessive Vererbung größter Wichtigkeit, weil nur heterozygote Trä-
Beide Eltern müssen heterozygot für das glei- gerinnen ein erhöhtes Risiko für einen erkrank-
che Allel sein, jedoch sind sie nicht betroffen. ten Sohn haben.
Das Merkmal tritt bei Geschwistern beiderlei Bei heterozygoten Trägerinnen können infolge
Geschlechts auf, aber nicht bei den Eltern und Abweichungen von der Inaktivierung eines der
vorhergehenden Generationen. Der zu erwar- beiden X-Chromosomen (s. S. 164) ausnahms-
tende Anteil erkrankter Kinder eines heterozy- weise leichte Manifestationen einer X-chromo-
goten Elternpaares beträgt stets 25 % (1/4). In somalen Krankheit auftreten.
Stammbaum 1 sind die Eltern II-3 (Mutter) und g Medizinische Relevanz. Der Katalog monoge-
II-4 (Vater) heterozygot; in Stammbaum 2 sind ner Krankheiten und Merkmale des Menschen
I-1 und I-2 die Eltern. In Stammbaum 3 liegt enthält fast 20000 autosomale, 1027 X-chro-
Blutsverwandtschaft (Consanguinität, vgl. mosomale und 57 Y-chromosomale monogene
S. 104) der Eltern (III-1 und III-2) vor (Cousinen Merkmale (Stand vom 20. März 2008; McKu-
1. Grades). Dies wird durch einen Doppelstrich sick, 1998 und OMIM).
angezeigt.
Bei autosomal rezessiven Mutationen kann Harper PS: Practical Genetic Counselling. 6th ed. Ed-
man unterscheiden, ob die Mutationen bei den ward Arnold, London, 2004.
McKusick VA: Mendelian Inheritance in Man. (Online
Eltern verschieden (allozygot) oder identisch
OMIM: www.ncbi.nlm.nih.gov/Omim).
(autozygot) sind. Im ersten Fall handelt es sich Rimoin DL et al, editors: Principles of Medical Genetics.
um unabhängig entstandene Mutationen; im 5th ed. Churchill-Livingstone-Philadelphia, 2007
zweiten meistens durch gleiche Herkunft, z. B. (mit online Zugang unter www.geneticstext.com).
bei Blutsverwandtschaft. Vogel F, Motulsky AG: Human Genetics. Problems and
Approaches. 3rd ed. Springer Verlag. Heidelberg –
New York, 1997.
Monogene Vererbung 93

1 2 3
1 2
I

1 2 3 4 5
II

neue neue
1 2 3 4 5 Mutation Mutation
III

erkrankt männlich, weiblich nicht erkrankt männlich, weiblich

A. Vererbungsmuster in Stammbäumen mit einem autosomal dominanten Merkmal

I
1 2 1 2 3

II 1 2 3 4

III 1 2 3 4

IV

B. Vererbungsmuster in Stammbäumen mit einem autosomal rezessiven Merkmal

1 3 neue Mutation
5
I oder heterozygot

XY XX
II
neue Mutation

4 III

XY XX XY XX
IV

XY XX 2 neue
Mutation

XY XX XY XX

erkrankt männlich (hemizygot) nicht erkrankt weiblich ,


Genträgerin (heterozygot)
C. X-chromosomale Vererbung
94 Formale Genetik

Kopplung und Rekombination autosomal dominante Mutation dar, der zu ei-


nem bestimmten Phänotyp führt, z. B. einer au-
Als Kopplung bezeichnet man die gemeinsame
tosomal dominant erblichen Krankheit. Betrof-
Vererbung von zwei oder mehr Genen. Diese zu-
fen sind der Vater und drei Kinder (rote Sym-
erst von Correns 1902 bemerkte, scheinbare
bole im Stammbaum). Der andere Locus (A) ist
Ausnahme von den Mendelschen Gesetzmäßig-
ein benachbarter Markerlocus. Alle drei Er-
keiten ist möglich, wenn die Genloci relativ
krankten haben vom Vater sowohl das mutante
nahe beieinander auf demselben Chromosom
Allel B als auch das Markerallel A geerbt. Die
liegen. Je näher sie beieinander liegen, desto
drei nicht erkrankten Individuen haben vom
häufiger werden sie gemeinsam (gekoppelt)
Vater das normale Allel b und das Markerallel a
vererbt. Rekombination führt zur Bildung einer
geerbt. Das väterliche Allel a zeigt die Abwe-
neuen Kombination von gekoppelten Genen
senheit der Mutation (Allel B). Es ist keine Re-
durch Crossing-over zwischen den Loci in der
kombination eingetreten (1).
Meiose (vgl. S. 70). Kopplung bezieht sich nicht
Rekombination (2) führt dazu, dass ein er-
auf bestimmte Allele, sondern auf Genloci. Im
kranktes Individuum vom Vater die Allele a und
Gegensatz zu Kopplung wird die gemeinsame
B erbt, anstatt A und B. Andererseits hat ein
Vererbung von Allelen an verschiedenen Gen-
nicht erkranktes Individuum das Allel A und
loci als Assoziation bezeichnet. Geschieht dies
das Allel b geerbt. Man kann dies jedoch nur
häufiger oder seltener als nach der individuellen
unterscheiden, wenn die Eltern heterozygot
Häufigkeit der beteiligten Allele zu erwarten
sind. Im vorliegenden Fall liegen die beiden Al-
wäre, so spricht man von Kopplungsungleichge-
lele A und b auf dem einen und die Allele a und
wicht (Kopplungs-Disäquilibrium, S. 104).
B auf dem anderen väterlichen Chromosom (in
A. Rekombination durch Crossing-over cis-Position). Es wäre auch möglich, dass beim
Es hängt vom zytologischen Vorgang (1) in der Vater das Allel A auf dem einen und das Allel B
Meiose ab, ob benachbarte Gene auf demselben auf dem anderen Chromosom liegt (in trans-
elterlichen Chromosom verbleiben oder ge- Position). Diese beiden Möglichkeiten stellen
trennt werden. Tritt zwischen den beiden Gen- zwei verschiedene Kopplungsphasen dar. Die
loci A und B mit den Allelen A und a bzw. B und Erkennung von Rekombination gegenüber
b kein Crossing-over ein, so bleiben sie auf Nicht-Rekombination setzt die Kenntnis der el-
demselben Chromosom zusammen (gekop- terlichen Kopplungsphase voraus.
pelt). Die in der Meiose gebildeten Gameten g Medizinische Relevanz. Segregationsanalyse
sind in diesem Fall nicht rekombinant und ent- gekoppelter Gene wird in der genetischen Dia-
sprechend den elterlichen Chromosomen. Tritt gnostik verwendet um Aufschluss über die
dagegen Crossing-over zwischen den beiden mögliche An- oder Abwesenheit einer Muta-
Genloci ein, so sind die gebildeten Gameten in tion zu erhalten, die direkt nicht nachgewiesen
Bezug auf diese beiden Genloci rekombinant. werden kann (indirekte DNA-Diagnostik, s. S.
Der zytologische Vorgang (1) spiegelt sich im 344). Man vergleicht innerhalb einer Familie
genetischen Ergebnis wider (2). Für zwei auf die Genotypen der Erkrankten mit denen der
demselben Chromosom benachbart liegende nicht Erkrankten wie in Teil B gezeigt. Voraus-
Genloci A und B gibt es zwei Möglichkeiten des setzung ist allerdings eine korrekte Zuordnung
genetischen Ergebnisses: Nicht rekombinant des Phänotyps (Krankheit) zum untersuchten
(Gameten entsprechen dem elterlichen Geno- Genlocus. Dies kann in der Praxis schwierig
typ) und rekombinant (neue Kombination). Die oder unmöglich sein.
beiden Möglichkeiten können allerdings nur
dann unterschieden werden, wenn der elterli- Correns C: Scheinbare Ausnahmen von der Mendel-
schen Spaltungsregel für Bastarde. Ber Dtsch Bot
che Genotyp heterozygot ist (Aa bzw. Bb). Ges 20: 97-172, 1902.
B. Kopplung eines Krankheitslocus mit Griffiths AJF et al: An Introduction to Genetic Analysis.
7th ed. WH Freeman & Co., New York, 2000 (mit CD-
einem Markerlocus Rom).
Gezeigt wird die Segregation von zwei gekop- Harper PS: Practical Genetic Counselling. 6th ed. Ed-
ward Arnold, London, 2004.
pelten Genloci in einer Familie. Es gibt zwei Rimoin DL et al, editors: Principles of Medical Gene-
Möglichkeiten: 1. Keine Rekombination und 2. tics. 5th ed. Churchill-Livingstone-Elsevier, Philadel-
Rekombination. Der eine Locus (B) stellt eine phia, 2007.
Kopplung und Rekombination 95

1. Cytologischer Vorgang 2. Genetisches Ergebnis


Elterliche Elterlicher
Chromosomen A B Genotyp A a Locus A
(heterozygot
Aa und Bb)

a b B b Locus B

Meiose
ohne neue DNAmit
Crossing-over Meiose
Crossing-over
A B A B

a b a b a a
A A
Gameten
Gameten B b b B
A B A b
1 3

2 4
a b a B nicht rekombinant rekombinant
(entspricht dem (neu)
nicht rekombinant rekombinant elterlichen Genotyp)

A. Rekombination durch Crossing-over

1. Keine Rekombination

Markerlocus A a A A

Krankheitslocus B b b b

a A A A a A a A A A A A

b b B b b b b b B b B b

2. Mit Rekombination
Markerlocus A a A A

Krankheitslocus B b b b

a A A A a A A A a A A A

b b B b b b b b B b B b

rekombinant
B. Kopplung eines Genlocus mit autosomal dominanter Mutation (B)
B. mit Markerlocus (A)
96 Formale Genetik

Kopplungsanalyse sie regelmäßig durch Rekombination getrennt


werden.
Kopplungsanalyse bezieht sich auf verschie-
Die Tabelle in A zeigt (vereinfacht) die LOD
dene Tests, um festzustellen, ob zwei oder mehr
Scores bei Rekombinationsfraktionen von we-
Genloci nahe beieinander entlang eines DNA-
niger als 0,05 (Zeile a), bei 0,15 (b und c), sowie
Abschnitts auf demselben Chromosom liegen,
bei 0,20 (d). Ein LOD Score von 3 wird nur in
d. h. gekoppelt sind. Zur Durchführung benötigt
Zeile a ( X 0,05 Rekombinationshäufigkeit, d. h.
man Daten über die untersuchten Loci von ei-
hohe Wahrscheinlichkeit für enge Kopplung)
ner möglichst großen Anzahl von Familien (El-
und Zeile b erreicht (bei 0,15 nicht enge Kopp-
tern und Kinder, möglichst auch Großeltern und
lung), während in Zeile c und d nur ein maxi-
Geschwister). Dabei muss man feststellen, wie
maler LOD Score von 1,6 bzw. 0,3 erreicht wird.
häufig Rekombination zwischen den untersuch-
(Tatsächlich werden LOD Scores viel genauer
ten Loci eingetreten ist und wie häufig nicht.
berechnet als hier dargestellt und ein maxima-
Daraus kann man die Rekombinationshäufig-
ler LOD Score von 3,0 wird nur als Ausnahme
keit (Rekombinationsfraktion) berechnen. Für
von Kopplung betrachtet).
die Durchführung einer Kopplungsanalyse ste-
hen zahlreiche, komplexe, computergestützte B. LOD-Score-Kurven für verschiedene
statistische Verfahren zur Verfügung. Mit ihnen Rekombinationsfraktionen
wird auf verschiedene Weise die Wahrschein-
Das Diagramm zeigt (vereinfacht) die Vertei-
lichkeit ermittelt, ob die beobachteten Zahlen
lung der LOD Scores bei verschiedenen Rekom-
tatsächlich durch Kopplung erklärt werden kön-
binationsfraktionen (Häufigkeiten) der in der
nen und nicht durch zufälliges Abweichen vom
Tabelle in Feld A oben enthaltenen Werte.
Vererbungsmuster vorgetäuscht sind. Drei An-
sätze sind häufig: (i) Kopplungsanalyse von C. Multilocus-Analyse
zwei Loci, z. B. ein Krankheitslocus und ein Mar-
Infolge der Verfügbarkeit von zahlreichen poly-
kerlocus, (ii) Kopplungsanalyse mehrerer Loci
morphen DNA-Markern werden meistens zahl-
(Multilocus-Analyse), (iii) Kopplungsanalyse für
reiche Loci gegeneinander auf Kopplung ge-
das gesamte Genom (Genom-Scan, s. S. 202).
prüft (Multilocus-Analyse). Dabei kann Infor-
Die durch genetische Kopplung ermittelte Ent-
mation über die Anordnung (Reihenfolge) der
fernung von Genloci wird in CentiMorgan aus-
Loci gewonnen werden (ausgedrückt als Lokali-
gedrückt (cM, benannt nach Thomas H. Morgan,
sations-Score) und eine Kopplungskarte erstellt
dem Begründer der Genetik durch Untersu-
werden. Hier wird das Ergebnis für einen bis-
chung der Taufliege Drosophila melanogaster).
her unbekannten Locus im Vergleich zu vier
Ein von Wert 1,0 cM entspricht einer Rekombi-
Markerloci A, B und C, und D gezeigt. Jeder Gip-
nationshäufigkeit von 0,01 %.
fel spiegelt Kopplung wider. Der unbekannte
A. LOD Scores Locus hat einen Gipfel zwischen B und C. Dies
zeigt, dass der unbekannte Locus wahrschein-
Kopplung von zwei Genloci wird angenommen,
lich zwischen den Markerloci B und C liegt.
wenn die Wahrscheinlichkeit von Kopplung ge-
(Abbildungen modifiziert nach Emery, 1986)
genüber Nicht-Kopplung 1000fach größer ist.
Dies entspricht einem Verhältnis von 1000 : 1 Byerley WF: Genetic linkage revisited. Nature 340:
(103: 1). Als Logarithmus ausgedrückt beträgt 340-341, 1989.
dies 3,0. Diese Zahl wird als LOD Score bezeich- Cantor RM: Analysis of genetic linkage, p. 151-166. In:
Rimoin DL, Connor JM, Pyeritz, RE, Korf BR, editors:
net (abgeleitet aus engl. Logarithm of the
Principles of Medical Genetics. 5th ed. Churchill-Liv-
Odds). Odds bezeichnet beim Wetten das Ver- ingstone-Elsevier, Philadelphia, 2007.
hältnis der Wahrscheinlichkeit zu gewinnen Emery AEH: Methodology in Medical Genetics. 2nd ed.
gegenüber nicht zu gewinnen. Für die Ermitt- Churchill Livingstone, Edinburgh, 1986.
lung des LOD Score wird auf Kopplung bei ver- Ott J: Analysis of Human Genetic Linkage. Johns Hop-
kins University Press, Baltimore, 1999.
schiedenen Rekombinationsfraktionen geprüft, Terwilliger J, Ott, J: Handbook for Human Genetic Lin-
z. B. bei X 0,05 (kleiner als 5 % Rekombinations- kage. Johns Hopkins University Press. Baltimore,
häufigkeit), bei 0,05, bei 0,10 (10 %) etc. Ab 0,50 1994.
liegen die Loci entweder auf verschiedenen
Chromosomen oder so weit auseinander, dass
Kopplungsanalyse 97

Rekombinationsfraktion

<0,05 0,05 0,10 0,15 0,20 0,30 0,35 0,40 0,45 0,50

a 3 0,7 0,3 0,2 0,01 0

b 0 0,1 3 0,2 0

c 0 0,2 0,7 1,6 1,0 0

d 0 0,1 0,2 0,3 0,2 0,1 0,1 0

A. LOD Scores

3,0

2,5

a b
2,0
LOD Score

1,5

1,0
c
0,5
d

0,05 0,10 0,15 0,20 0,25 0,30 0,35 0,40 0,45 0,50
Rekombinationsfraktion

B. LOD Score Kurven für verschiedene Rekombinationsfraktionen

30

20
Lokalisations-Score

10

-10
-15
Markerloci A B C D
wahrscheinliche Lage des unbekannten Locus
C. Multilocus Analyse
98 Formale Genetik

Quantitative Unterschiede Anzahl von Genen erklären, durch welche die


genetischer Merkmale Länge determiniert wird. (Abbildung modifi-
ziert nach Ayala & Kieger, 1984).
Viele genetisch bedingte Merkmale sind nur
quantitativ definierbar, aber nicht durch ein- B. Anzahl beteiligter Genloci bei
deutige von einem anderen Merkmal abgrenz- quantitativ definierten Merkmalen
bare Beobachtungen. Ein Beispiel für ein Mess-
Da mehr als ein Gen zu einem quantitativ defi-
ergebnis, das sich nicht sehr von einem ande-
nierten Merkmal beiträgt, wird dies als poly-
ren unterscheidet, wäre der Blutdruck oder die
gene (Fisher 1918) oder multifaktorielle (Falco-
Blutzuckerkonzentration. Die auch ihnen zu-
ner 1981) Vererbung bezeichnet. Wieviele Gen-
grunde liegenden genetischen Gesetzmäßig-
loci kommen in Betracht? Bei einem einzigen
keiten sind nicht als Mendelsche Erbgänge er-
Genlocus ist die Situation einfach, wenn man
kennbar. Dazu gehören beim Menschen unter
der Elterngeneration (P) nur ein Genpaar (zwei
anderem Körperhöhe, Augen-, Haut- und Haar-
verschiedene Allele A und a) unterstellt, die je-
farbe, Verhaltensmuster, Lernfähigkeit, Blut-
weils homozygot aa und AA vorliegen (1). Bei
druck oder eine Neigung zu bestimmten Krank-
zwei Genloci mit je zwei Allelen, aabb und
heiten etc. Auch bei Tieren und Pflanzen treten
AABB, würden in der F2-Generation fünf Geno-
quantitativ definierbare genetisch bedingte
typen resultieren (2). Bei drei Loci mit Homozy-
Merkmale auf. Der englische Genetiker Francis
gotie aabbcc und AABBCC würden in der F2-Ge-
Galton (1822–1911) führte 1883 für den Ver-
neration sieben Genotypen zu erwarten sein
such einer genetischen Analyse komplexer,
(3). Die in der F2-Generation in Situation 1, 2
quantitativ definierter Merkmale den Begriff
und 3 noch beobachtbaren Unterschiede wei-
„Quantitative Genetik“ ein. Der Genetiker und
chen bei mehr Loci einer glatten Verteilungs-
Mathematiker R. A. Fisher und andere führten
kurve (4). Geringe Unterschiede sind einzeln
ab 1918 neue Methoden zur Analyse in der
nicht mehr feststellbar.
quantitativen Genetik ein. Hier werden einige
Prinzipien der Erfassung quantitativ determi- g Medizinische Relevanz. Genloci, die zu einem
nierter Merkmale abgeleitet. quantitativ fassbaren Merkmal beitragen (engl.
Trait, ein beobachtbarer Teil eines Phänotyps),
A. Länge der Sprossachse bei Nicotiana werden als QTL bezeichnet (Quantitative Trait
longiflora Locus). Die Analyse von QTLs hat große Bedeu-
Die Länge der Sprossachse der Tabakpflanze tung für die Analyse komplexer Krankheiten
(Nicotiana longiflora) ist quantitativ genetisch und anderen Merkmalen, deren Auftreten auch
bedingt. Dies wurde bewiesen, indem man von Umweltfaktoren beeinflusst wird, z. B. des
Pflanzen der Elterngeneration (P) mit einer Herzkreislauf, Bluthochdruck, Diabetes melli-
durchschnittlichen Länge der Sprossachse von tus, psychiatrische Erkrankungen, genetische
40 cm (links im Bild oben) mit Pflanzen von Grundlagen von Verhaltensweisen, kognitive
durchschnittlich 90 cm Sprossachse (oben und intellektuelle Fähigkeiten etc.
rechts) kreuzt. In der nächsten Generation (F1)
Ayala FJ, Kiger JA: Modern Genetics 2nd ed. Benjamin/
zeigen die Pflanzen eine Verteilung der Spross- Cummings Publishing Co., Menlo Park, California,
länge, die länger als die bei den Eltern mit kur- 1984.
zer Sprossachse, aber kürzer als die der Eltern Falconer DS: An Introduction to Quantitative Genetics.
mit langer Sprossachse sind. Nach einer weite- 2nd ed. Longman, London, 1981.
Griffiths AJF, et al.: An Introduction to Genetic Analysis,
ren Generation (F2) ist die Sprossachsenlänge 5th ed. WH Freeman & Co., New York, 2000.
breiter nach kurz und lang verteilt als in der King R, Rotter J, Motulsky AG, eds.: The Genetic Basis of
vorhergegangenen F1-Generation. Züchtet man Common Disorders. 2nd ed. Oxford Univ. Press, Ox-
Pflanzen der F2-Generation mit kurzer, mittle- ford 2002.
Vogel F, Motulsky AG: Human Genetics and Approa-
rer und langer Sprossachse, so entstehen in der
ches. 3rd ed. Springer Verlag, Heidelberg – New
darauf folgenden Generation (F3) drei unter- York, 1997.
schiedliche Verteilungen der Länge: kurz
40–60 cm, mittlere Länge (50–70 cm) und lang
(70–85 cm). Dies lässt sich durch eine unter-
schiedliche Verteilung einer nicht bekannten
Quantitative Unterschiede genetischer Merkmale 99

30 40 50 60 70 80 90 100

70
60
50 Elterngeneration (P)
Anteil in %

40
30
20 Länge
ca. 40 mm des ca. 90 mm
10 Sprosses

F1-Generation

F2-Generation

F3-Generation
Eltern (Durchschnitt)

Eltern kurz Eltern lang


A. Länge der Sprossachse bei Nicotiana longiflora nach der Kreuzung
unterschiedlicher Elternpflanzen

Anzahl 1 2 3 4
Genpaare
aa AA aabb AABB aabbcc AABBCC aa..... AA....

Aa AaBb AaBbCc Aa....

F1

2 6 20
F2 4 16 15 64 15
4 4
64 64
ohne 1 1 16 16
6 6
Umwelt- 4 4 1
1
16 1 64 64 1
variation 16
64 64

F2
mit
Umwelt-
variation

B. Häufigkeitsverteilung in der F2-Generation bei unterschiedlicher Anzahl von Genloci


100 Formale Genetik

Multifaktorielles gen (n) geteilt. Da die Anzahl der unabhängigen


Schwellenwertmodell Messungen als n –1 definiert ist, wird mit ei-
nem Korrekturfaktor (n/n –1) multipliziert. Da-
Quantitativ definierte genetische Merkmale raus wird die Standardabweichung S ermittelt
sind in der Tier- und Pflanzenwelt häufiger als (Formel 6).
qualitativ definierte an den Mendelschen Ge-
setzmäßigkeiten erkennbare. Ein großes Reper- B. Schwellenwertmodell
toire computergestützter statistischer Metho- Man kann die Neigung (Suszeptibilität) zu ei-
den existiert für die quantitative genetische ner bestimmten Krankheit mit einer kontinu-
Analyse. Hier können nur Teilaspekte verein- ierlichen Verteilung interpretieren. Jedoch kön-
facht dargestellt werden. nen zwei Gruppen unterschieden werden, Er-
A. Normalverteilung krankte und Nichterkrankte (1).
Bei Verwandten 1. Grades (Eltern und Ge-
Wenn man die quantitativ gewonnenen Daten schwister) ist das Krankheitsrisko höher (2) als
aus einer Population (z. B. Körperhöhe oder bei Verwandten 2. Grades (z. B. Cousins, 3). All-
Blutdruck) in einem Diagramm in der Abszisse gemein ausgedrückt, ist die Krankheitsneigung
(X-Achse) und die beobachtete Anzahl in der bei Verwandten 1. Grades um die Hälfte des
Ordinate (Y-Achse) aufträgt, so entspricht in Mittelwertes verschoben, bei Verwandten
der Regel die aus der Verteilung der Häufigkei- 2. Grades um ein Viertel des Mittelwertes.
ten resultierende Kurve der Form einer Gauss-
Glockenkurve (Normalverteilung). Sie kann C. Unterschiede im Schwellenwert
durch den Mittelwert x in zwei Hälften a und b Bei einigen multifaktoriell bedingten Erkran-
geteilt werden (1). Berücksichtigt man eine kungen sind das männliche und das weibliche
Standardabweichung (s) nach links (–1s) und Geschlecht unterschiedlich häufig betroffen.
eine nach rechts (+1s), so erhält man zwei wei- Sind beispielsweise weibliche Individuen in der
tere Flächen, c auf der linken Seite und d auf der Bevölkerung seltener betroffen (1), so kann sich
rechten Seite. Die Felder a und b umfassen je der Anteil erkrankter Verwandter unterschei-
34,13 % der Gesamtfläche unter der Kurve (2). den, je nachdem, ob es sich um Verwandte
Bei zwei bzw. drei Standardabweichungen (2s (1. Grades) eines männlichen Patienten (be-
und 3s) entstehen außen drei weitere Felder, e zeichnet als Proband, 2) oder eines weiblichen
und f (3). Probanden (3) handelt. Wenn der Anteil er-
Die zugrunde liegenden statistischen Grundla- krankter Verwandter eines weiblichen Proban-
gen bestehen aus sechs Formeln (nach Burns & den größer ist (3) als der eines männlichen Pro-
Bottino, 1989, Seite 372 ff). Der Mittelwert (x) banden (2), so wird diese zunächst paradox er-
ergibt sich aus dem Quotient der Summe der scheinende Beobachtung als Hinweis interpre-
individuellen Einzelmessungen ( Ł x) und der tiert, dass für die Manifestation der Erkrankung
Anzahl der Individuen (n) (Formel 1). Zahlrei- bei weiblichen Individuen, ein höherer Anteil
che Einzelmessungen ergeben die Summe der krankheitsdisponierender genetischer Faktoren
Häufigkeiten fx( Ł fx) in Formel 2. Die Varianz vorliegt als in dem seltener betroffenen Ge-
der Population (s2) ist ein Ausdruck der Varia- schlecht. Dies wird als Carter-Effekt bezeichnet,
bilität (Formel 3). Sie ist definiert als das Qua- benannt nach dem englischen Humangenetiker
drat der Summe ( Ł ) aller individuellen Einzel- Cedric O. Carter, der dies 1962 beschrieben hat.
messungen (x) minus des Durchschnittswertes
der Population (m), geteilt durch die Anzahl der g Medizinische Relevanz. Die Analyse multifak-
Individuen (N) (Formel 3). Da es sich jedoch torieller Vererbung hat vor allem in Hinblick
häufig um Stichproben aus einer Population auf häufige Erkrankungen beim Menschen be-
handelt, können Mittelwert und die Gesamt- sondere Bedeutung.
zahl der Individuen meistens nicht direkt er-
Burns GW, Bottino PJ: The Science of Genetics. 6th ed.
mittelt werden. Statt Einzelmessungen wird Macmillan Publishing Co., New York, 1989.
die Varianz der Stichprobe (S2) geschätzt (For- Falconer DS: Introduction to Quantitative Genetics. 2nd
mel 4). Dabei wird das Quadrat der Summe der ed., Longman, London, 1981.
individuellen Messungen (x) minus des Mittel- Fraser CF: Evolution of a palatable multifactorial thres-
hold model. Am J Hum Genet 32: 796-813, 1980.
wertes (x) durch die Gesamtzahl der Messun-
Multifaktorielles Schwellenwertmodell 101

∑x
1. 1 x = n
(Durchschnitt)

a b
∑fx
x 2 x = n

3 σ2 = ∑ (x - μ)2 (Varianz)
2
N

∑ (x - x)2 n
c a b d 4 s2 = n
-1s +1s n-1

5 s2 = ∑ (x - x)2
(n - 1)
3

∑f (x - x)2
e c a b d f 6 s = n-1
-3s -2s -1s x +1s +2s +3s
(Standardabweichung)

A. Normalverteilung der Häufigkeit eines Merkmals

1 Schwellen- 1
Bevölkerung
wert
Häufigkeit

Häufigkeit

Anteil
erkrankter
Individuen

Krankheitsneigung Krankheitsneigung

2 2
Bevölkerung Verwandte
ersten
Grades
Verwandte eines
ersten
Grades männlichen
Probanden

1/2 x

3 3
Bevölkerung
Verwandte
ersten
Grades
Verwandte eines
zweiten weiblichen
Grades Probanden

1/4 x
X
B. Multifaktorielles Schwellenwertmodell C. Unterschiedlicher Schwellenwert
102 Formale Genetik

Verteilung von Genen in einer Häufigkeit der beiden Allele in einer Population
Population die Binomialbeziehung (p + q)2= 1.
Der Ausdruck p2 entspricht der Häufigkeit der
Das Gebiet der Populationsgenetik beschäftigt Genotypen AA, 2pq entspricht der Häufigkeit
sich mit den Gesetzmäßigkeiten, welche die der Heterozygoten Aa, q2 sind die Homozygo-
Häufigkeit von Allelen in einer Population be- ten aa. Aus der Kenntnis der Häufigkeit eines
stimmen, und den Faktoren, welche diese ver- der Genotypen kann man auf die Allelen-Häu-
ändern können. Eine Population kann durch die figkeit schließen. Kennt man nur die Häufigkeit
Verteilung von Genen, d. h. die Häufigkeit von q2 der Homozygoten aa, so kann man die Häu-
Allelen an verschiedenen Genloci definiert figkeit der beiden anderen Genotypen aus p =
werden. 1 – q ermitteln.
A. Verteilung von Genotypen bei g Medizinische Relevanz. In der genetischen Be-
verschiedenen Paarungstypen ratung kann man aus der Beziehung p + q = 1
Wie auf S. 86 gezeigt, sind bei einem Genlocus die Wahrscheinlichkeit ermitteln, mit der ein
mit zwei Allelen (ein dominant erbliches Allel nicht erkranktes Geschwister eines von einer
A und ein rezessiv erbliches Allel a) sechs Paa- autosomal rezessiv erblichen Krankheit betrof-
rungstypen möglich (1–6). Wenn einer der El- fenen Patienten heterozygot ist. Die a priori
tern homozygot und einer der Eltern heterozy- Wahrscheinlichkeit beträgt 2/3 (66,6 %), da aus
got ist, wie in den Paarungstypen 2 und 4, re- der 1:2:1-Verteilung für die Genotypen AA, Aa
sultiert eine 1 : 1 Verteilung der Genotypen bei und aa der Genotyp aa ausscheidet, weil die Er-
den Nachkommen (Genotypen 0,5 AA und 0,5 krankung nicht vorliegt. Es kommt nur 1/3 AA
Aa). Sind beide Eltern heterozygot (Paarungs- und 2/3 Aa in Frage. Das tatsächliche Risiko
typ 3), so treten bei ihren Kindern drei Genoty- wird aber durch die Allelenfrequenz des mu-
pen im Verhältnis 1 : 2 : 1 auf (0,25 AA, 0.5 Aa tanten Allels a in der Bevölkerung bestimmt.
und 0,25 aa). Bei den Paarungstypen 1, 5 und 6 Dies ergibt sich aus p2 (AA) + pq (Aa) + q2 (aa).
tritt bei den Kindern ein einziger Genotyp auf. Beträgt die Krankheitshäufigkeit z. B. 1:10000,
so wäre q = 1/100. Demnach wäre p = 0,99 oder
B. Allelen-Häufigkeit vereinfacht 1. Die Wahrscheinlichkeit für Hete-
Die Häufigkeit (Frequenz), mit der ein Allel in rozygotie Aa des nicht erkrankten Geschwisters
einer Population an einem gegebenen Genlocus beträgt 1/50 (2 %). Dies leitet sich ab aus 2pq =
vertreten ist, bezeichnet man als Allelen-Häu- 2 x 1 x 1/100. Für die Kinder dieses Geschwis-
figkeit (auch Genfrequenz genannt). ters würde ein Erkrankungsrisiko von 1:300
Gibt es für einen Genlocus zwei mögliche Allele (0,33 %) anzunehmen sein (abgeleitet aus 2/
dominant A und rezessiv a, so können folgende 3 × 1/50 × 1/4 = 1/300 oder 0,33 %). Das eigene
Genotypen auftreten: AA, oder Aa, oder aa. Die Heterozygotenrisiko ist 2/3, das des Partners 1/
Häufigkeit, mit der eine dieser Konstellationen 50; das Krankheitsrisiko beträgt 1⁄4 (25 %),
(AA bzw. aa homozygot oder Aa heterozygot) wenn beide heterozygot sind. Dieses Risiko
auftritt, hängt von der Häufigkeit der beiden wäre zwar höher als das Bevölkerungsrisiko
Allele in der Bevölkerung ab. Die Häufigkeit des von 1:10 000 (0,01 %), es läge aber im Bereich
Allels A wird als p bezeichnet, die des Allels a des ohnehin bei jeder Schwangerschaft anzu-
als q. Die Häufigkeit der beiden Allele zusam- nehmenden allgemeinen Risikos von ca. 1–2 %
men ist 100 % (1,0). Dementsprechend gilt p + q für das Auftreten irgendeiner Krankheit. Sofern
= 1. ein genetischer Heterozygotentest existiert,
Bei gleicher Häufigkeit von je 0,5 (50 %) erge- würde man ihn meistens anwenden.
ben sich bei den Kindern je 0,25 für AA und aa,
Griffiths AJF et al: Introduction to Genetic Analysis, 7th
sowie 0,5 für Aa (1). Beträgt die Häufigkeit p ed., WH Freeman & Co, New York, 2000.
des Allels A 0,6 (60 %) und die des Allels a 0,4 Harper P S: Practical Genetic Counseling. 6th ed., Ed-
(40 %), so ergibt sich eine Häufigkeit der Geno- ward Arnold, London, 2004.
typen von 0,36 für AA, 2 × 0,24 (= 0,48) für Aa Turnpenny PD, Ellard S: Emery’s Elements of Medical
Genetics, 13th ed., Elsevier-Churchill-Livingstone,
und 0,16 für aa (2). Da bei zwei Allelen an je- Edinburgh, 2007.
dem Genlocus nur drei Genotypen möglich
sind, AA oder Aa oder aa, ergibt sich für die
Verteilung von Genen in einer Population 103

AA AA Genotyp
1 bei den Eltern bei den Nachkommen

AA AA und AA 1,0 AA

AA Aa
2 AA und Aa 0,50 AA
0,50 Aa
AA Aa

Aa Aa 0,25 AA
3 Aa und Aa 0,50 Aa
0,25 aa
AA Aa Aa aa

Aa aa
0,50 Aa
Aa und aa
4 0,50 aa
Aa aa

AA aa

5 AA und aa 1,0 Aa
Aa

aa aa
6 aa und aa 1,0 aa
aa

A. Erwartete Häufigkeit von Genotypen bei den Kindern von Eltern mit verschiedenen
A. Paarungstypen

Eltern 0,5 A 0,5 a A = 0,60 a = 0,40

AA Aa
0,5 A A 0,36 0,24
0,25 0,25 p
0,6 AA Aa

Aa aa a 0,24 0,16
0,5 a 0,25 0,25 0,4 Aa aa q
1 2
Kinder
p q
p = 0,50 (Häufigkeit von A) p2 + 2 pq + q2 = 1
q = 0,50 (Häufigkeit von a) 0,36 + 0,48 + 0,16 = 1,0
B. Allelen-Häufigkeit (AA) (Aa) (aa)
104 Formale Genetik

Hardy-Weinberg-Äquilibrium Ein in einer Population nicht vorhandenes oder


seltenes Allel kann durch Wanderung (Migra-
Das Hardy-Weinberg-Gleichgewichtsprinzip
tion) in die Population eingeführt werden und
besagt, dass an einem gegebenen Genlocus die
sich anschließend bei Vergrößerung der Popula-
Häufigkeit der Allele in der Bevölkerung aus
tion ausbreiten (Gründereffekt).
der Verteilung der Genotypen abgeleitet wer-
(Photographie-Ausschnitt aus „Coney Island,
den kann, und dies von einer Generation zur
1938, Photograph by Weegee“, hilma hilcox, Fo-
anderen gleich bleibt. Es müssen aber be-
tofolio).
stimmte Bedingungen erfüllt sein.
Die Gesetzmäßigkeit und Bedingungen wurden g Medizinische Relevanz. Nach dem Hardy-
1908 von dem englischen Mathematiker Hardy Weinberg-Prinzip entspricht die Häufigkeit der
und dem Stuttgarter Arzt Weinberg erstmals Kombinationen von Allelen gekoppelter Loci ih-
geklärt (Hardy-Weinberg-Äquilibriumsprin- rer individuellen Häufigkeit. Abweichend kann
zip). jedoch eine bestimmte Kombination bevorzugt
auftreten, z. B. ein Krankheitslocus bevorzugt
A. Gleichgewicht zwischen Mutation gekoppelt mit einem bestimmten Allel sein.
und Selektion Dies wird als Kopplungs-Ungleichgewicht (engl.
Man könnte erwarten, dass ein im homozygo- Linkage disequilibrium) bezeichnet. Zum Bei-
ten Zustand zu einer schweren Erkrankung spiel treten Mutationen am CF-Locus (Cystische
führendes Allel (hier genannt Allel a) aus der Fibrose, vgl. S. 212) oder Hämoglobin-Mutatio-
Population im Laufe der Zeit verschwindet. nen (vgl. S. 302) bevorzugt assoziiert mit be-
Dies ist nicht der Fall, weil die in jeder Genera- stimmten Allelen von gekoppelten Marker-Loci
tion durch Erkrankung bei Homozygoten (aa) auf (Haplotypen). Die bevorzugte Assoziation
ausscheidenden Allele durch neue Mutationen bestimmter Allele an gekoppelten Loci kann
ersetzt werden. Es ergibt sich ein Gleichge- mehrere Gründe haben. Ein bei monogenen
wicht zwischen Häufigkeit einer Mutation und Krankheiten häufiger Grund ist der Gründeref-
Selektion gegen sie. Die Häufigkeit der drei Ge- fekt. Die ursprüngliche (ancestrale) Mutation ist
notypen ergibt sich aus der Binomialbeziehung in einem bestimmten Haplotyp aufgetreten, der
(p + q)2 = 1, wobei p der Häufigkeit des Allels A zufällig in der Population vorkam, und danach
und q der Häufigkeit des Allels a entspricht. aufgrund der engen Kopplung ohne Rekombi-
Zwischen dem Ausscheiden durch Krankheit nation über viele Generationen vererbt worden.
und der Mutationshäufigkeit kommt es zu ei- Cavalli-Sforza LL, Bodmer WF: The Genetics of Human
nem Gleichgewicht. Populations. WH Freeman & Co., San Francisco,
1971.
B. Die Allelen-Häufigkeit Cavalli-Sforza LL, Menozzi P, Piazza A: The History and
beeinflussende Faktoren Geography of Human Genes. Princeton Univ. Press.
Princeton, New Jersey, 1994.
Das Gleichgewichtsprinzip nach Hardy-Wein- Croucher PJP: Linkage disequilibrium. Nature Encyclo-
berg setzt voraus, dass die Population ausrei- pedia Hum Genome 3: 727-728. Nature Publishing
chend groß ist und die möglichen Paarungsty- Group, London, 2003.
Eriksson AW et al, eds: Population Structure and Gene-
pen entsprechend der Häufigkeit der Allele vor- tic Disorders. Academic Press, London, 1980.
kommen. Selektion für ein Allel (z. B. bei Hete- Jorde L: Linkage disequilibrium and the search for
rozygoten gegenüber Homozygoten) führt da- complex diseases. Genome Res 10: 1435-1444,
zu, dass dieses Allel im Laufe der Zeit häufiger 2000.
Kimura M, Ohta T: Theoretical Aspects of Population
wird. Die Häufigkeit eines Allels kann durch Genetics. Princeton Univ. Press, Princeton, New Jer-
nicht zufällige Paarung verschoben werden sey, 1971.
wenn bestimmte Paarungstypen bevorzugt auf- Kruglyak L: Prospects of whole-genome linkage dise-
treten (assortative Paarung). Das Hardy-Wein- quilibrium mapping of common disease genes. Na-
ture Genet 22: 139-144, 1999.
berg-Äquilibriumsprinzip setzt deshalb zufäl-
lige Paarung (Panmixie) voraus. Eine Änderung
der Mutationshäufigkeit kann das Gleichge-
wicht verschieben. In einer kleinen Population
kann sich durch zufällige Fluktuation der Anteil
der Genotypen verschieben (genetische Drift).
Hardy-Weinberg-Äquilibrium 105

Die aus einer Population


A A durch schwere Erkrankung
bei Homozygoten aa
Aa ausscheidenden Allele a
a a werden durch neue

Aa Mutation ersetzt.
Es besteht ein Gleichgewicht.

Genotypen Häufigkeit
neu durch
Mutation
Homozygote AA p2
aa Homozygote Heterozygote Aa 2pq
scheiden aus Homozygote aa q2
durch Krankheit

A. Konstante Allelen-Häufigkeit (Hardy-Weinberg-Äquilibrium)

Selektion für Nicht zufällige


Heterozygote Paarung verschiebt
erhöht q Anteil p und q

Änderung Zufällige Fluktuation


der Mutations- in einer kleinen
häufigkeit Population verschiebt
erhöht q Anteil p und q

B. Einige die Allelen-Häufigkeit beeinflussende Faktoren


106 Formale Genetik

Genetische Folgen von und drei Schritte über D und F, insgesamt fünf
Blutsverwandtschaft [(1/2)5= 1/32], ebenso von B nach G über C, so-
wie über D und F. Das Gesamtrisiko beträgt 1/16.
Konsanguinität (elterliche Blutsverwandt-
schaft, „vom selben Blut“) bedeutet, dass zwei B. Identität durch gemeinsame
Individuen in den vorausgegangenen Generati- Herkunft (IBD)
onen mindestens einen gemeinsamen Vorfah-
Die Probabilität (Wahrscheinlichkeit) von Ho-
ren gehabt haben. Meist bezieht sich dies auf
mozygotie durch Abstammung von einem (oder
die letzten 2–4 Generationen. Dieses Allel ist
mehreren) gemeinsamen Vorfahren wird ermit-
identisch durch gemeinsame Herkunft (Iden-
telt, indem man die Gesamtzahl der Schritte von
tity by Descent, IBD). Wenn dieses Allel eine
der Generation eines Ancestors zu der Genera-
krankheitsauslösende autosomal rezessive Mu-
tion eines möglicherweise durch IBD (Identity
tation darstellt, folgt daraus ein erhöhtes Risiko
by Descent) homozygoten Individuums be-
für das Auftreten einer Krankheit. Die Höhe
stimmt.
dieses Risikos ergibt sich aus dem Grad der Ver-
Bezeichnen wir von den vier möglichen Allelen
wandtschaft.
an einem bestimmten Genlocus bei den Vorfah-
A. Einfache Typen von Konsanguinität ren (Großeltern von III und IV) als A und B bei I,
Entscheidend ist die Zahl der Generations- sowie C und D bei IV. Der Weg des Allels A von I
schritte (Verwandtschaftsgrad, engl. Coefficient zu III entspricht zwei Generationsschritten von
of Relatedness, r) vom gemeinsamen Vorfahren je 1/2 (1/2)2, ebenso der von I zu IV. Da es sich
über beide Eltern. Der höchst mögliche Ver- um kombinierte Wahrscheinlichkeiten handelt,
wandtschaftsgrad von r = 1/2 besteht bei einer werden die einzelnen Schritte multipliziert, d. h.
in Geschwisterverbindung (1) und einer Eltern- (1/2)4×(1/2)4 oder 1/32. Da das Allel von jedem
Kind-Verbindung. Dies wird als Inzest bezeich- der beiden Vorfahren I und II stammen kann,
net. Die Wahrscheinlichkeit von Homozygotie müssen sie addiert werden. Es ergibt sich ein
für ein und daselbe Allel durch IDB beträgt 1/4 IBD von 1/16.
(25 % bzw. 0,25), weil nur je ein Generations-
g Medizinische Relevanz Bei einer genetischen
schritt erforderlich ist [(1/2)2]. Diese Wahr-
Beratung kann man folgende Zahlen für das Ri-
scheinlichkeit wird als Inzuchtkoeffizient, F,
siko für schwere Erkrankungen bei Kindern von
bezeichnet. Inzest ist in allen menschlichen Ge-
blutsverwandten Eltern annehmen: bei Inzest
sellschaften geächtet und illegal.
ca. 30 %, bei Cousinen 1. Grades ca. 3 %, bei Cousi-
Das gelbe Feld oben rechts zeigt den kurzen
nen 2. Grades ca. 1 % (Harper, 2004). Von Inzest
Weg von den beiden gemeinsamen Vorfahren,
abgesehen, ist demnach das absolute Risiko
A und B, über die Geschwister als Eltern, C und
nicht als sehr hoch anzusehen, wenn man be-
D, zum Kind, E, ist. Es sind von A über C nach E
rücksichtigt, dass auch für ein Kind nicht ver-
nur zwei Schritte [(1/2)2= 1/4]. Auch von B über
wandter Eltern ein Risiko von 0,5 bis 1 % ange-
D nach E sind es nur zwei Schritte.
nommen werden muss.
Cousin und Cousine 1. Grades (2) haben gemein-
In verschiedenen Bevölkerungen treten Heiraten
same Großeltern und 1/8 ihrer Gene gemeinsam
von Cousine und Cousin 1. Grades unterschied-
(r = 1/8). Das gelbe Feld rechts zeigt den Weg
lich auf, in Europa und Nordamerika unter 1 %. In
von den Großeltern, A und B, zu deren Kindern,
einigen geographisch oder sozial isolierten Po-
C und D, zum Cousin, G, und der Cousine, H, und
pulationen kann der Anteil hoch sein, z. B. in be-
von G und H zu deren Kind, I. Von A über C und
stimmten Gegenden einiger Länder wie Ägypten
G nach I sind es drei Schritte [(1/2)3= 1/8],
ca. 45 %, Türkei 15 %, Indien 11–24 %, Japan 8 %
ebenso von A über D und H nach I entsprechend
(Vogel & Motulsky, 1997).
zusammen 1/64. Da aber der Weg auch von ei-
nem anderen Ancestor, B, ausgegangen sein Bittles AH, Neel JV: The costs of human inbreeding and
kann, muss diese Möglichkeit durch Addition their implications for variations at the DNA level.
berücksichtigt werden. Das Gesamtrisiko erhöht Nature Genet 8: 117-121, 1994.
Harper PS: Practical Genetic Counselling. 6th ed. Ed-
sich deshalb auf 1/32 (1/64 + 1/64).
ward Arnold, London, 2004.
Bei einer Onkel-Nichten-Verbindung (3) ist der Vogel F, Motulsky AG: Human Genetics. Problems and
Verwandtschaftsgrad r = 1/4. Zum Kind, G, gibt Approaches. 3rd ed. Springer Verlag, Heidelberg –
es vom Ancestor A nach G zwei Schritte über C New York, 1997.
Genetische Folgen von Blutsverwandtschaft 107

A 1 1 B
2 2
1 1
r=1/2 2 2

C D
1 1
2 E 2

1. Geschwister-Verbindung

A B

C D
r=1/8

G H

I
2. Cousinen-Verbindung ersten Grades

A B

C D

r=1/4
F

G
3. Onkel-Nichten-Verbindung
A. Einfache Typen von Blutsverwandtschaft

I II 1 2
I III = 2

1 A, B C, D 1 2
2
I IV = 2
1
2
1 4
I III and IV = 2
A, C oder D A, C oder D
1 2
= 1
1 2 III and IV V 2
2
A, ... A, ...
III IV IBD : 1 4 1 4 x 1 = 1
2 + 2 2 16

V
AA Probabilität für Homozygotie durch gleichen
Ursprung
B. Inzuchtkoeffizient (F) durch gleiche Herkunft (identity by descent, IBD)
108 Formale Genetik

Zwillinge B. Pathologische Zustände bei


C. Dareste hat 1874 erstmalig eineiige (mono-
monozygoten Zwillingen
zygote, MZ) und zweieiige (dizygote, DZ) Zwil- Eine unvollständige Trennung (sog. Siamesi-
linge unterschieden. Beim Menschen tritt eine sche Zwillinge) oder Verbindung des Blutkreis-
Zwillingsschwangerschaft mit einer Häufigkeit laufs bei monozygoten Zwillingen führt zu
von etwa 1:80 auf, meistens dizygot. Monozy- krankhaften Zuständen. Verhältnismäßig häu-
gote Zwillinge treten mit einer weitgehend fig findet sich eine unvollständige Trennung im
konstanten Häufigkeit von 4 auf 1000 Geburten Bereich des Brustkorbs (Thoracopagus) (1). Der
auf, während die Häufigkeit dizygoter Zwillinge Blutkreislauf von Zwillingen kann durch die ge-
in verschiedenen Populationen unterschiedlich meinsame Plazenta verbunden sein (Bildung
ist, etwa 6 auf 1000 bei Europäern, etwa 1 auf eines Shunt, 2). Dies kann dazu führen, dass ein
100 bei Afroamerikanern, und bis zu 4 % in Tei- Zwilling weniger Blut erhält oder sogar ausblu-
len von Nigeria (Harper, 2004). Nach der Ge- tet. Besonders schwere Fehlbildungen entste-
burt von dizygoten Zwillingen treten bei einer hen durch unvollständig ausgebildete oder feh-
folgenden Schwangerschaft erneut DZ mit ei- lende Organe, z. B. Herz (Acardius, 3). Verstirbt
ner Wahrscheinlichkeit von 1,7 % auf. Monozy- ein Zwilling schon in einer sehr frühen Phase
gote Zwillinge entstammen aus einer einzigen der Schwangerschaft, kann er ggf. bei
befruchteten Eizelle, dizygote aus zwei Eizel- der Geburt des anderen nicht mehr bemerkbar
len. sein (sog. verschwundener Zwilling, vanishing
Ein Vergleich genetischer Merkmale von MZ twin).
und DZ kann unter bestimmten Voraussetzun-
gen Aufschluss darüber geben, welcher Anteil
C. Konkordanz oder Diskordanz
eines Phänotyps genetisch determiniert ist. Wenn Zwillinge das gleiche Merkmal aufwei-
Dies kann vor allem für komplexe, quantitativ sen, bezeichnet man sie als konkordant, wenn
definierte Merkmale aufschlussreich sein, wie sie sich unterscheiden, als diskordant. Der Ver-
z. B. Verhaltensweisen, kognitive Fähigkeiten gleich der Konkordanz lässt Rückschlüsse auf
etc. Bei getrennt aufgewachsenen monozygo- den relativen Anteil genetischer Faktoren be-
ten Zwillingen lassen sich Ähnlichkeiten und züglich des Merkmals zu.
Unterschiede feststellen, die auf den relativen
Anteil von genetischen und Umweltfaktoren
D. Biochemische Unterschiede
schließen lassen. Es gibt Untersuchungen, die Zwillingsuntersuchungen belegen, dass bioche-
dafür sprechen, dass die mentalen Fähigkeiten mische Unterschiede in der Abbaurate von
zu ca. 70 % von genetischen Faktoren bestimmt Pharmaka genetisch bedingt sind. Das Beispiel
sind. aus Vesell 1978 zeigt eine identische Abbaurate
von c-Phenylbutazon bei zwei MZ-Paaren
A. Typen von Zwillingen (links) und eine unterschiedliche bei zwei DZ-
Monozygote Zwillinge entstehen durch Spal- Paaren (rechts).
tung einer Zygote in sehr frühen Stadien der
Bouchard TJ et al: Sources of human psychological dif-
Entwicklung. Man unterscheidet drei Spal- ferences: The Minnesota study of twins reared
tungszeitpunkte: nach Bildung des Trophoblas- apart. Science 250: 223-228, 1990.
ten (1), nach Bildung des Amnions (2) und vor Bossma D, Busjahn A, Peltonen L: Classical twin studies
Bildung des Trophoblasten (3). Daraus ergibt and beyond. Nature Rev Genet 3: 872-882, 2002.
Gilbert SF: Developmental Biology, 7th edn. Sinauer
sich, ob bei einer gemeinsamen Plazenta zwei
Pub, Sunderland, Massachusetts, 2003.
Amnionhöhlen (monoplazentar, diamnial) vor- Goerke K: Taschenatlas der Geburtshilfe. Thieme,
liegen oder eine gemeinsame Amnionhöhle Stuttgart, 2002.
(monoplazentar, monoamnial) oder Plazenta Hall JG: Twins and twinning, p. 374-388. In: Rimoin DL
et al, editors: Principles of Medical Genetics. 5th ed.
und Amnionhöhle getrennt vorhanden sind (di-
Churchill-Livingstone-Philadelphia, 2007 (mit on-
plazentar, diamnial). Dizygote Zwillinge (DZ) line Zugang unter www.geneticstext.com).
haben getrennte Amnionhöhlen mit jeweils ei- Vesell ES: Twin studies in pharmacogenetics. Hum Ge-
ner eigenen Plazenta (Abb. modifiziert aus Gil- net 1 (Suppl): 19-30, 1978.
bert, 2003, und Goerke, 2002).
Zwillinge 109

1 Chorion
Trophoblast innere Zellmasse
Blastocoel

2 Amnions
1. Trennung nach Trophoblastbildung

Amnion
1 Chorion
Chorion

Embryo
Dotter- 1 Amnion
Zwei-Zell- 2. Trennung nach Amnionbildung sack
Embryo
2 Chorions

2 Amnions
3. Trennung vor Bildung der Trophoblasten
A. Typen von monozygoten Zwillingen beim Menschen

1. Thoracopagus 2. MZ durch Shunt verbunden 3. Acardius


B. Pathologische Zustände bei monozygotischen Zwillingen

(nach Connor & Ferguson-Smith, 1991) monozygot dizygot


100
Gaumen- 80 P.G. S.A.
spalte MZ 60 J.G. F.M.
Phenylbutazon-Konzentration im Plasma

40
Hüft- DZ
luxation 20

Gallensteine 10
8
6
Psoriasis 4

2
Allergien
100
Herzgefäß-
krankheit 80 Ja.T. A.M.
60 S.M.
40 Jo.T.
Körpergröße
20
Blutdruck 10

0 25 50 75 100 1 3 5 7 9 11 13 1 3 5 7 9 11 13
(Häufigkeit in %) Tage Tage
C. Konkordanz einiger Merkmale bei D. Ausscheidungsrate von
C eineiigen (MZ) und zweieiigen (DZ) Zwillingen Phenylbutazon (nach Vesell)
110 Formale Genetik

Unterschiedliche geographische von Haldane (1949) interpretierte Allison 1954


Verteilung von Genen richtig. Malaria ist die häufigste durch Infektion
entstehende Krankheit des Menschen. Jährlich
In verschiedenen Populationen in unterschied- erkranken weltweit 500 Millionen Menschen
lichen geographischen Regionen unterscheidet und 2–3 Millionen sterben als Folge der Infesta-
sich die Häufigkeit bestimmter Allele an ver- tion mit dem durch die Mücke Anopheles gam-
schiedenen Genloci. Dies kann entweder das biae übertragenen Parasiten Plasmodium falci-
Ergebnis zufälliger Häufigkeitsunterschiede parum. Malaria ist häufig in tropischen Regio-
(genetische Drift) oder von Selektion sein. nen (1), vor allem in Subsahara-Afrika. Bei He-
Wenn ein Allel gegenüber einem anderen einen terozygoten für eine Mutation in einem der Hä-
Vorteil für das betreffende Individuum bedeu- moglobin-Gene (vgl. Hämoglobin, S. 296) ver-
tet, weil es die Überlebenswahrscheinlichkeit läuft Malaria weniger schwer oder tritt seltener
erhöht, spricht man von selektivem Vorteil. auf. Insbesondere Sichelzellanämie (2, OMIM
A. Unterschiede in der Häufigkeit von 141900) und verschiedenen Formen von Thal-
Krankheiten assämien (3, OMIM 187550) sind in Malariage-
bieten sehr häufig. In diesen Regionen haben
Genetisch bedingte Erkrankungen beim Men- Heterozygote für eine Hämoglobin-Mutation
schen (Erbkrankheiten) kommen in verschie- einen selektiven Vorteil, weil sie überleben und
denen Gebieten der Erde unterschiedlich häu- das Allel für eine Hämoglobin-Krankheit im
fig vor. Ein charakteristisches Beispiel ist Finn- Gegensatz zu den Erkrankten in die nächste Ge-
land mit einer relativ homogenen Population, neration weitergeben können. Die Sichelzell-
die sich von den benachbarten Völkern unter- Mutation ist mindestens viermal in verschiede-
scheidet. Hier treten autosomal rezessiv erbli- nen tropischen Gebieten unabhängig aufgetre-
che Krankheiten gehäuft mit einem unter- ten und hat sich wegen des selektiven Vorteils
schiedlichen geographischen Verteilungsmus- der Heterozygoten in der jeweiligen Population
ter auf. Als Grund wird das Auftreten der jewei- ausgebreitet. Dies allerdings hat einen Preis:
ligen Mutation in verschiedenen Regionen Homozygote für Sichelzellanämie (s. S. 300)
Finnlands vermutet. oder eine der anderen Hämoglobin-Störungen
Für die angeborene flache Hornhaut (OMIM erkranken schwer.
217300) ist es der Norden des Landes (1), für Auch für Heterozygote eines X-chromosomalen
den finnischen Typ der angeborenen Nephrose Glucose-6-Phophosphat-Dehydrogenase-Man-
(OMIM 256300, eine schwere Nierenkrankheit) gels (OMIM 305900) genießen einen relativen
sind es südliche Landesteile (2), die Diastrophe Schutz gegen Malaria. Ihre Verbreitung ähnelt
Skelettdysplasie (OMIM 222600) findet sich in der Verbreitung von Malaria.
südöstlichen Regionen (3). Ähnliches ist für an- Der Begriff selektiver Vorteil kennzeichnet die
dere Krankheiten beschrieben. Es gibt keine Probabilität, eigene Gene an die nächste Gene-
Anhaltspunkte für einen selektiven Vorteil des ration weitergeben zu können. Dies wird als re-
mutanten Allels. Die unterschiedliche Vertei- produktive Fitness bezeichnet (ein Wert zwi-
lung spiegelt lediglich Ort und relativen Zeit- schen 1 [normal] und 0).
punkt der Mutation wider. Die Mutationen
müssen nach der Besiedelung Finnlands ent- Allison AC: Protection afforded by sickle trait against
standen sein, weil sie in Finnland ungewöhn- sub-tertian malarial infection. Br Med J 1: 290-292,
1954.
lich häufig sind. Sie sind jedoch kein generelles
Cavalli-Sforza LL, Menozzi P, Piazza A: The History and
genetisches Merkmal der finnischen Bevölke- Geography of Human Genes. Princeton Univ. Press.
rung. Ähnliche Beispiele finden sich in vielen Princeton, 1994.
anderen Gegenden der Welt und in anderen Po- Haldane JBS: Disease and evolution. Ric Sci Suppl A 19:
68-76, 1949.
pulationen.
Norio R, Nevanlinna HR, Perheentupa J: Hereditary dis-
eases in Finland. Ann Clin Res 5: 109-141, 1973.
B. Selektiver Vorteil von Norio R: The Finnish disease heritage. III: the indivi-
Heterozygoten dual diseases. Hum Genet 112: 470-526, 2003.
Weatherall DJ, Clegg JB: Thalassaemia – a global public
Hereditäre Hämoglobin-Krankheiten (s. S. 300)
health problem. Nature Med 2: 847-849, 1996.
sind ungewöhnlich häufig in Gebieten, in de- Weatherall DJ et al: Malaria and the red cell. Hematol
nen Malaria endemisch ist. Diese Beobachtung 1: 35-57, 2002.
Unterschiedliche geographische Verteilung von Genen 111

1. Angeborene flache Hornhaut 2. Angeborene Nephrose 3. Diastrophe Skelettdysplasie


A. Unterschiedliche Häufigkeit von Erbkrankheiten, z.B. in Finnland

1. Malaria

2. Sichelzellanämie 3. Thalassämie (verschiedene Formen)


B. Selektiver Vorteil von Heterozygoten
112 Chromosomen

Chromosomen in Metaphase DNA). Ihre Größe ist für jedes akrozentrische


Chromosom eines Individuums verschieden
Chromosomen sind die Strukturen, in denen
(chromosomaler Polymorphismus).
die Gene linear innerhalb eines durchgehenden
DNA-Moleküls assoziiert mit zahlreichen chro- C. Karyotyp
mosomen-spezifischen Proteinen liegen. Die
Die Gesamtheit aller Chromosomen in der Me-
Metaphase ist eine kurze Episode im Dasein ei-
taphase wird als Karyotyp bezeichnet, ein 1924
nes Chromosoms. Aber in diesem Stadium kön-
von Levitsky eingeführter Begriff. Dieser Begriff
nen Chromosomen lichtmikroskopisch gut un-
kann sich auf ein Individuum oder eine Spezies
tersucht werden. Zwar verdanken wir elektro-
von Lebewesen beziehen. Die formale Präsen-
nenmikroskopischen Befunden wesentliche Er-
tation von Chromosomen nach definierten Kri-
kenntnisse über Chromosomen, aber das wich-
terien ist ein Karyogramm. Dies wird heute
tigste Untersuchungsinstrument ist das Licht-
meist computer-gestützt erstellt; früher durch
mikroskop. Jedes Chromosom in der Meta-
Ausschneiden der einzelnen Chromsomen aus
phase hat eine individuelle äußerliche Struktur.
einer Photographie einer Metaphase. Ein Ideo-
Folgende beobachtbare Merkmale kennzeich-
gramm ist die stilisierte Darstellung eines Kary-
nen ein Chromosom: relative und absolute
ogramms. Es besteht aus einer festgelegten An-
Länge (beim Menschen 3–7 mm), Position des
ordnung von homologen Chromosomenpaaren.
Zentromers, Bandenmuster (Verteilung und
Der Mensch (Homo sapiens) hat 22 Chromoso-
Breite experimentell induzierbarer quer ange-
menpaare (Autosomen) und zuzüglich entwe-
ordneter Bänder unterschiedlicher Typen je
der zwei X-Chromosomen im weiblichen Ge-
nach Präparation und Färbung, s. S. 126). Den
schlecht oder ein X- und ein Y-Chromosom im
Begriff „Chromosom“ (griech. farbiger Faden)
männlichen Geschlecht (Karyotyp 46,XX bzw.
prägte Waldeyer 1888 nach den ersten Beob-
46,XY).
achtungen von Flemming 1879.
Der Karyotyp ist charakteristisch für jede Spe-
A. Metaphase-Chromosomen zies. Er ist das Ergebnis von Chromosomenum-
des Menschen ordnungen, die während der Evolution aufge-
treten sind. Die evolutionären Beziehungen
Bei etwa 1000facher Vergrößerung im Licht-
verschiedener Spezies spiegeln sich in Ähnlich-
mikroskop sind die Metaphase-Chromosomen
keiten und Unterschieden der Struktur und
des Menschen und anderer Wirbeltiere als ein-
Zahl ihrer Chromosomen wider.
zelne stäbchenartige Strukturen gut erkennbar.
Gezeigt wird eine Metaphase in etwa 2000fa- g Medizinische Relevanz. Die Analyse von Chro-
cher Vergrößerung. Die Chromosomen unter- mosomen in Metaphase oder Prometaphase ist
scheiden sich in Länge, Anordnung und Breite eine wichtige Untersuchungsmethode, weil bei
der quer verlaufenden hellen und dunklen Bän- etwa jedem 400. Neugeborenen eine Abwei-
der (Bandenmuster), sowie Ansatzpunkt der chung von der normalen Chromosomenanzahl
Spindel (Zentromer), der als Verschmälerung oder in der Struktur eines Chromosoms vor-
erkennbar ist. liegt. Im Stadium der Prometaphase sind Chro-
mosomen länger als in der Metaphase und zei-
B. Typen von Metaphase- gen mehr Bänder. Deshalb werden für be-
Chromosomen stimmte Zwecke Chromosomen in der Prome-
Je nach Lage des Zentromers kann man subme- taphase untersucht.
tazentrische, metazentrische, und akrozentrische
Miller OJ, Therman E: Human Chromosomes. 4th ed.
Chromosomen unterscheiden. Das Zentromer Springer, Heidelberg-Berlin-New York, 2001.
teilt submetazentrische Chromosomen in einen Speicher M: Chromosomen des Menschen, S. 126-174.
kurzen Arm (p-Arm, abgeleitet von petit) und In: Taschenlehrbuch Humangenetik, J Murken, T
einen langen Arm (q-Arm). Bei metazentri- Grimm, E. Holinski-Feder, Herausg. Thieme, Stutt-
gart, 2006.
schen Chromosomen sind der kurze und der
lange Arm etwa gleich lang. Akrozentrische
Chromosomen tragen am Ende des kurzen Ar-
mes als Satelliten bezeichnete verdickte An-
hängsel (nicht zu verwechseln mit Satelliten-
Chromosomen in Metaphase 113

ca. 7 μm

A. Metaphase-Chromosomen des Menschen

Zentromer Satelliten

submetazentrisch metazentrisch akrozentrisch


B. Typen von Metaphase-Chromosomen

C. Karyotyp
114 Chromosomen

Sichtbare funktionelle Strukturen in C. Lampenbürsten-Chromosomen


Chromosomen Lampenbürstenchromosmen sind erweiterte
In bestimmten Zellen von Insekten und Amphi- Chromosomenabschnitte, die während der
bien können chromosomale Strukturen beob- Meiose in Oocyten bestimmter Insekten (No-
achtet werden, die auf ihre Funktion schließen tophthalmus viridens) auftreten. Die gepaarten
lassen. In den Speicheldrüsen von Insekten Chromosomen (1) bestehen aus zahlreichen,
können z. B. lichtmikroskopisch sichtbare, entlang einer Achse angeordneten Chromatin-
große Strukturen als polytäne Chromosomen schleifen (2). Lampenbürsten-Chromosomen
nachgewiesen werden. Das durch Präparation zeichnen sich durch eine besonders hohe RNA-
gewonnene Muster individueller Bänder (Ban- Transkriptionsrate aus. (Photographie von J. G.
denmuster) ist für jeden Chromosomenab- Gall, 1956, in Lewin, 2008; Abbildungsschema
schnitt charakteristisch. Es eignet sich deshalb nach B. Alberts et al, 2008)
für die räumliche Zuordnung von Genen zu ei- D. Sichtbare Transkription in
nem definierten Ort auf dem Chromosom
ribosomalen RNA Clustern
(Genkartierung). Damit hat Sturtevant 1913 die
erste Genkarte erstellt. In Ribosomen findet die Translation statt. Tan-
dem-Wiederholungen von ribosomalen Genen
A. Polytäne Chromosomen werden im Nucleolus des Amphibiums Triturus
In Speicheldrüsen von Drosophila-Larven zei- viridiscens transkribiert. Entlang jedes Gens
gen polytäne Chromosomen alternierende werden rRNA-Moleküle (s. S. 144) gebildet. An
dunkle und helle Bänder. Ein polytänes Chro- mehreren DNA-Abschnitten sind die zuneh-
mosom resultiert aus der 10fachen Replikation mend länger werdenden RNA-Moleküle sicht-
ohne Trennung in Tochterchromosomen. Es bar. (Photographie von O.L. Miller & B.A. Ham-
handelt sich somit um 1024 (210) identische kalo, aus Griffiths et al, 2000)
Chromatidstränge, die strikt Seite an Seite lie-
Alberts B et al.: Molecular Biology of the Cell, 5th ed.
gen. Das Drosophila-Genom enthält etwa 5000 Garland Science New York, 2008.
Bänder (fast so viele wie Gene). Ein Ausschnitt Callan HG: Lampbrush chromosomes. Proc Royal Soc
eines polytänen Chromosoms zeigt das charak- Lond (Biol.) 214: 417-448, 1982.
Gall JG: On the submicroscopic structure of chromoso-
teristische Bandenmuster im Detail. (Abb. aus
mes. Brookhaven Symp Biol 8: 17-32, 1956.
Alberts et al, 2008 nach T. S. Painter, J. Hered. Gall JG: Through the looking glass. Nature Med. 12:
25 : 465–476, 1934; Photographie unten von 1142-1145, 2006.
Joseph G. Gall) Griffiths AJF et al: An Introduction to Genetic Analysis.
WH Freeman, New York, 2000.
B. Funktionszustände in polytänen Lewin B: Genes IX. Jones & Bartlett, 2008.
Miller OL: The visualization of genes in action. Scient
Chromosomen Amer 228: 34-42, 1973.
Polytäne Chromosomen bilden vorüberge-
hende Strukturen, die Funktionszuständen ent-
sprechen. Während der Larvenentwicklung tre-
ten in zeitlich abgestufter Weise eine Serie von
Ausstülpungen auf (1). Diese dekondensierten,
ausgedehnten Abschnitte entsprechen aktiven
Regionen mit Transkription. Durch Einbau mar-
kierter RNA lässt sich nachweisen, dass in die-
sen Bereichen RNA-Synthese stattfindet, ein
Zeichen von Genaktivität. Der zeitliche und ört-
liche Ablauf der Transkription, lichtmikrosko-
pisch sichtbar als Puffs und nachweisbar durch
Einbau radioaktiv markierter RNA, spiegelt die
verschiedenen Stadien der Larvenentwicklung
wider (2).
Sichtbare funktionelle Strukturen in Chromosomen 115

rechter Arm von


Chromosom 3
X-Chromosom

Chromo-
som 4

normale Mitose

homologe
Chromosomen
Chromo- getrennt
center

0 8 15 22
Stunden
linker Detail
Arm von
Chromo- 1. Bildung von Puffs (Pfeile)
som 2
linker rechter
Arm von Arm von
Chromo- Chromo-
som 3 som 2
Einbau von
20 μm markierter RNA
20 μm

2. Nachweis von Gen-Aktivität


B. Funktionszustände in polytänen
Chromosomen
A. Polytäne Chromosomen

Chromatin-
10 μm

Schleife

ein
Gen
0.1 mm

rRNA
Chromomer RNA
aus Polymerase
verdichtetem Richtung
Chromatin DNA der
Tran-
skription
1. Photographie 2. Schema einer
Chromatinschleife
C. Lampenbürsten-Chromosomen D. Sichtbare Transkription in ribosomalen
RNA-Clustern
116 Chromosomen

Chromosomenorganisation Euchromatin. Es zeigte sich später, dass das He-


terochromatin funktionell einem Bereich ent-
Die in der Interphase individuell nicht sichtba-
spricht, in dem wenig oder keine Gene liegen.
ren Chromosomen bilden einen als Chromatin
Heterochromatin besteht weitgehend aus repe-
bezeichneten Komplex aus DNA und assoziier-
titiven DNA-Squenzen. (Abb. aus E. Heitz, 1928)
ten, chromosomen-spezifischen Proteinen
(Histonproteine, kurz Histone genannt), und D. Konstitutives Heterochromatin im
anderen Proteinen im Zellkern. Nach Struktur Zentromer (C-Bänder)
und Funktion können zwei Formen von Chro-
Im Bereich des Zentromers lässt sich mit spezi-
matin unterschieden werden: Heterochromatin
ellen Methoden Heterochromatin spezifisch
und Euchromatin.
anfärben (C-Bänderung). Das Heterochromatin
A. Histon-freies Chromosom im des Zentromers besteht aus speziellen Protei-
Elektronenmikroskop nen und repetitiven DNA-Sequenzen. Da es
stets vorhanden ist, wird es als konstitutives
Ein Chromosom besteht zu 2/3 aus DNA und
Heterochromatin bezeichnet. (Abb. aus Verma
Histonen, sowie zu 1/3 aus Nicht-Histon-Prote-
& Babu, 1989)
inen. Wenn man die Histone entfernt, wird
elektronenmikroskopisch eine skelettartige g Medizinische Relevanz. Eine molekulare DNA-
Struktur sichtbar (1). Diese ist von zahlreichen Analyse beginnt etwa auf Ebene 2–3 in Teil B
dunkel anfärbbaren Fäden umgeben. Bei hö- und endet mit Ebene 4 oder 5.
herer Vergrößerung (2) zeigt sich, dass es sich
Alberts B et al: Molecular Biology of the Cell. 5th ed.
um einen einzigen durchgehenden Faden han-
Garland Science, New York, 2008.
delt, die DNA-Doppelhelix. (Photographien aus Heitz E: Das Heterochromatin der Moose. I: Jahrb Wiis
Poulson & Laemmli, 1977) Bot 69: 762–818, 1928.
Passarge E: Emil Heitz and the concept of heterochro-
B. Ebenen der Chromosomen- matin: Longitudinal chromosome differentiation
organisation was recognized fifty years ago. Am J Hum Genet 31:
106-115, 1979.
In einem Chromosom kann man schematisch Poulson, JR, Laemmli UK: The structure of histone-de-
fünf Ebenen der Organisation unterscheiden. pleted metaphase chromosome. Cell 12: 817-8282,
Die erste Stufe der Organisation (1) entspricht 1977.
Verma AS, Babu A: Human Chromosomes. Pergamon
einem Metaphase-Chromosom. Wählt man ei- Press, New York, 1989.
nen kleinen Abschnitt von etwa 10 % der Länge
mit ca. 10-facher Vergrößerung (2), so enthielte
dieser durchschnittlich etwa 40 Gene. Ein wei-
terer Ausschnitt mit 10-facher Vergrößerung
(3) enthielte ca. drei Gene. Ein nochmaliger
Ausschnitt aus einem Gen (4) ließe die Exons
und Introns erkennen. Die nächste Ebene der
Information wäre die DNA-Basensequenz in
diesem Abschnitt (5). (Abb. modifiziert nach
Alberts et al, 2008)

C. Heterochromatin und Euchromatin


Bahnbrechende Untersuchungen von Emil
Heitz definierten 1928 Heterochromatin und
Euchromatin. Heitz beobachtete 1928, dass be-
stimmte Abschnitte der Chromosomen eines
Moos (Pellia epiphylla) auch während der Inter-
phase verdichtet und stark anfärbbar bleiben,
wie sonst nur in der Mitose. Er nannte diese Be-
reiche Heterochromatin. Die jenigen Abschnitte,
die in der späten Telophase und anschließen-
den Interphase unsichtbar werden, nannte er
Chromosomenorganisation 117

2 μm 2 μm

1. 2.
A. Histon-freies Chromosom im Elektronenmikroskop

Chromosom (45–265 Millionen Basenpaare; 3–7 μm in Metaphase)


1

x10
Abschnitt (ca. 10%) eines Chromosoms mit 40 Genen (8 gezeigt)
2

x10

x10
7 Exons (E1–E7) und 6 Introns
4
regulatorische E1 E2 E3 E4 E5 E6 E7
Sequenzen
5 DNA-Sequenz:
ATGGCCCAAAGGACGGTCTGGATC............
TACCGGGTTTCCTGCCAGACCTAC...........
B. Ebenen der Chromosomenorganisation

D. Konstitutives Heterochromatin (C-Bänder)


C. Heterochromatin und Euchromatin D. im Bereich des Zentromers
118 Chromosomen

Funktionelle Elemente von sich nicht teilen (1). Fügt man dem linearen
Chromosomen Plasmid an beiden Enden telomere Sequenzen
hinzu (2), so wird die nomale Zellteilung wie-
Untersuchungen an Chromosomen von Hefe- derhergestellt. Dies zeigt, dass telomere Se-
zellen haben gezeigt, dass für die normale quenzen erforderlich sind um normale Zelltei-
Funktion in einem Chromosom drei Typen von lung zu gewährleisten. (Abb. in B-C modifiziert
Strukturelementen vorhanden sein müssen: 1. aus Lodish et al, 2005; nach Murray & Szostak,
ein Zentromer (zentromere DNA-Sequenzen, 1983)
CEN), 2. DNA-Sequenzen mit der Fähigkeit, die Unter Verwendung dieser funktionellen Struk-
Replikation zu beginnen und auszuführen (au- turen kann man künstliche Chromosomen aus
tonom replizierende Sequenzen, ARS), und 3. Hefe (YAC, Yeast Artificial Chromosome) und
ein Telomer an beiden Enden (telomere Se- Bakterien (BAC, Bacterial Artifical Chromo-
quenzen, TEL). some) konstruieren und in ihnen DNA klonie-
A. Grundstruktur eines eukaryoten ren. YACs können DNA-Fragmente bis zu 1000
Chromosoms kb aufnehmen, BACs ca. 80–350 kb.

Dieses Schema eines eukaryoten Chromosoms Lodish et al: Molecular Cell Biology. 5th ed. WH Free-
in der Metaphase zeigt die beiden Telomeren man, New York, 2004.
Murray AW, Claus TE and Szostak JW: Characterization
an jedem Ende. Sie haben eine spezielle Struk- of two telomeric DNA processing reactions in Sac-
tur (s. S. 124). Proximal von den Telomeren be- charomyces cerevisiae. Mol Cell Biol 8, 4642-4650,
finden sich subtelomere DNA-Sequenzen. Das 1988.
Zentromer enthält repetitive DNA-Sequenzen. Szostak JW, Blackburn EH: Cloning yeast telomeres on
linear plasmid vectors. Cell 29: 245-255, 1982.
Der häufigste Typ ist a-Satelliten-DNA aus Tan-
Murray AW, Szostak JW: Construction of artificial chro-
dem-Wiederholungen von 171 Basenpaaren. mosomes in yeast. Nature 305: 189-193, 1983.
Zentromere DNA hat zwischen 300 und 5000 Schueler MG et al: Genomic and genetic definition of a
kb und ist polymorph. Ausgeprägte zentromere functional human zentromere. Science 294: 109-
Polymorphismen finden sich besonders in den 115, 2001.
Zentromeren der Chromsomen 1, 9 und 16.

B. Autonom replizierende Sequenzen


(ARS)
Mutante Hefezellen ohne die Fähigkeit Leucin
zu bilden (Leu–) können mittels eines Plasmids,
das ein Gen für die Leucin-Synthese enthält, in
Leu+-Zellen transformiert werden (1). Jedoch
findet keine Replikation statt. Überträgt man
jedoch zusätzlich ARS-Sequenzen, so wird Zell-
teilung möglich (2). Allerdings ist die Vertei-
lung (Segregation) bei der Mitose fehlerhaft.
(Plasmide sind kleine zirkuläre, autonom repli-
zierende DNA-Moleküle in Bakterien. Sie kön-
nen in Hefezellen in einer Größe von 1–25 kb
eingebracht werden).

C. Zentromere Sequenzen (CEN)


Fügt man den mit dem Plasmid übertragenen
ARS-Squenzen (Teil A) auch zentromere Se-
quenzen hinzu (1), so ist die Verteilung der
Chromosomen in der Mitose normal (2).

D. Telomere Sequenzen (TEL)


Wenn man ein Plasmid wie in Teil C verwendet,
jedoch linearisiert, so können die Hefezellen
Funktionelle Elemente von Chromosomen 119

Telomer Multiple Origins of helle dunkle Zentromer subtelomere Telomer


Tandem- replication (auto- G-Banden α-Satelliten-DNA Sequenzen Tandem-
Repeats nom replizierende Repeats von 171 bp Repeats
Sequenzen, ARS) Monomeren

A. Grundstruktur eines eukaryoten Chromosoms

1 Leu Plasmid 2. Leu Plasmid mit 1. Leu Plasmid mit


mit Gen Leu-Gen zentromeren
für Leucin ARS und auto- CEN Sequenzen
aus Hefe nom repli- aus Hefe-
zierenden ARS chromosom
Sequenzen
Aufnahme in Leu–-Zelle

Leu–-Zelle Leu
Leu wird Leu+ Leu

ARS CEN

ARS

keine Replikation mitotische Segregation 2. mitotische


fehlerhaft Segregation
normal
Leu Leu Leu

ARS CEN CEN

ARS ARS

kein Wachstum Wachstum kein Wachstum fast


(Plasmid repliziert einiger Wachstum aller Zellen (> 90%)
nicht) Zellen (5–20%)

B. Autonom replizierende Sequenzen (ARS) C. Zentromere Sequenzen (CEN)

1. Lineares Plasmid 2. Lineares Plasmid mit telomeren Sequenzen

Leu CEN ARS TEL Leu CEN ARS TEL

1. 4.

CEN
AR
u

Leu CEN ARS


Le

TE
L L
TE

2.
5. Replikation und mitotische Segregation

CEN CEN
AR

AR
u

u
Le

Le
S

L L
kein Wachstum
TE

TE

TE TE
L

(Plasmid repliziert nicht)


Wachstum normal
D. Telomere Sequenzen (TEL)
120 Chromosomen

DNA und Nukleosomen ckungsstufe (ca. 1000-fach in Euchromatin).


(Abb. links nach B. Alberts et al, 2008; Photo-
Ein Nukleosom ist die Grundeinheit im Chro-
graphien von Thoma & Koller, 1979)
matin. Nukleosomen bestehen aus chromoso-
men-spezifischen Proteinen (Histonproteine D. Verschiedene Chromatin-Abschnitte
oder Histone) in enger Verbindung mit DNA.
Nukleosomen bilden aufeinander folgende Ag-
Die Entdeckung der Nukleosomen 1973 durch
gregate von unterschiedlicher Länge und Ver-
Olins & Olins und deren präzise Strukturana-
packungsgrad. H1-Histone binden an die da-
lyse durch Kornberg 1974 waren der Anfang für
zwischen liegende verbindende DNA (Linker).
das Verständnis der räumlichen Struktur der
Diese Strukturen entsprechen den 30 nm Fä-
DNA-Doppelhelix im Zellkern.
den. (Abb. nach B. Alberts et al, 2008)
A. Grundstruktur des Nukleosoms g Medizinische Relevanz. Reversible Verände-
Es gibt vier Histon-Typen, genannt H2A, H2B, rungen in der Chromatinstruktur und epigene-
H3 und H4. Ein Nukleosom besteht aus einem tische Modifikationen der Histone beeinflussen
Oktamer von insgesamt acht Histonen, je zwei die Regulation der Aktivität von Genen (s. S.
H2A, H2B, H3 und H4 in definierter räumlicher 150) und können sich auf Krankheitszustände
Anordnung und ca. 11 nm Durchmesser und auswirken.
6 nm Höhe. Etwa 150 Basenpaare DNA winden
Alberts B et al.: Molecular Biology of the Cell. 5th ed.
sich außen in 1,65 Windungen um ein Nukleo-
Garland Publishing, New York, 2008.
som. Felsenfeld G, Groudine M: Controlling the double helix.
Ein weiteres Histon, H1, bindet an den DNA- Nature 421: 448-453, 2003.
Linker. Histone können wegen eines hohen An- Kornberg RD, Lorch Y: Twenty-five years of the nucleo-
teils positiv geladener Aminosäuren (Lysin und some, fundamental particle of the eukaryote chro-
mosome. Cell 98: 285-94, 1999.
Arginin) stabil an die negativ geladene DNA Lewin B: Genes IX. Jones & Bartelett, Sudbury, Mary-
binden. Sie sind entsprechend ihrer wichtigen land, 2007.
Rolle evolutionär hoch konserviert. Jedes Nu- Luger K et al: Crystal structure of the nucleosome core
kleosom ist mit seinem Nachbarn durch einen particle at 2.8 Å; resolution. Nature 389: 251-260,
1997.
kurzen Abschnitt DNA (Linker) von 10–80 bp Olins AL, Olins DE: Spheroid chromatin units (v bo-
verbunden. dies). Science 183: 330-322, 1974.
Olins DE, Olins AL et al: Electron microscope tomogra-
B. Dreidimensionale Struktur eines phy: transcription in three dimensions Science 220:
Nukleosoms 498-500, 1983.
Thoma F, Koller Th, Klug A: Involvement of histone H1
Die dreidimensionale Feinstruktur des Nukleo- in the organization of the nucleosome and of the
soms bei einer Auflösung von 2,8 Ångström salt dependent superstructures of chromatin. J Cell
zeigt die außen liegende DNA-Doppelhelix und Biol 83: 403-427, 1979.
Richmond TJ, Davey CA: The structure of DNA in the
das innen liegende Oktamer des Nukleosoms
nucleosome core. Nature 423:145-150, 2003.
mit den vier Typen von Histonen in vier ver-
schiedenen Farben (Abb. aus Luger et al, 1997,
mit freundlicher Genehmigung von T. J. Rich-
mond)

C. Chromatin-Strukturen
Die Nukleosomen sind nacheinander in Struk-
turen von ca. 30 nm Durchmesser unterschied-
lich dicht verpackt angeordnet. Nach Entfer-
nung aus dem Zellkern sind Nukleosomen
elektronenmikroskopisch als fadenförmige
Strukturen sichtbar. Man kann dichte
(300–500 Å, oben), weniger dichte (250 Å,
Mitte) und lockere (100 Å) Strukturen unter-
scheiden („Perlen auf einer Schnur“). Die dich-
ten Abschnitte entsprechen der dritten Verpa-
DNA und Nukleosomen 121

11 nm
DNA
H2A H2B tritt aus

H3 H4
6 nm

H1
H4 H3

H2B H2A
DNA
1. Nukleosomen und Histone 2. DNA umläuft das tritt ein
Nukleosom außen
A. Grundstruktur des Nukleosoms

30 nm

gefaltet

DIA teilweise gefaltet

H2A H2B H3 H4
B. Dreidimensionale Struktur
Histon H1
eines Nukleosoms
ungefaltet
DNA

10 nm

C. Chromatin-Strukturen

Nukleosom sequenzspezifische 30 nm
DNA-bindende
Proteine

D. Chromatin-Abschnitte
122 Chromosomen

DNA in Chromosomen Monte Carlo Relaxationsstufen 200, 1000 und


40 000 (Bolzer et al, 2005).
Die Gesamtlänge der DNA des haploiden Ge-
(Abb. freundlicherweise von Prof. T. Cremer,
noms (nur je eines der beiden Chromosome-
München, überlassen).
paare berücksichtigt) des Menschen beträgt
etwa 1 Meter. Während der Mitose muss diese Alberts B et al: Molecular Biology of the Cell. 5th ed.
Gesamtlänge in 23 Metaphase-Chromosomen Garland Publishing, New York, 2008.
von je 3–7 mm (insgesamt ca. 115 mm) passen. Bolzer A et al: Three-dimensional mapy of all chromo-
somes in human male fibroblast nuclei and prome-
Dies erfordert eine Verpackung mit einer Ver-
taphases rosettes. PLoS Biol Vol. 3, No. 5, e157, May
kürzung um etwa das 10 000fache. 2005.
Cremer T, Cremer C: Chromosome territories, nuclear
A. Ebenen der Verpackung von DNA architecture, and gene regulation in mammalian
cells. Nature Rev Genet 2: 292-301, 2001.
In der Verpackung der DNA lassen sich ver-
Gilbert N et al: Chromatin architecture of the human
schiedene hierarchisch geordnete Ebenen un- genome: Gene-rich domains are enriched in open
terscheiden. Geht man von einem Chromosom chromatin fibers. Cell 118: 555-566, 2004.
in der Metaphase aus, so entspricht ein kleiner Lewin B: Genes IX. Jones & Bartlett, Sudbury, Mary-
Ausschnitt aus einem Chromatid den auf der land, 2008.
Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
vorhergehenden Seite in Teil C gezeigten Chro- man, New York, 2004.
matinstrukturen. Verfolgen wir die verschiede- Riddihough G: The Dynamic Chromosome. Chromoso-
nen Stufen der Verpackung der DNA in einem mes through space and time. Science 301: 717-876,
Zoom von der Ebene des Chromosoms in der 2003.
Tyler-Smith C, Willard HF: Mammalian chromosome
Metaphase zur molekularen Ebene der DNA- structure. Curr Opin Genet Dev 3: 390-397, 1993.
Doppelhelix: Abschnitte von Heterochromatin
und Euchromatin wechseln einander ab. In
Lampenbürstenchromosomen sind Chromatin-
schleifen entlang des Chromosomengerüsts an-
geordnet (s. S. 114). Weitere Ebenen sind die 30
nm Chromatinfäden mit eng gepackten Nukle-
osomen. Ein kleiner Ausschnitt daraus (drei
Nukleosomen gezeigt) illustriert schematisch
die Abfolge der Nukleosomen und die zwischen
ihnen verlaufende DNA. Hier erreichen wir die
Ebene der DNA mit einem Abschnitt von etwa
fünf Windungen der DNA-Doppelhelix (2 nm
Breite). Die enge Verpackung von DNA in Chro-
matin hat funktionelle Bedeutung. Transkrip-
tion ist nur möglich, wenn der Grad der Verpa-
ckung nicht zu dicht ist und die Doppelhelix
geöffnet werden kann.
(Abb. nach Alberts et al, 2008).

B. Chromosomen-Territorien
Chromosomen in der Interphase können defi-
nierten Domänen zugeordnet werden. Nach
neuen Befunden von T. Cremer und Mitarbeiter
(Bolzer et al, 2005) sind kleine Chromosomen
zur Mitte des Nukleus hin orientiert. Der Grad
der Auflockerung der Chromosomen lässt sich
von der Metaphase stufenweise bis zur Inter-
phase verfolgen (1). Jedes Chromosom nimmt
in der Metaphase eine bestimmte Position ein
(2). Die Zahlen in 1 bedeuten Grade der Chro-
mosomenauflockerung (Dekondensierung) in
DNA in Chromosomen 123

1400 nm
Metaphase-
Chromosom

verdickter Abschnitt

700 nm
eines Metaphase-
Chromosoms

300 nm
Teil eines
Chromosomen-
Abschnitts
Chromosome scaffold

30-nm-Chromatin-

30 nm
Faden mit
Nukleosomen

Chromatin-
11 nm

Abschnitt
2 nm

Ausschnitt aus
DNA-Doppelhelix

A. Ebenen der Verpackung von DNA

1. Chromosomen-Position in Metaphase und Interphase 2. Territorien für jedes Chromo-


som in der Interphase
B. Chromosomen-Territorien
124 Chromosomen

Das Telomer Telomerase verwendet das 3’-OH Ende des te-


lomeren Einzelstrang für die Synthese von Tan-
Das Telomer, ein 1938 von H.J. Muller definier-
dem-TTAGGG-Repeats. Als Vorlage dienen etwa
ter Begriff, schützt das Ende eines Chromosoms
15–22 Nukleotide der Telomerase-RNA. Die te-
gegen Fusion mit einem anderen Chromosom,
lomere DNA am 3’-Ende faltet sich zu einer Du-
verhindert Rekombination im Bereich der Gen-
plexschleife (t-loop) (3). Neue DNA am 3’-Ende
freien telomeren DNA-Sequenzen und vermei-
dringt in den Doppelstrang ein und verdrängt
det Erkennung als geschädigte DNA. Das Telo-
einen Strang. Dadurch entsteht eine D-Schleife
mer besteht aus charakteristischen tandemar-
(Displacement loop) aus ca. 100–200 Basen-
tig wiederholten DNA-Sequenzen und einem
paaren. An doppelsträngige, telomere DNA bin-
Komplex aus sechs Proteinen, Shelterin. Die Te-
dende Proteine (TRF2) stabilisieren die t-
lomerstruktur ist bei Eukaryoten evolutionär
Schleife. Durch diese Struktur wird verhindert,
konserviert. Telomere DNA-Sequenzen beste-
dass das einsträngige G-reiche Ende einzel-
hen aus G-reichen Tandem-Wiederholungen.
strängig bleibt.
Bei Vertebraten besteht diese Repeatsequenz
aus 5’-TTAGGG-3’. Das TTAGGG-Repeat beim D. Allgemeine Struktur eines Telomers
Menschen ist ca. 10–15 kb lang, bei der Maus
In den terminalen 6 bis 10 kb eines Chromo-
25–50 kb.
soms können telomere Sequenzen und Telo-
A. Das Replikationsproblem mer-assoziierte Sequenzen unterschieden wer-
den (1). Bei Protozoen, Hefen und Vertebraten
Während der 3’- nach 5’-Strang nach Anheften
unterscheiden sich die evolutionär konservier-
eines Primers direkt als Vorlage dienen kann
ten Repeats geringfügig (2).
(Vorwärtsstrang), erfolgt die Synthese am an-
deren Strang (dem Rückwärtsstrang, 5’ nach 3’, g Medizinische Relevanz. Die Verkürzung der
engl. lagging strand) nur in kleinen Schritten, Telomeren bei jeder Replikation in somatischen
den Okazaki-Fragmenten (vgl. DNA-Replika- Zellen führt zu Wachstumsverlust und Zellalte-
tion, S. 24). Etwa 8–12 Basen vor jedem der bei- rung (Seneszenz). Hohe Telomerase-Aktivität
den Enden kann die DNA-Polymerase die Syn- findet sich in Tumorzellen. Eine Telomerase-
these nicht fortsetzen, weil hinter diesem komponente ist defekt bei einer schweren Ent-
Punkt der benötigte Primer nicht ansetzen wicklungskrankheit, Dyskeratosis congenita
kann. Es gehen bei jeder Replikation 8–12 Nu- (OMIM 305000; Mitchell et al, 1999).
kleotide am Ende eines Chromosoms verloren.
Blackburn EH: Telomere states and cell fate. Nature
B. G-reiche repetitive Sequenzen im 408: 53- 56, 2000.
Blasco MA: Telomeres and human disease: Aging, can-
Telomer am 3’-Ende cer, and beyond. Nature Rev Genet 6: 611-622,
Der am 3’-Ende verbleibende überhängende 2005.
Buys CHCM: Telomeres, telomerase and cancer. New
Einzelstrang aus G-reichen Sequenzen von
Eng J Med 342: 1282- 1283, 2000.
50–100 Nukleotiden wäre ohne besondere Vor- de Lange T: t-loops and the origin of telomeres. Nature
kehrungen instabil. Neuere Befunde (Griffith, Rev Mol Cell Biol 5: 323-329, 2004.
1999) zeigen, dass eine haarnadelartige Umfal- Greider CW: Telomeres do D-loop-T-Loop. Cell 97: 419-
tung mit Bildung einer telomeren DNA-Duplex- 422, 1999.
Griffith JD et al: Mammalian telomeres end in a large
schleife (t-loop) das stabilisierende Ende bildet. duplex loop. Cell 97: 503-514, 1999.
Shay JW: At the end of the millenium, a view of the
C. Telomerase und Duplexschleife end. Nature Genet 23: 382-383, 1999.
Telomerase ist eine reverse Transkriptase, d. h. Shay JW, Wright WE: Implications of mapping the hu-
man telomerase Gene (hTERT) as the most distal
sie kann DNA als Vorlage für die Synthese von gene on chromosome 5p. Neoplasia 2: 195-196,
RNA verwenden. Sie besteht aus einem großen 2000.
Ribonukleoprotein mit Proteinen und etwa 450 Wang RC, Smogorzewska A, de Lange T: Homologous
RNA-Nukleotiden. Sie enthält RNA als Vorlage recombination generates T-loop-sized deletions at
human telomeres. Cell 119: 355-358, 2004.
für DNA-Synthese und hat katalytische Aktivi-
tät. An den Überhang einzelsträngiger telo-
merer DNA am 3’ Ende (1) werden mittels Telo-
merase neue Nukleotide angeheftet (2). Die
Das Telomer 125

Start Ende 12 – 16 Nukleotide


einzelsträngig
DNA- 5' 5' 3'
3'
Doppel-
strang 3' 5'
3' 5'
Replikation
(immer in 1. Einzelsträngiges Telomer-Ende
5' 3'-
Orientierung)

Primer neue DNA Neusynthese


5' 3'
3' 5' 5' 3' T T A GGG T T A
Templat
A U C C C A AU C C
A C
3' 5'
RNA-Templat
3' für Telomerase 5'
Templat (15 – 22 Basen)
5' 3'
3' 5'
Okazaki-Fragmente neue DNA 2. Zufügen von Nukleotiden am 3'-Ende

Primer
entfernt t-loop
Telomer-Repeat-
5' 3' Faktoren
3' 5' d-loop

5'
5' 3' Cen
3' neue
3' 5' DNA
Duplex-DNA Duplex-DNA
paart paart
Lücken
schließen 3. DNA-Duplex-Schleifen-Bildung (t-loop)

5' 3' C. Telomerase und Duplex-Schleife


3' 5'
Lücke Lücke ca. 9 kb
geschlossen bleibt 1.
Bereich Telomer-assoziierte telomere
für Gene Sequenzen Sequenzen
5' 3' (T T AG G G)
n
3' 5' zum
Lücke Zentromer ARS ARS n = 250 – 1500

an den 5'-Enden bleibt eine Lücke, 2. Beispiele für telomere Repeats


die nicht geschlossen werden kann,
weil der Primer fehlt
Protozoa z.B. Tetrahymena-Mikrochromosomen
A. Replikationsproblem am
5' – TTGGGG – 3'
Ende linearer DNA
Hefe z.B. Saccharomyces
G-Strang- 5' – TGTGGGG – 3'
Überhang
5' ( T T A GGG)n Repeats 3' Vertebraten 5' – TTAGGG – 3'
Cen
3' 5'
allgemein 5' – (T/A)1-4(G)1-8 – 3'
(Telomer nach rechts)
B. G-reiche repetitive Repeats
am 3'-Ende D. Allgemeine Struktur eines Telomers
126 Chromosomen

Das Bandenmuster menschlicher eingeteilt, die vom Zentromer ausgehend als


Chromosomen Region 1, 2 etc. bezeichnet sind. Zum Beispiel
bedeutet 2q3 die Region 3 des langen Armes (q)
Mit speziellen Färbeverfahren (Bänderungs- von Chromosom 2 oder 1p2 die Region 2 des
techniken) können in Präparaten von Chromo- kurzen Armes (p) von Chromosom 1.
somen in Metaphase- und Prometaphase quer Jede Region ist in Banden eingeteilt, ebenfalls
verlaufende helle und dunkle Banden induziert vom Zentromer ausgehend durchnummeriert
werden. Jedes homologe Chromosomenpaar als Band 1, Band 2 etc. Die Größe der Regionen
hat sein eigenes, spezifisches Bandenmuster. und Banden ist für jedes Chromosom individu-
Daran kann nicht nur jedes Chromosom, son- ell festgelegt. Zahlreiche Banden sind in Sub-
dern auch ein begrenzter Abschnitt eines Chro- banden unterteilt, die allerdings nur in hoch-
mosoms identifiziert werden. Jedes Chromo- auflösenden Präparaten unterschieden werden
som ist in Regionen und nummerierte Banden können. Diese Subbanden werden durch eine
eingeteilt, so dass jeder Bereich eines Chromo- angehängte Dezimale nach der jeweiligen
soms eindeutig bezeichnet werden kann (ISCN Bandnummer bezeichnet: Zum Beispiel besteht
2005). Verschiedene Bänderungstechniken er- die Region 3 im langen Arm von Chromosom 7
geben variante Muster, die für spezielle Frage- (7q31) aus drei Subbanden 1, 2 und 3. Dies wird
stellungen herangezogen werden können. Die gekennzeichnet mit 7q31.1, 7q31.2 und 7q31.3.
wichtigsten Typen sind G-Bänder (auch als GTG
bezeichnet weil Giemsafärbung mit Einwir- g Medizinische Relevanz. Pathologische Abwei-
kung von Trypsin verwendet wird), R-Bänder chungen von der normalen Chromsomenzahl
(reverses Muster der G-Bänderung), Q-Bänder oder –struktur führen zu zahlreichen unter-
(Quinacrin-induziert; dies ist die erste, 1970 scheidbaren Mustern von Entwicklungsstörun-
von Zech und Cassperson eingeführte Bände- gen. Dieser Bereich der Humangenetik wird als
rungstechnik; sie erfordert Dunkelfeldmikro- Zytogenetik bezeichnet. Die auf der Nomenkla-
skopie), C-Bänder (zentromeres Heterochroma- tur beruhenden Kurzbezeichnungen von Chro-
tin), T-Bänder (telomeres Heterochromatin), mosomenaberrationen finden sich in einer Ta-
sowie eine Reihe weiterer Techniken (s. Ta- belle im Anhang (s. Tabelle 2, Anhang, S. 361).
belle 1 im Anhang, S. 360). Zytogenetische Untersuchungen sind bei hä-
Die hellen G-Bänder repräsentieren im We- matologischen Tumoren wichtig.
sentlichen Gen-reiche Regionen (etwa Euchro-
ISCN 2005: An International System for Human Cyto-
matin entsprechend, mit GC-reichen Abschnit- genetic Nomenclature. Shaffer LG, Tommerup N,
ten und niedrigem Chromatin Faltungsgrad). editors. Cytogenetic & Genome Res, S. Karger, Basel,
Die dunklen G-Bänder repräsentieren Ab- 2005.
schnitte mit einem hohen Chromatin-Faltungs- Miller OJ, Therman E: Human Chromosomes. 4th ed.
Springer, New York-Berlin, 2001.
grad (entprechend etwa Gen-armen Hetero- Speicher M: Chromosomen des Menschen und Chro-
chromatin-ähnlichen, AT-reichen DNA-Sequen- mosomenaberrationen, S. 126-199. In: Taschenlehr-
zen). buch Humangenetik, J Murken, T Grimm, E. Ho-
linski-Feder, Herausg. Thieme Verlag, Stuttgart,
A. G-Bandenmuster 2006.

Die Abbildung zeigt das Schema des Banden-


musters der Chromosomen 1 bis 12. Etwa 550
individuell unterscheidbare Bänder im haploi-
den Chromosomensatz sind in der Abbildung
erkennbar (550-Banden-Stadium). Unter jedem
Chromosom ist dessen Anzahl an DNA-Basen-
paaren abgegeben (Mb: 1 Million).
Die Chromosomen 13 bis 22, sowie X- und Y-
Chromosom folgen auf der nächsten Seite. Ein
Chromosomenband ist definiert als ein Ab-
schnitt, der eindeutig von den beiden benach-
barten Abschnitten unterscheidbar ist (ISCN
2005). Jeder Chromosomenarm ist in Regionen
Das Bandenmuster menschlicher Chromosomen 127

1 2 3 4 5 6

36,3 16 15,3 25
36,2 25 25 15,2
15,3 15,1
36,1 24 24 15,2
2 1 15,1 22
23 2 p p 1 14
34 2
22 14
3
p 22 13 13 p 21
32 21 21 12
p 12
16 1
p 31 14 11
1 1
1 13 13 12
22 13 1
2 12 12 13 1
21 21 15
11 14
11 22 16
13 1
1 11 2 q 21
24 21
1
12 13 2 q 22,3
22,2
1 12 26 23 22,1
14 2
q 21 27 31,1
21 31,2 24
28
21 q 32 25
2 2 24 3
23 33
31 34
24 22 27
2 26 3 32 35
25 183 Mb
q
q 24
28
34
31 35 194 Mb
3 31 29
32,1 203 Mb
32,2
32,3
32 214 Mb
41 3 33
34
4 42
36 Zentromer helles G-Band

44
37 sekundäre Konstriktion dunkles G-Band
255 Mb
263 Mb

7 8 9 10 11 12

22 23 24 15 13
2 15
21 2 22 2 14 p 1 12
p p 21
p1 13
15 p 1 14 11
p 13 12
12 1
1 12
1 13 11 11 12
11 11 1 13
11 1 11
1 12
1 12
12
1 11 13 21
21
1
13 q
q 2 21
21 q
21 q 22 q 2 22 14 22
2 2 23
22 23
2 31 22
q 22
23 24 24
31,1 3 2 23
31,2 24,1 34,1 25
24
31,3 24,2 34,2 26
3 32 24,3 34,3 25

155 Mb 145 Mb 144 Mb 144 Mb 143 Mb


36

171 Mb

A. G-Bandenmuster
128 Chromosomen

Das Bandenmuster II: Mensch und somen bestehen, z. B. Chromosom 4 und 2,


Maus Chromosom 8 und 3 etc. Strukturelle Umord-
nungen des Karyotyps sind eine Folge der Tren-
Die 22 Chromosomenpaare (Autosomen) des nung verschiedener Spezies in der Evolution.
Menschen sind in sieben Gruppen (A–G) einge- (Photographien von H. Winking, Lübeck)
teilt: Gruppe A (1–3) sind große metazentri-
sche Chromosomen, Gruppe B (4–5) sind große Ford CE, Hamerton JL: The chromosomes of man. Na-
submetazentirsche Chromosomen, Gruppe C ture 178: 1020-1023, 1956.
Gersen SL, Keagle MB: Clinical Cytogenetics. Humana
(6–12 und X-Chromosom) sind mittelgroße
Press, Totowa, NJ, 2004.
submetazentrische Chromosomen, Gruppe D Gorczyca W: Cytogenetics, FISH and Molecular Testing
(13–15) sind mittelgroße akrozentrische Chro- in Hematologic Malignancies. Informa Healthcare,
mosomen mit Satelliten-förmigen Anhängen 2008 (ISBN 0415420091).
am kurzen Arm, Gruppe E (16–18) sind relativ ISCN 2005: An International System for Human Cyto-
genetic Nomenclature. Shaffer LG, Tommerup N,
kurze metazentrische und submetazentrische editors. Cytogenetic & Genome Res, S. Karger, Basel,
Chromosomen, Gruppe F (19–20) sind kurze 2005.
metazentrische Chromosomen, Gruppe G Miller OJ, Therman E: Human Chromosomes. 4th ed.
(21–22 und Y-Chromosom) sind akrozentrische Springer, New York-Berlin, 2001.
Tjio JH, Levan A: The chromosome number of man.
Chromosomen. Hereditas 42: 1-6, 1956.
Wegner RD, editor: Diagnostic Cytogenetics. Springer,
A. Bandenmuster von Chromosom Berlin, 1999.
13–22, X- und Y-Chromosom
Diese Abbildung ist die Fortsetzung der vorher-
gehenden Seite. Für jedes Chromosom wird
nach dem offiziellen ISCN-2005-Schema das
Zentromer und das Muster heller und dunkler
G-Banden gezeigt. Nicht gezeigt sind häufige
polymorphe Bereiche wie das zentromere He-
terochromatin der Chromosomen 1, 9 und 16
(darstellbar durch C-Bandenfärbung, s. S. 114).
In diesen Chromosomen ist eine kleine peri-
zentrische Inversion ein relativ häufiger Poly-
morphismus ohne klinische Bedeutung. Der
lange Arm des Y-Chromosoms ist interindivi-
duell variabel.
Die Größe der Chromosomen, ausgedrückt in
der Anzahl der Nukleotidbasen, reicht von 50
Millionen (50 Mb) bei Chromosom 21 bis 263
Millionen (263 Mb) bei Chromosom 1.

B. Karyotyp der Maus (Mus musculus)


Der Standardkaryotyp der Maus besteht aus
19 akrozentrischen Chromosomenpaaren etwa
gleicher Größe, sowie X- und Y-Chromosomen
(1). Sie unterscheiden sich jedoch durch das für
jedes Chromosomenpaar charakteristische
Bandenmuster und sind deshalb individuell
identifizierbar. In bestimmten Mäusestämmen
kann es Varianten des Karyotyps geben (2).
Diese Varianten sind aus der Fusion von Chro-
mosomen entstanden. In dem hier gezeigten
Beispiel entsprechen lediglich die Chromoso-
menpaare 1, 15, 19 und X dem Standard-Karyo-
typ, während die anderen aus Fusions-Chromo-
Das Bandenmuster II: Mensch und Maus 129

13 14 15 16 17 X
22.3
p 1 p 1 p 1 13 13
11 22.2
p 1 12 p 12
11 11 1 22.1
11 11 11 2
12 1
1
1 12
11 1 11 21.3
14 1 p
21 21.2
q q 21 12 21
21 q q q 21.1
2 2 22 22 2 22
2 11.4
22 2 23 24
24 24 11.3
31 24 25
1 11.23
31
3 32 26 92 Mb 11.22
3 98 Mb
32
34 11.21
109 Mb 106 Mb
114 Mb
11

18 19 20 21 22 1 12

13 13
p 1 11 p 1 13 p 1 12 p 1 12
p 1 11
12 11 21.1
11 11
1 11 21
q 2 q 2 21.2
12 13.1
q q 1 13.2 q 1 22 13
21 13.3 21.3
2 13 q
22 13.4
22.1
50 Mb 56 Mb 22.2
23 22.3
67 Mb 72 Mb
85 Mb 23
2
24
Zentromer helles G-Band
Y
sekundäre Konstriktion dunkles G-Band 25
11.3
p 1 11.2
X-Chromosom 11.1 26
um das Zweifache vergrößert 11.21
11.22
11.23 27
q 1
12
28
A. Bandenmuster von Chromosom 13–22, X und Y 51 Mb 163 Mb

1 2 3 4 5
4 8 7 13
2 3 6 5

6 7 8 9 10

12 14 18 17
11 12 13 14 15 10 9 11 16

16 17 18 19 XY 1 15 19 XX
1. Standard 2. Variante aus einer Population
B. Karyotyp der Maus (Mus musculus) mit Fusionschromosomen
130 Chromosomen

Chromosomenanalyse (Colcemid) in geeigneter Konzentration zuge-


setzt. Colcemid unterbricht die Mitose im Sta-
Da Chromosomen nur im Stadium der Meta-
dium der Metaphase, so dass es zu einer relati-
phase, unter besonderen Voraussetzungen
ven Anreicherung von Zellen in der Metaphase
auch in der Prometaphase, als einzelne Struk-
kommt. Auf die Zellkultur folgt die Präparation.
turen nach entsprechender Präparation im
Sie besteht aus Zentrifugation (2), Aufnahme
Lichtmikroskop sichtbar sind, erfordert jede
des Zellsediments (3) in leicht hypoosmoti-
Chromosomenanalyse Zellen in Teilung. In vivo
schem Kaliumchlorid (0,075 molare Lösung
enthalten nur Zellen des Knochenmarks einen
und Inkubation für ca. 20 Minuten, gefolgt von
ausreichenden Anteil mitotischer Zellen. Alle
erneuter Zentrifugation). Das anschließend ge-
Verfahren zur Untersuchung von Chromoso-
wonnene Zellsediment wird in Fixativ aufge-
men in Mitose erfordern eine Kultivierung ge-
nommen (4). Die Fixierlösung besteht aus ei-
eigneter Zellen. Das gängigste Verfahren ist die
nem Gemisch von Methylalkohol und Eisessig
Präparation von Chromosomen aus Blutzellen
im Verhältnis 3 : 1. Üblicherweise wird das Fi-
nach vorhergehender Kultivierung.
xativ durch anschließende Zentrifugation zwei-
Die aus dem peripheren Blut gewonnenen
bis dreimal gewechselt. Danach können die fi-
Lymphozyten werden in einem Nährmedium
xierten Zellen in eine Pipette aufgenommen
durch Phytohämagglutinin zum Wachstum an-
und auf einen Objektträger aufgetropft werden
geregt. Da sich Lymphozyten in der Kultur nur
(5). Es folgt die Vorbehandlung, z. B. mit Tryp-
wenige Male teilen können, ist jede Untersu-
sinlösung bei der GTG-Färbung (6). Das Präpa-
chung nur einmal möglich. Jedoch kann man
rat wird gefärbt (7) und danach unter einem
eine Lymphozytenkultur mit Epstein-Barr-Vi-
Deckglas eingedeckt (8). Nach der Präparation
rus zu einer lymphoblastoiden Zelllinie trans-
beginnt die Analyse. Zunächst werden geeig-
formieren. Diese Zellen teilen sich so oft, dass
nete Metaphasen im Mikroskop bei ca. 100fa-
wiederholte Male Material für Untersuchungen
cher Vergrößerung aufgesucht und anschlie-
zur Verfügung steht. Daneben können Fibro-
ßend bei etwa 1250facher Vergrößerung analy-
blasten aus einem Stückchen Haut in einer Zell-
siert. Bei der direkten Analyse im Mikroskop
kultur vermehrt und anschließend analysiert
wird die Chromosomenzahl und die An- bzw.
werden (vgl. S. 80). Dieses Verfahren ist jedoch
Abwesenheit aller Chromosomen und erkenn-
aufwendiger und dauert länger, so dass es nur
barer Chromosomenabschnitte analysiert. We-
bestimmten Fragestellungen vorbehalten ist.
gen präparativ bedingter Abweichungen von
A. Chromosomenpräparation aus Blut der normalen Chromosomenzahl und gelegent-
lich auch -struktur reicht die Analyse einer ein-
Fünf prinzipielle Schritte sind erforderlich: 1.
zigen Zelle nicht aus. Je nach Fragestellung
Lymphozytenkultur (48–72 Stunden), 2. Aufbe-
müssen zwischen 5 und 100 Metaphasen ana-
reitung der kultivierten Lymphozyten, 3. Präpa-
lysiert werden, meist 10–15. Einige Metapha-
ration von Metaphasechromosomen, 4. Fär-
sen werden im Mikroskop photographiert und
bung mit einer der Bänderungstechniken, 5.
der Karyotyp erstellt.
Auswertung durch lichtmikroskopische Ana-
Der Zeitaufwand für eine Chromosomenana-
lyse, ergänzt durch Karyotypisierung, ggf. com-
lyse ist je nach Fragestellung variabel, liegt aber
puter-unterstützt.
bei durchschnittlich 3–4 Stunden. Die Analyse
Als Ausgangsmaterial für die Kultur benötigt
und Karyotypisierung kann durch Computer-
man ca. 1–2 ml peripheres Blut. Das Blut muss
Verfahren abgekürzt werden.
durch Heparin ungerinnbar gemacht werden
(der Anteil Heparin zu Blut beträgt etwa 1 : 20). Miller OJ, Therman E: Human chromosomes. 5th ed.,
Die Stimulierung zur Mitose geschieht übli- Springer, New York, 2001.
cherweise mit Phytohämagglutinin, einem aus Speicher M: Chromosomen des Menschen und Chro-
mosomenaberrationen, S. 126-199. In: Taschenlehr-
Pflanzen gewonnenen Polysaccharid, das un-
buch Humangenetik, J Murken, T Grimm, E. Ho-
spezifisch T-Lymphozyten zur Teilung anregt. linski-Feder, Herausg. Thieme Verlag, Stuttgart,
Die Kultur zur Zellvermehrung erfordert etwa 2006.
72 Stunden bei 37 °C (1). Lymphozytenkulturen
bilden eine Suspensionskultur. Der Zellkultur
wird für ca. 2 Stunden ein Colchicin-Derivat
Chromosomenanalyse 131

Zellkultur Präparation
peripheres Phytohämagglutinin Colcemid
Blut (Mitose-Stimulierung) ca. 2 h
Lymphocyten

Zell- Zentri-
vermehrung fugation

ca. 72 h

Nährmedium
Zellsediment

Kaliumchlorid
hypoosmotisch

Zentrifugation

Aufnahme Zentri-
in Pipette fugation

Fixativ Zell-
Auftropfen auf Objektträger sediment

Färben
Eindecken
Erhitzen Deckglas

Präparat Objektträger

Färbekuvette

Analyse Mikroskopieren

Photographieren
und
Computer-
analyse

Karyotyp Metaphase im Mikroskop

A. Chromosomen-Analyse aus Blut


132 Chromosomen

Fluoreszenz-in-situ-Hybridisierung mosomen zeigen die Chromosomen 3 ein rotes


(FISH) Doppelsignal über dem Zentromer und ein grü-
nes Signal am Ende des kurzen Armes (3p). Ein
Unter dem Begriff Fluoreszenz-in-situ-Hybridi- zusätzliches drittes grünes Signal über einem
sierung (FISH) wird eine Vielzahl von Untersu- anderen, benachbarten Chromosom (16) zeigt
chungen zusammengefasst. Dabei werden Prä- an, dass Chromsomenmaterial von 3p dreifach
parate von Chromosomen in Metaphase oder vorhanden ist. Dies ergibt die Diagnose partielle
Zellen in Interphase mit molekularen Verfahren Trisomie 3p. (Oben rechts sind die Chromoso-
bearbeitet. Dies wird als molekulare Zytogenetik men 21 unspezifisch ebenfalls gefärbt).
bezeichnet. Bei einer FISH-Untersuchung wird
mit fluoreszierenden Farbstoffen markierte C. FISH in Interphase
DNA-Sonde mit komplementären einsträngigen In der normalen Zelle oben repräsentiert ein
DNA-Sequenzen chromosomenspezifisch auf rotes und ein grünes (gelbes) Signal das Chro-
dem Objektträger (in situ) hybridisiert. Durch mosomenpaar 22. In der Zelle unten fehlt ein
das mikroskopisch sichtbare Signal kann man rotes Signal. Dies zeigt eine Deletion in der Re-
Veränderungen erkennen, die man mit Chromo- gion 22q11 an.
somenanalyse allein nicht erkennen könnte. Mit
diesen Verfahren können kleine Veränderungen D. Nachweis einer Translokation
bis zu 100 kb erfasst werden, während mit Diese Abb. zeigt eine reziproke Translokation
Chromosomenanalyse allein nur Veränderun- zwischen dem langen Arm eines Chromo-
gen von 4 Mb oder mehr erkannt werden kön- soms 8 und dem kurzen Arm eines Chromo-
nen. soms 4. Das Chromosomenpaar 4 und 8 ist am
Für die nicht-isotope Signalerkennung unter- Zentromer markiert. Zusätzlich ist ein Signal
scheidet man direkte und indirekte Verfahren. über dem langen Arm von Chromosom 8 sicht-
Bei direkter Markierung (Labeling) hybridisie- bar. Bei dem Chromosom 8 am oberen Rand der
ren mit einem Fluorophor (fluoreszierender Metaphase (derivatives Chr. 8, der8) fehlt die-
Farbstoff) markierte Nukleotide. Bei der indirek- ses Signal. Stattdessen befindet es sich über
ten Markierung ist die DNA-Sonde mit einem dem Chromosom 4 in der Mitte links (der4); es
Fluorophor markiert. ist durch die Translokation von Chromosom 8
A. Prinzip der in-situ-Hybridisierung auf Chromosom 4 translociert (die reziproke
Translokation von Chromosom 4 nach 8 ist hier
Zellen in Metaphase oder Interphase werden nicht sichtbar) (Photo: H.J. Lüdecke, Essen).
auf einem Objektträger fixiert und denaturiert.
Dadurch wird doppelsträngige DNA (1a) in Ein- E. FISH von Telomer-Sequenzen
zelstrang-DNA überführt (2). In dem hier ge- In dieser Metaphase sind alle Telomeren spezi-
zeigten Beispiel hybridisiert mit Biotin mar- fisch gefärbt. Über jedem Chromatid befindet
kierte Einzelstrang-DNA (1b) mit komplemen- sich ein Signal (Photographie von Dr. Robert
tärer DNA auf dem Chromosomen- oder Inter- K. Moyzes, Los Alamos National Laboratory, mit
phasepräparat (3). Dies wird mittels eines Anti- freundlicher Erlaubnis des Autors, aus Spek-
körpers gegen Biotin sichtbar gemacht, der mit trum der Wissenschaft, Seite 52, Oktober 1991).
einem Fluorochrom markiert ist (4), z. B. Fluo-
reszein-Isothiocyanat (FITC). Da das primäre g Medizinische Relevanz. FISH ist eine wichtige
Signal nur schwach ist, wird ein sekundärer An- Methode zur Erkennung von submikriskopi-
tikörper (z. B. Avidin) angeheftet, der mit Biotin schen Chromosomenaberrationen.
verbunden ist (5). An den sekundären Antikör-
Speicher MR, Carter NP: The new cytogenetics: Blur-
per kann ein weiterer primärer Antikörper an- ring the boundaries with molecular biology. Nature
geheftet werden. Dies führt zur Verstärkung des Rev Genet 6: 782-792, 2005.
Signals (6), das lichtmikroskopisch nachgewie- Speicher M: Chromosomen des Menschen und Chromo-
sen werden kann. somenaberrationen, S. 126-199. In: Taschenlehrbuch
Humangenetik, J Murken, T Grimm, E. Holinski-Fe-
B. FISH in der Metaphase der, Herausg. Thieme Verlag, Stuttgart, 2006..

Auf dem Hintergrund dunkelblau mit DAPI


(4’,6’-Diamidino-2-Phenylindol) gefärbter Chro-
Fluoreszenz-in-situ-Hybridisierung (FISH) 133

1.a DNA- Chromosomen 1.b Sonde für


Doppelstrang auf gesuchten
Objektträger Bereich
Denaturierung Markierung
mit Biotin
2. Einzelstrang
Hybridisierung in situ

3.

primärer
Fluoreszenz Antikörper
Fluorochrom mit verstärktes
Fluorochrom Fluoreszenz-Signal

4.

sekundärer
Antikörper
mit Biotin

Amplifikation des Signals


durch Anheften eines
weiteren primären Antikörpers
5. 6.
A. FISH in Metaphase

normal

Deletion
1. 2.
B. FISH in Metaphase C. FISH in Interphase

der 8

der 4
8

D. Translokation 4;8 E. FISH von Telomer-Sequenzen


134 Chromosomen

Numerische Mehrere Mechanismen können zu Triploidie


Chromosomenaberrationen führen: Befruchtung durch zwei Spermien
(Dispermie), Fusion des zweiten Polkörpers mit
Abweichungen der Chromosomenzahl von der der Oozyte, unreduzierter Chromosomensatz
normalen Zahl werden als Aneuploidie bezeich- der Oozyte. Man kann dabei jeweils unterschei-
net, ein 1922 von A.F. Blakeslee eingeführter den, ob zwei mütterlich oder zwei väterliche
Begriff. Numerische Chromosomenaberratio- Chromosomensätze vorliegen (69,XXX bzw.
nen kommen beim Menschen etwa einmal auf 69,XYY).
400 Neugeborene vor. Bei einem zusätzlichen
Chromosom spricht man von einer Trisomie, C. Autosomale Trisomien
bei einem zuwenig von einer Monosomie. Ab- Beim Menschen treten bei lebend geborenen
weichungen der Chromosomenzahlen entste- Neugeborenen regelmäßig nur Trisomien für
hen durch Fehlverteilung (Nondisjunction) in die Chromosomen 21, 18, 13 in dieser Reihen-
der Meiose I oder II (meiotische Non-disjun- folge ihrer Häufigkeit auf. Alle anderen Triso-
ction). Bei meiotischer Nondisjunction findet mien kommen zwar vor, enden aber mit einer
sich die Aberration in sämtlichen Zellen. Nach spontanen Fehlgeburt etwa in der 8.–14.
Nondisjunction in der Mitose liegt eine nume- Schwangerschaftswoche. Alle Monosomien
rische Chromosomenaberration nur in einem sind fetal letal mit Ausnahme der Monosomie X
Teil der Zellen vor. Dies wird als chromosoma- (s. S. 336). Nondisjunction ist bei den drei auto-
les Mosaik bezeichnet. somalen Trisomien sehr häufig mütterlicher
A. Nondisjunction in Meiose I oder II Herkunft (90 % Trisomie 21, 97 % bei Trisomie
18, 88 % bei Trisomie 13). Die Monosomie X da-
Nondisjunction kann entweder in der ersten gegen ist bei 80 % väterlicher Herkunft. Mono-
oder in der zweiten meiotischen Zellteilung somie X führt zum Krankheitsbild des Turner-
vorkommen (s. S. 68). Infolge Nondisjunction Syndroms (vgl. S. 336).
erhält in der Meiose eine Tochterzellen zwei,
die andere kein Chromosom eines homologen D. Zusätzliche X- oder
Paares. Nach der zweiten meiotischen Teilung Y-Chromosomen
entstehen Gameten, die entweder zwei oder
Ein zusätzliches X- oder Y-Chromosom kommt
kein Chromosom dieses Paares enthalten. Bei
häufig vor: Tripel X (47, XXX), XXY, XYY.
Nondisjunction in der zweiten meiotischen Tei-
Im Gegensatz zu den autosomalen Trisomien
lung entstehen neben normalen haploiden Ga-
führen die Trisomien 47,XXX und 47,XYY nicht
meten auch disome und nullisome Gameten.
zu einem definierten klinischen Bild. Ein zu-
Nach der Fertilisation entsteht eine Trisomie,
sätzliches X-Chromosom bei Männern führt
durch eine nullisome Gamete eine Monosomie.
zum Klinefelter-Syndrom (S. 336).
Nondisjunction tritt sowohl bei der Oogenese
als auch Spermatogenese auf. Sie ist in der Oo- Graham GE et al: Sex chromosome abnormalities, p.
genese häufiger, vor allem bei erhöhtem müt- 1038-1057. In: Rimoin DL et al, editors: Principles of
Medical Genetics. 5th ed. Churchill-Livingstone-El-
terlichen Alter (s. S. 74).
sevier, Philadelphia, 2007 (mit online Zugang unter
www.geneticstext.com).
B. Numerische Aberrationstypen Miller OL, Therman E: Human Chromosomes. 4th ed.,
Bei einer Trisomie (1) ist nur ein Chromosom Springer, New York–Berlin, 2001.
dreifach vorhanden, alle anderen Chromoso- Tolmie JL, MacFadyen U: Clinical genetics of common
autosomal trisomies, p. 1015-1037. In: Rimoin DL et
men sind diploid. Selten kommen zwei ver- al, editors: Principles of Medical Genetics. 5th ed.
schiedene Trisomien bei verschiedenen Chro- Churchill-Livingstone-Elsevier, Philadelphia, 2007
mosomenpaaren vor (doppelte Aneuploidie). (mit online Zugang unter www.geneticstext.com).
Fehlt ein Chromosom eines Chromosomenpaa- Speicher M: Chromosomen des Menschen und Chro-
mosomenaberrationen, S. 126-199. In: Taschenlehr-
res, so bezeichnet man dies als Monosomie (2). buch Humangenetik, J Murken, T Grimm, E. Ho-
Triploidie (3) bezeichnet eine Abweichung aller linski-Feder, Herausg. Thieme Verlag, Stuttgart,
Chromosomen von der normalen Zahl. Jedes 2006.
Chromosom liegt dreifach anstatt wie üblich
paarweise vor. Bei der Tetraploidie liegt jedes
Chromosom vierfach vor.
Numerische Chromosomenaberrationen 135

Oogonium
oder Spermato-
gonium

Meiose I Nondisjunction normale Verteilung

Nondisjunction normale Verteilung


Meiose II

Gamete

disom nullisom disom nullisom normal


A. Nondisjunction in Meiose I oder II

1. Trisomie 2. Monosomie 3. Triploidie


B. Numerische Abberationstypen

XXX
Trisomie 13 ca. 1:800 weibliche
ca. 1:12000 Neugeborenen

XXY
ca. 1:700 männliche
Trisomie 18
Neugeborenen
ca. 1:6000

XYY
Trisomie 21 ca. 1:800 männliche
ca. 1:650 Neugeborenen

C. Autosomale Trisomien D. Zusätzliche X- und Y-Chromosomen


136 Chromosomen

Translokation unbalancierte Verteilung der beteiligten Chro-


mosomenabschnitte. Sie fehlen (Defizienz)
Eine Chromosomentranslokation ist ein Positi-
oder sind verdoppelt (Duplikation). Zum Bei-
onswechsel eines Chromosomenabschnitts in
spiel enthalten Gameten nach Segregation ad-
ein anderes Chromosom oder innerhalb dessel-
jacent-1 eine partielle Duplikation des blau
ben Chromosoms. Meistens geschieht der Aus-
markierten Chromosomenanteils und eine par-
tausch reziprok zwischen zwei Chromosomen
tielle Defizienz des rot markierten Chromoso-
(reziproke Translokation). Die Zahl der Chro-
menanteils (linkes Chromosomenpaar). Daraus
mosomen und Gene wird dabei nicht verän-
resultieren verschiedene Arten von Störungen,
dert. Wenn der Bruchpunkt einer Translokation
je nach beteiligten Chromosomenabschnitten.
außerhalb eines Gens liegt, resultieren keine
Störungen für das Indivuduum. Jedoch können A. Zentrische Fusion
bei der Bildung der Gameten Teile der beteilig-
Chromosom 14 und Chromosom 21 (1) sind am
ten Chromosmen fehlen oder zusätzlich vor-
häufigsten an einer Fusion beteiligt (ca. 1 auf
handen sein. Beides führt nach der Fertilisation
1000 Neugeborene). Durch die Fusion entsteht
zu einer chromosmal unbalancierten Zygote
ein aus dem langen Arm von Chromosom 14
mit prä- und postnatalen Entwicklungsstörun-
(14q) und dem langen Arm von Chromosom 21
gen.
(21q) bestehendes Chromosom, t14q21q (2).
Eine besondere Art von Translokation ist die
Der satellitentragende kurze Arm beider Chro-
zentrische Fusion von zwei akrozentrischen
mosomen geht verloren, aber dies ist unbedeu-
Chromosomen. Dies wird als Robertson-Trans-
tend, weil er keine Gene enthält. Bei der Bil-
lokation bezeichnet (benannt nach W.R.B. Ro-
dung der Keimzellen (Gameten) kann es zu Ab-
bertson, der diese Form 1911 bei Insekten be-
weichungen von der normalen Chromosomen-
schrieben hat).
zahl kommen (3). Es können folgende mögliche
A. Reziproke Translokation Gameten gebildet werden: Chromosom 14 al-
lein (kein Chromosom 21), ein Chromosom 14
Eine reziproke Translokation ist der Austausch
und ein Chromosom 21 (normal), das mit Chro-
von Chromosomenmaterial zwischen zwei
mosom 21 fusionierte Chromosom 14 (balan-
Chromosomen. Da bei einer reziproken Trans-
ciert) oder das Fusionschromosom und ein
lokation meist kein chromosomales Material
Chromosom 21 (insgesamt zwei Chromoso-
verloren geht oder hinzukommt, führt sie nicht
men 21). Nach der Fertilisation enthält die Zy-
zu klinischen Ausfallerscheinungen, weil sie
gote entweder nur ein Chromosom 21 (nicht le-
balanciert ist. Träger einer reziproken Translo-
bensfähige Monosomie 21), einen normalen
kation können Gameten mit unbalanciertem
Chromosomensatz, das Fusionschromosom
Chromosomensatz bilden. In der Meiose bildet
(balancierter Chromosomensatz) oder eine Ga-
sich eine Quadriradial-Struktur zwischen den
mete mit insgesamt drei Chromosomen 21 (Tri-
an der Translokation beteiligten Chromoso-
somie 21). Naturgemäß kann auch eine Triso-
menpaaren. Nach Trennung (Segregation) der
mie 14 und eine Monosomie 14 entstehen, die
vier beteiligten Chromosomen können mehrere
jedoch beide embryonal letal sind.
Möglichkeiten auftreten.
Bei alternierender Segregation erhält eine Ga- Miller OL, Therman E: Human Chromosomes. 4th ed.,
mete die beiden normalen Chromosomen 1 Springer, New York, Berlin, 2001.
und 4 und die andere die an der Translokation Speicher M: Chromosomen des Menschen und Chro-
mosomenaberrationen, S. 126-199. In: Taschenlehr-
beteiligten Chromosomen 2 und 3. In beiden
buch Humangenetik, Murken J, Grimm T, Holinski-
Fällen ist kein Material verloren gegangen oder Feder E, Herausg. Thieme Verlag, Stuttgart, 2006.
hinzugekommen. Bei nicht alternierender Se-
gregation (benachbarte Chromosomen, adja-
cent) gelangen die beiden Chromosomen 2 und
4 (links) in eine Gamete oder die beiden Chro-
mosomen 1 und 3 (rechts) in die andere Ga-
mete (adjacent-1). Bei adjacent-2 gelangen die
Chromosomen 1 und 2 in eine Gamete oder die
Chromosomen 4 und 3. Jeweils resultiert eine
Translokation 137

1 2
3 4 2 4

1 3

Meiose

normal reziproke Translokation

alternierend adjacent-1 adjacent-2


1 2 2 1 1 2
4 3 4 3 4 3

oder oder oder

normal balanciert unbalanciert unbalanciert

A. Reziproke Translokation

1. normal 2. zentrische Fusion t (14q21q)


21

14

14 21 14 t 21

3. mögliche Gameten bei t (14q21q)


21 21

14 14

14 14 21 t 21
zwei
kein Chromosomen 21 normal balanciert Chromosomen 21

n a c h F e r t i l i s a t i o n

Monosomie 21 normal normal Trisomie 21


(nicht lebensfähig) (Down Syndrom)

B. Zentrische Fusion von akrozentrischen Chromosomen


138 Chromosomen

Chromosomen-Strukturaberrationen homologen Paarung in der Meiose eine Inversi-


onsschleife bilden (1). Wenn der invertierte Ab-
Strukturveränderungen von Chromosomen re-
schnitt relativ groß ist, kann es in diesem Be-
sultieren aus einem Bruch eines oder mehrerer
reich der Inversion zu einem Crossing-over
Chromosomen. Sie können nach zytologischen
kommen (2). In den Tochterzellen kann da-
Typen und Auswirkung auf den Phänotyp ge-
durch in einem Chromosom eine Duplikation
ordnet werden. Die wesentlichen zytologischen
(z. B. für den Abschnitt A und B) sowie eine De-
Typen sind Translokation (Austausch), Deletion
fizienz (für den Abschnitt F) bestehen (3), wäh-
(Verlust), Inversion (Umkehrung), Insertion
rend das andere Chromosom eine Defizienz für
(Einschub), Isochromosom (s. u.), dizentrisches
den Abschnitt A und B, sowie eine Duplikation
Chromosom (s. u.), Ringchromosom (s. u.). Nach
für F aufweist (4). Diese Chromosomenab-
ihrer Auswirkung kann unterschieden werden,
schnitte sind nicht balanciert (Aneusomie
ob sie balanciert oder nicht balanciert sind. Bei
durch Rekombination).
balancierter Umordnung ist kein chromosoma-
les Material verloren gegangen oder hinzuge- E. Folgen eines Ringchromosoms
kommen. Unbalanciert bedeutet, dass chromo-
Ringchromosomen sind meistens instabil, weil
somales Material hinzugekommen ist (partielle
es in der Prophase der Mitose zu einem Bruch
Duplikation) oder verloren gegangen ist (parti-
mit Wiedervereinigung kommen kann. Es kann
elle Defizienz).
ein großes ringförmiges Chromosom mit zwei
A. Deletion, Duplikation, Zentromeren enstehen. Wenn sich in der Ana-
Isochromosom phase die Zentromeren in verschiedene Rich-
tung bewegen, zerreißt der Ring. Es resultieren
Eine Deletion entsteht durch einen Bruch mit
Tochterzellen, in denen Abschnitte fehlen (De-
Verlust eines Chromosomenabschnitts. Man
fizienz) oder verdoppelt sind (Duplikation). Im
unterscheidet terminale Deletion (1) und inter-
gezeigten Beispiel entsteht eine Tochterzelle
stitielle Deletion (2). Bei einer Duplikation (3)
mit einer Defizienz für Abschnitt 4 und eine
ist ein Abschnitt verdoppelt. Ein Isochromosom
Tochterzelle mit einer Duplikation für Ab-
ist ein Chromosom, das aus zwei langen Armen
schnitt 4. Nicht selten geht ein Ringchromosom
(4) oder aus zwei kurzen Armen besteht. Je-
gänzlich verloren und es entsteht eine Monoso-
weils fehlt der kurze bzw. der lange Arm. Rela-
mie.
tiv häufig kommt ein Isochromosom X beim
Turner-Syndrom (s. S. 336) vor. Miller OL, Therman E: Human Chromosomes. 4th ed.,
Springer, New York, Berlin, 2001.
B. Inversion Rossi E et al: Duplications in addition to terminal dele-
tions are present in a proportion of ring chromoso-
Eine Inversion ist eine Richtungsänderung ei- mes: clues to the mechanisms of formation. J med
nes Chromosomenabschnitts um 180 Grad. Genet 147-154, 2008.
Jede Inversion setzt einen Bruch in zwei ver- Speicher M: Chromosomen des Menschen und Chro-
schiedenen Bereichen voraus, gefolgt von einer mosomenaberrationen, S. 126-199. In: Taschenlehr-
buch Humangenetik, J Murken, T Grimm, E. Ho-
Wiederverbindung des invertierten Abschnitts.
linski-Feder, Herausg. Thieme Verlag, Stuttgart,
Je nach Beteiligung des Zentromers wird eine 2006.
perizentrische (das Zentromer liegt im Bereich Spinner NB, Saitta SC, Emmanuel BS: Deletion and
der Inversion) und eine parazentrische Inver- other chromosomal abnormaities of the autosomes,
p. 1058-1082. In: Rimoin DL et al, editors: Principles
sion unterschieden.
and Practice of Medical Genetics. 5th ed. Churchill-
Livingstone-Elsevier, Philadelphia, 2007.
C. Ringchromosom
Ein Ringchromosom entsteht nach zwei Brü-
chen mit anschließender Wiedervereinigung
der beiden Enden. Die distalen Abschnitte ge-
hen verloren. Deshalb ist ein Ringchromosom
unbalanciert.

D. Aneusomie durch Rekombination


Im Bereich einer Inversion kann sich bei der
Chromosomen-Strukturaberrationen 139

Verlust hinzu- normal


gefügt q
Verlust
p
cen

q q

1. Terminale Deletion 2. Interstitielle Deletion 3. Duplikation 4. Isochromosom


A. Deletion, Duplikation, Isochromosom

Verlust

Vereinigung
zwei
Brüche
Ring-
1. Perizentrisch 180° chromosom
Verlust
C. Ringchromosom

Ruhephase Prophase
Centromer CEN
1 1 1
2. Parazentrisch 5 5 5
180° 1 1
5 5
B. Inversion
2 2 2 2 2
4 4 4 4
D 4 3 3
3 3 3
C D
C Crossing-over
E E Prophase Metaphase
und Telophase
1 1 1
A B F 5 5 5
a
2 2 4 2 4
se

A B F
ha
ap

1. Inversionsschleife 4
An

D
n

3 3 3 3 3
ti

Crossing-over

rre

D
ze

C C 3
ng

4 2 4 2
Ri

E E
4 2 5 1 5 1
b
A B F 1
5 Zentromeren in
verschiedene Richtung
A B F
2. Crossing-over zwischen C und D Tochterzellen

A B C D E B A 1 5
1 5
3. Duplikation A, B/Defizienz F
2
4
F C D E F 2 a 3
3 b
4
4. Defizienz A, B/Duplikation F
Defizienz 4 Duplikation 4
D. Folgen von Crossing-over E. Folgen eines Ringchromosoms
140 Chromosomen

Vielfarb-Chromosomen- Kombinationen von Fluorophoren werden in


Identifizierung ein Spektrum sichtbarer Farben verwandelt.
Dabei werden rote, grüne und blaue Farben der
Eine Reihe von computer-gestützten optischen spezifischen Wellenlänge der Fluoreszenz zu-
Verfahren existieren in Metaphasechromoso- geordnet. Der von einem Computer generierte
men um kleine Strukturveränderungen von Spektral-Karyotyp beruht auf spezifischen
Chromosomen zu erkennen, die unterhalb des Falschfarben für jedes Chromosom. (Photogra-
Auflösungsvermögens der Bänderungstechni- phien freundlicherweise von Prof. Dr. Evelin
ken liegen. Die Hybridisierung chromosomen- Schröck, Dresden, überlassen)
spezifischer, Fluorochrom-markierter DNA-
Sonden für alle Chromosomen kann durch un- g Medizinische Relevanz. Computer-gestützte
terschiedliche Farbimages jedes Chromoso- molekularzytogenetische Verfahren haben
menpaares sichtbar gemacht werden („Chro- große Bedeutung für die Identifizierung konsti-
mosome painting“). Zwei besonders effektive tutioneller struktureller Chromosomenabbera-
Verfahren zur spezifischen Identifizierung klei- tionen und bei der Dianostik von Tumoren (Tu-
ner Chromosomenumordnungen werden nach- morzytogenetik).
folgend illustriert: die Multicolor-Fluoreszenz-
Schröck E et al: Multicolor spectral karyotyping of hu-
in-situ-Hybridisierung (M-FISH) und die Spek- man chromosomes. Science 273: 494 – 497, 1996.
tral-Karyotypisierung (SKY). Speicher MR, Ballard SG, Ward DC: Karyotyping human
chromosomes by combinatorial multi-fluor FISH.
A. Multiplex-FISH Nature Genet. 12: 368- 375, 1996.
Speicher MR, Carter NP: The new cytogenetics: Blur-
Dieses Verfahren (M-FISH, Speicher et al, 1996) ring the boundaries with molecular biology. Nature
verwendet Serien von chromosomenspezifi- Rev Genet 6: 782-792, 2005.
schen DNA-Sonden. Diese sind in YAC-Klonen Speicher M: Chromosomen des Menschen und Chro-
(Yeast Artifical Chromosomes) enthalten und mosomenaberrationen, S. 126-199. In: Taschenlehr-
buch Humangenetik, J Murken, T Grimm, E. Ho-
mit einem DNA-bindenden Fluoreszenzfarb-
linski-Feder, Herausg. Thieme Verlag, Stuttgart,
stoff markiert. Diese werden mit denaturierter 2006.
(einsträngiger) DNA in Metaphase-Chromoso- Strachan T, Read AP: Human Molecular Genetics. 3nd
men hybridisiert. Für jedes Chromosom wird ed. Garland Science London, 2004.
Uhrig S et al: Multiplex-FISH for pre- and postnatal
computergestützt eine spezifische Farbe er-
diagnostic application. Am J Hum Genet 65: 448-
zeugt, die dieses Chromosomenpaar identifi- 462, 1999.
ziert und von allen anderen unterscheidet. Die
Analyse erfolgt lichtmikroskopisch mit Epifluo-
reszenz-Mikroskopie unter Verwendung einer
Fernsehkamera (Charge-Coupled Device ca-
mera, CCD). Aus fünf verschiedenen Farbträ-
gern (Fluorophoren) können 24 Farbtöne für je-
des der Chromosomen (beim Menschen 1–22,
X und Y) als Computer-Falschfarben abgeleitet
werden. (Photographien freundlicherweise von
Drs. S. Uhrig und M. Speicher, Graz, überlassen)

B. Spektral-Karyotypisierung
Die Spektral-Karyotypisierung (SKY, Schröck
et al, 1996) verbindet die Fourier-Spektrosko-
pie, CCD-Imaging und die optische Mikrosko-
pie. Die Emissionsspektren aller Punkte der
Probe werden simultan im sichtbaren und im
Infrarot-Bereich gemessen. Durch ihre Kombi-
nation von 24 spezifischen Farbsonden für je-
des Chromosom werden nach der Denaturie-
rung mit Metaphase-Chromosomen hybridi-
siert. Die Emissionsspektren der individuellen
Vielfarb-Chromosomen-Identifizierung 141

1 2 3 4 5

6 7 8 9 10 11 12

13 14 15 16 17 18

19 20 21 22 x y

A . Karyogramm mittels Multicolor-Fluoreszenz-in-situ-Hybridisierung

Chromosomen in 24 Farben

Spectracube verbunden
mit einem
Epifluoreszenz-Mikroskop

x
Metaphase Chromosomen in 24 Farben Karyogramm in Chromosomen-
spezifischen Farben
B. Spektral-Karyotypisierung
142 Chromosomen

Molekularzytogenetische Analyse (links) und im Karyogramm (rechts) sieht man


neben dem Chromosomenpaar 21 ein kleines
Ein wichtiges molekularzyogenetisches Verfah-
zusätzliches akrozentrisches Chromosom mit
ren ist CGH (Comparative Genomic Hybridiza-
Satelliten und roter Fluoreszenz (Pfeil). Weitere
tion). Damit können Abweichungen von der
Untersuchungen bestätigen, dass das zusätzli-
normalen Menge an DNA in allen Chromoso-
che Chromosom aus dem Zentromer eines
men festgestellt werden. Es gibt methodisch
Chromosoms 21 und zusätzlichem Material ei-
verschiedene Ansätze (vgl. Array-CGH, S. 140).
nes Chromosoms 18 (rote Fluoreszenz) besteht.
Das Prinzip beruht darauf, Fluoreszenz-in-situ-
Es liegt ein chromosomal unbalancierter Chro-
Hybridisierung mit Chromosomenpainting
mosomensatz durch partielle Trisomie 18 vor.
(s. S. 140) zu kombinieren. CGH hat besondere
(Photographien freundlicherweise zur Verfü-
Bedeutung für die Analyse von Tumorzellen.
gung gestellt von Dr. Sabine Uhrig und Prof. Mi-
A. Vergleichende chael Speicher, Graz)
Genomhybridisierung (CGH) g Medizinische Relevanz. Strukturelle Chromo-
CGH vergleicht aus Tumorzellen isolierte DNA somenumordnungen treten bei Kindern mit ei-
mit normaler genomischer DNA. Gezeigt wird ner geistigen Entwicklungsstörung mit einer
oben eine Metaphase in drei verschiedenen Häufigkeit von etwa 0,7–2,4 pro 1000 auf.
Färbungen. Links (1) ist sie grün fluoreszierend Kleine überzählige Chromosomen werden bei
gefärbt mit Isothiocyanat (FITC), in der Mitte einer von 2500 Pränataldiagnosen beobachtet.
(2) rot durch Rhodamin und rechts (3) rot- In beiden Situationen müssen das oder die be-
grün-gelb durch Überlagerung von grün-rot. In troffenen Chromosom(en) identifiziert werden,
Abbildungsteil 4 sind links alle Chromosomen um richtige Rückschlüsse auf die Ursache zie-
schematisch aufgetragen. Jeweils rechts davon hen zu können. Viele kleine Veränderungen
ist das Verhältnis grün zu rot erfasst. entgehen einer konventionellen Chromoso-
Tumor-DNA ist grün, normale DNA rot fluores- menanalyse. Der Anteil identifizierter Aberra-
zierend. Alle Chromosomenabschnitte mit glei- tionen wird durch molekularzytogenetische
cher DNA-Menge erscheinen gelb. Zusätzliche Untersuchung mittels Fluoreszenz-in-situ-Hy-
DNA in Tumorzellen resultiert grün, vermin- bridisierung (FISH) deutlich erhöht.
derte DNA-Menge (Deletion) erscheint rot. Alle
Chudoba I et al: High-resolution multicolor banding. A
Chromosomen wurden mit einem AT-reiche
new technique for refined FISH analysis of human
Sequenzen bevorzugt färbenden Farbstoff chromosomes. Cytogenet Cell Genet 84: 156-160,
(DAPI: 4,6-Diamidinophenylindol) individuell, 1999.
fluoreszenz-mikroskopisch identifiziert. Dann Sellner LN, Taylor GR: MLPA and MAPH: New techni-
wurde die Metaphase mittels einer Charge- ques for detection of gene deletions. Hum Mutat
23: 413-419, 2004.
Coupled Device Kamera (CCD) mittels verschie- Speicher MR, Carter NP: The new cytogenetics: Blur-
dener Filtersysteme auf die Fluoreszenzfarbe ring the boundaries with molecular biology. Nature
entlang jedes Chromosoms analysiert und das Rev Genet 6: 782-792, 2005.
Ergebnis dokumentiert, wie hier gezeigt. Im Wolf G: Comparative genomic hybdridization.
(http://amba.charite.de/cgh/).
vorliegenden Beispiel weicht die Kurve über Wong A et al: Detection and calibration of microdeleti-
dem langen Arm von Chromosom 4 nach links ons and microduplications by array-based compa-
ab. Dies zeigt einen Verlust von DNA in den Tu- rative genomic hybridization and its applicability to
morzellen an. (Abb. von Drs. Nicole McNeil und clinical genetic testing. Genet Med 7: 264-271,
2005.
Thomas Ried, NIH, Bethesda, Maryland)

B. Identifizierung durch M-FISH


In diesem Beispiel einer molekularzytogeneti-
schen Methode wird ein kleines zusätzliches,
derivatives Chromosom identifiziert. Ein deri-
vatives Chromosom ist ein durch eine Umord-
nung entstandenes Chromosom. Verwendet
wurde M-FISH (Multicolor FISH, vgl. vorherge-
hende Seite und S. 132). In der Metaphase
Molekularzytogenetische Analyse 143

1. 2. 3.

1 2 3 4 5

6 7 8 9 10 11 12

13 14 15 16 17 18

19 20 21 22 X Y
4.
A. Vergleichende Genomhybridisierung (CGH)

1 2 3 4 5

6 7 8 9 10 11 12

13 14 15 16 17 18

19 20 21 22 x y

B. Identifizierung von zusätzlichem Chromosomenmaterial durch M-FISH


144 Regulation von Genfunktion

Zellkern, ribosomale RNA, ten Proteine wird auf ca. 90 000 geschätzt. Ihre
Poteinsynthese Gesamtheit bildet das Proteom. Welche Prote-
ine gebildet werden, hängt von Zelltyp und
Ein Ribosom ist ein Ribonukleinprotein, an dem Entwicklungstadium ab.
Translation stattfindet. Es koordiniert die Inter-
aktion von mRNA und Transfer-RNA (tRNA) C. Nukleolus und Synthese von
während der Proteinsynthese. Ein Ribosom be- Ribosomen
steht aus zwei ungleichen Untereinheiten. Jede
Der Nukleolus ist eine morphologisch und
Untereinheit wird von ribosomaler RNA (rRNA)
funktionell spezifische Region im Zellkern. Hier
gebildet, an die 20–30 kleine Proteinmoleküle
werden die Ribosomen gebildet. In einer euka-
gebunden sind.
royten Zelle werden Vorstufen (Untereinhei-
A. Struktur und Bestandteile von ten) der Ribosomen im Nukleolus gebildet, ei-
Ribosomen ner eigenen Struktur des Zellkerns. Der Nukleo-
lus enthält DNA-Schleifen aus bestimmten
Prokaryoten haben 70S-Ribosomen (2,5 Millio- Chromosomenregionen (Nukleolus-organisie-
nen Molekulargewicht, MDa), bestehend aus rende Region) mit Genen (rRNA-Gene), die
zwei Untereinheiten 50S (1,6 Mio) und 30S (0,9 durch RNA-Polymerase-I transkribiert werden.
Mio). Die 50S-Untereinheit besteht ihrerseits Zuerst wird ein 45S-rRNA-Vorläufer (13000
wieder aus einem großen (23S, etwa 2900 Nu- Nukleotide) gebildet und in ein großes Ribonu-
kleotide) und einem kleinen (5S, etwa 120 Nu- kleoprotein aus ribosomalen Proteinen und
kleotide) rRNA-Anteil. Ferner enthält sie 34 wieder verwendeten RNA- und Proteinmolekü-
weitere Proteine. Die 30S-Untereinheit enthält len zusammengefügt. Daraus entstehen in
eine große 16S-rRNA und 21 weitere Proteine. mehreren Schritten die kleine und die große
Während die 50S-Untereinheit Peptidyltransfe- Untereinheit. Diese werden aus dem Zellkern in
rase-Aktivität aufweist, ist die 30S-Unterein- das Zytoplasma transportiert und zu funktio-
heit der Ort der Entschlüsselung der in der Bo- nellen Ribosomen aktiviert (die komplexen
ten-RNA (mRNA) enthaltenen Information. Die biochemischen Vorgänge sind in der Abb. nicht
30S-Untereinheit verfügt über einen Korrektur- dargestellt).
lese-Mechanismus.
Bei Eukaryoten ist das Ribosom größer (80S, g Medizinische Relevanz. Eine Reihe von chemi-
entsprechend etwa 4,2 MDa), bestehend aus ei- schen Substanzen wirken als Gift und inaktivie-
ner 60S- und einer 40S-Untereinheit. Die 60S- ren Proteinkomponenten der Ribosomen. Syn-
Untereinheit enthält 5S-, 5,8S- und 28S- rRNAs thetische, die Funktion von Ribosomen beein-
von 120, 160 und 4800 Nukleotidbasen Länge, trächtigende Moleküle werden zur Krebsthera-
sowie 50 Proteine. Die 40S-Untereinheit ent- pie verwendet (s. Tabelle 3, Anhang, S. 362).
hält 18S-rRNA und 33 Proteine. Das Zytoplasma
Agalarov SC et al: Structure of the S15, S6, S18-rRNA
einer eukaryoten Zelle enthält mehrere Millio- complex: assembly of the 30S ribosome central do-
nen Ribosomen. Die Größenangabe S bedeutet main. Science 288: 107-112, 2000.
Svedberg-Einheit. Dies ist der Sedimentations- Alberts B et al: Molecular Biology of the Cell. 5th ed.
koeffizient. Er entspricht einer nicht additiven Garland Publishing, New York, 2008.
Alberts B et al: Essential Cell Biology. An Introduction
Größenangabe bei der Ultrazentrifugation). to the Molecular Biology of the Cell. Garland Publis-
(Abb. modiziert nach B. Alberts et al., 2008) hing, New York, 1998.
Ban N et al: Placement of protein and RNA structures
B. Vom Gen zum Protein into a 5 Å-resolution map of the 50S ribosomal sub-
unit. Nature 400: 841 – 847, 1999.
Transkription und Verarbeitung des primären
Garrett R: Mechanics of the ribosome. Nature 400:
Transkripts (RNA-Splicing) zu mRNA findet im 811-812, 1999.
Zellkern statt. Zur Stabilisierung ist die RNA im Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
Zellkern an nukleäre, RNA-bindende Proteine man, New York, 2004.
Wimberly BT et al: Structure of the 30S ribosomal sub-
gebunden. Die fertige RNA (mRNA) wird dann
unit. Nature 407: 327-339, 2000.
aus dem Zellkern ausgeschleust und dient im
Zytoplasma bei der Translation als Vorlage für
die Bildung eines Polypeptids. Die Gesamtzahl
der von einem eukaryoten Organismus gebilde-
Zellkern, ribosomale RNA, Poteinsynthese 145

Prokaryoten Eukaryoten
30S 40S
Ribosom Ribosom

70S 80S

50S 30S 60S 40S

rRNA rRNA

5S 23S 16S 5S 28S 5.8S 18S

und 34 Proteine und 21 Proteine und ca. 50 Proteine und ca. 33 Proteine

A. Struktur und Bestandteile von Ribosomen

Zelle Cytoplasma
Zellkern Nukleolus
(Nucleus)

Zellplasma- Nukleus Cytoplasma


Membran rRNA-Gen

Transkription
45S-rRNA-
DNA Vorläufer
Transkription
großes
nukleäre ribosomale Ribonukleo-
RNA- Proteine Protein-
bindende RNA- Partikel
Proteine Splicing
RNA
und
RNA-Transport 5S-rRNA Proteine

kleine große
Untereinheit Untereinheit
Ribosomen Translation

Polypeptid 5,8S-
18S-rRNA 5S- RNA
28S-
40S-Unter- 60S-Unter-
einheit einheit

B. Vom Gen zum Protein C. Nukleolus und Synthese von Ribosomen


146 Regulation von Genfunktion

Transkription C. Promotor der Transkription


Die Transkription der DNA in ein komplementä- Der Promotor besteht aus spezifischen DNA-Se-
res RNA-Molekül ist die erste Phase der Deco- quenzen. Ihre Sequenz ist bei allen Lebewesen
dierung der genetischen Information eines akti- identisch (evolutionär konserviert) und wird
ven Gens (exprimiertes Gen). Transkription wird daher auch als Konsensus-Sequenz bezeichnet.
durch zahlreiche Proteine (Transkriptionsfakto- Zwei kurze Konsensus-Sequenzen kennzeich-
ren) gesteuert, die an bestimmte Abschnitte der nen den Promotor bei Prokaryoten. Eine davon
DNA binden. Sie bilden einen Transkriptions- besteht aus der Sequenz TTGACA, die 35 Nukle-
komplex. Obwohl es einige Unterschiede in der otide (bzw. Basenpaare, bp) in 5’-Richtung
Transkription bei Prokaryoten und Eukaryoten („stromaufwärts“) von der Startstelle entfernt
gibt, sind die grundlegenden Prozesse gleich. liegt. Die andere Sequenz, TATATT (auch „TATA-
Die Transkription wird von RNA-Polymerase ka- Box“ genannt), liegt 10 Nukleotide vor der
talysiert. RNA-Polymerase bei Eukaryoten ist Startstelle des Gens. Bei Eukaryoten existieren
komplex. Sie besteht aus drei Enzymen, die je- zusätzliche genregulierende DNA-Sequenzen in
weils von verschiedenen Genen codiert werden. erheblichem Abstand vom Startpunkt der Tran-
skription (Enhancer).
A. Transkription durch D. Eine Transkriptionseinheit
RNA-Polymerase
Die Transkription beginnt am Promotor. Am 3’-
Die Transkription beginnt mit der Erkennung
Ende wird die Polymerase ebenfalls an definier-
spezifischer DNA-Sequenzen durch RNA-Poly-
ter Stelle wieder entfernt (Terminator). Sowohl
merase (1). An dieser Stelle öffnet sich die Dop-
Start als auch Ende der Transkription sind ge-
pelhelix und die RNA-Synthese beginnt (Initia-
nau definiert. Alle an der Bildung der RNA be-
tion). Dieser Vorgang (2) wird durch Verlänge-
teiligten Komponenten werden in ihrer Ge-
rung fortgesetzt (Elongation). Während die Po-
samtheit als Transkriptionseinheit bezeichnet.
lymerase an der DNA entlang wandert, wird
RNA synthetisiert. Die DNA wird von 3’- nach E. Bestimmung des Startpunktes der
5’-Richtung abgelesen, so dass RNA in 5’ nach Transkription
3’-Richtung synthetisiert wird. Am Ende der zu
Vor der Kenntnis der DNA-Sequenz des Ge-
transkribierenden Sequenz wird durch Ausbil-
noms war es nicht immer möglich ein Gen zu
dung einer Haarnadelschleife der Transkripti-
finden. Man konnte jedoch den Startpunkt der
ons-Stopp signalisiert (Termination). Die RNA-
Transkription bestimmen.
Polymerase löst sich dort von der DNA (3).
Man hybridisiert hierbei durch Transkription
Das durch Transkription entstandene RNA-Mo-
gebildete RNA mit komplementärer Einzel-
lekül (primäres Transkript) ist instabil. Bei Pro-
strang-DNA. Nach Zugabe von S1-DNA-Endo-
karyoten ist es mit der fertigen Boten-RNA
nuklease schneidet diese die Einzelstrang-DNA,
(mRNA) identisch, deshalb schließt sich dort
verschont aber den DNA/RNA-Hybridstrang.
die Translation sofort an. Bei Eukaryoten wird
Wenn man anschließend die RNA wieder ent-
das primäre Transkript erst in einer Serie kom-
fernt, steht die DNA des geprüften Bereichs zur
plexer Vorgänge zu mRNA verarbeitet (S. 32).
weiteren Analyse zur Verfügung.
Die RNA-Polymerisierungsrate beträgt etwa 30
Nukleotide pro Sekunde, entsprechend etwa g Medizinische Relevanz. Veränderungen der
3 Minuten für 5000 Nukleotide. Alle Vorgänge DNA-Basensequenz (Mutation) in regulatori-
werden durch ein komplexes Zusammenwir- schen Promotor-Bereichen kann zu genetisch
ken verschiedener Enzyme vermittelt. bedingten Krankheiten führen, da eine regel-
hafte Transkription verhindert wird.
B. Polymerase-Bindungsstelle
Alberts B et al: Molecular Biology of the Cell. 5th ed.
An der Bindungsstelle der spezifischen DNA- Garland Publishing, New York, 2008.
Sequenzen (Promotor-Sequenzen) bildet RNA- Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
man, New York, 2004.
Polymerase einen Transkriptionskomplex, be- Strachan T, Read AP: Human Molecular Genetics. 3rd
stehend aus zahlreichen Proteinen (Transkrip- ed. Garland Science, London, 2004.
tionsfaktoren).
Transkription 147

DNA-Doppelhelix RNA-Polymerase

RNA-Polymerase bindet
an DNA-Doppelhelix und
beginnt mit Entwindung
Bindung Entfernung

Beginn der RNA-Synthese


1. Initiation 5' 3'
Promotor mRNA Terminator

Start Ende
RNA-Synthese vom
3' 5' DNA-Strang D. Eine Transkriptionseinheit
DNA wieder
aufgewunden
DNA-Doppelhelix

mRNA mRNA- Polymerase


wandert entlang der DNA
Transkription
2. Elongation

RNA
RNA- Polymerase komple-
von DNA entfernt mentärer
DNA-
Einzelstrang
Hybridisierung
5' 3'
Primärtranskript (instabil)

3. Termination
A. Transkription durch RNA-Polymerase S1-Nuklease

aufwinden
Einzelstrang-
DNA Entfernung DNA
der RNA abgebaut

5' 3' DNA zur Analyse, z.B. Sequenzieren


mRNA entwinden
E. Bestimmung des Startpunktes
B. Polymerase-Bindungsstelle E. der Transkription

Startpunkt
DNA -35 -10 +1
TTGACA TATAAT

10 bp Transkription
Konsensus-Sequenzen
35 bp
C. Promotor der Transkription
148 Regulation von Genfunktion

Transkriptionskontrolle C. RNA-Polymerase-Promotor
Die Transkription wird durch Bindung sequenz- Eukaryote Zellen enthalten drei RNA-Polymera-
spezifischer DNA-bindender Proteine (Tran- sen (Pol I, Pol II und Pol III) mit jeweils einer ei-
skriptionsfaktoren) im Bereich des Promotors genen Promotor-Region. Pol II ist für die Syn-
und an anderen Sequenzen außerhalb der ei- these von RNA als Vorläufer der Boten-RNA
gentlichen regulierenden Region (Enhancer) (mRNA) verantwortlich und macht 20–40 % der
gesteuert. Man unterscheidet allgemeine Tran- zellulären Aktivität aus. Sie bindet an den RNA-
skriptionsfaktoren und zellspezifische, signal- Polymerase-II-Promotor (1). Pol I synthetisiert
abhängige Transkriptionsfaktoren. ribosomale RNA (rRNA) im Nukleolus und
macht 50–70 % der zellulären Aktivität aus. Der
A. Konsensus-Sequenzen in der RNA-Polymerase-I-Promotor (2) besteht aus
Promotor-Region zwei Bereichen, einem Kontrollelement etwa
Die Spezifität der DNA-Sequenzen in der Pro- 170–180 Basenpaaren stromaufwärts (up-
motor-Region lässt sich aus der Intensität der stream control element, UCE) und einem ande-
Transkription ableiten. Im Bereich der Konsen- ren, als Kernpromotor bezeichneten UCE,
sus-Sequenzen, die 35 und 10 Basenpaare ober- 20–45 bp stromaufwärts. Zwei weitere Fakto-
halb (in 5’-Richtung, „stromaufwärts“) der ren, UBFI und UBF2, binden an diese Regionen.
Startstelle für die Transkription liegen (1), re- Pol III ist für die Synthese von Transfer-RNA
duzieren fast alle Sequenzänderungen (Mutati- (tRNA), sowie 5S-rRNAs und kleine RNAs ver-
onen) die Transkription oder heben sie ganz antwortlich. Der Promotor für Pol III (3) besteht
auf. Dagegen ist dies bei Sequenzen außerhalb aus mehreren Regionen, die sich stromaufwärts
der Promotor-Region kaum oder nicht der Fall (5’-Richtung) und stromabwärts (3’-Richtung)
(2). (Abb. modifiziert aus Watson et al, 1987, des transkribierten Bereiches befinden. An die-
nach Rosenberg & Court, 1979, und Youderian sen Promotor binden drei wesentliche Tran-
et al, 1982) skriptionsfaktoren, TFIIIA (ein Zinkfingerpro-
tein, S. 152), TFIIIB (ein TATA-bindendes Pro-
B. Allgemeine Transkriptionsfaktoren tein) und TFIIIC. Die unterschiedliche Struktur
Man unterscheidet allgemeine und genspezifi- der Promotoren für die drei RNA-Polymerasen
sche Transkriptionsfaktoren (TF), je nach dem, spiegelt die ausgesprochene Spezifität der
ob sie generell für alle Gene oder spezifisch für Transkriptionskontrolle wider. (Abb. modifi-
ein bestimmtes Gen wirksam sind. Die Aktivie- ziert nach Lewin, 2004)
rung der RNA-Polymerase-II (Pol II) für die
Alberts B et al: Molecular Biology of the Cell. 4rd ed.
Transkription der meisten eukaryoten Gene er- Garland Publishing Co., New York, 2002.
fordert die Bildung eines Initiationskomplex Brivanlou AH, Darnell JE jr: Signal transduction and the
am Promotor. Dieser ist durch kurze Sequenzen control of gene expression. Science 295: 813-818,
von T-A- und A-T-Basenpaaren gekennzeichnet 2002.
Kraemer KK: From proteomics to disease. Nature Genet
(sog. TATA-Box), 10 Basenpaare stromaufwärts 36: 677-678, 2004.
(1). Lewin B: Genes VIII. Pearson-PrenticeHall, 2004.
Zunächst binden zwei Proteine, TFIID und TBP Rosenberg M, Court D: Regulatory sequences involved
(TATA-bindendes Protein) (2). Nachdem der in the promotion and termination of RNA transcrip-
tion. Ann Rev Genet 13: 319-353, 1979.
nächste Transkriptionsfaktor, TFIIB, daran ge- Watson et al: Molecular Biology of the Gene. 4th ed.,
bunden ist (3), können weitere Proteine TFIIH, Benjamin/Cummings, Menlo Park, CA., 1987.
TFIIE, TFIIF, an den Transkriptionskomplex bin- Youderian P et al: Sequence determinants of promoter
den, der dazu führt, dass Pol II an den Promotor activity. Cell 30: 843-853, 1982.
bindet (4). Polymerase II (Pol II) wird durch
eine Untereinheit von TFIIH, eine Proteinkinase,
phosphoryliert und dadurch aktiviert (5), so
dass die Transkription beginnen kann. TFIIHbe-
sitzt außerdem Helicase-Funktion, um die
DNA-Doppelhelix aufzuwinden. (Abb. modifi-
ziert nach Alberts et al, 2002)
Transkriptionskontrolle 149

Promotor-Region

5' TAGTGTATTG ACATGATAGAAGCACTCTACTATATTCT CAATAGGTCCACG 3'


3' A T C A C A T A A C T G T A C T A T C T T C G T G A G A T G A TAT A A G A G T T A T C C A G G T G C 5'
–35 Sequenz –10 Sequenz
1. 5' mRNA 3'
Startstelle für
Transkription

AGTTAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACGG
5' 3'
normale Transkription

GT C AT A
G
T wenig Transkription CG
CA
G

GCAG T CG C
keine Transkription
AT
A TC AT

2. Effekt von Mutationen in der Promotor-Region auf die Transkriptionsrate


A. Promotor-Region bei Prokaryoten

Codierender Strang Promotor- Beginn der Transkription TFIID c RNA-Polymerase II


Region Komplex
Transkription
5' 3' 5' 3'
TATA –25bp Polypeptide
1. Promotor
TFIID und TBP
binden an TATA 1. RNA-Polymerase-II-Promotor
5' 3'

2. TATA Pol I
SL1 SL1
TFIIB bindet
an TFIID UFB1 UFB1 Transkr.
TFIID
5' 3'
5' 3'
stromaufwärts Kernpromotor Ribos.
Kontrollelement -45 to -20 Gene
3. TFIIH, TFIIE, (UCE) -180 to -170
TFIIB TFIIF, Pol II
TFIID H E 2. RNA-Polymerase-I-Promotor
ist zweigeteilt
5' 3'
TFIIF
4. Pol II Transkription
(tRNAs, 5s rRNAs, small RNAs)
TFIIH phosphoryliert Pol II TF IIIB,
TF IIIA TF IIIC TF IIIC
Transkription 5' 3'
TFIID
interne Promotor
5' 3' Pol III
Pol II
5.
P P P P 3. RNA-Polymerase-III-Promotoren
Polymerase II aktiviert stromaufwärts und stromabwärts
B. Zusammenwirken von Transkriptionsfaktoren C. RNA-Polymerase-Promotor
150 Regulation von Genfunktion

Regulation der Genexpression (Schleifenbildung) der DNA gelangt das Aktiva-


torprotein in die Nähe eines Transkriptionsfak-
Der Begriff Genexpression bezieht sich auf ge-
tors und aktiviert diesen, so dass die Transkrip-
netische Aktivität mit Bildung eines Genpro-
tion beginnen kann. Man unterscheidet cis-
dukts, das sich auf den Phänotyp auswirkt. Ei-
agierende (auf demselben DNA-Strang) und
nige Gene sind stets aktiv (konstitutive Expres-
trans-agierende (auf einem anderen Strang)
sion). Andere Gene sind nur in bestimmten Ge-
Kontrollelemente (Abb. modifiziert nach Al-
weben oder zu bestimmten Stadien der Ent-
berts et al, 2008).
wicklung aktiv (konditionelle Expression).

A. Ebenen der Transkriptionskontrolle D. Alternatives Spleißen


Ein wichtiger Mechanismus der Kontrolle von
Bei Eukaroyten wird Transkription auf ver-
Genaktivität ist alternatives Splicing. Dabei
schiedenen Ebenen kontrolliert. Die erste und
entstehen unterschiedliche Genprodukte durch
weitaus wichtigste Ebene ist die primäre Kon-
Zusammenfügen (Spleißen) verschiedener
trolle der Initiation der Transkription (s. S. 146).
Exons. Zum Beispiel können ausgehend vom
Als nächstes kann die Verarbeitung des primä-
Gen für Calcitonin (OMIM 114130) in der
ren Transkripts durch alternatives Spleißen
Schilddrüse und im Hypothalamus verschie-
kontrolliert werden (s. u.). Danach kann die
dene Genprodukte gebildet werden. In der
Translation kontrolliert werden (mRNA-Edi-
Schilddrüse enthält die mRNA die Exons 1–4,
ting, s. Teil B). Schließlich kann auch die Aktivi-
nicht aber Exons 5 und 6. Im Hypothalamus
tät eines Proteins kontrolliert werden (post-
werden Exons 1, 2, 3, 5 und 6 zusammengefügt,
translationale Modifikation).
aber nicht Exon 4 (Calcitoningen-verwandtes
B. RNA-Editing Peptid, CGRP). Alternatives Spleißen kommt bei
etwa 40–60 % der Gene des Menschen vor
RNA-Editing ist eine seltene posttranskription-
(Modrek & Lee, 2002), vor allem bei im Gehirn
elle Verarbeitung durch enzymgesteuerte In-
exprimierten Genen. Alternatives Splicing ver-
sertion oder Deletion von Nukleotiden auf
leiht dem eukaryoten Genom eine enorme phy-
RNA-Ebene. Ein Beispiel ist die Expression des
siologische und ökonomische Flexibilität, weil
Apolipoprotein-B100-Gens (OMIM 107730).
ein Gen als Vorlage zahlreicher, funktionell fein
Dieses Gen codiert für ein 512-kD-Protein von
abgestufter Genprodukte dienen kann.
4536 Aminosäuren Länge, das im Lipoprotein-
Stoffwechsel wichtig ist. Es wird in der Leber Alberts B et al: Molecular Biology of the Cell. 5th ed.
gebildet und in das Blut abgegeben, wo es Li- Garland Publishing Co., New York, 2008.
pide transportiert. Im Darm wird in Codon Blackwood EM, Kadonga JF: Going the distance: A cur-
rent view of enhancer action. Science 281: 60-63,
2152 (CAA, das für Glutamin codiert) Cytosin zu
1998.
Uracil deaminiert. Dadurch entsteht ein Stopp- Gravely BR: Alternative splicing: increasing diversity in
Codon (UAA), das die Translation an dieser Po- the proteomic world. Trends Genet 17: 100-107,
sition beendet. Deshalb wird nun ein funktio- 2001.
Modrek B, Lee C: A genomic view of alternative spli-
nell verwandtes, kürzeres Protein, Apo B-84
cing. Nature Genet 30: 13-19, 2002.
(250 kD) mit 2152 Aminosäuren gebildet. (Abb. Stryer, L: Biochemistry. 4th ed. WH Freeman, New York,
modifiziert nach Stryer, 1995) 1995.

C. Einfluss durch Enhancer


Enhancer (Verstärkerelemente) sind eukaryote
transkriptionskontrollierende Regionen. Sie
wirken aus der Entfernung und können 50 kb
und weiter entfernt von der codierenden
Region liegen. Sie sind meist etwa 50 bis 200
Basenpaare lang und enthalten Bindungsstellen
für mehrere Transkriptionsfaktoren. Ein En-
hancer kann in beide Richtungen wirken. Der
Enhancer bindet an ein oder mehrere Akti-
vatorproteine. Durch Konformationsänderung
Regulation der Genexpression 151

1 Apo B-100 4536


Cytosol
Translation
Gln
DNA Nukleus CAA
5' 3'
primäre mRNA Cytosin-Deaminierung
Transkriptions- durch intestinale Deaminase
kontrolle UAA
5' 3'
Stopp
primäres Transkript
1 2152
Kontrolle der
Apo B-84
Verarbeitung
(alternatives B. RNA-Bearbeitung
Spleißen)
Aktivatorprotein Transkriptions-
mRNA startpunkt

Translations- 5' 3'


kontrolle Enhancer Promoter
(mRNA Bindung eines
Bearbeitung) Aktivatorproteins
Protein an den Transkriptions-
komplex
Protein-Aktivität Enhancer

Aktivatorprotein

aktiv inaktiv Transkriptionsfaktoren

Promoter mit Transkription


Transkriptions-
faktoren und
RNA-Polymerase II

A. Ebenen der Kontrolle C. Weitreichende Gen-Aktivierung


eukaryoter Gen-Expression durch einen Enhancer

Calcitonin-Gen
5' Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 3'

Transkription
primäres RNA-Transkript
5' 1 2 3 4 5 6 3'

mRNA C-Zellen in der Schilddrüse RNA-Verarbeitung im Hypothalamus


5' 1 2 3 4 3' 5' 1 2 3 5 6 3'

Translation Translation

Calcitonin verschiedene CGRP


Genprodukte (Calcitonin
gene-related
peptide)
D. Alternatives RNA-Splicing
152 Regulation von Genfunktion

DNA-bindende Proteine skriptionsfaktoren (ZNF) sind an wichtigen


Funktionen während der embryonalen Ent-
DNA-bindende Proteine erkennen regulatori-
wicklung und der Differenzierung in verschie-
sche DNA-Sequenzen durch spezifische Bin-
dene Gewebe beteiligt. (Abb. modifiziert nach
dung an einen Promotor oder einen Enhancer.
Alberts et al, 2002)
Dadurch aktivieren oder inaktivieren sie ein
bestimmtes Gen. In ihrer Gesamtheit werden D. Zinkfingerprotein-Bindung an DNA
sie als Transkriptionsfaktoren bezeichnet. Tran-
skriptionsfaktoren haben zwei wesentliche Do- Jedes ZnF-Protein erkennt eine spezifische
mänen: eine DNA-bindende und eine trans-ak- DNA-Sequenz. Da die Anzahl der Zink-Atome
tivierende, die den Promotor oder Enhancer ei- variiert werden kann, zeigt dieser Typ von
nes Gens aktiviert oder inaktiviert. Zusätzlich DNA-Bindungen eine große Flexibilität. (Abb.
kann eine Protein-Protein-interaktive Domäne modifiziert nach Alberts et al, 2002)
vorkommen.
E. Hormon-Response-Element
A. Bindung eines regulatorischen Bestimmte DNA-bindende Proteine sind Signal-
Proteins an DNA moleküle. Zur Gruppe dieser Signalmoleküle
gehören Steroidhormone. Sie aktivieren die
Genregulatorische Proteine können DNA-Se-
DNA-bindende Domäne eines Proteins und lö-
quenzen erkennen, ohne dass die Wasserstoff-
sen dadurch ein intrazelluläres Signal aus, das
Brückenbindungen der Helix geöffnet werden
zu Transkription des kontrollierten Gens führt.
müssen. Jedes Basenpaar stellt ein spezielles
Die auf das intrazelluläres Signal reagierenden
Muster eines H-Brücken-Donors (im Beispiel
DNA-Sequenzen werden als Hormon-Re-
rot gezeigt) und eines H-Brücken-Akzeptors dar
sponse-Element (HRE, Hormon-Antwort-Ele-
(im Beispiel grün). Diese Proteine binden an die
ment) bezeichnet. Die Abb. zeigt den dimeren
große Furche der DNA. Die Abb. zeigt den Kon-
Glucocorticoid-Rezeptor als HRE. In jeder der
takt eines Asparagins (Asn) eines genregulatori-
beiden Untereinheiten ist ein Zink-Atom zur
schen Proteins mit der DNA-Base Adenin (A).
Stabilisierung an vier Cystein-Seitenketten an
Ein typischer Oberflächen-zu-Oberflächen-
Position 443 und 440, sowie 460 und 457 ge-
Kontakt erstreckt sich über ca. 10–20 Nukleoid-
bunden (1). Das Skelettmodel (2) zeigt die Bin-
basen, jede mit einer anderen Aminosäure.
dung des dimeren Proteins (braun oder blau
(Abb. modifiziert nach Alberts et al, 2002)
unten) an zwei Bereichen der Doppelhelix
B. Spezifische DNA-Protein-Interaktion (große Furchen). Das dreidimensionale Modell
(3) zeigt wie exakt jedes Dimers des Proteins
Dieses Beispiel illustriert die enge Bindung der (braun und blau) in die DNA passt (dargestellt
sequenzlesenden Erkennungs-Helix an die in rot und grün). (Abb. modifiziert nach Stryer,
große Furche der DNA des Bakteriophagen- 1995, S. 1002)
434-Repressors. (Abb. modifiziert nach Lodish
et al, 2004) g Medizinische Relevanz. Störungen in der
Funktion von Transkriptionsfaktoren können
C. Zinkfingermotiv zu angeborenen Fehlbildungen führen, z. B. das
Eine charakteristische Gruppe eukaryoter Tran- Waardenburg Syndrom Typ I (OMIM 193500)
skriptionsfaktoren enthält eine Region mit ei- durch Mutation im PAX3-Transkriptionsfaktor
nem zentral gelegenen Zinkatom in einer fin- (Paired Box, OMIM 606597), Typ IIA (OMIM
gerähnlichen Konfiguration (Zinkfingermotiv, 193510) durch Mutation im MITF (Microphthal-
ZnF). Das Beispiel zeigt ein ZnF-Protein links mia-associated transcription factor, OMIM
schematisch und rechts als drei-dimensionales 156845) oder Krebs (s. p53, S. 268).
Modell, bestehend aus einem antiparallelen b- Alberts B et al: Molecular Biology of the Cell, 4rd ed.
Faltblatt (Aminosäuren 1–10), einer a-Helix Garland Science, New York, 2002.
(Aminosäuren 12–24), sowie der Verbindung Gilbert SF: Developmental Biology. 7th ed. Sinauer,
zum Zink-Atom. Vier Aminosäuren im oberen Sunderland, Massachusetts, 2003.
Lodish H et al: Molecular Cell Biology, 5th ed., WH Free-
Teil des Proteins sind mit dem Zn-Atom ver- man, New York, 2004.
bunden: zwei Histidine in Position 23 und 19, Stryer L: Biochemistry. 4th ed. WH Freeman, New York,
zwei Cysteine in Position 3 und 6. ZnF-Tran- 1995.
DNA-bindende Proteine 153

DNA-bindendes Protein

CH2
Asn C
große Furche H
Donor O N
H H Akzeptor
CH3 O HN
N H

H T N H N A N
N N
O H
zum
zum Zucker kleine Furche Zucker

A. Bindung eines B. Spezifische DNA-Protein-Interaktion


regulativen Proteins an DNA

25 1
HOOC N Y NH2 25
K 23 3 K HOOC
H C
V C His
23 Cys
R Zn 6
Q L
Zn
H 19 6 C
R E
S Cys
R
L His 19 3
A S
S F 10 1
K V H2N
Zn Zn 10
E
12 12

C. Zinkfingermotiv

D. Ein Zinkfinger-Protein bindet an DNA

Cys Cys
443 440

Zn

Cys Cys
460 457

1. 2. 3.
E. Bindung an ein Response-Element
154 Regulation von Genfunktion

Andere Transkriptions-Aktivatoren ZNF-Transkriptionsfaktoren werden bei Euka-


ryoten zur Expressionskontrolle tausender von
Die DNA-bindenden Domänen eukaryoter
Genen verwendet. Die Fähigkeit zur Bildung
Transkriptions-Aktivatoren oder –Repressoren
von Heterodimeren resultiert in einem breiten
können verschiedenen strukturellen Motiven
Spektrum von Spezifitäten (kombinatorische
zugeordnet werden. Das Genom des Menschen
Kontrolle). (Abb. modifiziert nach Alberts et al,
enthält etwa 2000 Transkriptionsfaktoren (Lo-
2008)
dish et al, 2004). Charakteristische Strukturmo-
tive sind Zinkfinger Proteine (s. S. 152), Leucin- C. Aktivierung durch Steroidhormon-
Zipper und Helix-Loop-Helix-Motive (s. u.). Bindung
Transkriptions-Aktivatoren sind dimere Prote-
Zahlreiche Steroidhormone wirken auf einen
ine mit definierten funktionellen Domänen, ei-
Enhancer (Verstärkerelement). Infolge der spe-
ner DNA-bindenden Domäne und einer aktivie-
zifischen Bindung des Hormons an die DNA-Se-
renden Domäne. Die DNA-bindende Domäne
quenzen des Enhancers wird dieser aktiviert.
interagiert mit spezifischen, regulativen DNA-
Dies aktiviert wiederum andere DNA-bindende
Sequenzen (s. S. 148). Die aktivierende Domäne
Proteine (Transkriptionsfaktoren) des Promo-
interagiert mit anderen Proteinen und initiiert
tors und leitet die Transkription ein.
die Transkription. Transkriptions-Aktivatoren
sind Teil des Initiationskomplex und stimulie- D. Nachweis von DNA-Protein-
ren die Bindung des allgemeinen Transkripti- Interaktion
onsfaktors TFIID an den Promotor. In ihrer Ge-
samtheit bilden Transkriptions-Aktivatoren Zum Nachweis Protein-bindender DNA-Berei-
eine zweite Ebene der Transkriptionskontrolle. che wird DNA mittels des Enzyms DNAse I ge-
schnitten und in kleine Fragmente unterschied-
A. Leucin-Zipper-Motiv licher Größe zerlegt. Im Bereich eines Polyme-
Es gibt auch DNA-bindende Proteine mit einer rase-Promotor-Komplex jedoch treten keine
charakteristischen Struktur, die einem Reißver- Fragmente auf (1), weil hier die DNA vor DNAse
schluss (Zipper) ähnelt. Das DNA-Bindungsmo- geschützt ist. In diesem Bereich entstehen
tiv besteht hier aus zwei a-Helices eines dime- keine DNA-Fragmente, in der Gelelektropho-
ren Proteins, das viele Kontakte mit der DNA rese sind keine entsprechenden Banden nach-
ausbildet. Die beiden Helices binden an die weisbar (Fußspur). Dies wird als DNA-Footprin-
Doppelhelix wie eine Wäscheklammer an eine ting bezeichnet. Mit diesem früher zur Erken-
Wäscheleine (1), die von sich periodisch wie- nung eines bisher nicht bekannten Gens ange-
derholenden Leucin-Resten reißverschlussartig wandten Verfahrens kann man einen DNA-Pro-
zusammengehalten wird. Ein dem Leucin-Zip- teinkomplex von freier DNA unterscheiden.
per-Motiv verwandtes DNA-bindendes Motiv Beim Bandshift-Nachweis wird in einer Gel-
ist das Helix-Schleifen-Helix-(Helix-Loop-He- Elektrophorese die unterschiedliche Laufge-
lix, HLH)-Motiv (2). Es besteht aus einer kurzen schwindigkeit der freien DNA und der an Prote-
und einer langen a-Helix, die durch eine fle- ine gebundenen festgestellt (Bandshift, 2).
xible Schleife (Loop) des Proteins miteinander g Medizinische Relevanz. Mutationen in einem
verbunden sind (hier nicht gezeigt). Basische ein bHLH-Protein codierenden Gen (TWIST1,
Helix-Loop-Helix-Proteine (bHLH) binden an OMIM 601622) verursachen das Akrozephalie-
DNA-Sequenzen, die Muskel-spezifische Gene Syndaktylie-Syndrom Typ III (Saethre-Chotzen-
aktivieren. Sie werden auch als MRFs bezeich- Syndrom, OMIM 101400).
net (Myogene Regulative Faktoren). (Abb. nach
Alberts et al, 2008) Alberts B et al: Molecular Biology of the Cell, 5th ed.
Garland Science, New York, 2008.
B. Alternative heterodimere Kress W et al: Saethre-Chotzen syndrome caused by
TWIST1 gene mutations: functional differentiation
Kombinationen from Muenke coronal synostosis syndrome. Europ J
Man kann bei Zinkfinger-Transkriptionsfakto- Hum Genet 14: 39-48, 2006.
Lodish H et al: Molecular Cell Biology. 5th ed. WH Free-
ren (ZNF) Homodimere aus zwei gleichen Pro- man, New York, 2004.
teinen (1 und 2) oder aus zwei verschiedenen
Proteinen (Heterodimere) unterscheiden (3).
Andere Transkriptions-Aktivatoren 155

DNA

1. 2. 3.

Homodimere Heterodimer
1. 2.
A. Leucin-Zipper-Motiv B. Alternative dimere Kombinationen

inaktives Gen Startpunkt für Transkription

DNA
keine mRNA
Enhancer Promotor

Hormon-Rezeptor-
Komplex
Startpunkt für Transkription
aktives Gen
DNA

Promotor mRNA
aktivierter Enhancer aktiviert

C. Aktivierung durch Steroidhormon-Bindung

Polymerase- DNA-Fragmente freie DNA DNA-Protein-


Promotor-Komplex getrennt, nach Komplex
Größe sortiert

groß

Einschnitt fehlendes
durch DNAse I Band im
Richtung

Bereich der
Bindung
(„Footprint“)
markierte
DNA schnell langsam

Wanderungsgeschwindigkeit
klein in der Gel-Elektrophorese

Gel-Elektrophorese
1. DNA-Footprinting 2. Band-Shift-Test
D. Nachweis einer proteinbindenden Stelle in der DNA
156 Regulation von Genfunktion

Genabschaltung durch strang-RNA (rote Pfeile). Die aus der Degrada-


RNA-Interferenz (RNAi) tion resultierenden mRNA-Bruchstücke werden
durch zelluläre Nukleasen rasch abgebaut (4).
Neben den drei klassischen Formen von RNA Durch die Zerstörung der mRNA wird das ent-
(mRNA, tRNA und rRNA), gibt es nicht-codie- sprechende Gen inaktiviert.
rende kleine RNAs (smRNAs, small RNAs), die
nicht an der Translation beteiligt sind. Diese D. Degradation doppelsträngiger RNA
20–30-Nukeotid-Sequenzen regulieren eine Doppelsträngige RNA wird durch ein als „Dicer“
Reihe von biologischen Vorgängen. Die wich- bezeichnetes Enzymsystem gespalten. Der
tigsten sind kleine interferierende RNAs (siR- Name ist von einem Haushaltsgerät abgeleitet,
NAs, small interfering RNA), Mikro-RNAs (miR- das Gemüse oder Fleisch in kleine Stücke zer-
NAs) und Piwi-assoziierte RNAs (piRNAs). schneidet. Dicer ist ein komplexes Molekül mit
siRNA wird durch Spaltung langer doppelsträn- Endonuklease- und Helicase-Aktivität (RNase-
giger RNA-Moleküle gebildet. miRNAs werden III-Helicase), das RNA spalten kann (1). Der Di-
durch spezifische Gene codiert und unterdrü- cer-Komplex (hier nur schematisch gezeigt)
cken die Translation. Sie werden von langen bindet an dsRNA (2). Die Helicase-Aktivität ent-
einzelsträngigen RNA-Molekülen gebildet. Das windet die dsRNA und die RNA-Endonuklease-
Genom des Menschen enthält etwa 200–255 Aktivität (RNAse-Typ-III-Enzyme) spaltet die
Gene für Mikro-RNAs; piRNAs werden von lan- RNA (3). Dadurch entsteht siRNA (4).
gen einzelsträngigen Vorläufern gebildet. Gen-
abschaltung (Silencing) durch RNA-Interferenz E. Funktionelle Effekte von RNAi
(RNAi) ist ein 1998 entdecktes biologisches Es wird auf ein bestimmtes Gen gerichtete
Phänomen, das in der Inaktivierung eines oder RNAi in vitro gewonnen (1) und in die Gonade
mehrerer Gene resultiert. von C. elegans (s. S. 184) injiziert. Eine Fluores-
zenz-markierte Sonde hybridisiert in dem
A. Kurze interferierende RNA (siRNA)
nicht-injizierten normalen Gewebe (2a), aber
Kurze interferierende RNA (short interfering nicht in dem mit RNAi injizierten Gewebe (2b).
RNA, siRNA) besteht typischerweise aus RNA- (Abb. in A–D modifiziert nach McManus &
Molekülen von 21–23 Nukleotiden, die ein Sharp, 2002, und Kitabwalla & Ruprecht, 2002;
zweisträngiges Duplexmolekül von 19 Basen- in E nach Lodish et al, 2004)
paaren bilden. An den beiden 3’-Enden besteht
g Medizinische Relevanz. RNAi ist ein neues,
ein Überhang von zwei Basen.
wichtiges Werkzeug zur Analyse von Genfunk-
B. RNA-induzierter Silencing-Complex tionen und zur Entwicklung neuer Behand-
Kurze interferierende RNA interagiert mit einer lungsmethoden (vgl. Kim & Rossi, 2007). Das
Helicase (lila Kreis), einer Nuklease (rotes Oval) Genom des Menschen enthält etwa 200–255
und mit anderen Proteinen. Diese bilden den Gene für Mikro-RNAs (Lim et al., 2003). RNAi
RNA-induzierten Silencing-Complex (RISC) wird als natürlicher Abwehrmechanismus ge-
(stilllegender Komplex, hier nur schematisch gen endogene Parasiten und exogene patho-
dargestellt). Durch die Helicase-Aktivität wird gene Nukleinsäuren angesehen.
doppelsträngige RNA entwunden, so dass ein- Fire A et al: Potent and specific genetic interference by
zelsträngige RNA entsteht. double-stranded RNA in Caenorhabditis elegans. Na-
ture 391: 806-811, 1998.
C. Posttranskriptionales Gen-Silencing Kim DH, Rossi JJ: Strategies for silencing human dis-
ease using RNA interference. Nature Rev Genet 8:
Das Zielmolekül einer posttranskriptionalen 173-184, 2007.
Geninaktivierung (Silencing) ist mRNA (1). Kitabwalla M, Ruprecht RM: RNA interference – A new
Durch die Helicase-Aktivität des RISC wird weapon against HIV and beyond. New Eng J Med
siRNA unter Energieverbrauch durch Spaltung 347: 1364-1367, 2002.
Lim LP et al: Vertebrate microRNA genes. Science 299:
von ATP in ADP entwunden (2). Der entste- 1540, 2003.
hende einzelsträngige Abschnitt der siRNA Lodish H et al.: Molecular Cell Biology. 5th ed. WH Free-
kann danach sequenzspezifisch als Antisense- man, New York, 2004.
RNA an die mRNA binden (3). Die Nuklease-Ak- McManus MT, Sharp PA: Gene silencing in mammals
by small interfering RNAs. Nature Rev. Genet. 3:
tivität des RISC spaltet die benachbarte Einzel- 737-747, 2002.
Genabschaltung durch RNA-Interferenz (RNAi) 157

RNA-Duplex (19 Nukleotide)


Helicase

siRNA
5' 3' 5' 3'

3' 5' 3' 5'

2 Nukleotide 2 Nukleotide
Überhang Überhang
Nuklease

A. Kurze interferierende RNA (siRNA) B. RNA-induzierter Silencing-Komplex (RISC)

1 Doppelsträngige mRNA (dsRNA)


1
Ziel-mRNA
Dicer (in Pflanzen
AAAAA und Drosophila)

2 Helicase
Helicase
2 ATP ADP
RNA-endonuclease
Dicer degradiert
dsRNA und
bildet siRNA
Risc siRNA in Risc 3
entwindet
durch Helicase

4 siRNA

3 D. Degradation doppelsträngiger RNA


Ziel-mRNA Sense-Transkript Antisense-Transkript
SENSE ESNES
AAAAA 5' 3' 5' 3'
SENSE ESNES

untersuchtes dsRNA untersuchtes


siRNA- 5' 3'
Nuklease Gen SENSE Gen
Antisense SENSE
spaltet Strang bindet 3' 5'
mRNA an mRNA
1. Invitro-Produktion von doppelsträngiger RNA
zelluläre
RNA-Nukleasen
4

mRNA-Degradation durch zelluläre


Nukleasen 2a. Nicht-injiziert 2b. Injiziert
C. Posttranskriptionales Gen Silencing (PTGS) E. Funktionelle Effekte von RNAi
158 Regulation von Genfunktion

Gezielte Gen-Inaktivierung bei zufälligen Stellen integriert haben (8). Ebenso


transgenen Mäusen sind alle Zellen empfindlich gegen Neomycin,
die nicht rekombinant sind. Im Gegensatz dazu
Mit gezielter Gen-Inaktivierung kann man bei enthalten Zellen nach homologer Rekombina-
Mäusen experimentell prüfen, welche Auswir- tion das virale tk+-Gen nicht (7). Sie sind des-
kungen auf den Phänotyp durch den Funktions- halb resistent gegen Ganciclovir (9). (Abb. mo-
ausfall entstehen. Insbesondere kann man auch difiziert nach Lodish et al, 2004)
die während der Embryonalentwicklung sicht-
baren Störungen untersuchen, die nicht mit B. Transgene Maus
dem Leben bis zur Geburt vereinbar sind. Eine transgene Maus entsteht durch Mikroin-
Organismen, in deren Genom ein Gen einge- jektion von transgenen ES (s. o.). Diese werden
führt oder gezielt ausgeschaltet wurde, werden 3,5 Tage nach der Befruchtung aus einer Blasto-
als transgen bezeichnet. Grundsätzlich gibt es zyste einer schwarzen Maus isoliert (1), die he-
drei Möglichkeiten, (i) Ersatz eines Gens, (ii) In- terozygot für eine Mutation des zu untersu-
aktivierung eines Gens („knock-out“), oder (iii) chenden Gens ist. Die ES werden in einer Zell-
Hinzufügen eines Gens („knock-in“). kultur auf einer Schicht letal bestrahlter Zellen,
A. Embryonale Stammzellen mit einer die selbst nicht wachsen können (Feeder Layer,
Knock-out-Mutation 2), vermehrt. DNA aus dem gesuchten Gen wird
durch Transfektion eingeführt (Aufnahme von
Das Zielgen wird in embryonalen Stammzellen DNA in lebende Zellen). Die rekombinanten
(ES) durch homologe Rekombination mit einem Zellen werden selektiv vermehrt (3) und in ei-
nicht funktionalen Allel ausgeschaltet (knock- nen anderen frühen Embryo (4,5 Tage) einge-
out). Die ES mit dem inaktivierten Gen (trans- führt (4). Dieser wird teilweise aus den rekom-
gene ES) müssen von den ES unterschieden und binanten Stammzellen gebildet (5) und in den
getrennt werden, die das inaktivierte Gen nicht Uterus einer scheinschwangeren Maus einge-
enthalten. Dies sind die meisten Zellen, entwe- pflanzt (6). Nach der Geburt erkennt man
der weil sie keine DNA aufgenommen haben transgene Mäuse aus den normalen und re-
(99 %) oder keine homologe Rekombination kombinanten Zellen (Chimären) an schwarzen
stattgefunden hat. Die Isolierung der er- Flecken im Fell (7). Nach Paarung mit einem
wünschten Zellen erfordert eine positive und homozygot weißen Partner (8) kann man
eine negative Selektion. Bei der positiven Selek- Mäuse züchten, die heterozygot für eine Muta-
tion können sich zunächst nur rekombinante tion in dem gesuchten Gen sind (9). Nach wei-
Zellen vermehren. In einem weiteren Schritt terer Züchtung erhält man Mäuse, die homozy-
werden durch negative Selektion die nicht-ho- got für das mutante Allel sind (Knock-out-
molog rekombinanten Zellen eliminiert. Maus). An ihnen kann man kann den Funkti-
In das DNA-Fragment mit homologen Sequen- onsausfall beobachten (bei früher Letalität nur
zen aus dem Ziel-Gen (1, in blau) wird ein Bak- bei Embryonen). (Abb. nach Lodish et al, 2004)
terien-Gen eingeschleust, durch das die Zelle
resistent gegen Neomycin (neoR) wird (2). Die- g Medizinische Relevanz. Durch Vergleich von
sem DNA-Vektor (Überträger) wird zusätzlich Genotyp (Mutation) und Phänotyp bei transge-
das Gen Thymidinkinase (tk+) des Herpes-sim- nen Mäusen können Informationen über die
plex-Virus hinzugefügt (gelb, 3). Zunächst neh- Auswirkungen einer Mutation gewonnen wer-
men alle Zellen den Vektor auf, an zufälligen den, vor allem für die Embryonalentwicklung.
Stellen (4) und (selten) im gesuchten Gen (5). Mit Einschränkungen ist dies auf den Men-
Zellen mit zufälligem Einbau durch nicht-ho- schen übertragbar.
mologe Rekombination (6) können von den ge-
Alberts B et al: Molecular Biology of the Cell. 5th ed.,
suchten Zellen mit Einbau im Ziel-Gen nach ho- Garland Science, New York, 2008.
mologer Rekombination (7) durch Kultivierung Capecchi MR: Targeted gene replacement. Scient.
im selektiven Nährmedium unterschieden wer- Amer, March 1994, pp. 52-59.
den. Die positive Selektion für rekombinante Lodish H et al.: Molecular Cell Biology, 5th ed. WH Free-
man, New York, 2004.
Zellen beruht darauf, dass diese das neoR-Gen Majzoub JA, Muglia LJ: Knockout mice. Molecular Me-
aufgenommen haben und deshalb resistent ge- dicine. New Eng J Med 334: 904-907, 1996.
gen Neomycin sind, aber nur, wenn sie DNA an
Gezielte Gen-Inaktivierung bei transgenen Mäusen 159

1. 1. Maus-
Blastocyste
klonierte DNA aus dem
zu untersuchenden Gen embryonale
Stammzellen
bakterielles (ES)
Gen mit Resistenz
gegen Neomycin Feeder-Layer embryonale
neoR Stammzellen
2. 2. (ES)
in Kultur
Virus tk+-Gen Einführung von Ziel-DNA
(von homozygoten Mäusen
hinzufügen
für schwarze Fellfarbe)
Aufnahme von
neoR tk+ der homologen
Stelle ist selten
3. 3.
rekombinante ES-Zellen
Gen-Replacement- auswählen und vermehren
Vektor rekombinante
ES-Zellen in
einführen in ES-Zellen verschiedene
frühe
Embryonen
übertragen

4.
rekombinante
4. nicht- homologe 5. homologe ES-Zellen
Rekombination Rekombination in frühe
Embryonen
Vektor Vektor integriert

5.

Transfer in
pseudo-
anderes Gen ES-DNA Ziel-Gen schwangere
Maus (weiß)

6. Geburt einiger schwarzer und weißer


chimärer Mäuse
6. zufälliger 7. Einbau in das
Einbau Ziel-Gen (selten)

transgene Mäuse mit


7. rekombinanten ES-Zellen
Zellkultur

selektives Medium
enthält Neomycin
und Ganciclovir 8. Verpaarung chimärer Mäuse mit
homozygoten weißen

8. andere 9. neue Zellen


Zellen mit dem
sterben zerstörten Gen 9. Heterozygote schwarze Mäuse enthalten
vermehren sich das mutante Allel

A. Isolierung von rekombinanten B. Transgene Maus nach Ausschaltung


embryonalen Stammzellen eines Gens
160 Epigenetische Modifikationen

DNA-Methylierung MspI erkennt dieselbe 5’-CCGG-3’-Sequenz,


spaltet DNA an der entsprechenden Stelle aber
DNA kann durch das Hinzufügen von Methly-
immer, unabhängig davon, ob sie methyliert ist
gruppen an spezifischen Stellen modifiziert
oder nicht. Wenn man bei einer Untersuchung
werden. Dies spielt eine wichtige Rolle bei der
beide Enzyme verwendet, resultiert ein unter-
Regulation der Aktivität bestimmter Gene. Me-
schiedliches Muster von DNA-Fragmenten im
thyliert werden Cytosin-Reste. Bis zu 10 % der
Southern-Blot (S. 48), weil HpaII im Gegensatz
Cytosine in der DNA bei höheren Organismen
zu MspI an bestimmten Stellen nicht schneidet
sind methyliert. Methylierung von DNA im Be-
und dadurch ein größeres DNA-Fragment ent-
reich eines Gens unterdrückt dessen Aktivität,
steht. Dieser Unterschied erlaubt Rückschlüsse
Demethylierung hebt diesen Effekt auf. Häufig
auf das Methylierungsmuster des untersuchten
ist ein Muster methylierter und nicht-methy-
DNA-Bereichs.
lierter DNA-Bereiche erkennbar. DNA-Methylie-
rung ist genspezifisch und tritt im gesamten D. Das DNMT3B-Gen des Menschen
Genom auf. Sie wird durch Methlytransferasen
Mutationen des Gens DNMT3B, das für die Typ
vermittelt. Diese vermitteln entweder Erhal-
3b de-novo-Methyltransferase codiert, verur-
tungs- oder de-novo-Methylierungen.
sachen ein schweres Krankheitsbild, das ICF-
A. Erhaltungsmethylierung Syndrom (Immundefizienz-Centromere Insta-
Diese Form der Methylierung ist verantwortlich bilität, Gesichts-(Facial)-Anomalien, OMIM
für die Methylierung neu synthetisierter DNA- 242860). Das DNMT3B-Gen besteht aus
Stränge nach der Replikation und Zellteilung. 23 Exons, die 47 kb genomische DNA umfassen
Neue Stränge der parentalen (elterlichen) DNA (1). Sechs dieser Exons werden alternativ ge-
(1) sind nach der Replikation zunächst nicht spleißt. Das Protein (2) hat 845 Aminosäuren.
methyliert (2). Durch das Enzym DNA-Methy- Die Pfeile zeigen sechs verschiedene Mutatio-
lase Dnmt1 (DNMT1 beim Menschen) werden nen. Bei der Mutation an Position 809 (3) wird
auch die neuen DNA-Stränge methyliert und das Codon 809 durch den Austausch eines Ade-
das ursprüngliche elterliche Methylierungs- nin (A) durch ein Guanin (G) von GAC (Asp) zu
muster wird wiederhergestellt (3). Diese Funk- GGC (Gly) verändert. Beide Eltern sind hetero-
tion ist essentiell; Mäuse, denen dieses Enzym zygot für diese Mutation (3). Die Zentromere
fehlt, sind nicht lebensfähig. der Chromosomen 1, 9 und 16 sind instabil und
führen zu charakteristischen Chromosomen-
B. De-novo-Methylierung konfigurationen (4). (Abb. nach Xu et al, 1999,
Bei diesem Typ der DNA-Methylierung werden u- Hansen et al, 1999)
Methyl-Gruppen an neuen Positionen in beiden Bird A: DNA methylation de novo. Science 286: 2287-
DNA-Strängen eingefügt. Zwei Gene für Me- 2288, 1999.
thyltransferasen mit überlappenden Funktio- Hansen RS et al: DNMT3B DNA methyltransferase gene
nen bei der de-novo-Methylierung sind be- is mutated in the ICF immunodeficiency syndrome.
Proc Nat Acad Sci 96: 14412-14417, 1999.
kannt: Dnmt3a und Dnmt3b. Unmethylierte Okano M et al: DNA Methyltransferases Dnmt3a and
DNA (1) wird durch diese Enzyme (2) in orts- Dnmt3b are essential for de novo methylation and
und gewebespezifischer Weise methyliert (3). mammalian development. Cell 99: 247-257, 1999.
Gezielte homozygote Zerstörung der Dnmt3a- Hagleitner MM et al: Clicnical spectrum of immunode-
ficiency, centromeric instability and facial dysmor-
und Dnmt3b-Gene bei Mäusen führt zu schwe- phism (ICF syndrome). J med Genet 45: 93-99, 2008.
ren Entwicklungsstörungen. Homozygote Dop- Reik W, Kelsey G, Walter J: Dissecting de novo methyla-
pelmutanten sterben vor Tag 11,5 ihrer 21 Tage tion. Nature Genet. 23: 380-382, 1999.
dauernden embryonalen Entwicklung. Robertson KD, Wolffe AP: DNA methylation in health
and disease. Nature Rev Genet 1: 11-19, 2000.
C. Erkennung eines methylierten Weksberg R et al: Epigenetics, pp. 81-100. In: Rimoin
DNA-Segments DL, Connor JM, Pyeritz RE, Korf BK, eds: Emery and
Rimoin’s Principles and Practice of Medical Gene-
Bestimmte Restriktionsenzyme spalten die tics, 5th edn. Churchill-Livingstone-Elsevier, Phila-
DNA nicht, wenn ihre Erkennungssequenz me- delphia, 2008.
Xu G, Bestor T et al: Chromosome instability and immu-
thyliert ist (1). Zum Beispiel spaltet das Enzym nodeficiency syndrome caused by mutations in a
HpaII DNA nur, wenn seine Erkennungssequenz DNA methyltransferase gene. Nature 402: 187-191,
5’-CCGG-3’ nicht methyliert ist (2). Das Enzym 1999.
DNA-Methylierung 161

5' 3'
CH3 CH3 CH3
3' 5'
5' 3'
CG CG CG 1. nicht methylierte DNA
GC GC GC
3' 5' 2. Methylierung
CH3 CH3 CH3

1. Methylierte Stellen in DNA Dnmt 3a Dnmt 3b


CH3 CH3 CH3 CH3
5' 3'
CH3 CH3 CH3
3' CH3 CH3 CH3 CH3 5'
5' 3'
CG CG CG orts spezifisch
GC GC GC 3. und gewebsspezifisch
3' 5'
Neue Stränge nicht methyliert B. De-novo Methylierung
5' 3'
CG CG CG
nicht methyliert nicht
GC GC GC methyliert methyliert
3' 5' CH3
CH3 CH3 CH3 5' 3'
C CGG C CGG C CGG
GGC C GGC C GGC C
2. Replikation 3' 5'
CH3
Dnmt 1 1. Restriktionsenzym Erkennungssequenz
CH3 CH3 CH3
5' 3' (Methylierungs- nicht gespalten
CG CG CG sensitiv)
GC GC GC 5'
C C GG C CGG C C GG
3'
3' 5'
CH3 CH3 CH3 3' GG C C GGC C G G C C 5'

2. HpaII
CH3 CH3 CH3
5' 3'
CG CG CG gespalten gespalten gespalten
GC GC GC 5' 3'
3' 5' C CG G C CG G C CG G
CH3 CH3 CH3 3' GG C C GG C C G G C C 5'

3. Beide Tochterstränge methyliert 3. MspI


A. Erhaltungsmethylierung C. Erkennung eines methyl. DNA-Abschnitts

Exons 10 12 14 16 18
1A 1B 2 3 45 6 7 8 9 11 13 15 17 19 20 21 22 23

2800 UAG
1. DNMT3B Gen 5 kb

53 655 656 718 809 810

1 845 ACAGGCGTG ACAG G CGTG


I IV VI IX X Gly809 A
PWWP 16p
Domaine Patient Eltern 16q 1q
aktiviert organisiert
Target- DNA-bindende
Cytosin Domaine 1q 1q
ACAGACGTG
Asp
Methylierungsreaktion Kontrolle 1p 1p
2. Protein (Schema) mit Mutation an sechs Stellen 3. Mutation A809G 4. Chromosomen
D. Das DNMT3B-Gen des Menschen bei ICF-Syndrom
162 Epigenetische Modifikationen

Reversible Veränderungen im C. Chromatin-Remodeling


Chromatin Als Chromatin-Remodeling wird der Wechsel
Die lokale Struktur von Chromatin stellt einen im epigenetischen Zustand von Chromatin be-
epigenetischen Zustand dar. Im Heterchromatin zeichnet. Durch Repressoren und Aktivatoren
sind Gene für Transkription und Replikation wird ein „Gen off“-Zustand in Heterochromatin
nicht zugänglich, im Euchromatin nur ein- in einen „Gen on“-Zustand in Eurochromatin
geschränkt. Chromatin kann durch eine Reihe überführt oder umgekehrt. Im aktivierten Zu-
von Mechanismen reversibel verändert werden stand ist das Chromatin so aufgelockert, dass
(Chromatin Remodeling). Die wesentlichen Vor- sich die Nukleosomen in ausreichendem Ab-
gänge sind Acetylierung und Deacetylierung, Me- stand befinden. Dadurch können Transkripti-
thylierung und Demethylierung, oder Phospho- onsfaktoren an den Promotor binden, die RNA-
rylierung und Dephosphorylierung bestimmter Polymerase kann ansetzen.
Aminosäuren in Histonproteinen H3 und H4 Die Bildung von Heterchromatin beginnt mit
(s. S. 120). Die benötigte Energie wird durch Hy- der Bindung von Heterochromatin-Protein 1
drolyse von Adenosintriphosphat (ATP) in großen (HP1) an methyliertes Histon H3. Ein DNA-bin-
Remodeling-Komplexen bereitgestellt, die nach dendes Protein, RAP1, bindet andere Proteine
ihren ATPase Untereinheiten klassifiziert werden (SIR3/SIR4). Diese binden an H3/H4 und poly-
können (vgl. Lewin, 2008, für Einzelheiten). merisieren entlang des Chromatins. (Abb. mo-
difiziert nach Lodish et al, 2004)
A. Histonmodifikation
g Medizinische Relevanz. Mutationen im
Die Modifikation von Aminosäuren in Histonen MECP2-Gen auf dem X-Chromosom (Xq28) ver-
an spezifischen Stellen führt zu funktioneller ursachen schwere Störungen der Sprach- und
und struktureller Modifikation von Chromatin. geistigen Entwicklung (Rett-Syndrom, OMIM
Dies geschieht in den Histonproteinen H3 (1) 312750).
und H4 (2). Modifikationen der hier gezeigten
Art treten vorzugsweise in den 20 N-terminalen Amir RE et al: Rett syndrome is caused by mutations in
X-linked MECP2, encoding methyl-CpG binding
Aminosäuren am N-terminalen Ende auf. Eine
protein 2. Nature Genet 23: 185-188, 1999.
Kombination von modifizierenden Signalen wird Chahrour M et al: MeCP2, a key contributor to neurolo-
als Histon-Code bezeichnet. Die Modifikationen gical disease, activates and represses transciption.
werden durch entsprechende Enzyme bewirkt Science 320: 1224-1229, 2008.
(Acetylasen und Deacetylasen, Methylasen und Grewal, SIS, Moazed D: Heterochromatin and epigene-
tic control gene expression. Science 301: 798-802,
Demethylasen sowie Phosphorylatkinasen). 2003.
Aktives Chromatin ist vornehmlich an Lysinres- Jaenisch R, Bird A: Epigenetic regulation of gene ex-
ten in H3- und H4-Histonen acetyliert. Inakti- pression: how the genome integrates intrinsic and
ves Chromatin ist vornehmlich an Lysin in Posi- environmental signals. Nature Genet Suppl 33: 245-
254, 2003.
tion 9 methyliert. Einige Stellen können alter- Lachner M, O’Sullivan RJ, Jenuwein T: An epigenetic
nativ methyliert oder acetyliert werden. Zwei road map for histone lysine methylation. J Cell Sci
Methyl-Cytosin bindende Proteine, MeCP1 und 116: 2117-2124, 2003.
MeCP2 binden selektiv an methylierte DNA und Lewin B: Genes IX. Jones & Bartlett, Sudbury, Mary-
land, 2008.
bewirken transkriptionale Repression durch
Lodish H et al: Molecular Cell Biology, 5th edn. WH
Histon-Deacetylierung. Freeman, New York, 2004.
Nan X et al: Transcriptional representation by methyl-
B. Histon-Acetylierung und CpG-binding protein MeCP2 involves a histone dea-
-Deacetylierung cetylation complex. Nature 393: 386-389, 1998.
Saha A, Wittmeyer J, Cairns, BR: Chromatin remode-
Durch Acetylierung bestimmter Bereiche von ling: the industrial revolution of DNA around histo-
Histonen und anderer Aktivatoren wird Chro- nes. Nature Rev Cell Biol 7: 437-447, 2006.
matin in einen aktivierten Zustand überführt, Strachan T, Read AD: Human Molecular Genetics, 3rd
edn. Garland Science, London & New York, 2004.
in dem Transkription und Replikation möglich
Troyer P, Reinberg D: Histone lysine demethylases and
sind (1). Deacetylierung bewirkt das Gegenteil their impact on epigenetics. Cell 125: 213-217, 2006.
(2). Histon-Acetylasen fügen an bestimmten Turner BM: Cellular memory and the histone code. Cell
Lysinresten in einem aktivierenden Multipro- 111: 285-291, 2002.
tein-Komplex Acetylgruppen ein.
Reversible Veränderungen im Chromatin 163
164 Epigenetische Modifikationen

Genomisches Imprinting zenta und des Fetus beobachtet (4). Bei zusätz-
lichem väterlichen Chromosomensatz (47,XXY
Bei Säugetieren wird von bestimmten Genen
oder 47,XYY) beobachtet man eine hypertrophe
nur ein Allel exprimiert, entweder das väterli-
Plazenta mit hydatidiformer Mole. (Photogra-
che oder das mütterliche. Dies wird als geno-
phien freundlicherweise von Prof. Helga Reh-
misches Imprinting (Prägung) bezeichnet.
der, Marburg, überlassen)
Genomisches Imprinting ist eine wichtige epi-
genetische Modifikation. Es ist in der Evolution C. Genomisches Imprint-Muster
vermutlich als Folge einer unterschiedlichen
Genomisches Imprinting hat ein eltern-spezifi-
Selektion von weiblicher und männlicher Re-
sches Muster, das in der frühen embryonalen
produktion entstanden. Für weibliche Säuge-
Entwicklung etabliert wird. Das in somatischen
tiere bedeutet es einen Vorteil, das Fetalwachs-
Zellen vorliegende Imprint-Muster (1) wird
tum sinnvoll zu begrenzen und so die vorhan-
durch alle mitotischen Zellteilungen hindurch
denen Ressourcen gleichmäßig auf mehrere
beibehalten. In primordialen Keimzellen wird
Schwangerschaften zu verteilen. Für männliche
das geschlechter-spezifische Imprint-Muster
Säugetiere dagegen liegt ein selektiver Vorteil
gelöscht (2). Während der Gametogenese wird
darin, dass der gegenwärtige, von ihm gezeugte
es wieder hergestellt (3). In der männlichen
Fetus optimal wächst, ohne Rücksicht auf die
Keimbahn erhalten alle Gameten das männli-
Mutter und künftige Schwangerschaften von
che Imprint-Muster und in der weiblichen alle
anderen Vätern.
das weibliche. Nach der Befruchtung wird das
A. Die Wichtigkeit von zwei korrekte Imprinting-Muster wiederhergestellt
verschiedenen elterlichen Genomen (4). Es wird durch alle folgenden Zellteilungen
hindurch unter der Kontrolle eines regionalen
Eine Säugetier-Zygote entwickelt sich nur nor-
Imprinting-Zentrums beibehalten. Das Im-
mal, wenn je ein Chromosomensatz von beiden
print-Muster ist das Ergebnis unterschiedlicher
Eltern vorhanden ist. Entfernt man aus einer
DNA-Methylierung. Nicht exprimierte Gene in
normalen Zygote (1) den weiblichen Pronu-
einem dem Imprinting unterliegenden Bereich
kleus und ersetzt ihn durch einen männlichen,
sind methyliert.
so entsteht eine androgenet. Zygote (2). In den
meisten Fällen findet keine Präimplantation g Medizinische Relevanz. Ein durch genetische
statt und die Frucht stirbt früh in der Embryo- Veränderungen abnormes Imprint-Muster ist
nalentwicklung ab (3). Ersetzt man den männ- die Ursache wichtiger Krankheiten (s. S. 320).
lichen Pronukleus durch einen weiblichen (4), Constância M, Kelsey G, Reik W: Resourceful imprin-
so erscheint die gynogenet. Zygote zunächst ting. Nature 432: 53-57, 2004.
normal. Danach jedoch bleiben die extra-em- Horsthemke B, Buiting K: Imprinting defects on human
bryonalen Gewebe unterentwickelt und die Im- chromosome 15. Cytogenet Genome Res 113: 292-
299, 2006.
plantation wird nicht abgeschlossen (Abb. mo-
Reik W, Surani A (eds): Genomic Imprinting. IRL Press
difiziert nach Sapienza & Hall, 2001). at Oxford University Press. Oxford, 1997.
Reik W, Dean W, Walter J: Epigenetic reprogramming
B. Einfluss der elterlichen Genome in mammalian development. Science 293: 1089-
Eine natürlich vorkommende Folge einer and- 1093, 2001.
Reik W, Walter J: Genomic imprinting: parental influ-
rogenetischen Zygote beim Menschen ist die ence on the genome. Nature Rev Genet 2: 21-32,
hydatidiforme Mole (1). Dies ist eine abnorme 2001.
Plazenta mit zwei Sätzen väterlicher Chromo- Reik W, Walter J: Evolution of imprinting mechanisms:
somen ohne mütterliche. Trotz Implantation the battle of the sexes begins in the zygote. Nature
Genet 27: 255-256, 2001.
entwickelt sich kein Embryo. Das Plazentage- Sapienza C, Hall JG: Genetic imprinting in human dis-
webe entwickelt Zysten (2). Wenn nur mütter- ease, pp 417–431. In: The Metabolic and Molecular
liche Chromosomen vorliegen (gynogenetische Bases of Inherited Disease, 8th edn. CR Scriver et al
Zygote), so entwickeln sich ovarielle Teratome, (eds), McGraw-Hill. New York, 2001.
Wilkins JF, Haig D: What good is genomic imprinting:
die verschiedene fetale Gewebe enthalten, aber the function of parent-specific gene expression. Na-
keine Plazenta (3). Bei Triploidie wird bei ei- ture Rev Genet 4: 359-368, 2003.
nem zusätzlichen mütterlichen Chromosomen-
satz (47,XXX) eine extreme Hypoplasie der Pla-
Genomisches Imprinting 165

früh
letal
2
androgen Präimplantation Fetus fehlt
misslingt meistens oder zu klein

normale

extra- Entwick-
1 3 embryonale lung
Gewebe
Diploide normal Präimplantation Fetus normal
Zygote

letal
etwas
später
4
gynogen