Sie sind auf Seite 1von 4

RNA (Ribonukleinsäure)

 Baustein: Nucleotid
 Phosphorsäure
 Pentose: Ribose
 Basen:
o Adenin
o Guanin
o Cytosin
o Uracil
m-RNA (Boten RNA/ Messenger RNA)

 Stellt Kopie der DANN im Zellkern her


t-RNA (Transfer RNA)

 Holt Aminosäuren aus dem Zellplasma und bringt diese zu den Ribosomen
r-RNA (Ribosomale RNA)

 Ist der „Baustein“ der Ribosomen (Baut das Ribosom auf)


i-RNA (interferance RNA)

 Kann Teile der DNA sperren oder nicht sperren => nimmt Einfluss auf das Genom
Enzym:
t-RNA-Synthetase

 Bindet Aminosäuren mit passender t-RNA

Proteinbiosynthese
1. Transkription
Polymerase trennt DNA auf

5‘ 3‘
G A G Terminator
C U
T C AC
A 5‘
3‘ Promotor TG A C
T C C U G
G U A G A U A U G Prä-m-RNA
G A C
A T C T A T A

2. Prozessierung der prä-m-RNA


 Spleißing:
o Introns werden herausgeschnitten
o Exons werden zusammengeschweißt
 Capping:
o Um vor Einwirkungen zu schützen
o „G-P-P-P“ vorne angesetzt
o AAA….AAA (Poly(A)-Schwanz vorne angesetzt)
3. Translation (findet am Ribosom statt)

So lange bis ein Stopp- Signal Cys

Ergebnis: Aminosäuren Kette


5‘ U A C G G C U U A G C A U C G A C G U A C 3‘
3.1. Aminosäuren-Aktivierung
AUGCCGAAUCGUAGCUGCAUG

t-RNA: aus Plasma Aminosäuren zu holen:

3.1.1. Primärstruktur eines Proteins

Zwischen Aminosäuren Kette sind Reptidbindungen


(Denaturierung von Eiweiß bei 41°C)

3.1.2. Sekundarstruktur

Helix:

Faltblatt:

Wasserstoffbrücken

3.1.3. Tertiärstruktur

Enzym:
Schlüssel-Schloss Prinzip

3.1.4. Quartärstruktur

Hämoglobin: roter Blut Farbstoff Fe


Fe
Fe: bindet O2
(zu wenig Fe=Anämie: Blutarmut
Fe Fe
Der Genetische Code
Der genetische Code ist

 Universell
o Jedes Lebewesen auf unserem Planeten hat die 4 Codeteile
 degeneriert
o mehr Basentriplets (64) für 20 Aminosäuren codieren 1 Aminosäure durch
mehrere Codons
 Kommalos
o Ohne Pause
 Nicht überlappend

Genregulation
DNA
[ Operon ]
Regulatorgen Promotor Operator Strukturgen Terminator
(On/Off Schalter) wird zum Protein

Regulatorgen => Protein Repressor => (On/Off Schalter)


Ist ein Substrat da, dann muss es abgebaut werden!
Sind genügend Endprodukte da, müssen nicht mehr erzeugt werden.
Haushaltsgen: Immer eingeschaltet.

Mutation
=Veränderung am Erbgut
spontane Mitose Replikation, Proteinbildung
Mutagene:

 Wirkungen die eine Mutation begünstigen


 Ionisierende Strahlen => DNA-Doppelstrangbrüche
 UV-Licht => Thyminverbindung => Thymindrose
 Chemikalien => Krebs
 Viren => Chromosomenbrücke/ Mutationen
 Körperzellen (somatische Zellen) => Krebs
 Keimzellen => Erbkrankheiten
3 Arten:

 Genom Mutation
 Chromosom Mutation
 Genmutation
1-22 Chromosom => Autosomen
23. Chromosom => Gonosom (Geschlechtschromosom)
Genom Mutation
Aneuploidie (Abweichung der Chromosomenzahl)
 Monosomie = 45 Chromosome
o (46-1) XO Turner Syndrom
 Trisomie = 47 Chromosome
o (46+1)
 T 21: Down Syndrom (einzige Lebensfähige)
 T 18 usw.
 XXY (m) Klinefelder Syndrom
 XXX (f)
 XYY (m)
 Polyploidie
o 2 oder mehr Sätze von Chromosomen in Zellen

Chromosomen Mutation (größere Veränderung des Chromosomenbaus)


Bruch zwischen Phosphor und Zucker

Deletion
 Katzenschrei Syndrom
 Wolf Syndrom

Inversion
 Bricht ab
 Umgedreht

Translocation
 Bricht ab
 Setzt sich woanders ab
 Reperaturenzyme setzen es ans falsche Chromosom an

Genmutation (Veränderung des Chromosomenbaus/ der Basenabfolge der


DNA)
Fehler in einer oder mehreren Basen

 Basenaustausch Substitut
 Missense Mutation => Sichelzellenanemie
o „falsch“ gefalten
 Muskeldystrophie

Non-disjunction: Schwesternchromatiden nicht richtig getrennt => Genommutation