Marine Biotechnology I (2005) PDF

96
Advances in Biochemical
Engineering/Biotechnology
Series Editor: T. Scheper
Editorial Board:
W. Babel · I. Endo · S.-O. Enfors · A. Fiechter · M. Hoare · W.-S. Hu
B. Mattiasson · J. Nielsen · H. Sahm · K. Schügerl · G. Stephanopoulos
U. von Stockar · G. T. Tsao · C. Wandrey · J.-J. Zhong
Advances in Biochemical Engineering/Biotechnology
Series Editor: T. Scheper
Recently Published and Forthcoming Volumes
Biotechnology for the Future Recent Progress of Biochemical and Biomedical

Volume Editor: Nielsen, J. Engineering in Japan I
Vol. 100, 2005 Volume Editor: Kobayashi, T.
Vol. 90, 2004
Gene Therapy and Gene Delivery Systems
Volume Editors: Schaffer, D., Zhou, W. Physiological Stress Responses in Bioprocesses
Vol. 99, 2005 Volume Editor: Enfors, S.-O.
Vol. 89, 2004
Sterile Filtration
Volume Editor: Jornitz, M. W. Molecular Biotechnology of Fungal β-Lactam
Vol. 98, 2006 Antibiotics and Related Peptide Synthetases
Volume Editor: Brakhage, A.
Marine Biotechnology II Vol. 88, 2004
Volume Editors: Le Gal, Y., Ulber, R.
Vol. 97, 2005 Biomanufacturing
Volume Editor: Zhong, J.-J.
Marine Biotechnology I Vol. 87, 2004
Volume Editors: Le Gal, Y., Ulber, R.
Vol. 96, 2005 New Trends and Developments in Biochemical
Engineering
Microscopy Techniques Vol. 86, 2004
Volume Editor: Rietdorf, J.
Vol. 95, 2005 Biotechnology in India II
Volume Editors: Ghose, T. K., Ghosh, P.
Regenerative Medicine II Vol. 85, 2003
Clinical and Preclinical Applications
Volume Editor: Yannas, I. V. Biotechnology in India I
Vol. 94, 2005 Volume Editors: Ghose, T. K., Ghosh, P.
Vol. 84, 2003
Regenerative Medicine I
Theories, Models and Methods Proteomics of Microorganisms
Volume Editor: Yannas, I. V. Volume Editors: Hecker, M., Müllner, S.
Vol. 93, 2005 Vol. 83, 2003
Technology Transfer in Biotechnology Biomethanation II

Volume Editor: Kragl, U. Volume Editor: Ahring, B. K.
Vol. 92, 2005 Vol. 82, 2003
Recent Progress of Biochemical and Biomedical Biomethanation I

Engineering in Japan II Volume Editor: Ahring, B. K.
Volume Editor: Kobayashi, T. Vol. 81, 2003
Vol. 91, 2004
Marine Biotechnology I
Volume Editors: Yves Le Gal, Roland Ulber
With contributions by
G. Antranikian · S. Barindra · G. Barnathan · J.-P. Bergé · C. Bertoldo
G. Debashish · F. Guérard · M. Joydeep · M. Lalk · Y. Le Gal
U. Lindequist · S. Malay · T. Matsunaga · H. Miyashita · T. Schweder
D. Sellos · H. Takeyama · C. E. Vorgias · H. Yokouchi
123
The series Advances in Biochemical Engineering/Biotechnology presents critical reviews of the present
and future trends in polymer and biopolymer science including chemistry, physical chemistry, physics
and material science. It is adressed to all scientists at universities and in industry who wish to keep
abreast of advances in the topics covered.
As a rule, contributions are specially commissioned. The editors and publishers will, however, always
be pleased to receive suggestions and supplementary information. Papers are accepted for Advances in
Biochemical Engineering/Biotechnology in English.
In references Advances in Biochemical Engineering/Biotechnology is abbeviated Adv Biochem En-
gin/Biotechnol and is cited as a journal.
Springer WWW home page: http://www.springeronline.com

Visit the ABE content at http://www.springerlink.com/
Library of Congress Control Number: 2005926286

ISSN 0724-6145
ISBN-10 3-540-25659-8 Springer Berlin Heidelberg New York
ISBN-13 978-3-540-25659-5 Springer Berlin Heidelberg New York
DOI 10.1007/b135780
This work is subject to copyright. All rights are reserved, whether the whole or part of the material
is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broad-
casting, reproduction on microfilm or in any other way, and storage in data banks. Duplication of
this publication or parts thereof is permitted only under the provisions of the German Copyright Law
of September 9, 1965, in its current version, and permission for use must always be obtained from
Springer. Violations are liable for prosecution under the German Copyright Law.
Springer is a part of Springer Science+Business Media
springeronline.com
c Springer-Verlag Berlin Heidelberg 2005
Printed in Germany
The use of registered names, trademarks, etc. in this publication does not imply, even in the absence
of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
Cover design: Design & Production GmbH, Heidelberg
Typesetting and Production: LE-TEX Jelonek, Schmidt & Vöckler GbR, Leipzig
Printed on acid-free paper 02/3141 YL – 5 4 3 2 1 0
Series Editor
Prof. Dr. T. Scheper
Institute of Technical Chemistry
University of Hannover
Callinstraße 3
30167 Hannover,Germany
scheper@iftc.uni-hannover.de
Volume Editors
Prof. Dr. Roland Ulber Prof. Yves Le Gal
Fachbereich Maschinenbau Station de Biologie Marine
und Verfahrenstechnik Muséum National d’Histoire Naturelle
Technische Universität Kaiserslautern Place de la Croix, BP 225
Gottlieb-Daimler-Str., Gebäude 44/519 29182 Concarneau cedex,
67663 Kaiserslautern, Germany France
ulber@mv.uni-kl.de ylegal@mnhn.fr, ylegal@voonoo.net
Editorial Board
Prof. Dr. W. Babel Prof. Dr. M. Hoare
Section of Environmental Microbiology Department of Biochemical Engineering
Leipzig-Halle GmbH University College London
Permoserstraße 15 Torrington Place
04318 Leipzig, Germany London, WC1E 7JE, UK
babel@umb.ufz.de m.hoare@ucl.ac.uk
Prof. Dr. S.-O. Enfors Prof. Dr. I. Endo

Department of Biochemistry and Faculty of Agriculture
Biotechnology Dept. of Bioproductive Science
Royal Institute of Technology Laboratory of Applied Microbiology
Teknikringen 34, Utsunomiya University
100 44 Stockholm, Sweden Mine-cho 350, Utsunomiya-shi
enfors@biotech.kth.se Tochigi 321-8505, Japan
endo@cel.riken.go.jp
VI Editorial Board
Prof. Dr. A. Fiechter Prof. Dr. J.-J. Zhong

Institute of Biotechnology State Key Laboratory
Eidgenössische Technische Hochschule of Bioreactor Engineering
ETH-Hönggerberg East China University of Science
8093 Zürich, Switzerland and Technology
ae.fiechter@bluewin.ch 130 Meilong Road
Shanghai 200237, China
Prof. W.-S. Hu jjzhong@ecust.edu.cn
Chemical Engineering
Prof. J. Nielsen
and Materials Science
University of Minnesota Center for Process Biotechnology
421 Washington Avenue SE Technical University of Denmark
Minneapolis, MN 55455-0132, USA Building 223
wshu@cems.umn.edu 2800 Lyngby, Denmark
jn@biocentrum.dtu.dk
Prof. Dr. B. Mattiasson
Department of Biotechnology Prof. Dr. K. Schügerl
Chemical Center, Lund University Institute of Technical Chemistry
P.O. Box 124, 221 00 Lund, Sweden University of Hannover, Callinstraße 3
bo.mattiasson@biotek.lu.se 30167 Hannover, Germany
schuegerl@iftc.uni-hannover.de
Prof. Dr. H. Sahm
Institute of Biotechnolgy Prof. Dr. U. von Stockar
Forschungszentrum Jülich GmbH Laboratoire de Génie Chimique et
52425 Jülich, Germany Biologique (LGCB), Départment de Chimie
h.sahm@fz-juelich.de Swiss Federal Institute
of Technology Lausanne
Prof. Dr. G. Stephanopoulos 1015 Lausanne, Switzerland
Department of Chemical Engineering urs.vonstockar@epfl.ch
Massachusetts Institute of Technology
Cambridge, MA 02139-4307, USA Prof. Dr. C. Wandrey
gregstep@mit.edu Institute of Biotechnology
Forschungszentrum Jülich GmbH
Prof. Dr. G. T. Tsao 52425 Jülich, Germany
c.wandrey@fz-juelich.de
Director
Lab. of Renewable Resources Eng.
A. A. Potter Eng. Center
Purdue University
West Lafayette, IN 47907, USA
tsaogt@ecn.purdue.edu
Advances in Biochemical Engineering/Biotechnology
Also Available Electronically
For all customers who have a standing order to Advances in Biochemical

Engineering/Biotechnology, we offer the electronic version via SpringerLink
free of charge. Please contact your librarian who can receive a password or free
access to the full articles by registering at:
springerlink.com
If you do not have a subscription, you can still view the tables of contents of the
volumes and the abstract of each article by going to the SpringerLink Home-
page, clicking on “Browse by Online Libraries”, then “Chemical Sciences”, and
finally choose Advances in Biochemical Engineering/Biotechnology.
You will find information about the

– Editorial Board
– Aims and Scope
– Instructions for Authors
– Sample Contribution
at springeronline.com using the search function.
Attention all Users
of the “Springer Handbook of Enzymes”
Information on this handbook can be found on the internet at

springeronline.com
A complete list of all enzyme entries either as an alphabetical Name Index or

as the EC-Number Index is available at the above mentioned URL. You can
download and print them free of charge.
A complete list of all synonyms (more than 25,000 entries) used for the enzymes
is available in print form (ISBN 3-540-41830-X).
Save 15%
We recommend a standing order for the series to ensure you automatically
receive all volumes and all supplements and save 15% on the list price.
Preface
Oceans, which occupy up to two thirds of the surface of our planet, were not
really approached from scientific point of view until the second half of the
19th century and even the 20th with regard to microbial and unicellular life.
Today, the importance of marine biodiversity has been fully recognized. It is,
indeed, one of the aspects which, over the two past decades, have made a major
contribution to our knowledge and vision of the living planet.
Marine organisms make up a very large collection of living beings, of which
the number of species is likely to exceed that of land species by several orders
of magnitude. However, the major interest in marine living systems is mainly
linked to the exceptional diversity of molecular structures, of chemical inter-
actions reflecting a long evolutionary history and also the fact that marine life
spreads within multiple and complex three-dimensional spaces. From a very
practical and trivial point of view, marine life can be seen as a huge reser-
voir of molecules which enable marine organisms to defend themselves, to
communicate and, more generally, to survive and thrive.
In a very broad sense, marine biotechnologies can be understood as being
the various techniques of managing marine living systems for the profit of man-
kind. The domain covered by marine biotechnologies is vast and ranges over
various overlapping disciplines, from developmental biology to the chemistry
of natural substances and bioprocess engineering. Not all these fields, however,
are ready for practical and industrial applications. Biomass from fishing or the
aquaculture industry is, in fact, complex, geographically and seasonally depen-
dent mixtures of compounds requiring adapted purification procedures.
Furthermore, many “natural substances”, for which we do not know any
terrestrial counterparts, and are, therefore, of the greatest interest, only exist
in tiny amounts in rare biological species and their exploitation is likely to call
for costly synthetic procedures.
Originally, marine life was used essentially as a provider of biomass directly
and indirectly for food. However, today, in the global context of the standstill
of world fisheries, common sense requires us to upgrade and exploit the ac-
tual biomass better. This clearly means developing techniques for identifying
the source of raw materials suitable for specific biomolecules, the design of
processes and their scaling up from pilot plant to production processes.
X Preface
Marine natural products not only display novel characteristics but also
complexity in terms of chemical structures. Isolation and structure elucida-
tion represents only the tip of the iceberg. The question of the functionality
of new isolated molecules within the perspective of challenging major pub-
lic health and environmental problems is crucial. In this domain, ecological
and evolutionary approaches should help the classical screening systems for
determining the right target systems.
In addition, a better understanding of the complex interactions between
macro and micro organisms is necessary for us to be able to use these re-
sources for industrial purposes. Thus, more and more groups are focussing
on the field of bioprocess engineering and downstream processing in marine
biotechnology.
This volume of Advances in Biochemical Engineering/Biotechnology illus-
trates several topics in line with the following broad objectives: thinking of
marine biotechnology as the controlled production and use of marine organ-
isms and molecules for useful purposes, firstly by exploring aspects of marine
biodiversity and exploitation of biomass, then considering the identification,
production and processing of marine products.
Kaiserslautern and Concarneau, Roland Ulber and Yves Le Gal

August 2005
Contents
Screening for New Metabolites from Marine Microorganisms

T. Schweder · U. Lindequist · M. Lalk . . . . . . . . . . . . . . . . . . . 1
Fatty Acids from Lipids of Marine Organisms: Molecular Biodiversity,

Roles as Biomarkers, Biologically Active Compounds,
and Economical Aspects
J.-P. Bergé · G. Barnathan . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Fish and Shellfish Upgrading, Traceability

F. Guérard · D. Sellos · Y. Le Gal . . . . . . . . . . . . . . . . . . . . . . 127
Marine Microalgae
T. Matsunaga · H. Takeyama · H. Miyashita · H. Yokouchi . . . . . . . . 165
Marine Enzymes
G. Debashish · S. Malay · S. Barindra · M. Joydeep . . . . . . . . . . . . 189
Extreme Environments as a Resource for Microorganisms

and Novel Biocatalysts
G. Antranikian · C. E. Vorgias · C. Bertoldo . . . . . . . . . . . . . . . . 219
Author Index Volumes 51–97 . . . . . . . . . . . . . . . . . . . . . . . 263
Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285

Contents of Volume 97
Marine Biotechnology II
Volume Editors: Yves Le Gal, Roland Ulber
ISBN: 3-540-25669-5
Aquaculture of “Non-Food Organisms”

for Natural Substance Production
G. Liebezeit
Bioprocess Engineering Data

on the Cultivation of Marine Prokaryotes and Fungi
S. Lang · M. Hüners · V. Lurtz
Downstream Processing in Marine Biotechnology

K. Muffler · R. Ulber
Marine Pharmacology:
Potentialities in the Treatment of Infectious Diseases,
Osteoporosis and Alzheimer’s Disease
M.-L. Bourguet-Kondracki · J.-M. Kornprobst
Asymmetric Total Synthesis of Complex Marine Natural Products

J. Hassfeld · M. Kalesse · T. Stellfeld · M. Christmann
Seafood Allergy: Lessons from Clinical Symptoms,

Immunological Mechanisms and Molecular Biology
K. H. Chu · C. Y. Tang · A. Wu · P. S. C. Leung
Adv Biochem Engin/Biotechnol (2005) 96: 1–48
DOI 10.1007/b135781
© Springer-Verlag Berlin Heidelberg 2005
Published online: 24 August 2005
Screening for New Metabolites

from Marine Microorganisms
Thomas Schweder (u) · Ulrike Lindequist · Michael Lalk
Institut für Marine Biotechnologie, W.-Rathenau-Str. 49, 17489 Greifswald, Germany
Schweder@uni-greifswald.de
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
2 Sequencing of the Genomes of Marine Microorganisms . . . . . . . . . . . 3

2.1 Completed and Ongoing Marine Sequencing Projects . . . . . . . . . . . . 3
2.2 Analysis of Marine Microbial Diversity . . . . . . . . . . . . . . . . . . . . 18
2.3 Environmental Genomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.4 Functional Genome Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.4.1 Proteome Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.4.2 Transcriptome Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
2.5 Genome Sequencing and Identification of New Antimicrobial Compounds 24
3 Screening for New Metabolites . . . . . . . . . . . . . . . . . . . . . . . . . 26

3.1 Alternative Cultivation Methods . . . . . . . . . . . . . . . . . . . . . . . . 26
3.2 Preparation of Materials for Screening . . . . . . . . . . . . . . . . . . . . . 27
3.3 Chemical and Physicochemical Screening . . . . . . . . . . . . . . . . . . . 28
3.4 Biological Screening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
3.5 High-Throughput Screening, Automation, Data Management . . . . . . . . 30
3.6 Metabolome Analysis Techniques . . . . . . . . . . . . . . . . . . . . . . . 31
3.7 Examples for Metabolites from Marine Microorganisms . . . . . . . . . . . 32
4 Application of Proteomics for Target Analyses of Antibacterial Compounds 41
5 Influence of Cultivation Conditions on Metabolite Production . . . . . . . 41
6 Outlook . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
Abstract This article gives an overview of current analysis techniques for the screening
and the activity analysis of metabolites from marine (micro)organisms. The sequencing
of marine genomes and the techniques of functional genomics (including transcriptome,
proteome, and metabolome analyses) open up new possibilities for the screening of new
metabolites of biotechnological interest. Although the sequencing of microbial marine
genomes has been somewhat limited to date, selected genome sequences of marine bac-
teria and algae have already been published. This report summarizes the application
of the techniques of functional genomics, such as transcriptome analysis in combina-
tion with high-resolution two-dimensional polyacrylamide gelelectrophoresis and mass
spectrometry, for the screening for bioactive compounds of marine microorganisms.
Furthermore, the target analysis of antimicrobial compounds by proteome or transcrip-
tome analysis of bacterial model systems is described. Recent high-throughput screening
2 T. Schweder et al.
techniques are explained. Finally, new approaches for the screening of metabolites from
marine microorganisms are discussed.
Keywords Functional genomics · Proteome · Metabolome · Natural compounds ·

High-throughput screening
1
Introduction
The tremendous biochemical diversity of marine microorganisms and their

biotechnological potential is becoming more and more recognized, not only
by microbiologists but also by the pharmaceutical industry. Several new
companies focus on the discovery of more effective drugs based on natu-
ral products of marine microorganisms. In recent years, the improvement
of screening technologies has yielded a considerable number of potential
new drug candidates and other metabolites from microorganisms of marine
ecosystems.
The physiological investigation of marine natural products has shown that
many of these compounds function as signal transducers and thus regulate
complex processes within marine living societies. It is supposed that these
structures play an important role in the inhibition of physiological processes
of potential competitors. This offers a promising potential for the exploration
of new drugs against critical pathogenic microorganisms.
Most of the marine compounds that have been successfully screened and
structurally elucidated so far originate from microorganisms, especially bac-
teria. Several studies have demonstrated that natural products isolated from
higher marine organisms like marine invertebrates are very frequently of
bacterial origin. However, these bacteria, which are for example in a symbi-
otic association with higher organisms, usually cannot be cultivated alone in
a pure culture. Their growth depends directly on the activity of their hosts.
Furthermore, only a minority of free-living marine microorganisms has been
identified and can be cultivated so far. The knowledge on such marine mi-
croorganisms is very limited compared to those microorganisms that can be
easily cultured under laboratory conditions. The taxonomical identification
of marine microorganisms in general is still in its infancy. The focus on the
physiology and the potential of bioactive substances of non-cultivable marine
microorganisms is an important challenge at present and for the future.
The estimated taxonomical diversity of marine microorganisms in general
indicates the powerful potential of novel bioactive substances produced in
aquatic ecosystems. It has been shown that marine bacteria, which are the
predominant microorganisms in the marine ecosystems, produce bioactive
substances that are different from known compounds from terrestrial bacte-
Screening for New Metabolites from Marine Microorganisms 3
ria. Also, metabolites from facultative and obligate marine fungi often have
structures unlike those of their terrestrial counterparts [1].
In the past, a successful cultivation was usually the prerequisite for the
screening and final application of a new natural compound. However, during
the last few years promising techniques have been developed that allow the
screening and presumably also application of biological activities, not only of
cultivable marine microorganisms but also of those organisms that cannot be
cultivated at present. These techniques are the focus of this article.
2
Sequencing of the Genomes of Marine Microorganisms
The genome sequencing of an organism gives the blueprint of its life. This
blueprint establishes the basis for a comprehensive view of the cellular phys-
iology. Knowing the sequence of all genes does not only allow the identifica-
tion of protein functions but also makes it possible to explore the complexity
of the cellular organization of an organism. Elucidation of the structural orga-
nization of sequenced genomes has led to new insights into the physiological
capacity of these organisms. This opens up new possibilities for the explo-
ration of genes that are involved in pathways responsible for the synthesis of
metabolites of biotechnological interest. However, the functions of the major-
ity of genes are still unknown. Understanding these functions will be a major
challenge for the next decades. In this field we are only at the beginning.
2.1
Completed and Ongoing Marine Sequencing Projects
A prerequisite for the sequencing of the whole genome of an organism is

usually the cultivation of the cells in a pure culture. It is estimated that
about 1–10% of the microbial diversity on earth has been identified [2].
However, the majority of the taxonomically classified microorganisms are
of terrestrial origin. The considerably smaller number of identified marine
microbial species is one of the reasons why most of the microbial genomes
that have been sequenced so far originate from terrestrial microorganisms.
Only few marine genome projects have been started and finished up to now.
The first completely sequenced genomes of marine bacteria were that of
the methanogenic bacterium Methanococcus jannaschii [3] and that of the
cyanobacterium Synechocystis spp. [4]. A selection of completed and ongoing
genome sequencing projects dealing with marine microorganisms is given in
Table 1.
4
Table 1 Selection of completed and ongoing marine genome sequencing projects
Complete genome sequences of marine microorganisms
Organism Properties Genome size (Mb) Institution Reference
Aquifex aeolicus VF5 Hyper-thermophilic marine 1.551 Diversa, [5]

bacterium (85 – 95 ◦ C) San Diego/USA
Aeropyrum pernix Aerobic hyperthermophilic archaeon 1.669 National Institute of [6]

growing at temperatures up to 100 ◦ C Technology and Evaluation
(NITE), Japan
Alcanivorax borkumensis Oil-degrading (hydrocarbonoclastic), 3.12 Competence Network [7]

surfactant-producing marine Bielefeld, Germany
bacterium
Anabaena sp. strain PCC 7120 Cyanobacterium 7.212 Kazusa DNA Research [8]
(1 chromosome of 6.414 Mb and Institute, Japan
six plasmids of 408.101 bp,
186.614 bp, 101.965 bp, 55.414 bp,
40.340 bp and 5.584 bp)
Carboxydothermus Thermophilic anaerobic bacterium 2.1 TIGR, Center of Marine [9]

hydrogenoformans from hydrothermal environments Biotechnology, USA
Chlorobium tepidum TLS Photosynthetic, anaerobic, 2.155 TIGR, USA [10]

green-sulfur bacterium, thermophile
T. Schweder et al.
Table 1 (continued)
Organism Properties Size (Mb) Institution Reference
Colwellia psychroerythraea 34H Arctic bacterium 5.3 TIGR, USA [11]
Methanococcoides burtonii Antarctic archaechon (one of two 2.8–3 Joint Genome Institute, [12]
cold-adapted archaeans to be USA
sequenced)
Methanococcus jannaschii Methanogenic archeon 1.66 TIGR, USA [13]

DSM 2661 Extremophile, grows near
hydrothermal vents at pressures
of more than 200 atm and
optimum temperature of 85 ◦ C
Methanopyrus kandleri AV19 Hyperthermophile methane- 1.695 Fidelity Systems, Inc, [14]
producing archaeon at the base USA
of black smokers (temperatures
near 100 ◦ C)
Nanoarchaeum equitans Marine archaeon, living as an 0.491 Diversa Corporation, [15]

obligate symbiont on another San Diego/USA
microbe (Ignicoccus) in undersea
vents and hot springs (one of the
smallest genomes of any sequenced
microbe)
Oceanobacillus iheyensis HTE831 Bacillus-related deep sea sediment 3.6 Japan Marine Science [16]
bacterium, tolerates extremely saline and Technology Center
and alkaline environments
5
6
Table 1 (continued)
Prochlorococcus marinus SS120 Marine cyanobacterium, one of the 1.86 Genoscope and Station [17]
most abundant photosynthetic Biologique de Roscoff,
organisms on earth France
Low-light-adapted
Prochlorococcus marinus MIT9313 Low-light-adapted ecotype (MIT 9313) 2.411 Joint Genome Institute, [18]
in deeper waters with less sunlight USA
Prochlorococcus marinus subsp. Highly light-adapted ecotype 1.658 Joint Genome Institute, [18]
pastoris CCMP1378 (MED4) (MED4), near the ocean surface USA
Pyrobaculum aerophilum DC3000 Facultatively aerobic nitrate- 2.2 University of California [19]
reducing hyperthermophilic & California Institute
crenarchaeon, T(opt) = 100 ◦ C, of Technology, USA
isolated from a boiling marine
water hole
Pyrococcus abyssi GE5 Archaeon, growing close to hot 1.765 Genoscope, Frankreich [20]
springs 3500 m deep in the
southeast Pacific (optimally at
103 ◦ C and 200 atmospheres)
Pyrococcus furiosus DSM 3638 Archaeon found in marine sand 1.908 University of Utah [21]
surrounding sulfurous volcanoes, & University of
optimal growth at temperatures Maryland, USA
above 100 ◦ C, highly resistant
to radiation
T. Schweder et al.
Table 1 (continued)
Pyrococcus horikoshii OT3 Hyperthermophilic archaebacterium 1.739 National Institute of [22]

near hydrothermal vents, Technology and
extremophile (optimum growth Evaluation, Japan
temperature 98 ◦ C)
Pyrolobus fumarii Archaeon, optimal growth at 106 ◦ C 1.8 Diversa, Celera [23]
(in hydrothermal vents at the bottom Genomics, USA
of the Atlantic Ocean)
Rhodopirellula baltica Marine planctomycete from the 7.145 Max Planck Institute [24]
(formerly Pirellula sp. strain 1) Baltic Sea, emits a reddish sunscreen of Marine Microbiology,
to protect itself from sunlight Germany
Sulfolobus tokodaii 7 Aerobic thermoacidophilic 2.695 National Institute of [25]

crenarchaeon, optimal growth Technology and Evaluation
at 80 ◦ C (hot springs), at low pH (NITE), Japan
Synechococcus WH8102 Marine unicellular cyanobacterium, 2.4 Joint Genome Institute [26]
photosynthetic, motile, in the and Scripps Institute,
open ocean USA
Synechocystis PCC 6803 Unicellular aquatic, photosynthetic 3.573 Kazusa DNA Research [27]
cyanobacterium Institute, Japan
Thermosynechococcus Thermophilic unicellular cyanobacterium 2.594 Kazusa DNA Research [28]

elongatus BP-1 (hot springs) Institute, Japan
7
8
Table 1 (continued)
Thermotoga maritima MSB 8 Extremely thermophilic eubacterium 1.861 The Institute for [29]
growing up to 90 ◦ C Genomic Research
(TIGR),
Maryland/USA
Vibrio fischeri ES114 Marine bioluminescent bacterium, 4.136 Integrated Genomics [30]
specific symbiont in the light- Inc, Univ. of Hawaii,
emitting organs of certain species USA
of squids and fishes
Vibrio vulnificus Halophilic seawater pathogen, 5.261 (2 chromosomes of Yang-Ming University, [31]
causes wound infections, 3.355 Mb and 1.857 Mb, one Taiwan
gastroenteritis plasmid of 48.508 bp)
Genomes and chromosomes of marine microorganisms in progress
Aeromonas hydrophila Enterotoxic aeromonad, fish No data TIGR, University [32]

bacterial pathogen of Maryland, USA
Aeromonas salmonicida Salmonid bacterial pathogen 4.7 National Research Council, [32]
subsp. salmonicida Institute for Marine
Biosciences, Canada
Bacteriovorax marinus SJ Marine predatory bacterium 3.431 Sanger Institute, [32]

(former salt water Bdellovibrio sp.) that parasitises a wide range University of Maryland,
of Gram negative bacteria Morgan State University,
USA
T. Schweder et al.
Table 1 (continued)
Chlorobium limicola DSMZ 245(T) Green sulfur bacterium 2.4 Joint Genome Institute, [32]
USA
Chlorobium phaeobacteroides Green sulfur bacterium 2.4 Joint Genome Institute, [32]
DSMZ 266(T) and MN1 USA
Chlorobium vibrioforme Green sulfur bacterium 2.4 Joint Genome Institute, [32]
f. thiosulfatophilum DSMZ 265(T) USA
Chloroflexus aurantiacus J-10-fl Phototrophic gliding filamentous 3.0 Joint Genome Institute, [32]
bacterium of hot springs USA
Cenarchaeum symbiosum Psychrophilic crenarchaeon that 3.7 Monterey Bay Aquarium [32]
inhabits a marine sponge Research Institute, USA
Crocosphaera watsonii WH8501 Diazotropic marine cyanobacterium, 4.0 Joint Genome Institute, [32]
isolated from the tropical Atlantic Woods Hole Oceanographic
and Pacific Oceans Institution, USA
Deinococcus geothermalis Extremely radiation-resistant No data Joint Genome Institute, [32]

DSM11300 and slightly thermophilic USA
bacterium from hot spring
9
10
Table 1 (continued)
Desulfobacterium autotrophicum Originally isolated from > 5.5 Göttingen Genomics [32]
HRM2 marine mud of the Laboratory, Real
Mediterranean Sea Environmental Genomics
(REGX, Max Planck Institute
for Marine Microbiology,
Bremen), Germany
Desulfotalea psychrophila LSv54 Psychrophilic sulfate-reducing 3.66 Epidauros Biotechnologie [32]

bacterium isolated from AG, REGX, Germany
permanently cold Arctic
marine sediments
Desulfuromonas acetoxidans Anaerobic, sulfur-reducing, 4.1 Joint Genome Institute, [32]

acetate-oxidizing bacterium USA
from sea or fresh water
Edwardsiella ictaluri 93-146 Primary bacterial pathogen No data Oklahoma University [32]
of channel catfish Health Science Center,
Mississippi State
University, USA
Epulopiscium sp. Lives in the intestines No data TIGR [32]

of several kinds of surgeonfish
off the Australian shore,
up to 500 µm in size
T. Schweder et al.
Table 1 (continued)
Flavobacterium psychrophilum Fish pathogen (coldwater No data National Center for [32]
disease) in aquaculture Cool and Cold Water
Aquaculture, Integrated
Genomics, USA
Hahella chejuensis 96CJ10356 Extracellular polysaccharide- 7.0 Korea Research Institute [32]
producing marine bacterium of Bioscience and
Biotechnology
Haloarcula marismortui Extremely halophilic archaeon 2.7 University of Maryland [32]
ATCC43049 from the Dead Sea Biotechnology Institute,
Institute for Systems
Biology, USA
Hyperthermus butylicus Hyperthermophilic peptide- 1.9 Epidauros Biotechnologie [32]
fermenting sulfur archaebacterium AG, Germany,
from the sea floor of University of Copenhagen,
solfataric habitats Denmark
Hyphomonas neptunium Primary colonizers of surfaces in 2.7 University of Georgia, [32]

ATCC 15444 marine environments and in areas TIGR, USA
adjacent to hydrothermal vents
Magnetospirillum Isolated from microaerobic No data Max-Planck-Institute [33]

gryphiswaldense zones of freshwater sediments of Marine Microbiology,
Max-Planck-Institute
of Genetics, Germany
11
12
Table 1 (continued)
Magnetospirillum magnetotacticum From microaerobic zones 4.5 Joined Genome Institute, [32]
MS-1, ATCC 31632 of freshwater sediments USA
Methanococcus Thermophilic nitrogen fixing No data Molecular Dynamics, [32]

thermolithotrophicus archaeon from submarine UK Integrated
hydrothermal vents Genomics, USA
Methanococcus voltae Archaeon from submarine No data Molecular Dynamics, [32]

hydrothermal vents Integrated Genomics
Inc, USA
Methanogenium frigidum Psychrophilic, H2 -using 2–2.5 Univ. of New S. Wales, [12]

methanogenic archaeon from Australian Genome Research
Ace Lake, Antarctica Facility, Australia
Molecular Dynamics, UK
Methanosarcina acetivorans Acetotrophic methane-producing 4.1 Göttingen Genomics [32]

bacterium isolated from Laboratory, Germany
marine sediments
Methylophaga thalassica S1 Marine methylotroph No data Integrated Genomics Inc, [32]

(1995-bp USA
Plasmid)
Microbulbifer degradans 2-40 Aerobic marine bacterium 6.0 Joint Genome Institute, [32]
that degrades and recycles USA
complex carbohydrates
T. Schweder et al.
Table 1 (continued)
Microcystis aeruginosa PCC 7806 Bloom-forming toxic 4.8 Institute Pasteur, France [32]
cyanobacterium
Mycobacterium marinum M Close relative of M. tuberculosis, 6.739 Sanger Institute, UK, [34]
fish and human pathogen University of Washington, USA,
Institute Pasteur, France,
Monash Univ., Australia,
Univ. of Tennessee, USA
Nautilia sp. Am-H Anaerobic, thermophilic sulfur- No data Univ. of Delaware TIGR, [32]
reducing bacterium, isolated from USA
tubes of the deep-sea hydrothermal
vent polychaete Alvinella pompejana
Pelagibacter ubique HTCC1062 Alpha purple bacterium, 1.54 Oregon State Univ., [32]
dominant microorganism in the Diversa, Center of
ocean surface (bacterioplankton) Marine Biotechnology,
USA
Persephonella marina Thermophilic hydrogen-oxidizing 1.6 Portland State Univ., [32]

microaerophile from deep-sea TIGR, USA
hydrothermal vents
13
14
Table 1 (continued)
Pseudoalteromonas haloplanktis Antarctic psychrotolerant Two Genoscope, France [35]

seawater bacterium chromosomes
of approx.
2700 and
800 kb
Renibacterium salmoninarum Actinobacterium, causative No data NWFSC, NCCCWA, Univ. [32]

agent of bacterial kidney of Washington, Integrated
disease in salmonid fishes Genomics, USA
Roseobacter sp. TM1040 Isolated from eggs and accessory No data Joint Genome Institute, [32]
nidamental glands of squids USA
Shewanella baltica OS1155 Gram negative gamma No data Joint Genome Institute, [32]
proteobacterium from the USA
Baltic Sea
Shewanella frigidimarina NCMB400 Antarctic Gram negative No data Joint Genome Institute, [32]
gamma proteobacterium USA
Shewanella violacea DSS12 Deep-sea barophilic Shewanella 4.9 Kinki Univ., JAMSTEC, [32]
strain Keio Univ., Japan
T. Schweder et al.
Table 1 (continued)
Silicibacter pomeroyi DSS-3 Dimethylsulfoniopropionate- 4.4 Univ. of Georgia, [32]

demethylating bacteria from TIGR, USA
marine environments
Sphingopyxis alaskensis RB2256 Chlorophenol-degrading alpha No data Joint Genome Institute, [32]
Proteobacterium from seawater USA
fjords in Alaska
Spirulina platensis Blue-green microalgae from No data Human Genome Center, [32]
lakes with high salt Beijing, China
concentrations, high
nutrient-density
Thermococcus kodakaraensis KOD1 Extremely thermophilic No data Kyoto Univ. Kwansei [32]
heterotrophic archaeon, Gakuin Univ., Japan
occurring in heated sea flows
Thermotoga neapolitana Extremely thermophilic 1.8 TIGR, USA [32]

ATCC49045 eubacterium near deep
sea vents
Thiomicrospira crunogena Autotrophic gamma No data Joint Genome Institute, [32]

proteobacterium from USA
hydrothermal vent sites
15
16
Table 1 (continued)
Trichodesmium erythraeum IMS101 Marine filamentous 6.5 Joint Genome Institute, [32]
cyanobacterium in tropical Woods Hole Oceanographic
and subtropical ocean Institute, USA
Uncultivated_Riftia pachyplila_endosymbiont Symbiont of deep sea tube 3.6–4.0 Molecular Dynamics, [32]
worm near hydrothermal Scripps Institution
vents and hot springs of Oceanography,
Quorex, USA
Vibrio salmonicida Fish pathogen No data Univ. of Tromso, [32]

NORSTRUCT, Norway
T. Schweder et al.
Recently, the genomes of three different members of the cyanobacterium

species Prochlorococcus marinus have been sequenced [36, 37]. These mem-
bers of the genus Prochlorococcus dominate phytoplankton communities in
most tropical and temperate open ocean ecosystems [38]. P. marinus is found
in two main ecological forms: high-light-adapted genotypes in the upper
part of the water column and low-light-adapted genotypes at the bottom of
the illuminated layer [36]. Analysis of the genome sequences of the different
P. marinus strains led to the identification of genes that play a role in deter-
mining the relative fitness of the ecotypes in response to key environmental
variables [37]. Furthermore, the genome comparison allowed determination
of a putative minimal gene set of this photoautotrophic bacterium [36].
Glöckner et al. (2003) reported the complete genome sequence of Pirellula
sp. strain 1 (“Rhodopirellula baltica”), a marine representative of the glob-
ally distributed and environmentally important bacterial order Planctomyc-
etales [39]. With 7.145 megabases, Pirellula sp. strain 1 has the largest circular
bacterial genome sequenced so far. The genome sequencing indicated the
presence of all genes required for heterolactic acid fermentation, key genes
for the interconversion of C1 compounds, and 110 sulfatases, which were un-
expected for this aerobic heterotrophic isolate.
The first genome of an uncultivable marine bacterium, the symbiont of
the deep sea tube worm Riftia pachyptila [40] is currently being sequenced
by a Californian consortium (Horst Felbeck, personal communication). This
uncultivable endosymbiotic bacterium seems to form a monoculture in the
trophosome of R. pachyptila. The knowledge of the bacterial genome se-
quence together with molecular techniques such as the proteome analysis
might help to find the explanation for this exclusive colonization by the mi-
crobial endosymbiont inside the trophosome of the tube worm. Furthermore,
the functional genome analysis of the bacterial symbiont will lead to the
identification of mechanisms and possibly natural products involved in estab-
lishing and maintaining the symbiosis with R. pachyptila.
Another promising field is the genome analysis of marine phages [41].
Phages have evolved unique strategies that sustainably influence the cellular
processes of bacteria. The directed isolation of marine phages and the de-
termination of their genome sequence could help to establish new strategies
for the inhibition of growth of pathogenic marine bacteria, but also of hu-
man pathogens. Such an approach has been undertaken by Liu et al. (2004)
for Staphylococcus aureus phages [42]. The sequencing of 26 phage genomes
led to the identification of 31 novel polypeptide families, the expression of
which inhibited the growth of S. aureus. Furthermore, the analysis of poten-
tial targets of these polypeptides led to the determination of proteins essential
for bacterial DNA replication. A subsequent screening for small molecule in-
hibitors of these targets allowed the isolation of chemical compounds that
imitate the growth-inhibiting effect of selected phage polypeptides. Thus, this
phage genomic approach could be a further strategy for the identification of

new antibiotics to successfully combat infectious diseases.
2.2
Analysis of Marine Microbial Diversity
The majority of marine microbial organisms cannot be cultured under ar-

tificial laboratory conditions and is thus not accessible for detailed taxo-
nomical and physiological characterizations. However, advanced molecular
techniques have altered the perspective on naturally occurring diversity and
distribution of such marine microorganisms. Direct isolation of DNA from
the environment makes it possible to identify bacterial species in different
natural marine habitats without the cultivation of the microbial cells. This
analysis is mainly based on the selective amplification of 16S rRNA gene se-
quences by application of primers of conserved regions of the 16S rDNA in
combination with the polymerase chain reaction (PCR) [43]. Due to its highly
conserved and variable sequence regions the 16S rDNA sequence is used as
a phylogenetic marker. The 16S rDNA sequence allows the identification and
taxonomical affiliation of different microbial strains from an environmental
sample. This analysis is thus an important feature, which allows the iden-
tification of so far unknown organisms and gives valuable information on
the biodiversity in marine habitats [44]. However, this technique gives only
limited information on the distribution and physiology of the microorgan-
isms in their natural environment.
The fluorescence in situ hybridization (FISH) allows investigations on the
structure of a population without PCR amplification of specific sequences
or cultivation of the microorganisms [45]. FISH with rRNA specific probes
is a technique that allows phylogenetic identification of bacteria in mixed
assemblages. For these analyses epifluorescence or confocal laser scanning
microscopy are applied [47, 48]. The sensitivity of the FISH 16S rRNA analy-
sis technique is based on the high number of ribosomes per cell and that each
ribosome contains one copy of the 16S rRNA. This is a kind of natural signal
amplification system.
2.3
Environmental Genomics
The FISH technique leads to a better understanding of the identity of selected

microorganisms and their distribution and abundance in the appropriate ma-
rine habitats. However, information concerning the biological properties of
these marine bacteria cannot be satisfyingly illuminated this way. In this
respect a new strategy has been developed, which is called environmental
genomics. Similar to the sequencing of genomes from cultivable microor-
ganisms, chromosomal DNA is used to generate genomic libraries. By the
environmental genomic strategy not only one genome is considered but all
genomic sequences from one environmental sample. Large genomic DNA
fragments are directly isolated from the environment and cloned into suit-
able host vector systems. Establishment of comprehensive gene libraries at-
tempts to cover all genome sequences from an environmental sample, to
gather as much information as possible on the biosynthetic machinery of
a microflora [49]. The comprehensive coverage of the genomes from an envi-
ronmental sample is also called metagenome analysis. This technique allows
a more realistic understanding of prokaryotic biodiversity in a distinct ma-
rine habitat [50].
A prerequisite for establishing comprehensive genomic libraries from
environmental samples is the availability of host vector systems allowing
the stable propagation of large DNA fragments. For the cloning of large
genome fragments usually fosmid [51] or bacterial artificial chromosome
(BAC) [52, 53] vectors are used (Fig. 1). Fosmid or BAC vectors facilitate the
conservation of large genomic fragments and thus open up the possibility to
characterize not only the gene content but also the physiological potential of
uncultivated microorganisms. The BAC system is based on the Escherichia
coli single copy F factor plasmid. The E. coli F factor replicon allows for a copy
number control of the clones so that they are maintained at one to two copies
per cell. BAC vectors can carry DNA inserts of variable size with a maximum
of 300 kb. Similar to the BAC system, the fosmid vectors also carry the E. coli
Fig. 1 Cloning strategies for the screening of enzymatic or metabolic activities

F factor replicon, which provides for their stable single copy number. Fosmid
vectors allow a size selection of the cloned DNA fragments from 32 to 43 kb by
packaging the DNA in λ-phage heads. Shizuya et al. (1992) developed the bac-
terial cloning system BAC for mapping and analysis of complex genomes [54].
Because of its high cloning efficiency and the stable maintenance of inserted
DNA, the BAC system is able to facilitate the construction of DNA libraries of
complex environmental genomic samples but also provides a comprehensive
representation of the genome sequence of one organism. The stabilizing effect
of BAC and also fosmid vectors is an important feature for the generation of
comprehensive genome libraries since distinct regions of genomic DNA (e.g.,
coding for potential toxic proteins) can cause vector instabilities in high copy
numbers.
The ability to clone long stretches of DNA has become an important tool
for genome analyses of uncultivated marine microorganisms (Fig. 1). Stein et
al. [51] isolated large genomic fragments from a widely distributed and rela-
tively abundant, but as yet uncultivated, group of prokaryotes, the planktonic
marine archaea from marine picoplankton. By construction and analysis of
a fosmid DNA library a 38.5-kbp recombinant clone could be identified,
which contained an archaeal small subunit ribosomal DNA gene. A similar
approach was used to identify genomic DNA fragments of the symbiotic ma-
rine archaeon Cenarchaeum symbiosum from the total DNA of the marine
sponge Axinella mexicana [55].
An environmental genomic study of Beja et al. [56] led to the discov-
ery of proteorhodopsin, a retinal-containing integral membrane protein that
functions as a light-driven proton pump, in the genome of an uncultivated
marine bacterium. This study indicated that photoactive proteorhodopsin is
present in oceanic surface waters. The data of Beja et al. (2001) suggested that
proteorhodopsin-based phototrophy is a globally significant oceanic micro-
bial process.
In another study Beja et al. [57] analyzed large genome fragments from
microorganisms sampled from an Antarctic picoplankton population and
compared them to those from deeper waters of the temperate North Pa-
cific. This study was initiated to better characterize uncultivated planktonic
crenarchaeotes, which are present in high abundance in Antarctic winter sur-
face waters and deep ocean waters. For this purpose environmental genomic
fragments were cloned into fosmid vectors and the inserts were sequenced.
Analysis of the DNA insert of one Antarctic marine archaeon revealed dif-
ferences in genome structure and content between archaea from Antarctic
surface water and temperate deepwater. Analysis of the proteins encoded by
the archaeon sequence from surface water and those derived from a deepwa-
ter planktonic crenarchaeote revealed many typical archaeal proteins but also
several proteins that have not been detected in archaea so far. Furthermore,
a comparison of closely related archaea originating from a single population
revealed significant genomic sequence differences that were not evident from
the 16S rRNA sequence analysis. Beja et al. [57] concluded that considerable
functional diversity may exist within single populations of coexisting micro-
bial strains, even those with identical 16S rRNA sequences.
Metabolic features are often coded in gene clusters, so called genomic is-
lands. Therefore, the metagenome approach can also be applied to identify
new genetic pathways for the directed synthesis of metabolites or enzymatic
functions. Such functional genomic islands from uncultured microorganisms
can be screened by isolating genetic material directly from original environ-
mental samples (Fig. 1). The successful cloning and transformation of these
sequences into a suitable host vector system for its expression and final char-
acterization is a prerequisite for such screening approaches. One example in
this respect is the commercialization of polyunsaturated fatty acids (PUFAs)
from marine microorganisms. The most important PUFAs are eicosopen-
taenic acid (EPA) and docosahexaenic acid (DHA). PUFAs are of biotechno-
logical interest because of their beneficial properties to human health and
their importance in infant development [58]. The screening of microbial
PUFA synthesis genes from metagenome libraries allows for the cloning of
the responsible genes into suitable expression hosts. The cloning of a 38 kb
gene cluster from Shewanella putrefaciens into E. coli and Synechococcus spp.
resulted in a successful EPA production by these microorganisms [59, 60].
The potential knowledge of PUFA-related genes offers the possibility for con-
struction of recombinant microbial cell factories suitable for an alternative
production of EPA and DHA.
The metagenome approach can also be used to automate the screening
of genes from nature, either to look for new technical enzymes or for other
specified activities. The screening of specific enzymatic activities requires
the cloning and expression of a single gene. However, the production of dis-
tinct compounds, such as metabolites or antibiotics, is coded by a set of
genes. The cloning of complex environmental DNA samples into a suitable
host in combination with HTS methods is a good strategy for the screening
and isolation of pathways for metabolic functions or the discovery of new
bioactive natural compounds directly from the marine environment. One pi-
oneer in this field is the company DIVERSA (San Diego, California). This
company estimates that its gene expression (metagenome) libraries currently
contain the complete genomes of over one million different microorgan-
isms (http://www.diversa.com/). DIVERSA has developed a set of automated
ultra HTS and enrichment strategies. The company uses two different screen-
ing strategies to discover novel biomolecules: (1) expression-based screening
for biological activity and (2) sequence-based screening by identification of
specific DNA sequences of interest. Recently, DIVERSA obtained the patent
rights on a strategy claiming the construction and screening of expression
libraries from nucleic acid directly isolated from the environment utilizing
a fluorescence activated cell sorter (http://www.diversa.com/). This approach
is based on a robotic screening system, which uses high-density microtiter
plates, capable of screening and characterizing of about one million clones

per day. If a clone expresses an activity or contains a DNA sequence of inter-
est, it is isolated for further analysis.
2.4
Functional Genome Analysis
The function of the majority of genes within the sequenced marine genomes
is not well understood. Furthermore, even if the complete set of genes of
a microbial cell is available, it is mostly not known how these genes are reg-
ulated or how the proteins interact to express their functions. In order to
assign potential functions to the genes of a genome, functional genome an-
alysis techniques are used. These techniques include the expression profiling
of the whole set of genes by using genomic DNA arrays and/or proteomics.
These techniques are not only suitable for exploration of the functions of the
proteins but also help to find new potential drug targets. Proteome and tran-
scriptome analysis techniques have led to a shift from direct antimicrobial
screening programs toward rational target-based strategies. Furthermore,
these techniques allow the identification of essential genes for the synthesis of
selected metabolites.
2.4.1
Proteome Analysis
The proteome technique is mainly based on two-dimensional protein gel elec-

trophoresis (2D-PAGE), used for protein separation, and MALDI-TOF mass
spectrometry, applied for protein identification. Mandatory for the proteome
analysis by mass spectrometry is the availability of the complete genome
sequence of the organism of interest. The proteome of only few marine mi-
croorganisms has been investigated so far. Most of these proteome studies
explore how marine bacteria adapt to alterations in their environmental con-
ditions. One of the first proteome analyses was performed using a marine
Vibrio [61, 62]. In these studies the response of the marine Vibrio sp. strain
S14 to starvation for carbon, nitrogen, or phosphate and to simultaneous de-
pletion of all these nutrients (multiple-nutrient starvation) was examined.
Gross et al. (1994) investigated changes in the two-dimensional protein pat-
tern of selected marine bacteria and fungi in response to high-pressure
stress [63].
The determination of proteome signatures related to defined variations
in the environmental conditions also allows the affiliation of unknown
gene/protein functions into functional groups. Rabus et al. (2002) studied the
proteome of the planctomycete Rhodopirellula baltica during growth with N-
acetylglucosamine and glucose [64]. Analysis of the two-dimensional protein
patterns revealed the presence of several protein spots, which were only de-
tectable in soluble protein extracts of cells grown with N-acetylglucosamine.
Lemus and Ngai (2000) examined alterations in the proteome of the Eu-
prymna scolopes light organ in response to symbiotic Vibrio fischeri. 2D-PAGE
identified changes in the soluble proteome of the symbiotic light organ in-
duced by a specific response to the interaction with V. fischeri [65].
Lopez et al. (2002) suggested the application of proteomics for the iden-
tification of marine species by the analysis of species-specific peptides from
randomly selected dominant protein spots [66].
2.4.2
Transcriptome Analysis
Proteome analysis is frequently accomplished by expression profiling with

DNA arrays. However, genomic DNA arrays have so far been designed for
only a few marine microorganisms. One of the first expression profiling
studies with marine organisms using a genomic DNA array was done by
Okamoto et al. (2003), who performed a genome-wide analysis of redox-
regulated genes in a dinoflagellate [67]. In this study, the effects of sodium
nitrite (a reactive nitrogen species generator) and paraquat (a producer of re-
active oxygen species) on gene expression in the marine dinoflagellate species
Pyrocystis lunula were investigated using genomic DNA microarrays.
Beside the application of genomic DNA microarrays for gene expression
profiling, the use of DNA chips, with probes for a selected number of gene
sequences, for ecological surveys and the exploration of marine biodiversity
has been suggested [68]. Wu et al. (2001) developed and evaluated functional
DNA arrays with genes involved in nitrogen cycling from pure cultures and
those cloned from marine sediments [70]. The authors could demonstrate
that their model DNA array in principle reveals functional gene composition
in natural microbial communities. However, the study also showed that more
work is needed to improve the sensitivity and specificity of this method. The
advantage of DNA chips in comparison to the FISH method would be that
multiple numbers of probes can be applied in one hybridization experiment.
This advantage of DNA chips is of special interest for the analysis of micro-
bial communities with a complex biodiversity. Furthermore, in comparison to
FISH this approach allows the application of multiple probes for a better con-
trol of false-positive and false-negative results. However, because of the large
unknown amount of genetic sequences in an environmental sample, DNA
chips are not yet widespread in marine microbial ecological applications [68].
For a successful application of DNA chips in this field, the discrimination of
single mismatches is crucial [69].
2.5
Genome Sequencing and Identification of New Antimicrobial Compounds
The sequencing of the genomes of microbial human pathogens has fun-

damentally changed the capabilities for antimicrobial drug screening [71]
(Fig. 2). Most antimicrobial drugs used today are derivatives of structures
originating from terrestrial microorganisms. However, these drugs have been
applied for many years and a considerable number of pathogenic microor-
ganisms have adapted to these structures by developing antibiotic resis-
tances [72, 73]. Therefore, new lead structures allowing new mechanisms of
Fig. 2 The impact of genomics on drug development processes

action, which are different from the established bioactive compounds from
terrestrial microorganisms, are required.
Most of the antimicrobial compounds currently on the market were
screened based on whole cell antimicrobial screening programs. By ap-
plication of new genome-driven techniques more directed, target-based
approaches are possible [71]. These new screening strategies are directly
coupled to potential drug targets, which have been identified by genome se-
quencing projects. Such antimicrobial targets are for example proteins that
are essential for microbial growth or cell survival.
Another important drug target are proteins that are involved in the
pathogenicity of the pathogenic organism. In this respect, comparative ge-
nomics of pathogenic and non-pathogenic strains is a suitable approach for
the identification of pathogenicity related proteins. For example, comparison
of the genomes of uropathogenic E. coli strains with those of non-pathogenic
E. coli and from other E. coli pathotypes revealed the existence of so-called
pathogenicity islands [74–76]. A similar approach has been used to investi-
gate the pathogenicity of the marine bacterium Vibrio vulnificus [77]. This
halophilic marine bacterium is an etiologic agent of human mortality from
seafood-borne infections. Genome sequencing and comparative analysis led
to the identification of selected genomic regions that are typical for V. vul-
nificus and the human pathogen V. cholerae. The genomic information of this
pathogenic bacterium can not only be applied for a monitoring of Vibrio in-
fections but will eventually also lead to the identification of virulence factors
of V. vulnificus.
The sequencing of the genome of a microorganism that has been identi-
fied as a potent producer of bioactive compounds allows the identification of
the gene clusters involved in the pathways for the production of these natural
compounds. Myxobacteria like Myxococcus xanthus and Sorangium cellulo-
sum have increasingly gained attention as producers of natural products with
biological activity [78]. However, these myxobacteria are difficult to handle in
large bioreactors for the biotechnological production of the metabolites of in-
terests. Therefore, Müller and co-workers from the University of Saarbrücken
are trying to identify biosynthetic gene clusters of these gram-negative bac-
teria by genome sequencing. In order to establish a biotechnological pro-
duction of selected bioactive structures a suggestion is to clone the essential
biosynthetic gene clusters of these myxobacteria into suitable hosts such as
Pseudomonas or Streptomyces, which fit the demands of the myxobacterial
genetics and biochemistry [78].
3
Screening for New Metabolites
3.1
Alternative Cultivation Methods
Less than 5% of the viable bacterial cells in marine samples ultimately grow
under standard culture conditions [79, 80]. Typically, nutrient concentrations
and cell numbers in the marine environment are three orders of magnitude
lower than in common laboratory media [81]. Based on this fact, Button
et al. (1993) developed a new approach for the isolation of marine bacte-
ria [82]. This group simulated the normal substrate concentrations but also
the cell density limited environmental conditions and was able to isolate
typical marine bacteria. Rappe et al. [81] have improved the technique of But-
ton et al. [82] and applied microarrays from the cell cultures coupled with
FISH. A high throughput procedure allowing the cultivation of the abundant
group of the ubiquitous SAR11 marine bacterioplankton clade was used. The
combination of the HTS and molecular analysis techniques was helpful in
increasing the rate at which cultures could be obtained and identified [81].
Fresh Oregon coast seawater samples were diluted so that each well of a mi-
crotiter plate was inoculated on average with about 22 microbial cells. The
medium in the microtiter wells was sterile Oregon coast water supplemented
with phosphate, ammonium, and defined mixtures of organic carbon com-
pounds. This approach allowed isolation of 18 bacterial cultures, which were
not cultivable under standard cultivation conditions and which had resisted
any cultivation efforts in the past. Rappe et al. [81] thus confirmed the suit-
ability of diluting natural microbial communities in very low nutrient media
for the isolation of new marine microorganisms. Consequently, high similar-
ity to the original environmental conditions of the samples is helpful for the
isolation of novel microbial species. Low nutrient conditions and the estab-
lishment of the selection of single cells for cultivation were also successfully
applied for the isolation of novel halophiles from Red Sea brine [83].
Furthermore, it has been reported that a combination of FISH and mi-
croautoradiography supports the determination of physiological activities of
microorganisms without cultivation [84]. In this approach a radioactively la-
beled substrate was used for the incubation of a complex microbial sample.
Cells metabolizing the radioactive-labeled substrate were finally detected by
FISH. By this technique the strains are not only taxonomically affiliated but
it is also possible to gain information concerning their physiological activity
and the utilization of distinct substrates.
There is a challenge of developing further new culture techniques that
incorporate an understanding of the special environmental conditions of ma-
rine organisms in their natural habitats. This includes variations of dissolved
organic matter, trace elements, or surfaces. In most cases essential interac-

tions with other organisms of the marine biotope have to be considered. The
growth and development of selected microorganisms could directly or indi-
rectly depend on the association with other bacteria or algae in the marine
environment. Therefore, the consideration of microbial consortia rather than
purified cultures could be a further suitable strategy for screening for new
microbial activities. Furthermore, most cultivation attempts are performed
either in liquid media or on agar plates as batch cultures. Special cultivation
conditions, such as permeable solid substrates that imitate sediments or con-
tinuous cultivations in flow reactors, are rarely applied. Another interesting
aspect is the potential addition of growth-supporting signal molecules. Bruns
et al. (2002) used signaling factors like the autoinducer acyl homoserine lac-
tone or cyclic AMP to support the culturing of marine microorganisms [85].
It is thought that microorganisms only synthesize their bioactive com-
pounds under distinct environmental conditions. Thus, beside the cultiva-
tion of these microorganisms the identification of the most suitable growth
conditions for a maximal production of secondary metabolites also has to
be considered. The influence of culture conditions on secondary metabolite
production has for example been demonstrated for cyclic and linear lipopep-
tides of Cyanobacteria [86]. The competition of different microorganisms for
limited natural resources is also supposed to support the synthesis of an-
timicrobial compounds. In the marine bacterium Streptomyces tenjimariensis
production of the antibiotic istamycin is induced by co-culturing with other
marine bacteria [87]. Such antibiotics frequently inhibit the growth of com-
petitors and thus play an ecological role in the suppression of competitive
microorganisms.
3.2
Preparation of Materials for Screening
The screening results depend on the quality of screening material, collec-

tion and storage of organisms, cultivation, extraction, storage of extracts, and
preparation of test samples. A directed (preselected) screening offers bet-
ter chances of finding interesting metabolites than an undirected (“blind”)
screening. Such a directed screening could be based on ecological observa-
tions (peculiarities like interactions, special environmental conditions), on
traditional experiences (use in ethnomedicine), or search in novel organ-
isms. Mode and solvent of extraction determine which substances are ex-
tracted [88, 89]. Solid phase extraction is a suitable method for automated
sample preparation [90].
Extracts make special demands on sample preparation and screening sys-
tems because they are usually complex mixtures of compounds. The concen-
tration of active compounds in crude extracts is often very low (1 : 1000). One
extract could contain compounds with opposite effects or compounds with
low effect, which are active only in combination. False-positive results could
be found. Further problems could be the lack of solubility in physiological
solvents, the coloring of an extract (difficulties in spectroscopic measure-
ments), or the non-tolerability of crude extracts to some bioassays.
3.3
Chemical and Physicochemical Screening
Chemical and physicochemical screening is the search for new chemical

structures regardless of their biological activities. The first step is the sepa-
ration of compounds from a complex extract by chromatographic methods.
In a second step, the chemical reactivity or physicochemical properties of
the separated compounds are analyzed by spectroscopic methods (UV/VIS,
MS, NMR) or by detection with special detection reagents in the TLC [91].
The development of HPLC-DAD-MS systems allows the specific detection
of single components in a complex mixture (e.g., an extract), regardless of
the background of other metabolites. Comparison with data bases allows
the identification of known structures (dereplication). Finding of unknown
peaks in a HPLC or TLC chromatogram stimulates the isolation of the com-
pound giving this peak by chromatographic methods and allows structure
elucidation of the isolated substance by spectroscopic methods like nuclear
magnetic resonance spectroscopy (NMR) or mass spectroscopy (MS). Taking
into account the growth of (marine) microorganisms in microtiter plates, the
screening for secondary metabolites could also be done on this miniaturized
scale [92].
The new metabolites found by chemical screening still have to be tested for
their biological activities. Combination of HPLC-separation, bioassays, and
on-line spectroscopy miniaturizes and accelerates the identification of bioac-
tive metabolites in a complex matrix [93].
3.4
Biological Screening
During biological screening test samples (extracts, fractions, pure com-

pounds, and compound libraries) are screened for their bioactivities in vitro
and/or in vivo. In the case of extracts, active metabolites could be isolated
by bioactivity-guided isolation processes. The finding of structurally known
compounds (dereplication) in active extracts is possible. Biological screening
methods have to be of relevance for the objective (e.g., for the therapeutic
aim), highly sensitive, selective (insensitive to inactive compounds and to
ubiquitous compounds), and reproducible. They should be characterized by
high information content and reasonable costs [94].
In vitro tests could be done on a molecular or on a cellular level. The
information content will increase from molecular to cellular level, but the
throughput is higher in molecular test systems (question of quantity vs. qual-

ity). Assays that require careful interpretation but provide a lot of information
per assay are ideal for marine natural products research [88].
Tests on the molecular level are based, e.g., on receptor systems (identifi-
cation of those compounds which bind to one receptor) or on enzyme sys-
tems (enzyme-catalyzed turnover rates). Tests on the genome, transcriptome,
or proteome level will become more and more important. Targets of high
pharmacological relevance are G-protein coupled receptors, tyrosine kinase
receptors, nuclear hormone receptors, ion channels, proteases, kinases, phos-
phatases, and transporter molecules. The detection of a reaction on the mo-
lecular level could be done by biochemical assays (e.g., spectrophotometric
measurement of the product of an enzymatic reaction), ligand binding assays
(readout by labeling with a tracer) or functional assays (reporter gene assays
quantifying the expression level of a specific reporter gene product, second
messenger assays, two hybrid assays for measuring protein–protein interac-
tions). Fluorescence-based assay technologies, isotopic labeling, colorimetry,
and chemoluminescence are very often used as detection methods [95–97].
Cell-based assays are more complex and more physiologically relevant
than tests on the molecular level. On the other hand they are still labor inten-
sive and more difficult to validate than molecular assays [98]. Permanent cell
lines have many advantages in handling compared to primary cell cultures.
Examples for cellular assays are: (1) vitality and proliferation studies with tu-
mor cells or other permanent cell lines for the detection of antitumor effects
or undesired cytotoxic effects, and (2) growth studies with bacterial or fun-
gal cells (diffusion assay or dilution assay) for detection of antibiotic effects
or morphological and biochemical investigations of special cell types, e.g., en-
dothelial cells, muscle cells, or keratinocytes. The detection could be done by
microscopic investigation, counting of cell number, measurement of electro-
physiological properties, determination of metabolic capacities or membrane
integrity (dye uptake assay), uptake of precursors into DNA (proliferation
studies), or several biochemical parameters (protein content and so on).
Most marine samples have only been tested in a limited number of as-
says. The true drug potential of many of these compounds may therefore not
yet be fully realized. Papers about new chemical structures of marine com-
pounds give only initial biotesting data. Their significance is often difficult to
determine. Papers with systematic screening results obtained from extracts
are rare. The goal of highlighting compounds that are likely to become clin-
ical candidates is also complicated by the fact that pharmaceutical companies
are naturally reluctant to talk about compounds in the early stages of devel-
opment [88]. The results of detailed pharmacological and biochemical studies
could therefore be found only for selected compounds.
A predominant portion of bioactive marine metabolites (from marine bac-
teria and fungi, but also from invertebrates) is occupied by antitumor/cyto-
toxic compounds. Other activities are antibacterial, antiviral, anti-inflamma-
tory, and enzyme-inhibiting [99]. Some toxic metabolites could be useful as

molecular tools.
3.5
High-Throughput Screening, Automation, Data Management
The use of high-throughput screening (HTS) methods can improve the ef-
ficiency of biological tests [95]. HTS is characterized by very high numbers
of test samples (more than 100 000 per day in UHTS), automated processes,
single-time-point measurement instead of kinetic measurements, develop-
ment of miniaturized and paralleled techniques (96-, 384- or 1536-well mi-
crotiter plates), and more sensitive detection technologies with fast read
time [96, 100]. Presently HTS or UHTS are designed to handle large libraries
of pure compounds, e.g., obtained by combinatorial chemistry [101]. They
mainly use isolated targets.
The development of new HTS methods for cell-based screening is in
progress. Because of their higher complexity they could simultaneously de-
liver information on multiple parameters, provide higher quality data, and
give better information about function of bioactive principles. Reporter sys-
tems are introduced into the cells, which are based on the expression of
genes encoding proteins such as β-galactosidase, luciferase, or alkaline phos-
phatase. An alternative to the use of expensive mammalian cells is the expres-
sion of a selected physiological process in microorganisms such as Saccha-
romyces cerevisiae. Novel methods of single molecule detection, e.g., fluores-
cence correlation spectroscopy (FCS) will improve the processes [95, 102].
High-content screening (HCS) becomes more and more important. This
means that a smaller number of high-qualitative compounds (higher purity)
is screened with higher performance (high information content).
HTS is performed mainly by the industry and seldom by academic groups.
It focuses on the active principle in a distinct bioassay. The screens are usually
run only for a limited length of time. Due to the above mentioned problems
with extracts, HTS is not suitable for these samples and crude extracts derived
from natural sources therefore only play a minor role in HTS [95]. A bioassay-
guided fractionation of an extract could need longer time than the screening
of the pure chemical library [88].
A way to overcome the problems of biogenic samples in HTS is the syn-
ergistic use of natural product chemistry and combinatorial chemistry. By
bringing together the structural value and complex molecular shape of nat-
ural products isolated from a natural source with rational synthetic strate-
gies of combinatorial chemistry and biochemistry, the success of screening
processes (the chance to find new lead structures) could be significantly
improved [103]. Thus one could randomly isolate pure compounds on the ba-
sis of interesting chemical structures, produce substance libraries and then
screen these libraries [88].
In every case, the results of HTS represent only the first step in a series of
experiments; valid cell culture experiments and animal assays are necessary.
ADMET properties (adsorption, distribution, metabolism, excretion, and to-
xicology of a bioactive metabolite) have to be considered. Only compounds
with positive results in primary HTS and in secondary assays could be de-
clared as a “hit”. The hits have also to be structurally defined.
Derivatization of hits by chemical or biochemical methods could produce
a “lead”, a series of hits for which the structure-activity relationship is shown
and activity demonstrated in vitro and in vivo.
A new development in the field of HTS is represented by the High
Throughput Pharmacological System™ (HTPS), which was patented by Ax-
iom Biotechnologies (San Diego, CA) [104]. This is a fluidics- based platform
that uses viable cells and test compounds to identify active compounds.
This approach allows for a very fast estimation of the potency of the com-
pounds and a determination of their specificity. HTPS can be understood
as an instrument for automated programming of complex pharmacological
cell treatment protocols. Edwards et al. (2001) [105] have coupled HTPS to
a flow cytometer using a plug flow coupling valve technology. Flow cytome-
try is performed with fluorescent probes and allows an optical measurement
of physiological parameters of individual cells or cellular macromolecules at
a high rate [106]. HTPS flow cytometry facilitates a high-throughput multi-
factorial screening of large compound libraries to increase the efficiency with
which novel bioresponse modifying drugs, such as from marine microor-
ganisms, may be identified and characterized [105]. In this approach a large
compound library in microtiter plates is sequentially combined with cells and
finally delivered to a flow cytometer for multiparametric analysis.
3.6
Metabolome Analysis Techniques
The metabolome is the final product of proteome activity including the total
assembly of low molecular weight molecules in a cell. Its composition is deter-
mined not only by the genetic information encoded in the genes, but also by
a particular physiological and developmental state as well as by environmen-
tal factors. The main technologies for metabolome analysis are MS and NMR
spectrometry, often combined with chromatographic methods. These require
minute amounts of sample and will accommodate individual components of
highly varying chemical structures and physical properties.
Metabolome analysis is expected to become a valuable tool in the search
for new metabolites from marine microorganisms and in investigation of
their biological effects on the metabolome of other cells.
Two of the methods of choice for the evaluation of metabolic constituents
of cells are the hyphenated techniques HPLC-NMR and HPLC-MS. These
methods can be used for the identification of several individual compo-
nents present in mixtures. Rapid identification is possible by comparison

to database entries of the NMR and MS patterns of compounds of inter-
est [107, 108].
By intelligent coupling of metabolome analysis with cellular test systems
it seems possible to detect the effects (or side effects) of drug candidates at
a very early stage of the drug development process and so to reduce the late
stage failure of compounds in the pipeline.
3.7
Examples for Metabolites from Marine Microorganisms
Some excellent reviews about bioactive metabolites from marine microorgan-

isms are given by Fenical and Jensen [79, 109, 110]. Selected examples will be
outlined in this overview.
Antitumor agents
Test samples are screened in cell-based assays against a panel of different hu-
man tumor cell lines. The NCI uses about 60 cell lines representing nine of
the most important tumor types. In the NCI screening the percentage of sig-
nificant active cytotoxic samples (IC 50 < 4 µg/mL) among marine organisms
was higher (2%) than that among plants (< 1%) [111]. After primary screens
numerous sophisticated molecular and biochemical screens that target spe-
cific cellular aspects of cancer growth and dissemination should follow [110].
A highlighted metabolite is salinosporamide A from a marine bacterium
of the new genus Salinospora, a group of obligate marine actinomycetes
widely distributed in marine sediments (Fig. 3). These bacteria possess a γ -
lactam-β-lactone bicyclic ring structure with clasto-lactacystin-β-lactone
with unique functionalization displaying potent in vitro cytotoxicity (mean
IC 50 value less than 10 nM). In more sophisticated tests it could be shown
that salinosporamide A inhibits the 20S subunit of proteasomes [112]. Due
to its essential role in cellular physiology the proteasome represents a very
attractive target for new drugs. Other examples for potential antitumor
drugs from marine microorganisms are the alkaloid alteramide (Fig. 3) from
a marine bacterium (Alteromonas) isolated from the sponge Halichondria
okadai [113], the diketopiperazine dimer asperazine (Fig. 3) from a strain of
Aspergillus niger obtained from the sponge Hyrtios sp. [114], the macrolide
halichomycin (Fig. 4) from Streptomyces hygroscopicus, isolated from the gas-
trointestinal tract of the marine fish Halichoeres bleekeri [115], the depsipep-
tide thiocoraline (Fig. 4) from Micromonospora marina [116], the leptosins,
diketopiperazine dimers from the obligate marine fungus Leptosphaeria
sp. [117], and the neomangicols, partly halogenated sesterterpenes isolated
from the mycelial extract of a wood-inhabiting marine fungus (Fig. 5) [118].
Fig. 3 Antitumor compounds from marine microorganisms (I)
Fig. 4 Antitumor compounds from marine microorganisms (II)
The IC 50 values of these compounds against various cell lines range from
0.1 to less than 10 µg/mL. More significantly, leptosins A and C displayed
potent in vivo activity in a Sarcoma-180 ascites tumor model in mice [110].
Fig. 5 Antitumor compounds from marine microorganisms (III)
Fig. 6 Antitumor compounds from marine microorganisms (IV)
Cytotoxic metabolites from cyanobacteria are cryptophycin from a Nostoc

sp. [119] and curacin A from a specimen of Lyngbya majuscula from Curaçao,
which inhibits microtubule assembly by binding at the colchicin site (Fig. 6).
Curacin A is only active in vitro [120].
The potent cytotoxin dolastatin-10, primarily found in the sea hare Dola-
bella auricularia, has recently been isolated from a cyanobacterium (Sym-
Fig. 7 Antitumor compounds from marine microorganisms (V)
ploca sp., [121]). The lyngbyastatins are cytotoxic depsipeptides from Lyng-
bya majuscula (Fig. 7) [122].
Antibiotics
Agar diffusion assays using different microbial strains (including multiresis-

tant strains) represent the most important screening method for detection
of antibacterial and antifungal effects of extracts and pure compounds. Ac-
tive test samples are further evaluated by dilution assays to determine the
minimal inhibitory concentration and by cytotoxicity assays to exclude unde-
sired effects against mammalian cells. Furthermore, tests for determination
of target and mode of action (see Sect. 4) and in vivo assays are necessary.
Examples for new antibacterial agents from marine microorganisms are
the massetolides A–H (Fig. 8), cyclic depsipeptides from two Pseudomonas
strains obtained from a marine alga and a tube worm [123], marinone
and debromomarinone from a marine-sediment derived actinomycete [124],
microsphaeropsisin from a fungus (Microsphaeriopsis sp.) isolated from
a sponge [125], ascochitin and ascochital from Kirschsteiniothelia maritima
Fig. 8 Antibiotic compounds from marine microorganisms (I)
Fig. 9 Antibiotic compounds from marine microorganisms (II)

Fig. 10 Antifungal compounds from marine microorganisms
isolated from wood [126], and corollosporin from the fungus Corollospora
maritima obtained from wood nearby Helgoland, Germany (Fig. 9) [127].
Antifungal activities are exhibited by lipodepsipeptides (LL-15 G256) from
the fungus Hypoxylon oceanicum (Fig. 10). They inhibit the fungal cell wall
synthesis [128].
Antiviral agents
In vitro tests for antiviral activity are carried out in cellular test systems such
as the influenza virus/MDCK cell system (Martin-Darby Canine Kidney cells)
or herpes simplex virus/VERO cells (kidney cells from green macaque). Cells
are damaged by virus infection and antiviral effects can be shown by im-
proved cell viability or membrane integrity. Other test methods are based
on virus specific enzymes. Examples for antiviral agents from marine mi-
croorganisms are the macrolactins A–F, macrolides from a Gram-positive
deep-sea bacterium from a sediment-sample obtained from the California
coast [129], the caprolactins A and B containing a cyclized lysine moiety
also from a Gram-positive deep-sea bacterium from a sediment sample [130],
the halovirs A–C, cyclic peptides similar to peptaibols from a marine fungus
(Scytalidium sp., [110]), and sulfated polysaccharides from a marine Pseu-
domonas sp. (Fig. 11) [131]. The named compounds inhibit herpes simplex
viruses; in addition macrolactin A is effective against HIV.
Fig. 11 Antiviral compounds from marine microorganisms
Anti-Inflammatory agents
Anti-inflammatory effects can be shown by the inhibition of enzymes in-

volved in the inflammation process (cyclooxygenases, lipoxygenases, some
proteases), on production and release of inflammatory cytokines, on blood
coagulation, histamine release, or in animal assays (phorbol ester induced ear
edema in mice and other).
Examples for anti-inflammatory metabolites from marine microorgan-
isms are the salinamides A and B, depsipeptides from an actinomycete
isolated from the surface of the jelly fish Cassiopeia xamancha [132];
thiotropocin, a sulfur-containing macrolide from a Caulobacter sp. [133]; and
the phomactins A–G, sesquiterpenes from a Phoma sp. obtained from a crab
shell (Fig. 12) [134].
The salinamides inhibit inflammation in a mouse ear edema assay by
> 80% at a dose of 50 µg/ear [132], phomactin D inhibits PAF (platelet-
activating factor)-induced platelet aggregation with an IC50 value of
0.8 µM [134], and thiotropocin depresses histamine release and hemolysis of
rabbit erythrocytes [133].
Fig. 12 Anti-inflammatory compounds from marine microorganisms
Agents with other indications
Enzyme inhibitors are of interest for treatment of several diseases, e.g., car-
diovascular or kidney diseases. They are the focus of many in vitro screen-
ing programs. A novel endothelin-converting enzyme inhibitor (compound
B-90063) with 4-pyridone and oxazole skeletons was discovered to be pro-
duced by a new marine species of the genus Blastobacter, isolated from sea-
water (Fig. 13) [135]. Endothelin is produced by endothelial cells and parti-
cipates in the regulation of blood pressure. Inhibitors are therefore of interest
for treatment of cardiovascular diseases.
The polyketide obionin from the obligate marine fungus Leptosphaeria
obiones, isolated from the coastal march grass Spartina alterniflora, inhibits
ligand binding to a dopamine-selective receptor with an IC 50 of 2.5 µg/mL
(Fig. 13) [136].
Komodoquinone A from a marine Streptomyces sp. [137] and epolactaene,
a polyene from a Penicillium sp. [138], induce the differentiation of neuronal
cells and could be of interest for regeneration of nerve cells (Fig. 14). The
semiplenamides A–G are fatty acid amides from a Papua New Guinea collec-
tion of the marine cyanobacterium Lyngbya majuscule which influence the
endogenic cannabinoid system of humans (Fig. 14) [139].
Fig. 13 Compounds with other indications from marine microorganisms (I)
Fig. 14 Compounds with other indications from marine microorganisms (II)

4
Application of Proteomics for Target Analyses
of Antibacterial Compounds
Proteome analysis is a suitable experimental tool for evaluating the mode of

action of drugs [140, 141]. In the case of known drugs proteome analysis with
suitable microbial model cells may confirm and complement the results of
biochemical and other target analysis assays. Comparisons to antibiotics with
known targets can be used to confirm the observed correlations. In the case of
new drugs, the target of which is unknown, proteome signatures give the first
indications of their mode of action. By comparing treated cells to untreated
controls, the influence of the drug on protein patterns of the model cells can
be followed. By this approach it was shown that the antibacterial compounds
ascochitin, ascochital, and corollosporin (Fig. 9), isolated from marine fungi,
induce protein stress in Bacillus subtilis. By comparison to protein signatures
of known antibiotics an influence on translation by these antimicrobial com-
pounds could be proposed [142].
5
Influence of Cultivation Conditions on Metabolite Production
Genomic analysis has shown that most fungi or bacteria that produce sec-
ondary metabolites have the genetic potential for several biosynthetic path-
ways and therefore to generate more than one compound. By alteration of
cultivation parameters it is possible to increase the number of secondary
metabolites from one microbial source (one strain – many compounds,
OSMAC) [143]. Chemical and biological screening methods are necessary to
record the whole spectrum of metabolites. This approach offers a good al-
ternative to industrial HTS, where the detection of additional compounds in
extracts that might be of interest in other bioassays is impossible. By a sys-
tematic approach, the group of Zeeck [143] was able to isolate more than 100
compounds belonging to more than 25 different structural classes from only
six different terrestrial microorganisms. It is supposed that marine microor-
ganisms show similar abilities.
Functional genome analysis will help to identify the cultivation conditions
that activate silent gene clusters responsible for the biosynthesis of bioactive
metabolites and the molecular mechanism triggering this change in expres-
sion profile.
6
Outlook
Exploitation of the potential of marine microorganisms as producers of

bioactive metabolites is just beginning. For the realization of this potential,
it is necessary that the full extent of biological and chemical diversity is ex-
amined by appropriate methods. Until now traditional screening methods
limited to selected disease areas have mostly been used.
Methods of functional genome analysis including transcriptome, pro-
teome, and metabolome analysis will lead to a better understanding of disease
mechanisms and the identification of new drug targets. Improved screen-
ing methods and further development of the necessary technical equipment
will allow immense progress in the drug development process. They will also
promote the cultivation of until now uncultivable marine microorganisms
and investigation of their genetic potential. It is expected that such novel
and obligate marine organisms contain more new metabolites than easily ac-
cessible facultative marine microorganisms. The exploration of the genome
structure and physiology of uncultivable microorganisms by environmen-
tal genomics will lead to the discovery of new biotechnologically relevant
enzymes and genes that code for bioactive metabolites. By improving the
HTS of metagenome databases complete genomic coverage of special marine
habitats will become possible. The revolutionary development in the field of
functional genomics during the last 10 years supports this assumption. Nev-
ertheless, it should be clear that years of development and a lot of money are
required before utility of new marine natural compounds in medicine and
biotechnology is fully accomplished.
References
1. Lindequist U, Schweder T (2001) In: Rehm HJ, Reed G (eds) Biotechnology, vol 10:
Special processes. Wiley VCH, pp 441–484
2. Staley, J (2002) Biodiversity of microbial life. Wiley-Liss, New York
3. Smith DR, Doucette-Stamm LA, Deloughery C, Lee H, Dubois J, Aldredge T, Bashir-
zadeh R, Blakely D, Cook R, Gilbert K, Harrison D, Hoang L, Keagle P, Lumm W,
Pothier B, Qiu D, Spadafora R, Vicaire R, Wang Y, Wierzbowski J, Gibson R, Jiwani N,
Caruso A, Bush D, Reeve JN, et al. (1997) J Bacteriol 179:7135–55
4. Nakamura Y, Kaneko T, Hirosawa M, Miyajima N, Tabata S (1998) Nucleic Acids Res
26:63–67
5. Deckert G, Warren PV, Gaasterland T, Young WG, Lenox AL, Graham DE, Over-
beek R, Snead MA, Keller M, Aujay M, Huber R, Feldman RA, Short JM, Olsen GJ,
Swanson RV (1998) Nature 392:353–358
6. Kawarabayasi Y, Hino Y, Horikawa H, Yamazaki S, Haikawa Y, Jin-no K, Takahashi M,

Sekine M, Baba S, Ankai A, Kosugi H, Hosoyama A, Fukui S, Nagai Y, Nishijima K,
Nakazawa H, Takamiya M, Masuda S, Funahashi T, Tanaka T, Kudoh Y, Yamazaki J,
Kushida N, Oguchi A, Kikuchi H, et al. (1999) DNA Research 6:83–101
7. Golyshin PN, Martins Dos Santos VA, Kaiser O, Ferrer M, Sabirova YS, Lunsdorf H,
Chernikova TN, Golyshina OV, Yakimov MM, Puhler A, Timmis KN (2003) J Biotech-
nol 106:215–220
8. Kaneko T, Nakamura Y, Wolk CP, Kuritz T, Sasamoto S, Watanabe A, Iriguchi M,
Ishikawa A, Kawashima K, Kimura T, Kishida Y, Kohara M, Matsumoto M, Mat-
suno A, Muraki A, Nakazaki N, Shimpo S, Sugimoto M, Takazawa M, Yamada M,
Yasuda M, Tabata S (2001) DNA Res 8:205–13; 227–253
9. http://wit.integratedgenomics.com/GOLD/index.cgi?want=Prokaryotic+Ongoing+
Genomes
10. Eisen JA, Nelson KE, Paulsen IT, Heidelberg JF, Wu M, Dodson RJ, Deboy R,
Gwinn ML, Nelson WC, Haft DH, Hickey EK, Peterson JD, Durkin AS, Kolonay JL,
Yang F, Holt I, Umayam LA, Mason T, Brenner M, Shea TP, Parksey D, Nierman WC,
Feldblyum TV, Hansen CL, Craven MB, Radune D, Vamathevan J, Khouri H, White O,
Gruber TM, Ketchum KA, Venter JC, Tettelin H, Bryant DA, Fraser CM (2002) Proc
Natl Acad Sci USA 99:9509–9514
11. http://www.tigr.org/tdb/mdb/mdbinprogress.html
12. Saunders NFW, Thomas T, Curmi PMG, Mattick JS, Kuczek E, Slade R, Davis J, Franz-
mann PD, Boone D, Rusterholtz K, Feldman K, Gates C, Bench S, Sowers K, Kad-
ner K, Aerts A, Dehal P, Detter C, Glavina T, Lucas S, Richardson P, Larimer F,
Hauser L, Land M, Cavicchioli R (2003) Genome Res 13:1580–1588
13. Bult CJ, White O, Olsen GJ, Zhou L, Fleischmann RD, Sutton GG, Blake JA, Fitz-
Gerald LM, Clayton RA, Gocayne JD, Kerlavage AR, Dougherty BA, Tomb JF,
Adams MD, Reich CI, Overbeek R, Kirkness EF, Weinstock KG, Merrick JM, Glo-
dek A, Scott JL, Geoghagen NS, Venter JC (1996) Science 273:1058–1073
14. Slesarev AI, Mezhevaya KV, Makarova KS, Polushin NN, Shcherbinina OV, Shakho-
va VV, Belova GI, Aravind L, Natale DA, Rogozin IB, Tatusov RL, Wolf YI, Stetter KO,
Malykh AG, Koonin EV, Kozyavkin SA (2002) Proc Natl Acad Sci USA 99:4644–4649
15. Waters E, Hohn MJ, Ahel I, Graham DE, Adams MD, Barnstead M, Beeson KY,
Bibbs L, Bolanos R, Keller M, Kretz K, Lin X, Mathur E, Ni J, Podar M, Richardson T,
Sutton GG, Simon M, Soll D, Stetter KO, Short JM, Noordewier M (2003) Proc Natl
Acad Sci USA 100:12 984–12 988
16. Takami H, Takaki Y, Uchiyama I (2002) Nucleic Acids Res 30:3927–3935
17. Dufresne A, Salanoubat M, Partensky F, Artiguenave F, Axmann IM, Barbe V, Du-
prat S, Galperin MY, Koonin EV, Le Gall F, Makarova KS, Ostrowski M, Oztas S,
Robert C, Rogozin IB, Scanlan DJ, Tandeau de Marsac N, Weissenbach J, Wincker P,
Wolf YI, Hess WR (2003) Proc Natl Acad Sci USA 100:10 020–10 025
18. Rocap G, Larimer FW, Lamerdin J, Malfatti S, Chain P, Ahlgren NA, Arellano A, Cole-
man M, Hauser L, Hess WR, Johnson ZI, Land M, Lindell D, Post AF, Regala W,
Shah M, Shaw SL, Steglich C, Sullivan MB, Ting CS, Tolonen A, Webb EA, Zinser ER,
Chisholm SW (2003) Nature 424:1042
19. Fitz-Gibbon ST, Ladner H, Kim UJ, Stetter KO, Simon MI, Miller JH (2002) Proc Natl
Acad Sci USA 99:984–989
20. Cohen GN, Barbe V, Flament D, Galperin M, Heilig R, Lecompte O, Poch O, Prieur D,
Querellou J, Ripp R, Thierry JC, Van der Oost J, Weissenbach J, Zivanovic Y,
Forterre P (2003) Mol Microbiol 47:1495–1512
21. Robb FT, Maeder DL, Brown JR, DiRuggiero J, Stump MD, Yeh RK, Weiss RB,
Dunn DM (2001) Methods Enzymol 330:134–157
22. Kawarabayasi Y, Sawada M, Horikawa H, Haikawa Y, Hino Y, Yamamoto S, Sekine M,
Baba S, Kosugi H, Hosoyama A, Nagai Y, Sakai M, Ogura K, Otsuka R, Nakazawa H,
Takamiya M, Ohfuku Y, Funahashi T, Tanaka T, Kudoh Y, Yamazaki J, Kushida N,
Oguchi A, Aoki K, Kikuchi H (1998) DNA Research 5:55–76
23. http://www.spaceref.com/news/viewpr.html?pid=6101
24. Glockner FO, Kube M, Bauer M, Teeling H, Lombardot T, Ludwig W, Gade D, Beck A,
Borzym K, Heitmann K, Rabus R, Schlesner H, Amann R, Reinhardt R (2003)
Proc Natl Acad Sci USA 100:8298–8303
25. Kawarabayasi Y, Hino Y, Horikawa H, Jin-no K, Takahashi M, Sekine M, Baba S,
Ankai A, Kosugi H, Hosoyama A, Fukui S, Nagai Y, Nishijima K, Otsuka R, Naka-
zawa H, Takamiya M, Kato Y, Yoshizawa T, Tanaka T, Kudoh Y, Yamazaki J, Kushida N,
Oguchi A, Aoki K, Masuda S, Yanagii M, Nishimura M, Yamagishi A, Oshima T,
Kikuchi H (2001) DNA Research 31:123–140
26. Palenik B, Brahamsha B, Larimer FW, Land M, Hauser L, Chain P, Lamerdin J, Re-
gala W, Allen EE, McCarren J, Paulsen I, Dufresne A, Partensky F, Webb EA, Water-
bury J (2003) Nature 424:1037–1042
27. Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hi-
rosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki A,
Nakazaki N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe A, Ya-
mada M, Yasuda M, Tabata S (1996) DNA Research 3:109–136
28. Nakamura Y, Kaneko T, Sato S, Ikeuchi M, Katoh H, Sasamoto S, Watanabe A,
Iriguchi M, Kawashima K, Kimura T, Kishida Y, Kiyokawa C, Kohara M, Mat-
sumoto M, Matsuno A, Nakazaki N, Shimpo S, Sugimoto M, Takeuchi C, Yamada M,
Tabata S (2002) DNA Research 9:123–130
29. Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peter-
son JD, Nelson WC, Ketchum KA, McDonald L, Utterback TR, Malek JA, Linher KD,
Garrett MM, Stewart AM, Cotton MD, Pratt MS, Phillips CA, Richardson D, Hei-
delberg J, Sutton GG, Fleischmann RD, Eisen JA, Fraser CM, et al. (1999) Nature
399:323–329
30. http://ergo.integratedgenomics.com/Genomes/VFI/index.html
31. Chung-Yung C, Keh-Ming W, Yo-Cheng C, Chuan-Hsiung C, Hui-Chi T, Tsai-Lien L,
Yen-Ming L, Hsiang-Ju C, Bo-Ting AS, Jian-Chiuan L, Teh-Li S, Chung-Ping S,
Chung-Te L, Lien-I H, Shih-Feng T (2003) Genome Res 13:2577–2587
32. http://wit.integratedgenomics.com/GOLD/index.cgi?want=Prokaryotic+Ongoing+
Genomes
33. Schüler D, personal communication
34. http://www.sanger.ac.uk/Projects/M_marinum/
35. Danchin A, personal communication
36. Dufresne A, Salanoubat M, Partensky F, Artiguenave F, Axmann IM, Barbe V, Du-
prat S, Galperin MY, Koonin EV, Le Gall F, Makarova KS, Ostrowski M, Oztas S,
Robert C, Rogozin IB, Scanlan DJ, Tandeau de Marsac N, Weissenbach J, Wincker P,
Wolf YI, Hess WR (2003) Proc Natl Acad Sci USA 100:10 020–10 025
37. Rocap G, Larimer FW, Lamerdin J, Malfatti S, Chain P, Ahlgren NA, Arellano A, Cole-
man M, Hauser L, Hess WR, Johnson ZI, Land M, Lindell D, Post AF, Regala W,
Shah M, Shaw SL, Steglich C, Sullivan MB, Ting CS, Tolonen A, Webb EA, Zinser ER,
Chisholm SW (2003) Nature 424:1042–1047
38. Partensky F, Hess WR, Vaulot D (1999) Microbiol Mol Biol Rev 63:106–127
39. Glöckner FO, Kube M, Bauer M, Teeling H, Lombardot T, Ludwig W, Gade D, Beck A,
Borzym K, Heitmann K, Rabus R, Schlesner H, Amann R, Reinhardt R (2003) Proc
40. Distel DL, Lane DJ, Olsen GJ, Giovannoni SJ, Pace B, Pace NR, Stahl DA, Felbeck H
(1988) J Bacteriol 170:2506–2510
41. Paul JH, Sullivan MB, Segall AM, Rohwer F (2002) Comp Biochem Physiol Part B
133:464–476
42. Liu J, Dehbi M, Moeck G, Arhin F, Bauda P, Bergeron D, Callejo M, Ferretti V, Ha N,
Kwan T, McCarty J, Srikumar R, Williams D, Wu JJ, Gros P, Pelletier J, DuBow M
(2004) Nat Biotechnol 22:185–191
43. Olsen GJ, Woese CR (1993) FASEB J 7:113–123
44. Ludwig W, Strunk O, Klugbauer S, Klugbauer N, Weizenegger M, Neumaier J, Bach-
leitner M, Schleifer KH (1998) Electrophoresis 19:554–568
45. DeLong EF (2001) Curr Opin Microbiol 4:290–295
46. Hugenholtz P, Goebel BM, Pace NR (1998) J Bacteriol 180:4765–4774
47. Amann R, Fuchs BM, Behrens S (2001) Curr Opin Biotechnol 12:231–236
48. DeLong EF, Schleper C, Feldman R, Swanson RV (1999) Biol Bull 196:363–365
49. Handelsman J, Rondon MR, Brady SF, Clardy J, Goodman RM (1998) Chem Biol
5:245–249
50. Rodriguez-Valera F (2002) Environ Microbiol 4:628–633
51. Stein JL, Marsh TL, Wu KY, Shizuya H, DeLong EF (1996) J Bacteriol 178:591–599
52. Beja O, Suzuki MT, Koonin EV, Aravind L, Hadd A, Nguyen LP, Villacorta R, Am-
jadi M, Garrigues C, Jovanovich SB, Feldman RA, DeLong EF (2000) Environ Micro-
biol 2:516–29
53. Beja O, Aravind L, Koonin EV, Suzuki MT, Hadd A, Nguyen LP, Jovanovich SB,
Gates CM, Feldman RA, Spudich JL, Spudich EN, DeLong EF (2000) Science 289:1902–
1906
54. Shizuya H, Birren B, Kim UJ, Mancino V, Slepak T, Tachiiri Y, Simon M (1992) Proc
55. Schleper C, DeLong EF, Preston CM, Feldman RA, Wu KY, Swanson RV (1998) J Bac-
teriol 180:5003–5009
56. Beja O, Spudich EN, Spudich JL, Leclerc M, DeLong EF (2001) Nature 416:786–789
57. Beja O, Koonin EV, Aravind L, Taylor LT, Seitz H, Stein JL, Bensen DC, Feldman RA,
Swanson RV, DeLong EF (2002) Appl Environ Microbiol 68:335–345
58. Gill I, Valivety R (1997) TIBTECH 15:401–409
59. Yazawa, K (1996) Lipids 31:297–300
60. Takeyama H, Takeda D, Yazawa K, Yamada A, Matsunaga T (1997) Microbiology
143:2725–2731
61. Nystrom T, Flardh K, Kjelleberg S (1990) J Bacteriol 172:7085–7097
62. Nystrom T, Olsson RM, Kjelleberg S (1992) Appl Environ Microbiol 58:55–65
63. Gross M, Kosmowsky IJ, Lorenz R, Molitoris HP, Jaenicke R (1994) Electrophoresis
15:1559–1565
64. Rabus R, Gade D, Helbig R, Bauer M, Glockner FO, Kube M, Schlesner H, Rein-
hardt R, Amann R (2002) Proteomics 2:649–655
65. Doino Lemus J, McFall-Ngai MJ (2000) Appl Environ Microbiol 66:4091–4097
66. Lopez JL, Marina A, Alvarez G, Vazquez J (2002) Proteomics 2:1658–1665
67. Okamoto OK, Hastings JW (2003) Gene 321:73–81
68. Peplies J, Glockner FO, Amann R (2003) Appl Environ Microbiol 69:1397–1407
69. Liu W-T, Mirzabekov AD, Stahl DA (2001) Environ Microbiol 3:619–629
70. Wu L, Thompson DK, Li G, Hurt RA, Tiedje JM, Zhou J (2001) Appl Environ Micro-
biol 67:5780–5790
71. Rosamond J, Allsop A (2000) Science 287:1973–1976
72. Jones RN, Pfaller MA (1998) Diagn Microbiol Infect Dis 31:379–388
73. File TM Jr (1999) Chest 115:3–8
74. Dobrindt U, Blum-Oehler G, Nagy G, Schneider G, Johann A, Gottschalk G, Hacker J
(2002) Infect Immun 70:6365–6372
75. Oelschlaeger TA, Dobrindt U, Hacker J (2002) Int J Antimicrob Agents 19:517–521
76. Hacker J, Hentschel U, Dobrindt U (2003) Science 301:790–793
77. Chen CY, Wu KM, Chang YC, Chang CH, Tsai HC, Liao TL, Liu YM, Chen HJ,
Shen AB, Li JC, Su TL, Shao CP, Lee CT, Hor LI, Tsai SF (2003) Genome Res 13:2577–
2587
78. Gerth K, Pradella S, Perlova O, Beyer S, Müller R (2003) J Biotechnol 106:233–253
79. Jensen PR, Fenical W (1994) Annu Rev Microbiol 48:559–584
80. Bernan VS, Greenstein M, Maiese WM (1997) Adv Appl Microbiol 43:57–90
81. Rappe MS, Connon SA, Vergin KL, Giovannoni SJ (2002) Nature 418:630–633
82. Button DK, Schut F, Quang P, Martin R, Robertson BR (1993) Appl Envir Microbiol
59:881–891
83. Eder W, Jahnke LL, Schmidt M, Huber R (2001) Appl Envir Microbiol 67:3077–3085
84. Lee N, Nielsen PH, Andreasen KH, Juretschko S, Nielsen JL, Schleifer KH, Wagner M
(1999) Appl Environ Microbiol 65:1289–1297
85. Bruns A, Cypionka H, Overmann J (2002) Appl Environ Microbiol 68:3978–3987
86. Burja AM, Abou-Mansour E, Banaigs B, Payri C, Burgess JG, Wright PC. J (2002) Mi-
crobiol Methods 48:207–219
87. Slattery M, Rajbhandari I, Wesson K (2001) Microb Ecol 41:90–96
88. Faulkner DJ (2000) Antonie van Leeuwenhoek 77:135–145
89. Pfefferle CM, Suessmuth RD (2003) Screening 5:41–43
90. Schmid I, Sattler I, Grabley S, Thiericke R (1999) BIOforum 1–2:17–20, and 5:261–
264
91. Grabley S, Thiericke R, Zeeck A (1999) In: Grabley S, Thiericke R (eds) Drug discov-
ery from nature. Springer, Berlin Heidelberg New York, pp 124–148
92. Clerval R, Kühner M, Li Z, Minas W, Fjällman A, Witholt B, Duetz WA (2000)
BioWorld 6:24–26
93. Hamburger M, Danz H, Dittmann K (2002) Screening 2:33–35
94. Bhakuni DS (1998) J Indian Chem Soc 75:191–205
95. Grabley S, Thiericke R (1999) In: Grabley S, Thiericke R (eds) Drug discovery from
nature. Springer, Berlin Heidelberg New York, pp 38–48
96. Frobel K, Metzger S (2001) In: Rehm HJ, Reed G (eds) Biotechnology, vol 10: special
processes. Wiley VCH, pp 41–60
97. Vogel HG (ed) (2000) Drug discovery and evaluation, 2cnd edn. Springer, Berlin
Heidelberg New York
98. Minor L (2003) Screening 5:25–28
99. Jensen PR, Fenical W (1994) Ann Rev Microbiol 48:559–584
100. Devlin JP (2002) In: Mei HY, Czarnik AW (eds) Integrated drug discovery technolo-
gies. Marcel Dekker, New York, pp 221–245
101. Lebl M (2002) In: Mei HY, Czarnik AW (eds) Integrated drug discovery technologies.
Marcel Dekker, New York, pp 395–405
102. Otrocka A, Oehlenschlager F, de Hoop M (2003) Screening 1:41–43
103. Bertels S, Frormann S, Jas G, Bindseil K (1999) In: Grabley S, Thiericke R (eds) Drug
discovery from nature. Springer, Berlin Heidelberg New York, pp 72–105
104. Okun I, Kaler G et al. (2000) SPIE Proc 3921:90–100

105. Edwards BS, Kuckuck FW, Prossnitz ER, Ransom JT, Sklar LA (2001) J Biomol Screen
6:83–90
106. Shapiro HM (1995) Practical flow cytometry. Wiley-Liss, New York
107. Lindon JC, Bailey NJC, Nicholson JK, Wilson, ID (2003) Handbook of analytical sep-
arations, vol 4: bioanalytical separations. pp 293–329
108. Lindon JC, Nicholson JK, Wilson ID (2000) J Chromatogr B 748:233–258
109. Fenical W (1993) Chem Rev 93:1673–1683
110. Jensen PR, Fenical W (2000): In: Fusetani N (ed) Drugs from the Sea. Karger, Basel,
pp 6–29
111. Eder C, Proksch P (1997) DROGENREPORT 10:24–28
112. Feling RH, Buchanan GO, Mincer TJ, Kauffman CA, Jensen PR, Fenical W (2003)
Angew Chem 115:369–371
113. Shigemori H, Bae MA, Yazawa K, Sasaki T, Kobayashi J (1992) J Org Chem 57:4317–
4320
114. Varoglu M, Corbett TH, Valeriote FA, Crews P (1997) J Org Chem 62:7078–7079
115. Takahashi C, Takada T, Yamada T, Minoura K, Uchida K, Matsumura E, Numata A
(1994) Tetrahedron Lett 35:5013–5014
116. Baz JP, Canedo LM, Fernan’dez Puentes JL, Silva Elipe MV (1997) J Antibiot 50:738–
741
117. Takahashi C, Numata A, Ito Y, Matsumura E, Minoura K, Eto H, Shingu T, Ito T,
Hasegawa T (1994) J Antibiot 47:1242–1249
118. Renner MK, Jensen PR, Fenical W (1998) J Org Chem 63:8346–8354
119. Trimurtulu G, Ohtani I, Patterson GML, Moore RE, Corbett TH, Valeriote FA, Dem-
chik L (1994) J Am Chem Soc 116:4729–4737
120. Gerwick WH, Proteau PJ, Nagle DG, Hamel E, Blokhin A, Slate DL (1994) J Org Chem
59:1243–1245
121. Luesch H, Yoshida WY, Moore RE, Paul VJ, Mooberry SL, Corbett T (2002) J Nat Prod
65:16–20
122. Luesch H, Yoshida WY, Moore RE, Paul VJ (1999) J Nat Prod 62:1702–1706
123. Gerard J, Lloyd R, Barsby T, Haden P, Kelly MT, Andersen RJ (1997) J Nat Prod
60:223–229
124. Pathirana C, Jensen PR, Fenical W (1992) Tetrahedron Lett 33:7663–7666
125. Höller U, König GM, Wright AD (1999) J Nat Prod 62:114–118
126. Kusnick C, Jansen R, Liberra K, Lindequist U (2002) Pharmazie 57:510–512
127. Liberra K, Jansen R, Lindequist U (1998) Pharmazie 53:578–581
128. Schlingmann G, Milne L, Williams DR, Carter GT (1998) J Antibiot 51:303–316
129. Gustafson K, Roman M, Fenical W (1989) J Am Chem Soc 111:7519–7524
130. Davidson BS, Schumacher RW (1993) Tetrahedron 49:6569–6574
131. Matsuda M, Shigeta S, Okutani K (1999) Mar Biotechnol 1:68–73
132. Trischman A, Tapiolas DM, Jensen PR, Dwight R, Fenical W (1994) J Am Chem Soc
116:757–758
133. Kawano Y, Asada M, Inoue M, Nakagomi K, Oka S, Higashirana T (1998) J Mar
Biotechnol 6:49–52
134. Sugano M, Sato A, Iijima Y, Oshima T, Furuya K, Kuwano H, Hata T, Hanzawa H
(1991) J Amer Chem Soc 113:5463–5464
135. Takaishi S, Tuchiya N, Sato A, Negishi T, Takamatsu Y, Matsushita Y, Watanabe T,
Iijima Y, Haruyama H, Kinoshita T, Tanaka M, Kodama K (1998) J Antibiot 51:805–
815
136. Poch GK, Gloer JB (1989) Tetrahedron Lett 30:3483–3486
137. Itoh T, Kinoshita M, Aoki S, Kobayashi M (2003) J Nat Prod 66:1373–1377

138. Kakeya H, Takahashi I, Okada G, Isono K, Osada H (1995) J Antibiot 48:733–735
139. Han B, McPhail KL, Ligresti A, Di Marzo V, Gerwick WH (2003) J Nat Prod 66:1364–
1368
140. Bandow JE, Brötz H, Leichert LOI, Labischinski H, Hecker M (2003) Antimicrob
Agents Chemother 47:948–955
141. Sender U, Bandow EJ, Engelmann S, Lindequist U, Hecker M (2004) Pharmazie
59:65–70
142. Lindequist U, Sender U, Bandow J, Jülich WD, Kusnick C, Schweder T, Hecker M
(2001) Antibacterial substances from marine fungi and their investigation by
proteome-based methods. In: Proceedings of 8th international marine and freshwa-
ter mycology symposium. Hurghada, Egypt, 2001, p 457
143. Bode BH, Bethe B, Höfs R, Zeeck A (2002) Chem Bio Chem 3:619–627
DOI 10.1007/b135782
Fatty Acids from Lipids of Marine Organisms:

Molecular Biodiversity, Roles as Biomarkers,
Biologically Active Compounds, and Economical Aspects
Jean-Pascal Bergé1 (u) · Gilles Barnathan2
1 Centre de Nantes, Laboratoire Génie Alimentaire, Département Valorisation des
Produits, Institut Français pour l’Exploitation de la Mer (IFREMER), BP21105,
44311 Nantes Cedex 03, France
jpberge@ifremer.fr
2 Pôle Mer et Littoral, Laboratoire de Chimie Marine, Groupe SMAB (EA 2160),
Substances marines à activité biologique, Université de Nantes,

2 rue La Houssinière, 44322 Nantes Cedex 03, France
gilles.barnathan@univ-nantes.fr
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
2 Nomenclature of fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . 53
3 Fatty-acid biosynthetic pathways in primary producers . . . . . . . . . 53
4 Marine bacteria and cyanobacteria . . . . . . . . . . . . . . . . . . . . . 54
5 Phytoplankton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56
6 Macroalgae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
7 Zooplankton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
8 Marine invertebrates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
8.1 Sponges . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
8.1.1 ∆5,9 fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
8.1.2 Branched fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
8.1.3 Methoxylated fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
8.1.4 Acetylenic fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
8.2 Coelenterate – Cnidaria . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
8.3 Echinodermata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
8.4 Tunicates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
8.5 Molluscs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
8.5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
8.5.2 Mussels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
8.5.3 Oysters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
8.5.4 Patella . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
8.5.5 Clams . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
8.5.6 Scallops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
8.5.7 Squids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
9 Crustacea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
50 J.-P. Bergé · G. Barnathan
10 Polyunsaturated FA (n-3) of commercial interest . . . . . . . . . . . . . 78

10.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
10.2 Health benefits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
10.2.1 Heart health . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
10.2.2 Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
10.2.3 Arthritis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
10.2.4 Psoriasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
10.2.5 Lung disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
10.2.6 Attention-deficit disorder . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
10.2.7 Mental health . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
10.2.8 Pregnancy and infancy . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
10.3 Nutrition: importance of the ratio of (n-6) and (n-3) essential FA . . . . 82
10.4 Routes for biosynthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
10.4.1 Aerobic pathways . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
10.4.2 Anaerobic pathway . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
10.5 Some promising sources of marine LC-PUFA . . . . . . . . . . . . . . . . 90
10.5.1 PUFA from nonphotosynthetic microorganisms . . . . . . . . . . . . . . 90
10.5.2 PUFA from fish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
10.6 Current utilization of marine oils and lipids . . . . . . . . . . . . . . . . 105
10.6.1 Market . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
10.6.2 Common resources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Abstract Because of their characteristic living environments, marine organisms produce

a variety of lipids. Fatty acids constitute the essential part of triglycerides and wax esters,
which are the major components of fats and oils. Nevertheless, phospholipids and glycol-
ipids have considerable importance and will be taken into account, especially the latter
compounds that excite increasing interest regarding their promising biological activities.
Thus, in addition to the major polyunsaturated fatty acids (PUFA) such as eicosapen-
taenoic (EPA) and docosahexaenoic (DHA) acids, a great number of various fatty acids
occur in marine organisms, e.g. saturated, mono- and diunsaturated, branched, halo-
genated, hydroxylated, methoxylated, non-methylene-interrupted. Various unprecedented
chemical structures of fatty acids, and lipid-containing fatty acids, have recently been dis-
covered, especially from the most primitive animals such as sponges and gorgonians. This
review of marine lipidology deals with recent advances in the field of fatty acids since the
end of the 1990s. Different approaches will be followed, mainly developing biomarkers
of trophic chains in marine ecosystems and of chemotaxonomic interest, reporting new
structures, especially those with biological activities or biosynthetic interest. An import-
ant part of this review will be devoted to the major PUFA, their relevance to health and
nutrition, their biosynthesis, their sources (usual and promising) and market.
Keywords Lipids · Fatty acids · Marine organisms · Biomarkers · Nutrition
Abbreviations
AA arachidonic acid 20:4(n-6)
DHA docosahexaenoic acid 22:6(n-3)
EPA eicosapentaenoic acid 20:5(n-3)
FA fatty acid
Fatty acids from marine I 51
FATM fatty-acid trophic markers

GC/MS gas-chromatography mass spectrometry
PUFA polyunsaturated fatty acids
LC-PUFA long-chain polyunsaturated fatty acids
VLC-PUFA Very-long-chain polyunsaturated fatty acids
MUFA monounsaturated fatty acids
NMI non-methylene-interrupted fatty acids
NMID non-methylene-interrupted dienoic fatty acids
PL phospholipids
SFA saturated fatty acids
TL total lipids
EFA essential fatty acid
TAG triacylglycerols
SCO single-cell oil
1
Introduction
Lipids are major sources of metabolic energy and essential materials for the
formation of cell and tissue membranes. They are very important in the phys-
iology and reproductive processes of marine animals and reflect the special
biochemical and ecological conditions of the marine environment [1–3]. The
interest of chemists, biochemists and biotechnologists in lipids and fatty acids
(FA) from marine animals and algae has been stimulated, in particular, by
the recognition that polyunsaturated fatty acids (PUFA) are important to hu-
man health and nutrition. They are required for reproduction and growth.
The relative proportion and composition of FA in marine organisms are char-
acteristic for every species and genus, and also depend on environmental
conditions. Several comprehensive reviews are available on marine FA, their
occurrence, their roles and the methods used in their analysis [4–8].
The principal role of neutral lipids, which in marine organisms consist
predominantly of triacylglycerols (TAG) and wax esters, is as an energetic re-
serve of FA that are destined either for oxidation to provide energy (ATP) or
for incorporation into phospholipids. Phospholipids are the building blocks
for the membrane lipid bilayer. FA provide the hydrophobic interior of all cell
membranes, forming an impermeable barrier to water and polar molecules
and separating the cell contents from the extracellular medium. The phys-
ical properties of the membrane are determined by the individual lipids
within the FA components of the lipids and their interaction with sterols
and proteins. While their function as structural lipids in membranes has
been known for a long time, ceramides and glycosyl ceramides (glycosph-
ingolipids) play an important role in many fields of cell biochemistry, such
as molecular recognition. In addition, ceramides from marine organisms
have excited great attention as signal transducers, and some of them have
been recognized as possessing antimicrobial and cytotoxic activities. Marine

glycosphingolipids, chiefly isolated from sponges, show interesting biologi-
cal activities such as immunomodulation and antitumoral activity [9]. The
fatty acyl chains linked to these classes of compounds are often commonly
occurring but several new and original structures have been reported re-
cently [10, 11]. Arising from alpha-glycosphingolipids isolated from marine
sponges, the simplest (KRN 7000) is being considered as an anticancer agent
([12], see Bourguet-Kondracki & Kornprobst, this book).
Fat not only provides energy, it facilitates the absorption of fat-soluble
vitamins (vitamins A, D, E, and K), and plays an important role in the pro-
duction and regulation of eicosanoids. In addition, lipid class and FA compo-
sitions can be used to understand and identify food web interactions.
Different approaches can be applied in this field of marine lipidology, fo-
cused on FA, mainly:
– searching for new FA structures
– evaluating new sources of major PUFA of biological interest
– evaluating their role in cell membranes
– investigating biosynthetic pathways
– developing trophic and/or chemotaxonomic biomarkers in ecosystems.
The rapid development of excellent analytical methods, especially gas liquid
chromatography coupled to mass spectrometry (GC/MS), which can deal
with complex mixtures, has also been a major contributing factor to the
progress in the chemistry and biochemistry of marine lipids [5, 6, 13].
As the principal producers in the marine environment, microalgae support
both pelagic and benthic food webs, and their lipids and FA are been extensively
studied. Microalgae are known to have different FA compositions depending on
their taxonomic position [14, 15]. At the next trophic level, zooplankton form
an essential link between primary producers and higher-order consumers. Very
recently, a complete review was devoted to fatty-acid trophic markers (FATM)
in the pelagic marine environment [8]. The FATM concept is based on the ob-
servation that marine primary producers lay down certain FA patterns that may
be conservatively transferred through aquatic food webs. Thus, they can be
recognized in their primary consumers. The next step is concerned with the
dynamics of FA in fish, which catabolize and transform dietary FA.
Marine invertebrates, especially sponges, have proved to be a rich source
of many unusual FA. Sponges are very ancient animals with special structural
features, particularly the cell membrane, which have allowed their adaptation
to often precarious environments. These primitive organisms are difficult to
classify due to the few available useful morphological characteristics. The use
of taxonomic knowledge allows investigation to be focused on genera that
offer the great potential in metabolites of biological interest. Recently, a com-
prehensive taxonomy was published, which provides the state of the art [16].
Representatives of the Coelenterate phylum have remarkable peculiarities in
their FA composition. Some species contain unusual FA or unusual concen-

trations of common components.
The main purposes of this paper are to illustrate the molecular biodiver-
sity in marine lipids (from the first planktonic marine producers to fish) and,
in another part, to focus on the most important PUFA (sources, biosynthesis,
economy). This work has been done by considering the most interesting ad-
vances in marine lipidology since the end of the 20th century. Thus, without
covering the subject exhaustively, this review deals with FA from total lipids
or those specifically linked to a particular lipid class such as TAG, wax esters,
ceramides, polar lipids and some additional atypical secondary metabolites.
Thus, unusual or novel FA, and FA that are interesting due to their appli-
cations in chemotaxonomy, biosynthesis and as biomarkers, will mainly be
taken into account.
2
Nomenclature of fatty acids
According to the international nomenclature, the position of the first double

bond is given by the (n-x) notation, counting the number of carbon atoms
from the methyl end. For instance, 18:4(n-3) identifies an FA with 18 carbon
atoms and four double bonds, the first double bond occurring after the third
carbon atom [4, 7] (Fig. 1). An additional PUFA is depicted in Fig. 1 (middle),
namely 24:6(n-3).
According to an alternative notation, the locations of the double bonds
are counted from C-1 (the carboxyl group). Thus, 18:4(n-3) is designated
6,9,12,15-18:4. This latter notation will be used in particular in the case of
non-methylene-interrupted fatty acids (NMI FA), such as 7,13,17-20:3 shown
above, the most commonly encountered among these being the dienoic acids
(NMID) (Fig. 1, bottom).
The configuration of double bonds, generally assumed as cis (Z) in natu-
ral compounds, must be indicated in other cases. The positions of a methyl
branch or another group is indicated by the number of the carbon atom
on which the chain is substituted (e.g. 10-methylhexadecanoic acid or
simply 10-Me-16:0; 2-hydroxydocosanoic acid or 2-OH-22:0 ; 6-bromo-5,9-
heptacosadienoic acid or 6-bromo-5,9-27:2).
3
Fatty-acid biosynthetic pathways in primary producers
The basic processes of FA biosynthesis are summarized in Fig. 2. The de novo

biosynthesis of FA follows the common pathway with major end products
Fig. 1 Examples of numbering and designation of fatty acids (FA)
being mainly 16:0 and also 14:0, 18:0 and 20:0 (also produced by chain elon-
gation) [8].
Then, an aerobic desaturation is catalyzed by the enzyme ∆9-desaturase
to give rise to 16:1(n-7), 18:1(n-9) and 20:1(n-11). Generally, only plants are
capable of biosynthesizing de novo (n-3) and (n-6) PUFA (Fig. 2A). Oleic
acid 18:1(n-9) is the precursor of all (n-3) and (n-6) PUFA. The next double
bonds are introduced to form 18:2(n-6) and 18:3(n-3). Through appropri-
ate desaturations and chain elongations, 18:2(n-6) may be further converted
to 20:4(n-6) (AA), and 18:3(n-3) to EPA. DHA is obtained via C24 PUFA in-
termediates rather than direct elongation of EPA, according to the so-called
Sprecher pathway [21–23]. This biosynthetic scheme is typically observed
in dinoflagellates, in which FA such as 18:4(n-3) and DHA are often dom-
inant. Furthermore, the biosynthetic pathway producing 16:4(n-1) from 16:0
is characteristic of diatoms [8, 24]. The de novo biosynthesis of long-chain
monounsaturated FA (MUFA) typically pronounced in calanoid copepods is
showed in Fig. 2B. Biosynthetic considerations will be developed in detail in
the last part of this review.
4
Marine bacteria and cyanobacteria
Marine bacteria are known for their role in nutrient cycling and the degra-
dation of organic matter [8]. The roles of bacteria in marine food webs has
two aspects, firstly as primary food sources, and secondly as components of
the commensal microbial communities of marine animals [25]. Marine het-
erotrophic bacteria are abundant in sediments and as colonizers of settling
particulate matter following plankton blooms [26]. That observation explains
why the FA composition of marine bacteria has mainly been studied by geo-
chemists [26–29]. Bacteria incorporate FA mainly in PL. Bacterial FA are
Fig. 2 Major pathways of FA biosynthesis in marine algae (a), modified after Gurr & Har-
wood [17] and Cook [18], and herbivorous calanoid copepods (b), modified after Sargent
& Henderson [19] and Kattner & Hagen [20]. Extracted from Dalsgaard et al. [8]
commonly saturated (SFA) and monounsaturated (MUFA), ranging from C10

to C20 , whereas PUFA are quite rare. Bacterial FA biomarkers are typically
odd-numbered, branched trans-unsaturated and cyclopropyl FA such as 15:0,
17:0, iso- and anteiso-branched SFA and MUFA, 10-methyl-16:0 ([8] and ref-
erences therein).
Furthermore, deep-sea bacteria and several bacterial strains (Pseu-
domonas, Vibrio) have been shown to be capable of producing (n-3) PUFA,
as recently reviewed [24, 25, 30–32]. Very little is known about the biosyn-
thesis of PUFA in bacteria. EPA and DHA in bacteria are contained within
phospholipids rather than TAG. Therefore, marine bacteria seem to be of
limited use as a source of oils rich in (n-3) PUFA [24]. (see the chapter entitled
“Promising sources of marine LC-PUFA”)
Cyanobacteria, a class of photosynthetic prokaryotes occurring in the phy-
toplankton, produce C18 PUFA esterified to polar lipids, but they do not
biosynthesize EPA or DHA [24]. EPA production was obtained by a trans-
genic marine cyanobacterium carrying a plasmid containing the essential
open reading frames for EPA synthesis [33].
Fig. 3 Malingamide G and its potential precursor 7-methoxy-dodec-4-enoic acid
Fatty-acid amides are widespread in nature [34]. They are incorporated

into some lipid classes such as ceramides, glycosphingolipids and various N-
acylated lipid molecules. A new diacylgalactolipid was isolated from the ma-
rine cyanobacterium Oscillatoria sp. comprised of 9,12-octadecadienoyl and
4-hexadecenoyl chains [35]. Cyanobacteria of the genus Lyngbya are a rich
source of bioactive secondary metabolites including fatty-acid amides [36].
A series of biologically active malyngamides has been identified from marine
cyanobacteria with a mid-chain methoxylated fatty acyl chain [37–40]. As an
example, Malyngamide G and the new 7-methoxydodec-4(E)-enoic acid (its
possible precursor) were isolated from Lyngbya majuscula collected off the
French Mediterranean coast (Fig. 3).
Both these compounds are non-cytotoxic to KB cells and show immuno-
suppressive activity [39]. In several other malyngamides, the fatty-acid amid
is 7-methoxy-tetradecen-4-enoic.
5
Phytoplankton
Primary producers provide the basic FA patterns in marine food webs. They
consist of macroalgae and phytoplankton, which mainly comprise microalgae
and photoautotrophic bacteria. Phytoplankton in the pelagic environment
comprises mainly Bacillarophyceae (diatoms), Dinophyceae (dinoflagellates)
and Prymnesiophyceae. Algal FA are biosynthesized in the chloroplasts com-
prising the thylakoid membranes, and are chiefly esterified to glycolipids
rich in (n-3) PUFA. During the exponential growth phase of phytoplankton
blooms, carbon fixed through photosynthesis is allocated to growth and cell
division rather than lipid storage. Therefore, the level of glycolipids is partic-
ularly high in this phase, and the proportion of (n-3) PUFA can reach 50%
of total lipids [8, 14, 41, 42]. It is well known that plants are usually the only
organisms that can biosynthesize de novo the acids 18:2(n-6) and 18:3(n-3).
These FA and their principal derivatives (e.g. AA, EPA and DHA) are essential
constituents of heterotrophic organisms. Thus, algae occupy a central pos-
ition within marine food webs.
As shown in a recent review, FA patterns can be used as potential taxo-
nomic markers regarding the presence and combinations of certain FA that
can be characteristic of particular algal classes, whereas individual FA can-

not be used as indicators of particular algal species [43]. This approach has
been developed in the case of diatoms and dinoflagellates, two important
classes in marine
environments.
Thus, high values of 16:1(n-7)/16:0 (typically
> 1), and C16 / C18 have been associated with a dominance of bacil-
lariophytes
[28, 29, 44]. Furthermore, high values of 18:5(n-3)/18:3(n-3) and
(C18 PUFA, C22 PUFA) have been associated with dinophytes [45]. Bacil-
lariophytes
can be distinguished from dinophytes by means of high values of
C16 / C18 together with low values of 18:5(n-3)/18:3(n-3) [45]. This crite-
ria can be reinforced by the examination of the ratio 22:6(n-3)/20:5(n-3) [28].
A value ≥ 1 indicates a predominance of dinophytes, while a value < 1 indi-
cates a predominance of bacillariophytes. The lipids of diatoms, characterized
by high levels in EPA and the absence of DHA, are also rich in C16 PUFA [24].
If investigations of FA isolation and purification have principally been
carried out on (n-3) PUFA, there are other potentially interesting FA com-
mercially unavailable. Thus, the acids 16:3(n-4), 16:2(n-4) and 16:2(n-7) were
isolated as methyl esters by means of liquid chromatography using a porous
graphitic-carbon phase [46].
The taxonomy of the Raphidophyceae is still uncertain and needs the help
of chemotaxonomic data, such as FA composition, in order to distinguish
correctly the genera [45–49]. The FA compositions of twelve raphidophyte
strains were established and were very similar to previous data [47]. The
major PUFA were EPA (14.8–24.5%) and 18:4(n-3) (12.0–26.6%, with an ex-
ception at 0.3%) [49]. High levels of free FA were observed in lipids of Fibro-
capsa species (23.6–37.9%). FA profiles allowed clear discrimination between
the genera. By using a selected EPA-deficient mutant of Porphyridium cruen-
tum, it has been demonstrated that TAG of the red microalga P. cruentum can
contribute to the biosynthesis of eukaryotic galactolipids [50]. FA biomark-
ers were used to investigate the biogeochemistry of a former blue-mussel
aquaculture site and the high levels of PUFA found indicated a substantial
phytoplankton source (diatoms and dinoflagellates) [29]. FA composition of
toxic microalgae have been determined to detect useful biomarkers in screen-
ing seawater seafood samples [51]. Two Pseudo-nitzschia species were studied
and both displayed similar FA compositions typical of diatoms, including
16:1(n-7), 16:2(n-4) and EPA as major unsaturated FA. 16:4(n-1) occurred in
both species and therefore could be used as a signature compound in differ-
entiating toxic Pseudo-nitzschia from other diatoms [51]. Furthermore, the
possibility of using boiling water to deactivate lipolytic enzymes, as previ-
ously found [52], was confirmed, and it was suggested that some mechanisms
of PUFA degradation was also inhibited [51].
The FA compositions of microalgae have been shown to change in re-
sponse to changes in salinity. Green unicellular microalgae of the genus
Dunaliella are known for their capability to grow at high salinities up to
salt-saturated water [53]. The major unsaturated FA in two Dunaliella iso-
lates originating from Antarctic hypersaline lakes were 16:4(n-3), 18:3(n-3),

18:2(n-6), 18:1(n-9) and 16:1(n-7). The results suggest that the appropriate
environment necessary for the growth of these halophilic species is a certain
level of osmotic pressure in the medium [53].
High levels of DHA are noticeable in the lipids of the Dinophyceae, an-
other major component of marine phytoplankton, together with significant
amounts of EPA, 18:5(n-3) and 18:4(n-3) [24, 54]. Thus, it seems possible
that dinoflagellates are capable of synthesizing DHA through the chain-
shortening of 24:6(n-3), since a similar mechanism could produce 18:5(n-3)
from EPA [24]. The presence of EPA and also DHA and 18:5(n-3) has been
linked to potential toxicity in a raphidophyte Heterosigma as well as in a di-
noflagellate Gymnodinium [55, 56]. It was suggested that the mode of action
in the ichthyotoxicity of these harmful bloom-forming flagellates is corre-
lated to oxygen radical formation [49]. Two Gymnodinium species and several
other dinoflagellate species were found to contain unusual octacosapolyenoic
FA, namely 28:7(n-6) and 28:8(n-3) at levels up to 2.2% of total FA [57]
(Fig. 4).
VLC-PUFA have also been found in some autotrophic and heterotrophic
lower organisms such as microalgae, fungi, sponges and bacteria [59],
and most of them are either saturated or monounsaturated. Such FA were
identified in Baltic herring, namely 28:7(n-3) and 28:7(n-6) [58]. Further-
more, the two Prorocentrum species studied were found to contain 18:4(n-3)
(12.7–15.3%), 18:5(n-3) (36.4–37.6%) and DHA (18.3–22.0%) [57, 58]. 28:8
(n-3) was also identified in a commercially available oil, used as dietary sup-
plements of PUFA for humans, from the heterotrophic dinoflagellate Crypte-
codinium cohnii [60]. Furthermore, these unusual octacosapolyenoic FA also
occurred as minor components in lipids of all five dinoflagellates studied for
fatty acid and sterol compositions [57]. The major unsaturated FA were as
followed: 18:4(n-3) (2.5–11.5%), 18:5(n-3) (7.0–43.1%), EPA (1.8–20.9%) and
DHA (9.9–26.3%). A new ceramide isolated from the epiphytic dinoflagellate
Coolia monotis bears a novel fatty acyl moiety, namely 2-hydroxy-15-methyl-
3-octadecenoyl [61] (Fig. 5).
The fatty acid composition of polar lipids and TAG was determined in
different types of symbiotic dinoflagellates isolated from several hermatypic
corals from a fringing reef in Japan [15]. 18:4(n-3) (10.0–26.2%) and DHA
Fig. 4 Octacosapolyenoic FA from dinoflagellates

Fig. 5 New ceramide from the dinoflagellate Coolia monolis
(10.6–17.8%) were found as major PUFA in polar lipids of symbiotic di-

noflagellates isolated from all species studied. In addition, polar lipids of
dinoflagellates from Millepora intricata were different from those originating
from other corals in that they contained high amounts of 18:5(n-3) (8.7%) and
22:5(n-6) (10.3%). It was suggested that FA might provide useful information
on possible taxonomic differences among symbiotic dinoflagellates [15].
6
Macroalgae
FA in marine algae have attracted considerable attention among researchers

because they can produce significant amounts of interesting PUFA and
provide useful distinguished features of chemotaxonomic value [62]. The
data available on lipids from macroalgae have been reviewed recently [8].
Three classes are mainly concerned: Chlorophyceae, Rhodophyceae and
Phaeophyceae. FA from 11 macroalgae from the French Brittany coast were
studied [63]. More recently, Li et al. [62] reported the FA compositions of
22 species of marine macrophytes, collected from the coast of the Bohai Sea
belonging to the three aforementioned algal classes. These algae have FA pat-
terns typical of red, brown and green algae from other regions. In general,
red algae from the Bohai Sea contained high levels of C20 PUFA, primarily
that of EPA (up to 37.5%) and AA (up to 29.4%). The main difference in the
FA compositions between red and brown algae was that the latter were richer
in C18 PUFA, especially in 18:4(n-3) (up to 20.1%). Seven of the teen brown
algal species studied also contained EPA as a major component, account-
ing for 8.4–24.2%. Green algae studied had the highest level of C18 PUFA,
mainly 18:3(n-3) (20.5–27.2% of total lipids) and 18:4(n-3), and the lowest
level of C20 PUFA [62]. Interestingly, another study of FA composition of
19 species of the same algal classes, collected on the Pacific coast of North
California gave rise to very similar conclusions [64]. Red Californian algae
contained AA (5.3–23.4%) and EPA (27.8–45.4%). Brown algae contained
18:4(n-3) (3.6–18.6%) and EPA (3.1–15.5%). Two of the three green algae
studied contained 16:4(n-3) (13.6–16.2%) and 18:4(n-3) (12.1–22.1%). Both
these studies show that red, brown and green algae have distinguished FA
Fig. 6 New methoxylated FA from lipids of Schyzimenia dubyi
profiles that do not depend on the geographical location of the algae and that
have a chemotaxonomic significance for seaweeds [62, 64]. A recent compar-
ative study of FA composition of Arctic and Antarctic macroalgae considered
their use as indicators of phylogenetic and trophic relationships [65]. Several
eicosanoids, metabolites of AA, such as hydroxytetraenoic acids, associ-
ated with prostaglandins, were identified in a Japanese red alga Gracilaria
asiatica [66].
Methoxy FA are not very widespread in nature [67, 68]. Several mid-chain
methoxy FA have been reported only in certain microorganisms and marine
cyanobacteria (genus Lyngbya), as seen above. Four novel mid-chain methoxy
FA (16% of total acid mixture) were identified in lipids from a red alga as
9-MeO-15:0, 9-MeO-17:0, 13-MeO-21:0 and 15-MeO-23:0 acids [69], as de-
picted in Fig. 6.
These algal lipids contained C14 -C28 SFA, accounting for 77%, and hydrox-
ylated FA, but no PUFA. Furthermore, marine sponges have provided new
2-methoxy long-chain acids that will be presented in a following chapter.
7
Zooplankton
During the last decade, zooplanktonic organisms from Arctic and Antarc-
tic waters have given rise to intense research, especially on lipids [70–90].
These investigations have highlighted the general lipid characteristics in
high-latitude zooplankton communities, such as copepods and ctenophores,
in terms of food webs and biomarkers. The Southern Ocean has a com-
plex food web including planktivorous herbivores (krill, salps, copepods) that
are fed upon by fish, squid, seals and whales [83, 87]. Krill (Euphausia su-
perba) provide 30–90% of the diet for these carnivores and have an estimated
standing stock biomass of 200–400 million metric tons. This high biomass re-
flects krill’s ability to adapt to marked seasonality in food supply. Krill are
primarily herbivores feeding on phytoplankton in the summer. In the win-
ter krill feed mainly on ice algae [87, 89]. Krill lipids have been intensively
studied because of their commercial interest and undisputed importance in
the Southern Ocean, while the importance of gelatinous organisms, such as
salps, ctenophores and medusae, is now recognized in marine pelagic ecosys-
tems.
As the best-studied group of zooplankton with respect to the FA trophic-
markers concept, herbivorous calanoid copepods have been mainly exam-
ined. They dominate the zooplankton biomass in high-latitude ecosystems
and accumulate large lipid reserves. In addition, the FA characteristics of om-
nivorous and carnivorous copepods have been summarized, especially using
FA as markers of carnivory [8]. Moreover, calanoid copepods are themselves
important producers of specific FA and fatty alcohols (from wax esters). They
play an important role in polar food webs and provide higher trophic levels
with a lipid-rich high-energy diet [71]. However, similarities and differences
between species emerge more clearly if the major lipid classes are analysed
separately to determine their compositions. Phospholipids and the storage
lipids (TAG and wax esters) are expected to exhibit strong compositional dif-
ferences, which may provide additional information on their structural and
energetic functions [71].
The compositions of wax esters, TAG and phospholipids in nine Arctic
and Antarctic copepods have provided evidence of energetic adaptations with
similarities and differences between the species [71]. The wax esters of the
herbivorous species were clearly characterized by the long-chain monounsat-
urated FA 20:1(n-9) and 22:1(n-11), whereas the omnivorous and carnivorous
species usually had high relative amounts of 18:1(n-9). The phospholipids
contained very high levels of PUFA, especially 22:6(n-3). The phospholipid
FA compositions in both Arctic and Antarctic species were found to be very
similar. This extremely high degree of unsaturation (EPA and DHA together
accounted for 46–60% of the total phospholipid FA) is quite unusual. In a re-
cent investigation, the variation in the FA content was related to the spatial
distribution of krill and the available diet as well as to maturity and sex [83].
E. superba are known as essentially herbivores when phytoplankton is abun-
dant, but they can be omnivorous if algal biomass becomes relatively low.
Three regionally groups of krills were considered. Krills from one group,
almost exclusively juveniles, were surviving in the region characterized by
lowest algal biomass and had probably resorted to carnivory on PUFA-rich
copepods [83]. The latter krill had unusually high level of PUFAs, mainly
18:4(n-3), EPA and DHA. Changes in lipid composition of the Antarctic E. su-
perba were investigated regarding the influence of geographical location, the
sexual maturity stage and the distribution among organs [73].
Lipid metabolism of E. crystallorophias and its ecological implications have

been studied because this euphausiid is the dominant krill species in high-
Antarctic waters. Thus, it has to cope with the most extreme environmen-
tal conditions of all euphausiids [76]. Wax esters were the primary storage
lipids and accounted for up to 55.6% of total lipids, including 18:1(n-9) and
18:1(n-7) as major components (together up to 90% of total wax esters acids).
16:0, EPA, DHA and 18:1(n-9) were the major phospholipid FA components.
Little is known about lipids and FA of a member of gelatinous zooplank-
ton, the salps (Tunicates). The pelagic tunicate Dolioletta gegenbauri is abun-
dant in the North Atlantic and occurs in frequent blooms [74]. Polar lipids
were the dominant lipid classes. The FA composition was largely dominated
by EPA (13–14%) and DHA (27–30%).
8
Marine invertebrates
8.1
Sponges
Marine sponges are the most primitive multicellular animals and contain
many new metabolites, including lipids, in particular glycolipids and phos-
pholipids [91–97]. Thus, sponge lipids are one of the richest source of un-
usual FA. Sponges are very ancient animals with special structural features in
their cell membranes, in particular phospholipid FA and sterols, since sterol–
phospholipid interactions are assumed to play a major role in cell mem-
branes [91–93]. Furthermore, sponge classification needs to be supported by
chemotaxonomic criteria, in particular regarding FA. Recently, a comprehen-
sive taxonomy was published, which provides the state of the art [16]. Marine
invertebrates, e.g. sponges, are filter feeders and consequently they can be as-
sociated with microorganisms. Thus, particular FA appear as biomarkers for
such organisms. It has been chosen here to focus on the most unusual recent
data, such as unsaturated or branched patterns.
8.1.1
∆5,9 fatty acids
Major sponge phospholipid FA include very low amounts of the usual

methylene-interrupted PUFA, or none at all, but high levels of very-long-
chain acids (C23 to C34 , representing up to 80%); these are the so-called
demospongic acids. Sponges (Demospongia) are a source of novel FA struc-
tures, especially unusual long-chain ∆5,9 FA with no counterpart in the
terrestrial world, with sometimes a third double bond or a bromine atom [93,
96–102]. In each set of sponge phospholipids studied, about 50 to 70 FA were
identified. Some sponges contain up to fifteen ∆5,9 FA in their phospholipids

and, in several cases, one of them accounted for more than 50% of the total
phospholipid FA mixture [99, 102]. Such NMI FA are showed in Fig. 7.
Approximately twenty ∆5,9 unsaturated FA were found in these
sponges [102]. It is generally admitted that ∆5,9 demospongic acids are
biosynthesized by Demospongiae through short-chain unsaturated FA,
mainly from exogenous ∆9-16:1 [93]. The sponge Geodinella robusta was
very interesting in that it contained an unusually high level of free FA, mainly
with ∆5,9 unsaturation, including the rare anteiso-5,9-24:2 acid (19.5% of the
total free FA), and the new iso-5,9-24:2 acid (30%) [103]. Mixtures of these
latter compounds showed cytotoxic activity against mouse Ehrlich carcinoma
cells and a hemolytic effect on mouse erythrocytes [103]. The FA of total
lipids from Halichondria panicea included ∆5,9,19-26 a major component
(33%), and six other ∆5,9 FA [104]. Several common PUFA, such as AA, EPA
and DHA, occurred in this sponge. The 5,9,23-triacontatrienoic methyl es-
ter, isolated as a natural compound by bioassay-guided fractionation from the
marine sponge Chondrilla nucula, is an elastase inhibitor with the potential to
be a therapeutic agent in some diseases such as pulmonary emphysema and
chronic bronchitis [105]. The 5,9,21-30:3 sponge acid was reported as a DNA
topoisomerase inhibitor [106].
Brominated FA from marine invertebrates have also been reviewed [100].
Recently, a comprehensive review of natural halogenated FA included those
from marine algae and invertebrates [36]. Cinachyrella sponges from the
Red Sea also contained three 6-brominated acids with the new 6-bromo-5,9-
nonacosadienoic [102]. 6-Bromo-5,9,24-27:3 and 6-bromo-5,9,24-28:3 acids
have been isolated from the sponge Xestospongia sp. [107, 108]. It should
be noted that the latter FA, and the 6-bromo-5,9-heptacosadienoic acid, dis-
played moderate activity against murine leukaemia L1210 cells and against
human carcinoma KB cells [108].
Nevertheless, it was demonstrated that sponges are not the only source
of these unusual ∆5,9 FA since they have been observed in zoanthids and
sea anemones [109, 110], gorgonians [100, 111]. Thus, the novel iso-5,9-
pentadecadienoic acid was isolated from Eunicea succinea and prepared by
synthesis [111]. In addition, new 6-bromo-5,9-eicosadienoic acid was identi-
fied from an anemone and a zoanthid [110].
Fig. 7 ∆5,9 fatty acids from Cinachyrella sponges

Fig. 8 Irciniasulfonic acid from Ircinia sp.
A novel FA analogue, named irciniasulfonic acid, has been isolated from

the Japanese marine sponge, Ircinia sp. Its structure consists of three differ-
ent kinds of acids, i.e. common FA, a novel unsaturated branched C10 FA and
an isethionic acid. Irciniasulfonic acid and deacyl irciniasulfonic acid reverse
multidrug resistance in human carcinoma cells caused by overexpression of
membrane glycoprotein [112] (Fig. 8).
8.1.2
Branched fatty acids
Branched FA including isoprenoid acids have often been found in marine

sponges. The main isoprenoid FA are 4,8,12-trimethyltridecanoic and phy-
tanic acids [95, 96, 101, 102]. As a recent example, phospholipid FA of two
sponges of the genus Cinachyrella from the Red Sea were studied and com-
pared with previous results for other Cinachyrella sponges [102]. Five SFA not
hitherto found in nature were identified, namely 17-methyl-24:0, 18-methyl-
24:0, 18-methyl-25:0, 18-methyl-26:0 and 18,24-dimethyl-26:0 acids [102]
(Fig. 9).
The rare 10,13-dimethyl-14:0 and the new 9,13-dimethyl-14:0 were identi-
fied in marine sponges [102, 114]. The occurrence of bacteria in sponges is
supported by the huge levels of phosphatidylglycerol and phosphatidylinos-
itol that are characteristic of bacterial membranes [93]. In addition, several
branched short-chain FA were identified, which are typically of bacterial
origin, such as iso- and anteiso-15:0, iso- and anteiso-17:0, 10-methyl-16:0,
13-methyl-16:0, 10-methyl-18:0, and 11-methyl-18:0 acids. The new branched
long-chain acids probably arise from shorter precursors of exogenic origin
through a homologation process [102]. Other sponges were found to be rich
in such branched FA, including additional branched FA, 3-methyl branched
short-chain acids and the new 8,10-dimethyl-16:0 acid [101, 115–117]. The
lipids of the sponge Hymeniacidon sanguinea from the Black Sea contained
73 FA, including the novel 13-methyl-20:0, 15-methyl-22:0 and 3,13-dimethyl-
Fig. 9 New long-chain branched FA from Cinachyrella sp.
14:0 [116]. The compositions of lipids in this sponge collected from two
locations with different ecological conditions (Canary Islands and Black Sea)
were compared [94, 116]. The significant differences in the structures and
relative concentrations of the typically bacterial FA, and the occurrence of
cyclopropane-containing FA only in the Canary Islands sponge, suggests that
the symbiotic bacteria in the two species are different [116].
A most interesting finding in Callyspongia fallax was a series of iso mo-
noenoic branched-chain C15 -C17 and double bonds at either ∆4, ∆5, ∆6, ∆7,
or ∆9 [117]. The lipids of the stromatoporoid Astrosclera willeyana (a “liv-
ing fossil” sponge) and the demosponge Agelas oroides contained complex
isomeric mixtures, at large amounts, of branched FA including iso-/anteiso-
branched FA and abundant mid-chain branched acids present in the C15
to C25 range. These compounds are most likely derived from specific het-
erotrophic bacterial symbionts [118].
8.1.3
Methoxylated fatty acids
Methoxylated FA are relatively rare in nature and limited to primitive or-

ganisms such as cyanobacteria, bacteria and sponges [66, 101, 117, 122]. The
first naturally occurring α-methoxylated FA were found in phospholipids
from the sponge Higginsia tethyoides, which contained saturated, monoun-
saturated and diunsaturated α-methoxylated FA with chain lengths between
19 and 28 carbon atoms [121, 122]. Methoxylated lipids have been recently
reviewed with an emphasis on the alkylglycerol ethers and FA bearing
the methoxy group in the alkyl chain [119]. In that recent review, 29 α-
methoxylated acids were listed [67]. These phospholipid α-methoxylated FA
share the common molecular properties of possessing the R configuration
at the chiral center [123]. While the first very-long-chain α-methoxylated
FA (C19 –C28 ) could have arisen from sponge cells, recent examples of short-
chain analogs (C14 -C18 ) are postulated to originate from bacteria in symbiosis
with sponges. A novel series of α-methoxylated FA have been reported from
Caribbean sponges from the genera Amphimedon, Callyspongia and Sphe-
Fig. 10 Some α-methoxylated FA identified in Caribbean sponges
ciospongia (Fig. 10) [122, 123]. Various syntheses of methoxy FA have been
performed [124].
8.1.4
Acetylenic fatty acids
Acetylenic FA have been found in sponges [125, 126]. Brominated C16 , C18 ,
and C20 acetylenic FA have been reported from sponges of the genera
Xestospongia and Oceanapia [127]. An already known brominated acetylenic
acid was isolated from the sponge Xestospongia testudinaria by bioassay frac-
tionation (A1 adenosine receptor affinity), as shown in Fig. 11 [128].
This FA was the active compound. Two novel steryl esters with bromo-
acetylenic chains that were also isolated were found to be inactive. A C14
acetylenic acid from the sponge Oceania sp. showed significant antimicro-
bial activity against various bacteria and fungi (Fig. 12a) [129]. Recently, new
acetylenic FA from the Steletta sponge species exhibited weak cytotoxicity
against a human leukemia cell line [130] (Fig. 12b). The second compound
from Stellata is a symmetric dimer of the first, and is the first example of
a sponge metabolite possessing an acid anhydride functionality (Fig. 12b).
In a recent work, a sulfated C24 acetylenic FA, namely callysponginol
sulfate A, was isolated by bioassay-guided fractionation from the Japanese
sponge Callyspongia truncata (Fig. 13) [131].
Callysponginol sulfate A is the first example of an acetylenic acid con-
taining a sulfate group from marine organisms. These compounds inhib-
ited membrane type 1 matrix metalloproteinase (MTP1-MMP), one of the
key enzymes involved in tumor growth, migration, angiogenesis, invasion
and metastasis [131]. Recently, new lysophosphatidylcholines and monoglyc-
erides were reported from Stelletta, which include acetylenic fatty acyl chains
and dimethyl branched chains [132].
Fig. 11 Biologically active FA from Xestospongia testudinaria

Fig. 12 New acetylenic FA from (a) Oceanapia and (b) Stellata
Fig. 13 Callysponginol sulfate A from Callyspongia truncata
Ceramides have received increasing interest because of their various prop-

erties, including antifungal and antimicrobial activities. Recently, several new
ceramides have been isolated from various marine sponges including Hali-
clona tenuiraniosa (Fig. 14A) [133, 134]. They contain the usual saturated C20
to C26 fatty acyl chains. Biofouling organisms such as barnacles, mussels and
macroalgae cause serious damage to ship’s hulls and aquaculture nets. Thus,
it is very important to identify nontoxic alternatives to the organotin com-
pounds currently used. The sponge H. koremella provides a new ceramide
with activity as an antifouling substance against macroalgae (Fig. 14B) [133].
This work showed that the length of the acyl residue seems to be import-
ant for the antifouling activity of ceramides. Recently, a mixture of ceramides
has been isolated from the red alga Ceratodictyon spongiosum containing the
symbiotic sponge Sigmadocia symbiotica [135]. Their non-hydroxylated acyl
chains ranged from C22 to C24 . In addition, a unique 24-methylenecholesteryl
ester (19:0) was characterized in these organisms.
Glycosphingolipids (GSL) are ubiquitous membrane constituents in ani-
mals that play fundamental roles in major phenomena such as cell–cell recog-
nition and antigenic specificity. GSL from marine sponges possess interesting
immunostimulatory and antitumor activities [9–11, 136–141]. Sponges are
a very rich source of new glycolipid structures [9–11, 139–141]. Two glycol-
ipids were isolated from the sponge Pseudoceratina sp.: a galactosyl diacyl-
Fig. 14 Ceramides from the sponges Haliclona tenuiraniosa (a) and H. koremella (b)
glyceryl, and an alkylacylglycerol linked to a five-membered cyclitol, with

common fatty acyl chains ranged from 14:0 to 18:0 [142]. Ectyoceramide, the
first natural hexofuranosylceramide has been isolated from Ectyoplasia ferox
in a pure form, instead of a complex mixture as is usually found [11]. The
FA attached to the amino group is a 2-hydroxylated anteiso-16:0. It has been
demonstrated that a change in the stereochemistry of the glycosidic linkage
from the usual β to the quite rare α configuration can affect their biologi-
cal activity. Thus, α-glycosyl GSL, such as the natural Agelasphines and their
synthetic derivative KRN7000 [143–145], are immunomodulating and anti-
tumor compounds. Not all sponge glycolipids are GSL and a great variety of
structures is observed.
These compounds stimulated the microtubule polymerization at 10 ◦ C.
The investigation of glycolipids from the Caribbean sponges allowed the
isolation of Plakosides A and B from Plakortis simplex [10] (Fig. 15), and
Plakosides C and D from Ectyoplasia ferox [140] (Fig. 15). These glycolipids
are among the most fascinating lipids isolated from marine organisms. They
have a unique structure with a prenylated galactose and two cyclopropanyl
alkyl chains. The Plakosides had the same α-hydroxylated C22 fatty acid amid
with a cyclopropane at the C11–C12 positions. As the sponges are taxonom-
ically distant, it is possible that these unusual glycolipids may originate from
bacteria. Plakosides A and B are immunosuppressants that act through a non-
cytotoxic mechanism [9, 10].
Crasserides, and their minor associated compounds isocrasserides, are
widely distributed in marine sponges, and are considered to be glycolipids
although their sugar unit is replaced by an unusual five-membered cycli-
tol [146] (Fig. 16).
The cyclitol is linked to the glycerol with an O-3 ether bond. Also linked to
the glycerol are an O-1 alkyl group and an O-2 acyl group. Furthermore, var-
ious fatty acyl chains are present including mid-chain branched chains. The
Italian group has found crasserides in all sponges whose glycolipids have been
studied.
Fig. 15 Plakosides A and B from Plakortis simplex, and Plakosides C and D from Ectopla-
sia ferox
Fig. 16 An example of an isocrasseride isolated from Plakortis simplex
8.2
Coelenterate – Cnidaria
Representatives of the Coelenterate phylum have remarkable peculiarities in

their FA composition. Some species contain unusual FA or unusual concen-
trations of common components. Thus, large amounts of tetracosapolyenoic
acids, namely 24:6(n-3) and 24:5(n-6), were found in different orders of
the Octacorallia subclass of Anthozoa [147]. Gorgonian corals are of in-
terest since some of these invertebrates are known sources of methylene-
interrupted PUFA, in particular of the (n-3) and (n-6) series [148, 149]. The
gorgonian specimens harvested in colder waters contained high amounts of
methylene-interrupted PUFA, unlike specimens from warmer waters. This
could have been due to the temperature or to the high content of wax es-
ters. Nevertheless, arachidonic acid, a major component in all FA mixtures
studied (14–21%), is a well-known precursor of prostanoid compounds.
The high levels of tetracosapolyenoic FA in specimens from colder waters
were of particular interest: 24:6(n-3) (5.1–5.3%), 24:5(n-6) (8.4–15.8%) and
24:5(n-3) (5.0–5.2%) [149]. An analysis of four gorgonians from the genus
Pseudopterogorgia revealed that the main PUFA are 18:3(n-6), 18:4(n-3), AA,
DHA, 24:5(n-6) and 24:6(n-3), with the (n-6) PUFA predominating [150].
All five gorgonians of the genus Eunicea presented a similar phospholipid
FA composition with unsaturated acyl chains from C18 to C24 , as shown
below in Table 1 [151]. 2-Hydroxy long-chain acids also occurred in these
gorgonians. Several 2-hydroxy FA have been identified before in marine
sponges [152, 153].
The phospholipid FA composition of the Caribbean gorgonians Gorgonia
mariae and Gorgonia ventalina (Gorgoniidae) was investigated [154]. This
study reports that the main FA were 14:0, 16:0, 18:3(n-6), 18:4(n-3), 18:2(n-6),
AA, DHA and 24:5(n-6), as shown in Table 2. In both gorgonians (n-6) PUFA
predominated over the (n-3) family. In addition, Table 2 gives data for other
gorgonians of the family Gorgoniidae [150].
Table 1 Principal unsaturated FA in phospholipid from gorgonians of the genus Eu-

nicea [151]
Fatty acid Eunicea sp. E. fusca E. laciniata E. mammosa E. succinea
18:4(n-3) 24.6 16.6 7.5 7.6 15.2

18:3(n-6) 18.0 15.8 17.0 9.8 10.2
18:2(n-6) 0.7 1.5 4.9 1.3 1.5
18:1(n-9) 4.2 9.6 2.4 1.0 2.2
20:5(n-3) 1.3 1.5 3.1 1.3 1.5
20:4(n-6) 12.4 12.4 13.5 15.7 11.5
22:6(n-3) 5.1 6.3 4.2 3.5 6.2
24:5(n-6) 3.8 1.5 2.5 14.2 3.9
24:6(n-3) 0.6 0.4 1.4 2.9 2.7
Several species also contained 2-OH-20:0 and 2-OH-22:0 acids up to 5% of total FA PL.
All species contained the new (Z)-7-Me-16:1(n-10) and (E)-7-Me-16:1(n-10) (0.5–2%)
Within the experimental errors, all of these gorgonians share a similar

phospholipid FA profile, in as much as: 1) they all biosynthesize, in a similar
ratio, the acids 24:5(n-6) and 24:6(n-3), with the former predominating, 2) the
(n-6) family of FA predominates over the (n-3) family, and 3) the polyunsatu-
rated FA DHA and AA are key FA in these gorgonians. Several new branched
unsaturated FA occurred in gorgonians [149–151]. The New Caledonian gor-
gonian Rumphella aggregata also contained 24:5(n-6) (11%), NMID FA, and
unusual short branched-chain unsaturated acids [155].
Table 2 Main phospholipid unsaturated fatty acids of gorgonians from the family Gor-
goniidae
Fatty acids Gorgonia mariae Gorgonia ventalina Pseudopterogorgia∗
18:3(n-6) 10.6 15.8 7.3

18:4(n-3) 10.8 16.4 12.0
18:2(n-6) 8.6 10.3 4.6
18:1(n-9) 5.0 4.0 3.0
20:4(n-6) 10.0 9.4 17.2
20:5(n-3) 6.4 1.2 0.2
22:6(n-3) 5.6 8.6 6.1
22:4(n-6) 2.2 0.3 –
24:5(n-6) 4.0 1.4 10.2
24:6(n-3) 2.0 0.4 3.7
∗ average of 4 Pseudopterogorgia species
(Z)-7-Me-16:1 n-10 and (E)-7-Me-16:1 n-10 occurred at 0.8–3.5%
2-OH-21:0 and 22:0 acids were identified at < 1%
An interesting investigation on the FA composition of solar coral Heliopora

coerulea (Octocorallia, Helioporacea) supported a chemotaxonomic signifi-
cance of tetracosapolyenoic acids in Coelenterates [148]. 24:6(n-3), a tetra-
cosahexaenoic acid, was found in Heliopora coerulea [148]. The major FA
were 16:0 (40–42%) and 18:3(n-3) (15–16%), as shown below.
Table 3 Main fatty acids from total lipids of Heliopora coerulea [147]
Fatty acids % for two samples Fatty acids % for two samples
14:0 4.8–4.8 18:4(n-3) 3.5–3.6

16:1(n-7) 3.1–3.3 18:0 7.3–5.0
16:0 40.9–41.6 20:5(n-3) 5.4–5.5
18:1(n-9) 3.1–3.5 22:6(n-3) 4.7–5.5
18:3(n-6) 15.1–15.8 24:6(n-3) 1.7–1.9
Despite a relatively low content of 24:6(n-3) (2% of total FA), it was con-
cluded that PUFA of regular structure with 24 carbon atoms and five to six
methylene-interrupted cis-double bonds are typical constituents of represen-
tatives of all orders of the Octacorallia, Alcyonaria, Gorgonaria, Helioporida
and Pennatularia. Three novel 10-hydroxydocosapolyenoic acids were iso-
lated from deep-water scleratinian corals, as shown below [156].
Fig. 17 10-Hydroxypolyenoic FA from Madrepora oculata
A work has recently been carried out aimed at elucidating the biosynthe-
sis of docosahexaenoic acid in trout liver microsomes [157, 158]. This report
conclude that the tetracosahexaenoic acids, such as 24:6(n-3), are intermedi-
ates in the biosynthesis of DHA. Therefore, it is very likely that gorgonians
utilize a similar biosynthetic route, thus providing yet another interesting sys-
tem to study this type of biogenesis. However, work still remains to be done
on the role of symbiotic zooxanthellae in the production of some of these
unusual FA.
A survey of lipid and FA composition was made for 15 cnidarians from
Okinawa, Japan [159]. Corals having symbiotic Zooxanthellate within their
cells contain large amounts of lipid in their tissues (24–26% of dry weight).
All specimens contained monoalkyldiacylglycerol and were rich in wax es-

ters and triacylglycerol. Palmitic acid was the most abundant FA component
of these lipid classes (more than 40% in each class), followed by stearic and
oleic acids [159]. Four ceramides with the same hexadecyl acyl chain iso-
lated from a gorgonian exhibited significant human cholesteryl ester transfer
protein inhibitory activity [160].
8.3
Echinodermata
Significant amounts of tetracosapolyenoic acids such as 24:6(n-3) were found

in different marine organisms, echinoderms (Ophiuroidea and Crinoidea)
and coelenterates [147], and in their predators [161]. 24:6(n-3) occurred in
symbiotic and non-symbiotic brittlestars [162]. Isolated from the brittlestar
Ophiura sarsi [163], this FA had anti-inflammatory and anti-allergic proper-
ties similar to those of DHA [164]. Total lipids of this organism contained 14%
of 24:6(n-3), 15% of EPA and 2.6% of DHA [163]. Furthermore, high levels of
EPA and 24:6(n-3) were observed in phospholipids that accounted for more
than 50% of total lipids from O. sarsi. Several novel NMI FA were further iden-
tified in O. sarsi [165], namely 7E,13E-20:2, 7E,13E,17Z-20:3 (13% of total FA),
9E,15E,19Z-22:3, and 4Z,9E,15E,19Z-22:4 acids, as shown below.
Fig. 18 New non-methylene-interrrupted FA from Ophiura sarsi
Other NMI FA also occurred in this brittlestar, namely 5,11-20:2, 5,13-

20:2, 7,13-22:2 and 7,15-22:2. 24:6(n-3) Accounted for about 6%. Structural
analyses of these fatty acids were performed after partial hydrogenation
with hydrazine sulfate and subsequent isolation of the monoenoate products
by argentation thin-layer chromatography, followed by GC/MS analyses of
dimethyl disulfide adducts [165]. A comparison of FA in symbiotic and non-
symbiotic brittlestars from Oban Bay, Scotland, was performed in order to
look for bacterial signals that might indicate contribution of subcuticular bac-
teria to their hosts’ diet [162]. Odd-chained and branched FA were present in
low amounts but palmitoleic and cis-vaccenic acids, also considered as good
markers for bacteria, occurred at much higher amounts in symbiotic species

studied than in the non-symbiotic species. EPA occurred at high levels in all
species studied (11–23%) but DHA was present at low amounts. The unusu-
ally concentrations of 24:6(n-3) (up to 15%) may indicate that DHA derived
from dietary phytoplankton is being elongated to the former [162]. Further-
more, three other tetracosapolyenoic acids and 26:6(n-3) were found in some
species [162].
Three new ceramides from the starfish Acanthaster planci have been re-
ported [166]. Several glycosphingolipids have been identified recently in sea
cucumbers possessing α-hydroxylated or non-hydroxylated, saturated or mo-
noenoic fatty acyl chains [167–169].
8.4
Tunicates
Few works have been published on the lipid composition of tunicates [147,
157, 170, 171]. Lipids of edible ascidian Halocynthia roretzi, very popular in
Japan and Korea, have also been studied [170]. Several studies of phospho-
lipids of pelagic tunicates (belonging to gelatinous zooplankton) have also
been undertaken [171]. PUFA represent the most important class, accounting
for around 50%. The tunicates Eudistoma bituminis and Cystodytes violat-
inctus from the Indian Ocean were investigated for their phospholipid FA
content [172]. In both cases, the most abundant FA were the saturated ones
(C10 to C18 ). Cystodytes violatinctus contained high amounts of oleic acid
(20%). Both E. bituminis and C. violatinctus contained phytanic acid and ∆10
FA, which had not previously been found in such organisms. These tunicates
contained only trace amounts of PUFA, which are usually predominant in this
phylum [172].
8.5
Molluscs
8.5.1
Introduction
Lipids are a very important food reserve, in particular in the oocytes of mol-
luscs, which assures viability of the larvae. Lipids also provide energy for
growth during conditions of limited food supply when carbohydrate levels
(the main energetic reserve in molluscs) are low. Phytoplankton represent
the largest food source for bivalve molluscs and contain a high proportion of
PUFA. The intensive rearing of bivalves still relies on the massive production
of unicellular algae especially for growing young spat, which represent the
largest biomass in a commercial hatchery. The high cost and unpredictable
culture success of algae has inspired the development of artificial diets such
as microcapsules, mixed diets, yeast based diets, lipid microspheres and lipo-
somes to substitute or supplement live algal diets. The importance of lipids
in bivalve nutrition is now well known [173]. The (n-3) PUFA, EPA and DHA,
have been reported to be essential for optimal growth for at least some species
of juvenile bivalves.
The biochemical composition of the intertidal rocky-shore bivalves, e.g.
mussels, is greatly affected by periods of air exposure, at which times the bi-
valves are denied a food source. Consequently, the resulting effect would be
similar to starvation [174].
In coastal environments, detritus, bacteria and zooplankton may greatly
affect available food composition. It is known that organic detritus areas an
energy source for bivalves during periods of scarce primary productivity. Ad-
ditionally, detrital material is a source of saturated and monounsaturated
C14 –C18 FA. A high proportion of SFA, such as 20:0, has been observed in bi-
valves distributed in environments rich in organic material with an abundant
bacterial load [175], compared with those mainly nourished by marine phyto-
plankton, which are dominated by (n-3) PUFA of 18, 20 and 22 carbons. The
lipid composition of molluscs can be affected by external factors, such as fluc-
tuations in the environmental conditions and qualitative and or quantitative
changes in food availability, or by internal factors, such as sexual matura-
tion [175]. Recently, some very interesting investigations have dealt with the
chemical composition and chemotaxonomic of cardiolipids from some ma-
rine bivalves and led to evidence of a tetradocosahexaenoic cardiolipin [176].
8.5.2
Mussels
FA profiles of seeds of the mussel Mytilus galloprovincialis originating from

two habitats (rocky shore and subtidal) were compared after transfer to the
same habitat (subtidal), in order to study the initial levels of different FA of
metabolic importance and their variability [177]. According to previous stud-
ies, PUFA were found to be the group with highest percentage (42–49% of
total FA), including EPA and DHA as major components [177]. Moreover,
these findings concur with recent studies of numerous bivalve species dis-
tributed in other regions of Europe and America, such as Argopecten purpu-
ratus [178] and Crassostrea gigas [179]. Additionally, the mussels of subtidal
origin presented higher initial levels than the rocky-shore mussels with re-
gard to FA characterized by energetic-type functions, such as 14:0, 16:0 and
EPA. High initial levels of some PUFA observed in the subtidal mussels, such
as 18:3(n-3), 18:4(n-3) and EPA, are presumably due to the fact that these
mussels had greater access to phytoplanktonic food. Initial levels of 14:0, 16:0
and 18:0 in the rocky-shore mussels were significantly greater than in the
mussels of subtidal origin. FA characterized by structural-type functions, e.g.
18:0, DHA and NMID FA with 20 and 22 carbons, in rocky-shore mussels
presented higher levels than those of the subtidal mussels. These NMID FA
have been observed in greater proportions in phospholipids, thus implying
a structural-type function [177].
In addition, it is also known that these NMI FA are distributed in
greater quantities in the organs more exposed to the immediate environ-
ment, such as the gills, mantle and foot. In another study, minor NMI FA
were characterized in Mytilus galloprovincialis by GC/MS of their 2-alkenyl-
4,4-dimethyloxazoline derivatives, namely 7,13–16:2, 5,11–20:2, 5,13–20:2,
7,15–22:2, and the new trienoic FA 5,11,14-20:3 and 7,13,16-22:3 [180]. This
discovery supports a biosynthetic route implying the desaturation and sub-
sequent elongation of 20:2(n-6) [180]. Lipid, FA and sterol composition of
the New Zealand green-lipped mussel (Perna canaliculus) and the Tasmanian
blue mussel (Mytilus edulis) have also been reported [181].
8.5.3
Oysters
Seasonal variations of lipid classes and FA in the flat oyster Ostrea edulis have
been studied [182]. The dynamics of FA in the larval development, metamor-
phosis and post-metamorphosis of this oyster have been investigated [183].
The lipid composition of Crassostrea gigas was analysed during the reproduc-
tive phase in natural as well as under artificial conditions [179]. A specific
accumulation of DHA and EPA in the polar lipids was observed under both
conditioning diets. The proportions of DHA and EPA from neutral and polar
lipids of oysters conditioned artificially were significantly lower than of those
that were naturally conditioned. A useful comparison of the lipid class and FA
composition between a reproductive cycle in nature and a standard hatchery
conditioning of the Pacific oyster Crassostrea gigas was performed [179].
8.5.4
Patella
The effects of season and spatial distribution on the FA composition of four

Patella species’ gonads and soft body tissue were evaluated [185]. The re-
sults show that the quantitatively most important FA were 14:0, 16:0 and
18:0; the MUFA 18:1(n-7), 18:1(n-9), 16:1(n-7) and 20:1(n-9), EPA and AA. P.
depressa and P. ulyssiponensis soft-body FA profiles revealed significant dif-
ferences between sexes, with males showing significantly higher percentages
of PUFA, mainly EPA and AA, while in females significantly higher propor-
tions of MUFA were found. The fatty-acid composition of P. depressa gonads
revealed significant differences between sexes. Males showed a significantly
higher percentage of PUFA from the (n-3) and (n-6) series (AA and EPA),
while females were seen to have higher proportions of SFA and MUFA [185].
8.5.5
Clams
Recent studies on clam lipids were concerned with their aquaculture. Thus,
the possible use of emulsions rich in EPA and DHA as an artificial lipid
supplement to live algae was investigated for seed of the Manila clam Tapes
philippinarum [173]. In addition, the influence of the lipid composition of
microalgal diets and cornstarch on the lipid classes and FA of the Rudi-
tapes decussatus spat was studied [186]. This clam species is of commercial
interest in Spanish aquaculture. In order to increase its production, experi-
ments have been carried out with alternative foods to live microalgae, such
as freeze-dried microalgae or cornstarch. The main FA present in the spat of
R. decussatus were 16:0, 18:1(n-9) and DHA, followed by lower contents of
18:4(n-3) and 18:1(n-7). The essential FA EPA is present in small amounts.
The content of (n-3) PUFA, (n-9), (n-6), and 20:2 and 22:2 NMID FA differed
significantly according to the diet supplied. Spat fed on a microalgal diet show
the significantly highest content in (n-3) PUFA and (n-9) FA [186].
8.5.6
Scallops
Overfishing has often resulted in a decline of natural beds of Pecten max-

imus in several areas. Thus, several experiments have been performed on P.
maximus culture, growth and reproduction to improve the biological know-
ledge of this species [187, 188]. Lipids are a very important food reserve in
the oocytes, which assures viability of the larvae. It has been shown that suc-
cess of Pecten maximus hatching is related to the lipid status of the eggs when
spawned. Lipids in the female gonad were analysed for lipid class composi-
tion and FA composition of TAG and phospholipids, and their variations in
relation to gametogenic cycle were studied [184–188]. PUFA were more abun-
dant in the TAG and the series (n-3) was clearly predominant. The principal
(n-3) FA (mainly in phospholipids) showed a seasonal variation clearly re-
lated to the reproductive cycle [188]. Soudant et al [184] have analysed the
composition of polar lipid classes in male gonads of Pecten maximus and the
effect of nutrition. Seasonal digestive-gland dynamics of the scallop Pecten
maximus have been reported [189].
The distribution of lipids and FA in different organs of the Chilean scallop
Argopecten purpuratus broodstock, namely female and male gonads, diges-
tive gland, gills, mantle and adductor muscle, have been investigated [178].
The highest level of (n-3) PUFA (mainly EPA and DHA) was found in the
adductor. The major FA in all parts studied were 16:0, EPA (8.1–20.3%) and
DHA 9.2–25.6%). Similarities between the FA composition of the triglyceride
fraction of the female gonad and the digestive gland (e.g. the high level of 14:0
and 18:4(n-3)) indicated the transfer of lipids from the lipid-rich digestive
gland to the female gonad. A special feature of the gills and mantle was the
presence of high levels of plasmalogens (phosphoglycerides with 1-alkenyl
chains) recognized by the presence of dimethylacetals, which are formed sim-
ultaneously with FAME by acid-catalyzed transmethylation [178]. In another
investigation, dietary supplementation with lipid emulsions during brood-
stock conditioning of A. purpuratus was used to manipulate the fatty-acid
composition of the eggs [187, 190]. The scallops were fed a mixed algal diet
either alone or supplemented with an emulsion rich in ethyl esters of DHA or
EPA. Lipid supplementation resulted in a significant increase of the total lipid
content of the eggs. The EPA and DHA levels in the total and neutral lipids
of eggs from broodstock supplemented with diets including the correspond-
ing emulsions were significantly higher than in eggs from scallops fed solely
algae [190, 191]. NMID FA, which are not present in the phytoplankton, have
been reported in many species of molluscs. Thus, they are presumably synthe-
sized by molluscs. Interestingly, the identification and occurrence of a novel
cis-4,7,10,trans-13-docosatetraenoic acid in the female gonads of the scallop
Pecten maximus was described [192].
Lipid deterioration during frozen storage at – 20 ◦ C of the adductor mus-
cle, the major edible part of the giant scallop, was examined by determination
of fatty chain compositions in the sn-1 and/or sn-2 positions of ether and
ester glycerophospholipids [193]. During storage, the contents of total lipid
and polar lipid decreased but that of non-polar lipid increased. The percent-
ages of PUFA such as EPA and DHA in the total lipid and polar lipid fractions
decreased during storage, but those of the PUFA in the non-polar lipid in-
creased. Changes during storage in alkenyl and alkyl chain compositions of
ether glycerophospholipids and in fatty acyl chain compositions of ether glyc-
erophospholipids were determined [193]. The 20:2 and 22:2 NMID FA also
occurred.
8.5.7
Squids
Biochemical composition changes and FA in several tissues of the squid Illex

argentinus from the South Atlantic Ocean at different sexual stages were
studied. All tissues contained high concentrations of PUFA followed by SFA
and MUFA, e.g.16:0, 18:0, 18:1(n-9), 20:1, 22:1, EPA and DHA. The lipids
also contained unusually high levels of FA of the linoleic family (2–3%). The
digestive gland of the squid is rich in polyenoic FA, EPA and DHA. This tis-
sue could be a cheap raw material, presently discarded, for production of
PUFA [194].
The lipid content and composition of phosphatidylcholine and FA were
determined in tissues of 70 species of teleosts, and in muscle of six species
of squid. Amount and composition of diacyl glyceryl ethers were re-
cently analysed in various tissue lipids of the deep-sea squid Berryteuthis

magister [195].
9
Crustacea
The mud crab Scylla serrata is a commercially important species in the Indo-
Pacific region and has been cited as a target species for a stock-enhancement
program in Japan and also as a target species for aquaculture in many Asian
countries [196]. A recent study evaluated the requirements of linoleic acid
(18:2(n-6)), linolenic acid (18:3(n-3)), EPA and DHA during rotifer, as well
as Artemia feeding on survival and larval development of mud-crab lar-
vae [196]. Decreased natural seed availability and the low survival rate in
crab hatcheries [197–199] have been major problems in increasing aquacul-
ture production. Moreover, Takeuchi et al [197] described the requirement
of EPA and DHA for larval development, where EPA is effective in maintain-
ing survival while DHA plays an important role in accelerating the intermolt
period and produces a wider carapace width in swimming crab larvae. A pre-
vious study showed that the Artemia feeding schedule (in combination with
rotifers) for larval mud crab and their essential FA composition affected the
survival of larvae [199–201].
If the conditions of thermal adaptation are well documented in fish, lit-
tle information is available for marine invertebrates. A comparative study of
the phospholipid FA compositions was conducted with the Baltic Sea am-
phipod crustacean Gammarus spp. collected from different thermal environ-
ments [202]. It was reported that environmental temperature had little effect
on FA composition. In fact, Gammarus was shown to use the same strategy to
control membrane fluidity in the cold as fish species investigated so far [203],
namely the crustacean accumulates sn-1 monoenoic and sn-2 polyenoic phos-
pholipid FA at reduced temperatures.
10
Polyunsaturated FA (n-3) of commercial interest
10.1
Introduction
An “essential” nutrient is one that is needed for normal development and

function of mammalian cells throughout the life cycle. In its active or precur-
sor form there is a minimum amount of such a nutrient that must regularly be
provided in the diet. This dietary requirement generally varies with species,
gender, age and the presence of physiological and pathological challenges

(pregnancy, lactation, infancy, aging, infection, disease, etc.).
The term “essential fatty acid” is ambiguous and inappropriately inclu-
sive or exclusive of many polyunsaturated FA. When applied most rigidly
to linoleate and a linolenate, this term excludes the now well-accepted but
conditional dietary need for two long-chain polyunsaturates (arachidonate
and docosahexaenoate) during infancy. The metabolism of essential and
nonessential FA is clearly much more interconnected than previously under-
stood. Replacing the term “essential fatty acid” by existing but less-biased
terminology, i.e. polyunsaturates, (n-3) or (n-6) polyunsaturates, or naming
the individual fatty acid(s) in question, would improve clarity and would po-
tentially promote broader exploration of the functional and health attributes
of polyunsaturated FA [204].
10.2
Health benefits
Initially, it should be noted that the chemical form of the PUFA supplementa-
tion used for clinical assays and up to the final consumers will not be detailed.
Indeed, sometimes they take TAG forms while occasionally they are ethyl es-
ters or free fatty acids, depending on the target.
Polyunsaturated FA (PUFA) are essential components in higher eukaryotes
that confer fluidity, flexibility and selective permeability to cellular mem-
branes. PUFA affect many cellular and physiological processes in both plants
and animals, including cold adaptation and survival [205, 206], modulation
of ion channels [207, 208], endocytosis/exocytosis [209], pollen formation,
pathogen defense, chloroplast development in plants [210], and activities of
membrane-associated enzymes that are sensitive to the biophysical properties
of lipid membranes [211–213].
In mammals, metabolism of LC-PUFA by oxygenases yields a range of im-
portant short-lived molecules (generically known as the eicosanoids), such
as prostaglandins, leukotrienes and thromboxanes (Fig. 19). These resulting
metabolites bind to specific G-protein-coupled receptors and signal cellu-
lar responses and modulate many biological processes (see below). Because
the production of various classes of these molecules depends in part upon
the availability of their PUFA precursors in membrane phospholipids, mod-
ulation of PUFA is a potential target of pharmaceuticals and nutraceuti-
cals [213, 214].
The (n-3) LC-PUFA, particularly EPA and DHA, are thought to display
a variety of beneficial effects in areas ranging from foetal development to
cancer prevention [215]. Some of those health effects are presented below.
10.2.1
Heart health
It is well established that populations with a high consumption of oily fish

have a lower incidence of heart disease and several studies have confirmed
that EPA and DHA are the protective components [216–224].
Recent research concludes that perhaps the most important effect of (n-3)
LC-PUFA, when it comes to preventing cardiovascular disease, is their ability
to stabilize atherosclerotic plaque by reducing the infiltration of inflammatory
and immune cells (lymphocytes and macrophages) into the plaque [225]. This
could explain the reduction in fatal and nonfatal heart attacks and strokes
associated with an increased intake of fish oils [226]. In addition, the anti-
inflammatory effect of DHA by reducing the C-reactive protein (CRP) level in
blood may decrease the risk of coronary heart disease such as atherosclero-
sis [227].
Several large clinical trials have confirmed the ability of fish oils to prevent
sudden cardiac death in both presumably healthy subjects as well as in pa-
tients having suffered a heart attack [228–231]. Although most research so far
has focused on the effect of (n-3) on life-threatening ventricular arrhythmias
it is likely than many of the findings may also be applicable to atrial fibril-
lation [232]. It has also been shown that a high (n-3) content of blood cells
and serum cholesterol esters is associated with increased heart rate variabil-
ity and leads to a decreased risk of cardiac disease and a longer lifespan [233].
In addition, EPA and DHA seem to reduce the mortality among not only pa-
tients who have survived a first heart attack [234–236] but also among old
people [237, 238].
Numerous studies have confirmed that (n-3) LC-PUFA included in fish oils
significantly combat hypertension by a notable reduction of blood pressure
and benefit heart transplant patients [239–247].
EPA and DHA are also effective in lowering the blood level of triglyc-
erides [248, 249], in improving large artery dilation in patients with high
cholesterol levels [250], and they possess antithrombotic effect [251]. Such
positive actions also contribute to reduce the risk of cardiovascular disease.
10.2.2
Cancer
Several studies have shown the effect of LC-PUFA against cancer such as an
inverse relationship between blood levels of EPA and DHA and the risk of
prostate cancer [252, 253] or fish and fish oil consumption and adenocarci-
nomas [254]. In addition, (n-3) PUFA can also act positively against cancer
effects like cachexia (abnormal weight loss) or survival rate in end-stage
cancer [255, 256].
10.2.3
Arthritis
The (n-3) PUFA are also known to decrease rheumatoid arthritis; notably by
lowering interleukin-1beta production which results in a significant reduc-
tion in morning stiffness and the number of painful joints [257–261].
10.2.4
Psoriasis
Psoriasis is a fairly common skin disease characterized by high concentra-

tions of AA in the plaques and profound changes in the metabolism of
eicosanoids leading to an increase in proinflammatory agents. Some stud-
ies have shown that n-3 PUFA, notably EPA, can counteract the formation
of these proinflammatory agents and that oral supplementation with fish oils
benefit psoriasis patients [262, 263].
10.2.5
Lung disease
A few years ago it was shown that children who regularly eat fresh, oily fish
have a four times lower risk of developing asthma than children who rarely
eat such fish. EPA was suspected to be responsible by reducing airway in-
flammation and responsiveness. Later, studies on supplementation by (n-3)
LC-PUFA have confirmed their benefit in the reduction of breathing diffi-
culties and other symptoms in asthma patients. More recently, it has been
demonstrated that those PUFA are also beneficial in the treatment of other
lung diseases such as cystic fibrosis and emphysema [264–267].
10.2.6
Attention-deficit disorder
Attention-deficit hyperactivity disorder (ADHD) is characterized by hyper-

activity, emotional instability, poor coordination, short attention span, poor
concentration, impulsiveness, and learning disorders. It is very common
among school-age children with an incidence of 4–20%. Initial studies have
linked ADHD to a deficiency of certain long-chain FA, notably AA, EPA and
DHA [268]. More recently Burgess et al. [269] have found that children with
ADHD were breastfed less often as infants than children without ADHD
(breast milk is an excellent source of DHA). In addition to ADHD, other
disorders such as dyslexia (difficulties in learning to read and write) and dys-
praxia (problems with coordination and muscle control) also have deficiency
in LC-PUFA as a common denominator that may be avoided by oral supple-
mentation of concentrated fish oils [270].
10.2.7
Mental health
Several epidemiological studies have shown that a high dietary intake of

linoleic acid and a low intake of EPA and DHA are associated with cogni-
tive impairment and an increased risk of dementia. In a recent study, it was
that EPA and especially DHA help keep the membranes of brain cells more
fluid while saturated and (n-6) FA tend to “harden” them. Authors believe this
and the anti-inflammatory effects of EPA and DHA are what help preserve
cognitive function [271].
In addition to preventing dementia, (n-3) PUFA help in combating depres-
sion, schizophrenia, Alzheimer’s disease and other mental illnesses [272–283].
10.2.8
Pregnancy and infancy
An adequate intake of DHA and EPA is particularly important during preg-

nancy and lactation. During this time the mother must supply all the baby’s
needs for DHA and EPA because it is unable to synthesize these essential FA
itself. DHA makes up 15–20% of the cerebral cortex (a normal adult human
brain contains more than 20 g of DHA) and 30–60% of the retina (it is also
concentrated in the testes and sperm), so it is absolutely necessary for normal
development of the foetus and baby, which implies optimal levels in preg-
nant and lactating mothers. There is some evidence that an insufficient intake
of (n-3) FA may increase the risk of premature birth and an abnormally low
birth weight. There is also emerging evidence that low levels of (n-3) acids are
associated with hyperactivity in children [268, 284–292].
The constant drain on the mother’s DHA reserves can easily lead to a de-
ficiency that may be linked to preeclampsia (pregnancy-related high blood
pressure) and postpartum depression [288–290]
10.3
Nutrition: importance of the ratio of (n-6) and (n-3) essential FA
There are good fats and there are bad fats. Artificially produced trans-FA are
bad in any amount and saturated fats from animal products should be kept
to a minimum. The best fats, or oils rather since they are liquid at room tem-
perature, are those that contain the essential FA that are so named because
without them we die (see chapter introduction). Essential FA are polyunsat-
urated and grouped into two families, the (n-6) EFA and the (n-3) EFA.
Seemingly minor differences in their molecular structure make the two
EFA families act very differently in the body. 18:2(n-6) and 18:3(n-3) are not
interconvertible and compete for the rate-limiting 6-desaturase in the synthe-
sis of LC-PUFA (see biosynthesis). AA and EPA are the parent compounds
for the production of eicosanoids with opposite properties, see Fig. 19. Many
scientists believe that a major reason for many diseases (see below) is the
profound imbalance between our intake of (n-6) and (n-3) FA. Our ancestors
evolved on a diet with a ratio (n-6)/(n-3) of about 1 : 1. A massive change in
dietary habits over the last few centuries (modern agriculture) has changed
this ratio to something closer to 20:11 [293–295].
An increase in the dietary intake of (n-6) EFA changes the physiological
state to a prothrombotic, proconstrictive, and proinflammatory state. Many
of the chronic conditions, cardiovascular disease, diabetes, cancer, obesity,
autoimmune diseases, rheumatoid arthritis, asthma and depression, are as-
sociated with increased production of thromboxane A2 (TXA2 ), leukotriene
B4 (LTB4 ), IL-1β, IL-6, tumor necrosis factor (TNF), and C-reactive pro-
tein [295]. All these factors increase with (n-6) fatty-acid intake and decrease
with (n-3) fatty-acid intake, whether 18:3(n-3), 20:5(n-3) or 22:6(n-3). EPA
and DHA are more potent2 , and most studies have been carried out using EPA
and DHA (see above).
The optimal dose or ratio of (n-6)/(n-3) varies from 1/1 to 4/1 depending
on the disease under consideration. In the secondary prevention of cardio-
vascular disease, a ratio of 4/1 was associated with a 70% decrease in total
mortality [296]. A ratio of 2.5/1 reduced rectal cell proliferation in patients
with colorectal cancer, whereas a ratio of 4/1 with the same amount of (n-3)
PUFA had no effect [297]. The lower (n-6)/(n-3) ratio in women with breast
cancer was associated with decreased risk [298]. A ratio of 2–3/1 suppressed
inflammation in patients with rheumatoid arthritis, and a ratio of 5/1 had
a beneficial effect on patients with asthma, whereas a ratio of 10/1 had ad-
verse consequences [265, 299]. These studies indicate that the optimal ratio
may vary with the disease under consideration. This is consistent with the fact
that chronic diseases are multigenic and multifactorial. Therefore it appears
important to restore the balance between (n-6) and (n-3) for homeosta-
sis and normal development. On this basis and by recognizing the unique
benefits of EPA and DHA and the serious consequences of a deficiency, rec-
ommendations for daily intake of (n-3) PUFA has been published by several
international scientific authorities [300–303].
10.4
Routes for biosynthesis
Despite extensive screenings, no angiosperm plants have been detected

that accumulate in reserve triacylglycerols or in membrane lipids cis-
polyunsaturated FA with carbon chains longer than C18 [305]. However, it
1 Lipid consumption in Europe nowadays: vegetal (65%) > land animals (17%) > butter (16%) >
marine animals (2%).
2 Alpha-linolenic acid can be converted to EPA and DHA in the body, but the conversion is quite
inefficient, especially in older people [294].
Fig. 19 Biosynthesis of eicosanoids from the essential FA [304]. Abbreviations: PL,

phospholipids; PLA2, phospholipase A2; COX, cyclooxygenase; LOX, lipoxygenase; PG,
prostaglandins; TBX, thromboxanes; HETE, hydroxy-eicosatetraenoic acids; HPETE, hy-
droperoxyeicosatetraenoic acids; LT, leukotrienes. Dietary lipids provide EFA and pre-
formed substrates for the COX/LOX pathways. Dietary FA such as 20:3(n-6), 20:4(n-6),
and 20:5(n-3) are direct precursors, while 18:2(n-6) and 18:3(n-3) must be elongated and
desaturated prior to their conversions to eicosanoids
is well known that polyunsaturated FA have crucial roles in membrane bi-

ology and signalling processes in most living organisms (see the section on
health benefits). As indicated by Abbadi et al. [306], the daily requirement of
such PUFA may vary and depend on the availability of linoleic and linolenic
acid for conversion by elongation and desaturation, but a more regular con-
sumption and an accordingly sustainable source of PUFA would be highly
desirable. At present, these FA enter the human diet mainly in the form of
marine and freshwater fish. But in view of the increasing human population,
the overfishing of marine resources, the dependence of fish farming on PUFA
from fish oil and the environmental impact of aquaculture systems, neither
farmed nor captured fish can be considered as a sustainable source of PUFA
(see section on market) [307]. Thus alternatives have to be found such as new
sources or by modifying existing ones by genetic approaches. For example,
transgenic oilseeds could be a way out of the forthcoming shortage, partic-
ularly in view of the fact that a low percentage of PUFA in daily-consumed
plant oils would satisfy nutritional requirements [306].
So, over the last few years, the biosynthetic LC-PUFA pathway has been
the subject of much interest and it is only recently that molecular genetic
approaches have allowed detailed studies of the enzymes involved in their
Fig. 20 Pathways of very-long-chain polyunsaturated synthesis in different organisms.

Major products are indicated in ovals while enzymes are boxed. The anaerobic route (a)
makes use a polyketide-like system (PKS), whereas aerobic routes (b, c) use differ-
ent enzymes (desaturases and elongases). If routes (b, c) are started with linoleic acid
(9,12–18:2), arachidonic acid (AA) = 5,8,11,14–20:4 is obtained. Route (b) is a direct
pathway that may operate in marine primary producers and initiate the food chain of
“oceanic” polyunsaturated FA ending in large carnivorous fish. Route (c) represents the
Sprecher [22] pathway as typical for mammalian cells. Mammals lacks ∆12 and n3 de-
saturase activities and obtain linoleic acid and α-linolenic acid (9,12,15:18:3) from their
diets. In this route, the synthesis of DHA is now known to consist of two succeeding
elongation cycles, a ∆6 desaturation and a β-oxidation chain-shortening
synthesis. Thus, at this time, three distinct routes for LC-PUFA biosynthesis
have been identified; two are aerobic and one is anaerobic (Fig. 20).
10.4.1
Aerobic pathways
In these routes, LC-PUFA biosynthesis is catalysed by sequential desaturation

and fatty acyl elongation reactions. Known pathways involve the processing of
the saturated 16:0 or 18:0 products of fatty acid synthase (FA) by elongation
and aerobic desaturation reactions. The desaturase enzymes insert double
bonds at specific carbon atoms in the fatty acid chain and the fatty acid elon-
gation system elongates the precursors in two-carbon increments [308, 309].
Significant progress has been made in the identification of the enzymes re-
quired for PUFA synthesis; in particular, the fatty acid desaturases which
are central to this pathway have now all been identified [308, 310]. The most
relevant desaturases required for PUFA biosynthesis are the so-called “front-
end” desaturases [311] that introduce a new double bond between an existing
one and the carboxyl end of the acyl group. These “front-end” desaturases
are all members of the cytochrome b5 fusion desaturase superfamily, since
they contain an N-terminal domain that is orthologous to the microsomal
cytochrome b5 [312].
Interestingly, there is a division of labor in higher eukaryotes for the syn-
thesis of 20:4(n-6), 20:5(n-3) and other PUFA. Angiosperm plants convert
oleic acid (18:1) to linoleic acid (18:2) and linolenic acid (18:3(n-3)), which
are essential FA for mammals as substrates for the synthesis of C20, but
these plants are unable to elongate the FA further. Mammals also convert
18:0 to 18:1(n-9) using a membrane-bound 18:0-CoA desaturase, however,
they lack both ∆12 and (n-3) desaturase activities. Therefore, they require
18:2(n-6) and 18:3(n-3), the essential FA (EFA), in their diet [213]. These EFA
are converted to long-chain PUFA via a series of desaturation and elonga-
tion reactions in the endoplasmic reticulum (ER) [308]. The ∆6 desaturase
uses 18:2(n-6) and 18:3(n-3) as a substrates and inserts a double bond to pro-
duce 18:3ω6 and 18:4ω3. PUFA with a double bond at ∆6 are substrates for
the elongation machinery, which uses malonyl-CoA to add two carbons to the
C-terminal end of the FA, producing 20:3(n-6) and 20:4(n-3). These FA are
substrates for a ∆5 desaturase, which produces 20:4(n-6) and 20:5(n-3) [213].
Those pathways for the synthesis of arachidonic acid (AA) and eicosapen-
taenoic acid (EPA) have been characterized biochemically and are supported
by the recent cloning and characterization of desaturase and elongase genes.
In addition, some notable variations exist such as, for example, the free-
living nematode Caenorhabditis elegans [313–316], the fungus Mortierella
alpina [317] the moss Physcomitrella patens [318] the red algae Porphyrid-
ium cruentum [319], the freshwater protist Euglena [320] and the microalga
Isochrysis galbana [321]. All these organisms posses particular enzymatic

pathways.
At this stage of LC-PUFA biosynthesis a split occur. The force of logic sug-
gested that the steps succeeding AA and EPA synthesis would be another
two-carbon elongation step and countervailing desaturation by ∆4 desaturase
to produce the C22 PUFA (elongation of EPA and AA to C22:5(n-3) and DTA,
respectively, and the desaturation of the latter to form DHA and DPA). The
cloning of a ∆4 desaturase from the DHA-producing marine protist, Thraus-
tochytrium sp., suggests that this pathway (route b, Fig. 22) is valid in some
organisms [322]. However, mammals lack ∆4 desaturase activity, and evi-
dence has accumulated for an alternative pathway for C22 PUFA biosynthesis.
The sequence involving ∆4 desaturase is the simplest one. It operates in
various unicellular, eucaryotic algae belonging to different systematic groups
and contributing to marine primary production. These and other photosyn-
thetically active organisms are considered to be the primary sources of EPA
and DHA entering marine feeding webs with large carnivorous fish and fi-
nally humans at the end [306, 307].
The other route, the so-called Sprecher pathway (route c, Fig. 20), re-
mained controversial but recent experiments have indicated that it is the
predominant route to DHA in mammals [22, 23, 323–328]. It now seems clear
that the human C22 PUFA synthesis pathway consists of two succeeding elon-
gation cycles (leading to 24:5(n-3)) followed by a ∆6 desaturation, all of which
occur in the endoplasmic reticulum. After transfer of the fatty acid to perox-
isomes, there is a specific β-oxidation chain-shortening to the C22 product.
By this route, the synthesis of DHA from acetyl–coenzyme A (acetyl-CoA) re-
quires approximately 30 distinct enzyme activities and nearly 70 reactions,
including the four repetitive steps of the fatty acid synthesis cycle [329].
Over the past few years, sequences encoding virtually all the enzyme activ-
ities involved in microsomal PUFA biosynthesis have been isolated, identified,
and expressed in a variety of heterologous hosts (Table 4) [330]. Results from
these studies help to increase our understanding of the biochemistry of elon-
gases and desaturases and the regulation of PUFA biosynthesis. Then, the
next challenge will be the selection of a set of suitable copies of the avail-
able genes, which after transformation and expression in a heterologous host
(such as oilseed crop) should result in a cooperating ensemble of enzymes
and production of PUFA.
10.4.2
Anaerobic pathway
The diversity of PUFA synthesis described above relies on variations on

desaturase and elongase biochemistry. This aerobic biosynthetic pathway
was thought to be taxonomically conserved, but nature has also solved the
problem of PUFA synthesis using a fundamentally different anaerobic path-
Table 4 Origin of presently available genes for cDNAs encoding desaturases and elongases
involved in the biosynthesis of LC-PUFA. The encoded enzymes have been character-
ized by functional expression. The numerous sequences published for the ubiquitous ∆9-,
∆12- and ∆15-desaturases are not included [308]
Enzyme Organism Reference
∆4 desaturase Thraustochytrium sp [322]

∆5 desaturase Homo sapiens [331, 332]
Caenorhabditis elegans [333, 334]
Mortierella alpina [335, 336]
∆6 desaturase Homo sapiens [337]
Caenorhabditis elegans [338]
Borago officinalis [339]
Ceratodon purpureus [340]
Physcomitrella patens [341]
Mortierella alpina [342, 343]
∆8 desaturase Euglena gracilis [320]
(n-3) desaturase Caenorhabditis elegans [344]
∆6 elongase Caenorhabditis elegans [314]
Mortierella alpina [317]
Physcomitrella patens [345]
way [329]. Indeed, numerous PUFA-producing bacterial strains are capable

of producing PUFA under strictly anaerobic conditions, thus precluding the
participation of an oxygen-dependent mechanism. The system involved here
does not require the multiple desaturase and elongase enzymes outlined
above, but instead uses a polyketide synthase-like (PKS) gene cluster, found in
both prokaryotic and eukaryotic marine microbes, to synthesize PUFA [214].
Several marine bacteria contain EPA and DHA at levels as high as 25% of
total membrane FA [346]. A genomic library prepared from one of these ma-
rine bacteria (Shewanella sp. Strain SCRC2738) was used to identify a 38 kb
DNA fragment that resulted in EPA synthesis when expressed in E. coli. [347].
Experimental results [329, 348–350] indicated that these genes expressed in
E. coli encode a protein complex that is capable of EPA synthesis without any
reliance on enzymes of the E. coli FA or any long-chain intermediate such
as 16:0-ACP. Apparently, the genes encode a PKS that acts independently of
FA elongase and desaturase activities to synthesize EPA directly [213]. Genes
with high homology to the Shewanella gene cluster have been identified in
Photobacterium profundum [351] and in Moritella marina, which accumu-
lates DHA rather than EPA [352]. Thus it is likely that the PKS pathway for
PUFA synthesis is widespread in marine bacteria [213].
The thraustochytrid Schizochytrium sp accumulates large quantities of
triacylglycerol rich in DHA (see chapter on thraustochytrids). Biochem-
ical experiments have revealed the involvement of a PKS protein com-
plex [329], which was further confirmed by molecular genetic analysis. The
Schizochytrium genome encodes three proteins with domains highly similar
to those encoded by genes from Shewanella, raising the possibility that the
PUFA PKS has undergone lateral gene transfer [213].
Several “front-end” PUFA aerobic desaturases from Thraustochytrium
have been identified recently [322, 353], but the prevalence of this newly dis-
covered PKS-like biosynthetic pathway is not known. Because Schizochytrium
is also a member of the Thraustochytriidae, it is perhaps surprising to find
these two distinct biosynthetic pathways represented in the same family, but
molecular characterization of PUFA biosynthesis in the Thraustochytriidae
might provide insights into the evolution of this important pathway.
The primary structure of Shewanella PKS (and its relatives) does not con-
form to any of the previously described classes of PKS proteins. Instead, it
suggests the assembly of several multifunctional proteins into a complex.
PUFA PKS carry out some of the same reactions as FA and use the same
small protein (or domain), acyl carrier protein (ACP), as a covalent attach-
ment site for the growing carbon chain. However, in these enzyme systems,
the complete cycle of reduction, dehydration, and reduction seen in FA is
often abbreviated, so that a highly derivatized carbon chain is produced, typ-
ically containing many keto and hydroxy groups as well as carbon–carbon
double bonds in the trans configuration (Fig. 21). The linear products of PKSs
are often cyclized to form complex biochemicals that include antibiotics, afla-
toxins, and many other secondary products [329]. Since the double bond on
the PUFA molecules were formed by dehydration and isomerization of keto
groups in cycles of polyketide-forming chain elongation, reaction to the C20
PUFA may not be the direct precursor of C22 PUFA [354].
The relative simplicity of this PKS-like system makes it attractive in terms
of transgenic production of LC-PUFA. For example, introducing and regulat-
ing the three Schizochytrium PKS-like open reading frames in a transgenic
plant is relatively simple compared with the more than five desaturase and
elongase genes required for the aerobic pathway [306]. In addition, the iden-
tification of new (PUFA-specific) PKS activities such as double-bond isomer-
ization might help in the bioengineering of additional families of polyketide
antibiotics [214].
Furthermore, our improved knowledge of PUFA synthesis in Shewanella,
Schizochytrium and their relatives has implications for understanding food-
web dynamics in marine ecosystems. Because these organisms are significant
primary producers of 20- and 22-carbon PUFA in cold-water oceans [346], the
PKS pathway may be an important source of PUFA for fish and mammals and
thus also for human diets. The importance of 20:5 in food-web dynamics of
freshwater ecosystems has recently been discussed [355]. Finally, the identi-
fication of these PKS systems in ancient lineages raises intriguing questions
about the evolutionary relationship of this newly discovered pathway to 20:5
Fig. 21 Generalized scheme for the processive synthesis of polyunsaturated FA (PUFA)

by a polyketide synthase (PKS) system [214]. In the case of PUFA, it is envisaged that
a primer molecule (in the form of acetyl-CoA) undergoes several rounds of sequential
reactions (keto-synthase, keto-reductase, dehydratase and enoyl reductase), resulting in
repeated synthesis and fatty acyl chain (esterified to the acyl carrier protein) elongation
by two carbons per cycle. Because PUFA contain methylene-interrupted double bonds
(i.e. at the third carbon), it is likely that a dehydratase (FabA-like) module in the PKS also
simultaneously carries out a trans–cis isomerization to generate this configuration
and 22:6 FA relative to the enzymatically more complex desaturase/elongase

route found in higher eukaryotes [213].
10.5
Some promising sources of marine LC-PUFA
10.5.1
PUFA from nonphotosynthetic microorganisms
If nowadays conventional fish oils are the main industrial sources of PUFA
they may be not suitable to meet the increasing markets, notably for DHA
owing to their limited supply (see section on sources and market), lower con-
tent of DHA in comparison to that of EPA, and peculiar taste and odour.
Thus, the production of (n-3) PUFA by microbial fermentation of oleaginous
microorganisms has attracted considerable attention in relation to industrial
application of single-cell oil (SCO) [354, 356, 357]. For instance, a range of
autotrophic and heterotrophic microbes has been assessed for potential com-
mercial sources of EPA and DHA by various workers including Barclay et
al. [358], Lewis et al. [359] and Vazhappilly and Chen [360], and the results
of many studies in this area have been reviewed by Singh and Ward [361] and
Ratledge [362].
In comparison to autotrophic microorganisms, the de novo synthesis of
(n-3) and (n-6) PUFA by heterotrophic microorganisms may provide an eas-
ier and less expensive means of producing PUFA-rich biomass and oils [363].
Thus, Ratledge [362] considered that, despite improvements in the efficiency
of photobioreactors, it is doubtful whether the growth of microalgae in biore-
actors could be scaled up to satisfy even a modest demand for SCO rich in
(n-3) PUFA, and suggested that heterotrophic microbes might be a more pro-
ductive source.
In recent years, interest in the use of microheterotrophs as a source of
PUFA has increased [364]. Microheterotrophs do not require some of the
elements necessary for the culture of autotrophs (e.g., light, carbon diox-
ide), and some see them as a potential alternative to traditional commer-
cial sources of PUFA. Arachidonic acid has been produced in quantity by
some fungi [365, 366]. Certain bacteria have been shown to produce EPA and
DHA [367, 368]. The recognized need in aquaculture for alternative sources of
PUFA for feeding both larvae and adults has seen PUFA-producing bacteria
successfully demonstrated as a means to enrich rotifers (Brachionus plicatilis,
a live-feed organism for finfish larvae) with these FA [369–371]. In addition
an increasing body of research into microheterotrophic PUFA production has
concentrated on the thraustochytrids [363].
10.5.1.1
Bacteria
In marine food webs, microalgae have long been considered as the only de
novo source of EPA [372]. Indeed PUFA were once thought to be absent in
bacterial membranes [373] and the production of PUFA by bacteria is of-
ten ignored [374]. However, numerous bacterial species of marine origin
have now been shown to produce LC-PUFA such as EPA and DHA and some
authors correctly pointed to the potential role of prokaryotic PUFA produc-
tion in marine food webs [25, 347, 375].
Phylogeny
The screening of PUFA-producing prokaryote has led to the identifica-

tion of previously undescribed taxa within the genera Shewanella and Col-
wellia [376, 377]. Subsequently, the chemotaxonomy of PUFA-producing bac-
teria was reviewed [30]. Indeed, until recently the taxonomic status of PUFA-
producing bacteria received little attention, with most research efforts fo-
cused on the description of PUFA production [31].
Figure 22 represents the division-level diversity of the bacterial domain
based on 16S rDNA sequences. Several of the divisions (e.g. Proteobacte-
ria, Actinobacteria) are well represented by cultivated strains. However the

majority are poorly represented by cultured organisms. In fact 13 of the 36 di-
visions are defined by environmental sequences only [378]. The proportion of
cultivated versus uncultivated sequences obtained from environmental mo-
lecular analyses may be used as an indication of the level of described biodi-
versity for a particular division. The occurrence of bacteria with the ability to
produce PUFA is limited to five well-known marine genera which fall within
two distinct domains of bacteria. Although separated by a significant evolu-
tionary distance, the ability to produce EPA is apparent from both groupings.
Species from each domain also possess the ability to produce further PUFA
products, namely AA or DHA, respectively (Fig. 22) Thus, the ability to pro-
duce PUFA exhibits a phylogenetic linkage centred on two distinct lineages,
the marine genera of the γ -Proteobacteria (Shewanella, Colwellia, Moritella,
Psychromonas, Photobacterium) and more limited species within two genera
of the Cytophaga-Flavobacterium-Bacteroides (CFB) grouping (Flexibacter,
Psychroflexus). However, it is pertinent to note that not all species within
Fig. 22 Evolutionary distance tree of the bacterial domain [31]. The major PUFA-
producing genera, Shewanella, Colwellia and Moritella, are expanded from the Proteobac-
teria division together with Flexibacter and Psychroflexus from the Cytophagales division.
For each genus, biomarker FA and the types of PUFA are listed
Fig. 23 Schematic of the phylogenetic relationship of the genus Shewanella based on 16S
rDNA sequence. Species known to produce polyunsaturated FA (PUFA) and their lines of
descent are highlighted in black. Species and lines of descent known not to produce PUFA
are highlighted in grey. Arrows indicate sites of divergence where the expression of PUFA
synthesis has been lost. Adapted from Russell and Nichols [30]
these genera express the ability to produce PUFA (Figs. 22, 23). Evidence
implies that PUFA production is associated with physiological adaptations
within marine bacteria.
Marine ecology
Bacterial PUFA-producing isolates have been found to be particularly preva-

lent in high-pressure low-temperature deep-sea habitats and permanently
cold marine environments [357, 367, 379]. Indeed, the majority of the γ -
Proteobacteria PUFA producers are characterized as being psychrophilic3 ,
halophilic and predominantly piezophilic4 or piezotolerant [30, 380]. These
physiological traits have influenced the ecological distribution of PUFA-
producing bacteria in the marine environment (Table 5). The enrichment
of PUFA-producing strains from these environments has led to speculation
that PUFA synthesis is an important adaptation for countering the effects
of elevated hydrostatic pressure and low temperature on membrane fluidity
or phase. In strains which have been analysed, PUFA synthesis undergoes
3 The term psychrophile (psychro = cold, phile = loving) is an operational definition, to describe
the temperature-growth relationship of microorganisms [400].
4 (Piezo = pressure, phile = loving). Same comments as above.
temperature-dependent and, for deep-sea isolates, pressure-dependent regu-

lation. Typically, as cultivation temperature is decreased, and or pressure in-
creased, PUFA incorporation into membrane phospholipids is enhanced. This
modulation is thought to maintain appropriate membrane physical structure.
Indeed, in marine bacteria, PUFA are component FA of certain phospholipids
which occur in the cell membrane. It is considered that the low melting tem-
perature of these highly unsaturated membrane components, combined with
their unique molecular geometry in the membrane, yields a particular ad-
vantage at low temperature in balancing the competing homeoviscous and
homeophasic forces in the cell membrane [30].
However, if bacteria of the CFB grouping are similarly psychrophilic and
halophilic, they lack the ability to grow at high pressure [380]. In addition,
for at least one high-pressure-adapted deep-sea bacterium, Photobacterium
profundum strain SS9, growth at high pressure and low temperature does
not depend upon PUFA synthesis [351]. Hence while PUFA production ap-
pears as a phylogenetically linked genotypic strategy for such selective pres-
sures, their presence may not be essential for the growth of bacteria in such
environments.
While there is not necessarily a phylogenetic relationship between psy-
chrophilic organisms, such relationships may exist through the evolution
of adaptive strategies for low-temperature growth. This is supported by
empirical observations such as in the genus Shewanella (Fig. 23). Here,
there is a good correlation between those species which are cold-adapted
and produce PUFA (S. pealeana, S. hanedai, S. benthica, S. gelidimarina,
S. frigidimarina), in contrast to those which do not produce PUFA and
grow at higher temperatures (mesophiles) (S. putrefaciens, S. alga, S. baltica,
S. woodyi, S. oneidensis, S. amazonensis). However, as indicated by Nichols
et al. [31], S. frigidimarina and S. pealana are rather psychotolerant than psy-
chrophilic and in addition S. frigidimarina also grows without the presence
of salt. Thus these authors point out that the correlation among psychrophily,
halophily and PUFA production is therefore not exclusive. They suggest that
PUFA production may be a common physiological strategy for coping with
the combined constraints of low temperature and marine salinity.
In addition to cold environment (sea ice) and deep sea water, PUFA-
producing bacteria have also been isolated in the intestinal contents of marine
fish and invertebrates [347, 368, 379, 395–397] Moreover, the transfer of bacte-
rially derived FA and specifically PUFA, between marine bacteria and higher
trophic levels has been demonstrated [370, 398]. For example, recent studies
have demonstrated that PUFA-producing bacteria can be used to enrich ro-
tifers in EPA or DHA [370, 371, 399]. The greatest level of EPA enrichment
in rotifers was 5.8% dry weight [370], whereas for DHA it was 0.3% dry
weight [371]. These studies provide an important step in the development of
novel sources of PUFA for aquaculture [346].
Table 5 Major bacterial genera responsible for the production of PUFA in the marine
environment (adapted from Nichols [25])
Species Ps Ha Pi PUFA Environmental source References
Shewanella
S. algae – – – – Red algae, Japan [376]
S. amazonensis – + – – Water, Amazon river [381]
S. baltica – – – – Oil brine, Japan [376]
S. benthica + + + + Holourithan intestine [376]
S. colwelliana – + – – Aquaculture, USA [31]
S. frigidimarina ± – – + Sea ice, Antarctica [376]
S. Gelidimarina + + ± + Sea ice, Antarctica [376]
S. hadenai + + ± + Sediment, Artic [376]
S. japonica ± – – + Sediments, mussels [382]
S. livingstonensis ± – – nd Sea water, Antarctica [383]
S. oneidensis – – – – Lake sediment, USA [31]
S. pealeana ± + – + Squid gland [31]
S. putrefaciens OG1 – – – – Butter, UK [31]
S. putrefaciens OG3 – – – – Butter, UK [31]
S. woodyi ± + – – Sea water, Hawaii [31]
S. violacea + + + + Deep-sea [384]
Colwellia
C. demingiae + + nd + Sea ice, Antarctica [377]
C. hadaliensis + + + nd Deep-sea [385]
C. hornerae + + nd + Sea ice, Antarctica [377]
C. maris + + nd + Sea water, Japan [386]
C. psychroerythraea + + nd + Flounder eggs [377]
C. psychrotropica + + nd + Burton lake, Antarctica [377]
C. rossensis + + Nd + Sea ice, Antartica [377]
Moritella
M. japonica + + ± + Deep-sea [384]
M. marina + + ± + Sea water [387]
M. vavanosii + + + + Deep-sea [388]
M. viscosus + + ± nd Fish [389]
Psychromonas
P. antarticus + + + nd Sea-ice, Antarctica [390]
P. kaikoae + + + + Deep-sea [391]
P. marina + + + + Seawater [392]
Psychroflexus
Ps. gondwanense – – nd – Burton lake, Antarctica [393]
Ps. torquis + + nd + Sea ice, Antarctica [393]
Photobacterium
Ph. profundum + + + + Deep-sea [394]
Ps: Psychrophilic, Ha: Halophilic, Pi: Piezophilic

All theses facts uphold the idea presented by Nichols [25] that the assump-
tion that microalgae provide the bulk of de novo PUFA production for all
marine food webs must now be actively reviewed to determine the role and
potential importance of PUFA-producing prokaryotes in marine microbial
niches such as sea ice, marine animals and abyssal communities.
Biotechnology
Interest in the production of PUFA from alternative sources for use in aqua-
culture feeds and human nutraceuticals (see section on heath benefit) has
fuelled recent research into the molecular biology of PUFA production in
prokaryotes. A key advantage of bacterial PUFA production (as for thraus-
tochytrid PUFA production, see below) is that only a single PUFA is pro-
duced, rather than the complex mixture yielded from fish or algal oils [30].
Thus bacterial sources of PUFA remove the expense of preparative purifica-
tion in the production of high-purity PUFA oils.
In addition to their potential use as “cell factories”, bacteria in particular
offer the biotechnological opportunity to investigate the genes and enzymes
responsible for PUFA production. A variety of bacterial fatty-acid biosyn-
thetic mechanisms exist, which vary with taxonomic identity and class of
fatty acid product [401–403]. Some reports have suggested that bacterial
(n-3) PUFA production is mediated by undefined desaturases [30, 348, 352].
However, as indicated by Allen et al. [351], sequence studies of bacterial genes
required for PUFA biosynthesis have gradually led to a reappraisal of this view
(see section on biosynthesis).
Initial insight into the genetics of bacterial PUFA synthesis was gained by
the transfer of a gene cluster from Shewanella putrefaciens SCRC-2738 into
Escherichia coli and a Synechococcus sp. resulted in the successful expression
of EPA in these organisms [347]. However, the level of expression achieved
was low. The gene cluster used in both cases consisted of a 38 kb fragment
containing eight open reading frames with three of these possessing homol-
ogy with genes that encode for enzymes involved in fatty-acid biosynthesis.
Further characterization using these organisms has identified five genes re-
sponsible for PUFA biosynthesis, designated ORFs 2, 5, 6, 7 and 8. A sub-
sequent analysis of the predicted amino acid sequences of the products of
these genes indicated that they are most related to microbial polyketide syn-
thase (PKS) complexes and fatty acid synthase (FA) enzymes (see section on
biosynthesis). In addition to the Shewanella sp. SCRC-2738 sequences, related
genes partially responsible for PUFA production have been analysed from
the DHA-producing bacterium Moritella marina strain MP-1 (formerly Vibrio
marinus) [352] and from a DHA-producing thraustochytrid marine protist
belonging to the genus Schizochytrium [329]. Recently, Metz et al. [329] re-
ported biochemical analyses of PUFA production in E. coli strains harbouring
Shewanella sp. SCRC-2738 DNA and in the Schizochytrium species. Consistent
with the examination of enzyme domains, isotopic-labelling studies provided

compelling support for a PKS-like pathway of PUFA synthesis in both systems
studied [329].
After spending significant effort on understanding the mechanistic mi-
crobial production of PUFA, research now has to focus on the regulation of
such biosynthesis to maximize the transgenic potential of bacterial LC-PUFA
genes.
10.5.1.2
Thraustochytrids
Thraustochytrids are microheterotrophs generally considered necessarily

marine with a specific requirement for Na+ ions [404] that feed as saprobes or
occasionally as parasites [405]. Thraustochytrids have been characterized by
the presence of sagenogenetosome, an ectoplasmic net, a cell wall with non-
cellulosic scales, and a life cycle consisting of vegetative cells, zoosporangium,
and biflagellate zoospores [354]. They have a wide geographic distribution in
estuarine and marine habitats, with strains isolated from Antarctica [406], the
North Sea [407], India [408], Micronesia [409], Japan [410], Australia [359]
and Fiji [354]. They have been reported frequently from seawater, sediments,
algae, and invertebrates, both as saprotrophs and parasites. Their ubiquitous-
ness and physiological capabilities to utilize a wide variety of habitat suggest
that they play a definite role in the marine ecosystem.
Originally thought to be primitive fungi, thraustochytrids have more re-
cently been assigned to the subclass Thraustochytridae (Chromista, Het-
erokonta), aligning them more closely with the heterokont algae (e.g., brown
algae and diatoms) [411].
In research on microheterotrophic PUFA production, particular attention
has been given to the thraustochytrids since their lipids contains proportion-
ately large quantities of ω3 PUFA and particularly DHA [357].
Bowles et al. [386] have screened 57 thraustochytrids isolates from three
different locations. Although a common fatty-acid profile for the thraus-
tochytrid isolates emerged ((n-3) PUFA as a significant component, as previ-
ously found [?]), there was considerable difference in the DHA content of the
oil. This large variation in DHA proportion can also be extended to biomass
and lipid yields depending on the thraustochytrid strains (Table 6). Thus, in
some isolates from a cold-temperate environment, DHA can represent almost
50% of the total FA present while those from a sub-tropical environment pro-
duce higher levels of biomass, with up to 37 (w/w) % oil but with a lower
DHA content [423].
As indicated by Lewis et al. [363], most reports concerning the produc-
tion of PUFA by thraustochytrids have dealt almost exclusively with DHA
production (Table 6), as this compound is often the most abundant PUFA pro-
duced by strains of thraustochytrids reported to date. However, it is evident
that some thraustochytrid strains also produce other PUFA. Thus, Huang et
al. [354] have shown that the fatty acid profiles of DHA-producing thraus-
tochytrids could be used to classify them into five separate categories:
– DHA/DPA (docosapentaenoic acid; C22:5 (n-6)),
– DHA/DPA/EPA,
– DHA/EPA,
– DHA/DPA/EPA/AA
– DHA/DPA/EPA/AA/DTA (docosatetraenoic acid, C22:4 (n-6)).
Their seven isolates from Japan and Fiji were proved to be new thraus-
tochytrids by their specific insertion sequences in the 18S rRNA genes. The
phylogenetic tree constructed by molecular analysis of 18S rRNA genes from
those isolates and typical thraustochytrids shows that strains with the same
PUFA profile form each monophyletic cluster. These results suggest that the
C20–22 PUFA profile may be applicable as an effective characteristic for
grouping thraustochytrids. Moreover, Bowles et al. [423] have shown that,
among their 57 thraustochytrids, all synthesized the ω6 PUFA arachidonic
acid in varying amounts, mainly as a minor component of the PUFA and that
EPA was present in the oil produced by all the isolates except two (however
EPA content was generally low, varying from 0.2 to [–(%w/w)]0.6 of the dried
thraustochytrid cells). So, although about 15 strains of thraustochytrids, in-
cluding Thraustochytrium aureum, T. roseum, T aggregatum, Schiizochytrium
limacinum and S. aggregatum, have been reported to produce significant
amounts of DHA (Table 6), there are many potential strains yet to be ex-
plored [363, 424].
As indicated by Hammond et al. [425], there are no reports in the liter-
ature of direct human consumption of thraustochytrids. This is due to the
fact that, prior to the late 1980s, thraustochytrids had never been cultured
on a scale larger than a laboratory shake flask. Barclay [422] and Bajpai
et al. [414, 415] were the first to successfully cultivate Schizochytrium sp. and
Thraustochytrium sp., respectively, in fermenters (two patents have been filed
detailing the cultivation of thraustochytrid strains to produce lipids con-
taining EPA and DHA [422, 426]). However, thraustochytrids are primarily
consumed by filter-feeding invertebrates in the marine ecosystem, includ-
ing mussels and clams, and by fish that are consumed directly by humans.
Thus, in the last few years, thraustochytrids have been successfully used for
commercial production of PUFA-rich products notably in aquaculture ap-
plications. This is the case for a Schizochytrium strain, which is the basis
for two products marketed for enriching rotifers (Brachionus sp.) and brine
shrimp (Artemia sp.) with PUFA, prior to feeding these organisms to cul-
tured finfish larvae ([427]; www.aquafauna.com; www.sandersbshrimp.com).
OmegaTech commercialized a product for aquaculture applications (HUFA
2000, a spray-dried form of Schizochytrium sp. dried microalgae), which has
been successfully utilized for over seven years as an excellent stable dietary
source of DHA in shrimp larvaculture and finfish (red seabream, Japanese

flounder) culture with no adverse effects. Use of Schizochytrium sp. in these
applications has been found to promote larvae survival and growth [428].
Other uses of thraustochytrid oil are being actively explored. Monsanto
(www.monsanto.com) is producing Schizochytrium sp.–derived oil under
a cooperative technology agreement with OmegaTech (www.omegadha.com).
Moreover, dried Schizochytrium microalgae (DRM, OmegaTech) have also
been generally recognized as safe (GRAS) for use as a DHA-rich ingredi-
ent in broiler chicken and laying-hen feed at levels up to 2.8–4.3%, respec-
tively [429]. Since 1997, DHA-enriched eggs from hens fed a diet containing
approximately 1% DRM are now commercially marketed in the United States,
Mexico, Germany, Spain, Portugal, the Benelux countries, Italy, Norway, and
Israel [430].
These products have entered the market in direct competition with mi-
croalgal and fish-oil products. It is possible, however, that thraustochytrids
will offer some advantage over other oils as sources of PUFA for aquacul-
ture. Many aquaculture species require proportionally more DHA than EPA
in their diet [431]. The PUFA profiles of many thraustochytrids fit this cri-
terion, while most oils from the fish-meal industry contain more EPA than
DHA. However it has to be noticed that a recent study [432] has revealed
that the replacement of fish oil with a dried product made from a thraus-
tochytrid culture in canola-oil-based diets for Atlantic salmon could affect
the disease resistance of fishes. Indeed, if the authors didn’t observe signifi-
cance differences in final weight, weight gain, feed consumption, feed efficient
ration or protein value between the diets, nor in whole-body chemical com-
position, organ somatic indices or measures of immune function, they have
noticed that, following transfer to seawater and two challenges with Vibrio
anguillarum, cumulative mortality was significantly lower in fish fed some
fish oils than the others. They concluded that their thraustochytrid strain had
no detrimental effects on the performance of salmon although, at the cur-
rent inclusion of 10%, it failed to confer the same effects as fish oil under
challenging conditions.
In conclusion, as indicated by Lewis et al. [363], thraustochytrids are
clearly a new and potentially competitive player in the PUFA market. Con-
siderable work is required before the production of oil from these organisms
significantly increases its share of the market for PUFA-rich products. To
achieve this aim, the following key stages need to be negotiated. Firstly,
the collection, screening, and maintenance of PUFA-producing strains. Sev-
eral strains with potential for the commercial production of DHA-rich oils
have been isolated already. However, if thraustochytrids that produce higher
yields, more attractive PUFA profiles, or other less common but sought-after
PUFA are isolated and optimized, then demand for these isolates and com-
pounds may well increase. Secondly, the efficiency of PUFA production must
be optimized. The types and amounts of PUFA produced by individual strains
100
Table 6 Docosahexaenoic acid (DHA) production by thraustochytrids [350]
Age Temp Vessel Other Biomass Lipid Refs.

(d) (◦ C) (g/L) (% dw) (% TFA) (mg/g) (mg/L)
Shizochytrium sp. 2.5 28 Fermenter PH. 4 21 50 35 224 4700 [412]

SR21
Shizochytrium sp. 4 Fermenter – 48 77 36 277 13 300 [413]

SR21 300 rpm
S. Limacium 5 25 Flask – 38 37 33 110 4200 [357]

SR21
S. aggregatum 10 25 Flask Dark 0.9 – 1.7 30 0.4 [360]

ATCC 28209 200 rpm
Thraustochytrium 6 25 Flask Light 3.8 16.5 49 70 270 [414]

aureum 300 rpm
ATCC 34304
J.-P. Bergé · G. Barnathan
Table 6 (continued)
Age Temp Vessel Other Biomass Lipid Refs.

(d) (◦ C) (g/L) (% dw) (% TFA) (mg/g) (mg/L)
T. aureum 6 25 Flask Light 4.9 20.3 [415]

Fatty acids from marine I
ATCC 34304 300 rpm 51 104

511 1
T. aureum 2.5 25 Flask Light 5.7 8.1 40 – – [356]

ATCC 34304
T. aureum 6 25 Flask Dark 0.8 – 3.7 50 4.0 [360]

ATCC 28211 200 rpm
T. roseum 5 25 Flask Light 7.6 18.2 50 87 650 [416]

ATCC 28210 250 rpm
T. roseum 12 25 Flask Fed 17.1 25 49 115 2100 [417]

ATCC 28210 250 rpm batch
Thraustochytrium sp. 4 25 Flask – 2.7 7.3 35 25 68 [418]

ATCC 20892 200 rpm
Thraustochytrium sp. 6 28 Flask Light 7.5 32 25 –+ – [419]

ATCC 20892 120 rpm
101
of thraustochytrids are susceptible to manipulation by varying culture condi-

tions. Enhancement of PUFA profiles using molecular techniques may be also
considered. Different markets will provide demand for strains that produce
high levels of PUFA measured either in terms of biomass (i.e., PUFA pro-
duction w/w cell mass) or volume (i.e., PUFA production w/vol fermentation
medium). Thirdly, appropriate conditions for long-term storage of micro-
bial cells and their products must be determined. The form and stability of
thraustochytrid biomass and of oils will be major factors in determining the
suitability of these products for use as food additives. Finally, oil extraction
and refinement technologies must be developed to meet market demands
for cost-effective and safe trophic transfer of PUFA to the target consumers.
The bottom line for the biotechnological future of thraustochytrid oils will
be their competitiveness against other PUFA-rich oils. Nevertheless, oils de-
rived from fish and microalgae generally have a complex fatty acid (total
and polyunsaturated) profile, and do not readily lend themselves to the iso-
lation of high-purity (> 98%) FA. Conversely, oils produced by some thraus-
tochytrids have relatively simple fatty-acid profiles and may well be more
amenable to cost-effective refinement. DHA is a good illustration of the in-
dustrial potential of thraustochytrids. Thus, the largest potential market for
microbial oils containing DHA is perceived to be as an additive to infant for-
mulae as an essential fatty acid for brain and retinal development (see section
on health benefit); Ratledge [362] considered that the presence of significant
quantities of EPA in the thraustochytrid oils so far assessed precluded its
use for this purpose. Indeed, eicosapentaenoic acid is considered contraindi-
catory in breast milk substitutes, but strain selection will easily allow this
difficulty to be overcome [423].
10.5.1.3
Conclusions
Growing interest in PUFA applications in various fields coupled with their

significance in health and dietary requirements (see section on health bene-
fit) has encouraged “hunting” for more suitable sources of these compounds.
The inadequacy of conventional agricultural and animal oils has put attention
on developing new microbial technologies. Indeed, microorganisms repre-
sent the largest reservoir of undescribed biodiversity, and hence possess the
greatest potential for the discovery of new natural products. It is estimated
that the Earth currently supports 3–30 million species of organisms. Of these,
approximately 1.4 million have been described by science. This includes vir-
tually all the species of birds and mammals (∼ 13 500). In contrast only
around 200 000 of the estimated 1.0–1.5 million species of fungi have been
characterized (i.e. 13–20%). For the bacteria this percentage is even lower
with estimates ranging from only 1–10% of probable species being described
in culture [433, 434].
However, the focus of biotechnology on highly valuable PUFA requires

knowledge of how microorganisms control and regulate the fatty-acid biosyn-
thetic machinery in order to obtain specific PUFA in high yield.
Elucidation of the signalling systems and mechanisms transmitting the
signals from different membranes to the major sites of lipid biosynthetic ma-
chinery represents a challenging and potentially rewarding subject for further
research [435]. At least, the extensive research and development of PUFA pro-
duction carried out over the past few years will be aimed at improving the
economic competitiveness of microbial lipids compared to plant- and animal-
derived oils.
Nowadays, by using conventional stirred-tank fermenters, economically
viable quantities of certain microorganisms that are rich in LC-PUFA can be
produced [436]. The chief advantages of such techniques lie in the consis-
tency and purity of the final fatty acid product. Further, unlike the scenario
with fish oils, economies of scale have reduced the price of oils derived from
organisms raised in fermenters by 10- to 30-fold [437].
10.5.2
PUFA from fish
Fish is a major source of food for mankind, providing a significant amount

of the animal protein diet in many countries. Moreover, the consumption of
fish has been linked to health benefits (see section on health benefit). Indeed,
oils from fish are characterized by a large range of FA from 12–26 carbon
atoms and 0–6 double bonds. The bulk of the fatty acid chains is contributed
by saturated (15–25%), monoenes (35–60%) and polyenes (25–40%). In con-
trast with the other fats and oils, fish oils contain large amounts of EPA and
DHA, respectively, 14–19% and 5–8%. The proportion of polyunsaturated FA
depends on many parameters (see below). Saturated FA include C12 up to
C24:0 components, and some branched chains (iso C16, iso C17.) are also
found. Among the monoenes, 16:1(n-7), 20:1(n-9) and 22:1(n-11) are present
in various amounts, this last component being bioconverted from the corres-
ponding fatty alcohol of copepod wax ester by the fish liver [438]. More than
50 different FA were described in marine fish oil, but eight species frequently
represent more than 80% of the total amount (Table 7).
In fish tissues, the composition of FA (mainly of triacylglycerols and to
a lesser extend of phospholipids), is determined by diet composition and lipid
metabolism [439, 440]. Fish have the ability to synthesize de novo the satu-
rated and monounsaturated FA and also to selectively absorb and metabolize
dietary FA including LC-PUFA [440, 441] in order to obtain an optimal fatty
acid composition [442]. This optimal composition seems to be a character-
istic for each species and even each strain [443, 444]. Moreover, the PUFA
conversion capacity in fish varies among species and even races [439]. Thus,
freshwater fish are generally able to elongate and desaturate α-linolenic acid
Table 7
Menhaden Herring
14:0 7–12 5–8

16:0 15–26 10–19
16:1(n-7) 9–16 6–12
18:0 2–4 1–2
18:1(n-9) 8–14 9–25
20:1(n-9) – 7–20
20:5(n-3) 11–16 4–15
22:1(n-11) <1 7–30
22:6(n-3) 5–14 2–8
(18:3(n-3)) to EPA and DHA, whereas marine fish, which lack or have a very
low activity of ∆5-desaturase, cannot and require LC-PUFA such as EPA and
DHA in the diet [440].
In addition to food accessibility and lipid metabolism some environmen-
tal parameters also notably influence the proportion of PUFA [445]. Indeed,
the colder the water, the higher the amount of these components. An inher-
ent property of cells in poikilothermic animals is their capacity to adjust the
physicochemical characteristics of their membranes to the prevailing tem-
peratures. This phenomenon, known as homeoviscous adaptation of mem-
brane fluidity, has been reported in poikilothermic fish [446]. In fish, during
adaptation to reduced temperatures, unsaturation of the constituent FA in-
creases, with the polar head group as well as the molecular species composi-
tion of membrane phospholipids being reorganized [202]. Evidence suggests
that the fatty acid distribution is very individual from species to species
and depends on many factors like season, temperature, fishing ground, fish
species, age, gender or nutritional habits [447–452].
The FA distribution in triacylglycerols is stereospecific [www.cyberlipid.
org]. Indeed, results indicate that the stereospecific location of the PUFA is in
position 2 (also 3 for EPA in cod) in fish but in position 3 for mammals (same
in seal, whale and polar bear). This raises the question of the availability of
these FA from food expecting a benefic effect on diverse human functions (see
section on health benefit).
Familiar fish species used in the production of fish oil include among
others, anchovies, capelin, Atlantic cod, Atlantic herring, Atlantic mackerel,
Atlantic menhaden, salmonids, sardines (see section on market and sources).
Of the world’s fish oil production, 90% is produced from fatty fish where
lipids are localized mainly under the skin, around the intestines or in the
white muscle. In such fishes, the oil content varies (see above) but it can reach
21% (herring) and 18% (sardines). Such oils are still the least-expensive natu-
ral source of preformed long-chain PUFA, and several industries (e.g., Ocean
Nutrition, Halifax, N.S., Canada, and Pronova Biocare, Sandefjord, Norway)

now specialize in their production and purification through cold pressing,
further concentration by winterization (i.e., chilling), and other technolo-
gies [431].
There are, however, potential problems associated with fish oils as a source
of PUFA such as: taste, odor, stability problems as well as the presence of co-
extracted contaminants. Some could be at least partially solved for example
by microencapsulation [453] and deodorization [454]. Nevertheless, the cru-
cial problem of those oils is their sustainability due to the worldwide decline
of fish stocks (see section on market). A better use of raw material but as well
of by-catch and by-products from fisheries may be one solution, another is
to look for other sources (see above) including non- or little-exploited fish
species.
Lipid content has been studied for a long time mainly in the liver and ed-
ible parts of fish such as muscles. Several investigations have evidenced that
other parts i.e. liver and skin, often discarded for several reasons when fish
are prepared for consumption, may have possible nutritional and therapeutic
value mainly due to their EPA and DHA content [445, 455]. Indeed valuable
fish oils can be obtained from trash fish and/or fish scraps or cannery wastes,
which are often called “gurry” from filleting and canning operations. Fish
scraps normally consist of the head, skeleton, and adhering proteinaceous
tissues.
Surprisingly, it can also be observed that often no detailed chemical stud-
ies of the lipid and fatty acid content of certain fish are available, even
though the fish most often consumed or commercially exploited, such as for
example the species Sardinella and Cephalopholis in Senegal waters [455].
Capelin, squid liver, krill (Euphausia superba) could constitute sustainable
new sources [437].
10.6
Current utilization of marine oils and lipids
10.6.1
Market
10.6.1.1
Production
From a world production of oil and fat of about 20 million tons in 1939, about
77 million tons were produced in 1989 where 74% were of vegetal origin (soy-
bean 19% > palm 13% > rapeseed 10.3% > sunflower 9.6%). In 2003–2004 the
global production of fats and oils is expected to be 128.5 million tons with
82% of vegetal origin. The world average consumption of oils and fats in 2003
is about 20 kg per capita [www.cyberlipid.org].
Of the estimated 89 million tons of fish produced in 2000 in the world,

excluding China, nearly 71 percent (63 million tons) was used for direct hu-
man consumption. The remainder (about 29 percent) was utilized for various
nonfood products, mostly for reduction to meal and oil (the state of world
fisheries and aquaculture, 2002 FAO). Indeed, nowadays, a third of the world’s
catch from the seas is going into manufacturing fish meal and fish oil. Thus,
the world production of marine oils represent approximately 1% of the com-
modity world fats and oils production (Table 8).
Remark: the International Fishmeal and Fish Oil Organisation (IFFO) is
the international nongovernmental trade organization representing fish meal
and oil producers worldwide. It has more than 200 member companies in 38
countries. Two-thirds of the world’s production of fish meal and fish oil are
members of the IFFO and 95% of the exports of fish meal and oil are also part
of the IFFO.
Chile, Peru, Scandinavia, USA and Japan are the main suppliers of fish oil
(Fig. 24). The average world production between 1991 and 2001 was about
1.25 million tons of fish oil produced annually. Important fluctuations in pro-
duction can be observed, they were due to the El Niño phenomenon mostly
in Chile and Peru. In 1998, which was the big El Niño year, the production
of these two countries only reached 210 000 tons while the average over the
last five years was 520 000 tons (the total catch volume by Peruvian fisheries
was reduced to 3696 million tons, only 45% of the 2002 catch of 8238 mil-
lion tons). However, due to better prediction of such climatic occurrence, the
governments concerned are increasingly proactive in anticipating and taking
precautionary measures for fishing. Thus, precautionary approach to fisheries
management has been maintained (in Peru notably) to safeguard the viability
and prevent depletion of stocks through overfishing. Careful management of
the fishery and a return to normal environmental conditions allowed stocks
to recover in 1999 and 2000.
Table 8 Production (million tonnes) for 17 commodity oils in the four-year period
1998/99 to 2001/02 [456]
98/99 99/00 00/01 01/02
Total production 107.6 113.5 117.3 119.7

Soybean 24.60 25.30 27.10 29.40
Palm 19.40 21.30 23.70 24.30
Rapeseed 12.70 14.50 13.90 13.40
Sunflower 9.30 9.50 8.70 7.50
Other vegetal oils 19.70 20.50 21.70 22.40
Fish 0.86 1.38 1.42 1.12
Other animal fats and oils 21.04 21.02 20.78 21.58
Fig. 24 World fish body oil production – major producers (IFFO)
10.6.1.2
Exportation
The major exporters are mainly the same countries, with the noticeable ex-
ception of Japan that is rather now a net importer (Fig. 25). Over the past
Fig. 25 World marine oils and fats exports by major exporters (IFFO)
decade fish oil exports by Peru (the main exporting country) have expanded
by almost twelve times (US$ 91.1 million in 2001). However, Peru’s exporta-
tion is variable; it can be enormous (up to 500 000 tons in 2000) or very small,
notably during El Niño periods. The second main fish oil exporter is now the
USA (US$ 41.7 million in 2001).
10.6.1.3
Consumption
Consumption of fish oils by countries is indicated in Fig. 26. Most of the fish
oil goes into salmonid feed in Norway, Chile, Canada and various European
countries, which is the reason for the predominance of these countries in
terms of consumption.
Remark: fish oil is included in aquaculture feeds as a source of both di-
etary energy and PUFA. Considerable research is occurring worldwide in an
effort to find alternatives to fishmeal and fish oil in aquaculture feeds. How-
ever, this research is tempered by the obligate dietary requirement of many
marine finfish species for long-chain PUFA (LC-PUFA: e.g., EPA and DHA).
Aquaculture has been the world’s fastest-growing food production over
a decade [438]. The world aquaculture production has at least multiplied by
a factor of two in the last ten years: 24 457 421 tons live weight in 1993 and
48 413 636 tons live weight in 2001 (Eurostat and FAO sources). The Interna-
tional Fishmeal and Oil Manufacturers Association [www.iffo.com] estimates
Fig. 26 World marine oil consumption and stocks – major consumers (IFFO)
that inclusion of fish oil in aquaculture feeds will rise from 380 000 tons
in 1994 to 582 000 tons in 2001 and 1 133 000 tons in 2010 (Table 9). With
aquafeed demand at about 1 million tons of fish oil in 2010, depending on
the production of fish oil it could be around 80% or even close to 100%.
This could well result in a worldwide undersupply of fish oil, leading to in-
creased demand for fish oil alternatives. Moreover, this lack of fish oil will
have an impact on aquafeed composition. It seems likely that cheap, plant- or
animal-derived oils, which often contain low levels of LC-PUFA, will be used
increasingly as alternative sources of energy in some aquaculture feeds. If
such substitution does occur, sufficient LC-PUFA to meet the dietary require-
ments of cultured aquaculture species may be required from other sources.
Typically, many cultured marine species require around 1% to 2 wt/wt % LC-
PUFA in their diets [457, 458]. Pike and Barlow [459] estimated that marine
aquaculture finfish species will require about 2 × 106 tons of feed in 2010.
These figures point to a potential demand, for these species alone, for at least
10 000 tons of LC-PUFA per annum (Table 10).
In addition to aquafeed, the current and potential world market for fish oil
products spans a number of sectors from unprocessed, oil-rich biomass for
animal feeds, to high-quality food-grade oils for use as food additives and nu-
traceuticals, and to very-high-purity oils and even individual FA for use in the
pharmaceutical industry (Table 9).
As indicated by Lewis et al. [363], the imprecise boundaries surrounding
the nutraceutical market make estimating the size of this market sector more
difficult. Sales of marine supplement oils were in the order of $55 million in
the United States in 1996 [460], and represented 20% of sales from health food
retail outlets. In the United Kingdom, fish oils account for approximately 29%
(U.S. $140 million) of the total annual market for nutraceuticals [461]. More-
over, there is an increasing trend for infant formula manufacturers to include
PUFA-rich oils in their products. Typical inclusion levels of PUFA-rich oils are
designed to achieve a final DHA concentration in dry infant formula of 0.1%
to 0.2 wt/wt %. Indeed, the Western European market for infant formula in-
creased from 81 500 tons in 1988 to 103 933 tons in 1994. Extrapolating these
figures suggests a potential annual demand in the European infant formula
Table 9 Fish oil use prediction based on an annual world production of 1.25 million
tonnes for the period 2002–2010 [461]
1990 2002 2010
Edible 76% 30% 14%

Industrial 8% 12% 5%
Aquafeed 16% 56% 79%
Pharmaceutical – 2% 2%
Table 10 Predicted use of fish oil in fish feed (data from IFFO)
% of fish oil inclusion in feed produced Thousand tons of fish oil

2000 2010 2000 2010
Carp – 0.5 – 103

Catfish 1.0 – 5 –
Tilapia 1.0 0.5 8 9
Milkfish 2.0 2.0 6 11
Shrimp 2.0 3.0 30 73
Eel 5.0 8.0 17 23
Marine fish1 10.0 12.0 23 156
Trout 15.0 15.0 95 121
Marine fish2 20.0 15.0 226 335
Salmon 25.0 20.0 307 379
TOTAL 716 1209

1 Flat fish including flounder, turbot, halibut, sole and cod, hake
2 Bass, bream, yellowtail, grouper, jacks, mullets
market for up to 100 to 200 tons of DHA. Several food and beverage products
enriched with DHA or other PUFA are already on the market. Mukherjee [461]
reported the availability of products such as enriched spreads, breads, eggs,
and soft drinks in Europe and Japan. Bread enriched with refined tuna oil as
a source of LC-PUFA is achieving substantial market penetration in Australia.
As awareness by both consumers and regulators of the importance of adequate
levels of PUFA in our diet increases, it can be assumed that demand for a greater
range of PUFA-enriched products will increase [363].
10.6.1.4
Prices
The biggest use of fish oils is by the aquaculture industry, where it is neces-
sary to have an oil rich in the long-chain polyunsaturated FA characteristic
of fish oils. For this purpose, therefore, fish oil cannot be adequately replaced
by vegetable oils. To meet this demand there has been a reduction in stocks
and an increase in price. In 2000 and 2001 the average monthly price for crude
fish oil ranged from US$ 235–325/ton and $ 323–598/ton. In January 2002 it
was $613/ton. [Oil World, www.oilworld.org]. In August 2002, crude fish oil
prices peaked (about 650 US$ per ton) and have started to decline ever since.
In November 2002, finally soybean oil prices managed to overtake those of
crude fish oil due to the shorter supply than initially forecast, which make the
latter competitive once more on the hardening market. For 2002, the average
price of crude fish oil from any origin was about US $587/ton; in 2003 it was
about US$ 562/ton (data from Oilworld). Peru’s enormous fish oil production
capacity sets this product’s international prices.
10.6.2
Common resources
Fish oil is a by-product of industrial fishing and the fish meal industry. Fish
oils are produced almost exclusively from small, bony species of pelagic fish
(living in the surface waters or middle depths of the sea), for which there is
little or no demand for human consumption [Fishmeal Information Network,
www.fin.org.uk]:
South America (three species)
In Peru, anchovy is by far the most important species for fishmeal and fish oil
production, with sardine largely making up the difference. The Chilean fish-
meal industry uses anchovy, sardine and jack mackerel.
Europe (seven species)
Seven key species are used to produce fishmeal and fish oil in Europe. These
can be divided into three groups:
a) No use for human consumption (inedible feed-grade fish – sandeel, capelin,
Norway pout).
b) Potential use for human consumption but mainly used for fishmeal be-
cause of limited outlets for human consumption (blue whiting, sprat).
c) Primary use is human consumption but surplus may be used for fishmeal
(herring, horse mackerel).
Fishmeal production also provides a major outlet to recycle trimmings from
the food-fish processing sector which would otherwise be dumped at ex-
tra cost to the environment and the consumer. In the EU, Spain, France,
Germany, Ireland and the UK produce fishmeal and fish oil primarily from
trimmings.
Global capture fisheries, i.e. catches of wild fish as distinct from farmed
fish, are valuable and finite resources which, although renewable, are highly
vulnerable. Moreover, overfishing has caused the collapse or near collapse
of some valuable fisheries. Overexploiting one fish species can affect other
species, not least birds and mammals, in the marine ecosystem. This situation
has generated understandable and justifiable pressure for environmentalists
to reduce fishing effort and catches further by introducing tighter regulatory
measures [438].
References
1. Sargent JR (1995) Origins and functions of egg lipids: nutritional implications. In:
Bromage NR, Roberts RJ (eds.), Broodstock Management and Egg and Larval Qual-
ity. Blackwell Science, Oxford, p 353
2. Sargent JR, Bell MV, Bell JG, Henderson RJ, Tocher DR (1995) Origins and func-
tions of n-3 polyunsaturated fatty acids in marine organisms. In: Cevc G, Paltauf F
(eds.), Phospholipids: Characterization, Metabolism and Novel Biological Applica-
tions. AOCS, Champaign, Illinois, p 248
3. Pazos AJ, Roman G, Acosta CP, Sanchez JL, Abad M (1997) Comp Biochem Physiol
117B:393
4. Ackman RG (ed.) (1989) Marine Biogenic Lipids Fats and Oils. Vol I II. CRC, Boca
Raton, Florida
5. Rezanka T (1989) Progr Lipid Res 28:147
6. Christie WW (ed) (2003) Lipid Analysis, Isolation, Separation, Identification and
Structural Analysis of Lipids. The Oily Press, PJ Barnes, Brigwater, UK
7. Hagen W, Auel H (2001) Zoology 104:313
8. Dalsgaard J, St John M, Kattner G, Müller-Navarra D, Hagen W (2003) Adv Mar Biol
46:227
9. Fattorusso E, Mangoni A (1997) Marine Glycolipids. In: Hertz W, Kirby GW, Moore
RE, Steiglich W, Tamm W (eds), Progress in the Chemistry of Organic Natural Prod-
ucts. Springer, Wien, p 215
10. Costantino V, Fattorusso E, Mangoni A, Di Rosa M, Ianaro A (1997) J Am Chem Soc
119:12 465
11. Costantino V, Fattorusso E, Imperatore C, Mangoni A (2003) Eur J Org Chem 1433
12. Crul M, Mathot RAA, Giaccone G, Punt CJA, Rosing H, Hillebrand MJX, Ando Y,
Nishi N, Tanaka H, Schellens J, Beijnen JH (2002) Cancer Chemotherap Pharmacol
49:287
13. Ackman RG (2002) Anal Chim Acta 465:175
14. Napolitano GE, Pollero RJ, Gayoso AN, MacDonald BA, Thompson RJ (1997)
Biochem Syst Ecol 25:739
15. Zhukova NV, Titlyanov EA (2003) Phytochemistry 62:191
16. Hooper JNA, Van Soest RWM (2002) Systema Porifera: A Guide to the Classification
of Sponges, Kluwer Academic/Plenum, New York
17. Gurr MI, Hardwood JL (1991) Lipid Biochemistry: An Introduction. Chapman Hall,
London, UK
18. Cook HW (1996) Fatty acid desaturation and chain elongation in eukaryotes. In:
Biochemistry of Lipids, Lipoproteins and Membranes. Vance DE, Vance JE (eds),
Elsevier Scientific, Amsterdam, p 129
19. Sargent JR, Henderson RJ (1986) Lipids. In: The biological chemistry of marine
copepods, Vol 1, EDS Corner and SCM O’Hara (eds.), Clarendon, Oxford, UK, p 59
20. Kattner G, Hagen W (1995) ICES J Mar Sci 52:329
21. Sprecher H (1992) Omega-3 News 7:1
22. Sprecher H (2000) Biochim Biophys Acta 1486:219
23. Williard DE, Nwankwo JO, Kaduce TL, Harmon SD, Irons M, Moser HW, Raymond
GV, Spector AA (2001) J Lipid Res 42:501
24. Henderson RJ (1999) The production of n-3 polyunsaturated faty acids in marine
organisms. In: Lipid Technology, Barnes PJ, UK, p 5
25. Nichols DS (2003) FEMS Microbiol Lett 219:1
26. Nadjek M, Debobbis D, Miokovic D, Ivancic I (2002) J Plankton Res 24:494
27. Harvey HR, Macko SA (1997) Organic Geochem 26:531
28. Budge SM, Parrish CC (1998) Organic Geochem 29:1547
29. Budge SM, Parrish CC, McKenzie CH (2001) Mar Chem 73:285
30. Russel NJ, Nichols DS (1999) Microbiology 145:767
31. Nichols DS, McMeekin TA (2002) J Microbiol Meth 48:161
32. Pond DW, Allen CE, Bell MV, Van Dover CL, Fallik AE, Dixon DR, Sargent JR (2002)
Mar Ecol Progr Ser 225:219
33. Yu R, Yamada A, Watanabe K, Yazawa K, Takeyama H, Matsunaga T, Kuranr R (2000)
Lipids 35:1061
34. Hannun YA, Obeid LM, Dbaibo GS (1996) Handbook of Lipid Research, Vol 8, p 177
35. Wha Sona B, Chul Kima J, Dae Choib H (2001) Lipids 36:427
36. Dembitsky VM, Srebnik M (2002) Progr Lipid Res 41:315
37. Wu M, Milligan KE, Gerwick WH (1997) Tetrahedron 53:15 983
38. Kan Y, Sakamoto B, Fujita T, Nagai H (1998) J Nat Prod 61:152
39. Mesguiche V,Valls R, Piovetti L, Peiffer G (1999) Tetrahedron Lett 40:7473
40. Kan Y, Sakamoto B, Fujita T, Nagai H (2000) J Nat Prod 63:1599
41. Falk-Petersen S, Sargent JR, Henderson J, Hegseth EN, Hop H, Okolodkov YB (1998)
Polar Biol 20:41
42. Henderson RJ, Hegesth EN, Park MT (1998) Polar Biol 20:48
43. Volkman JK, Barett SM, Blackburn SI, Mansour MP, Sikes EL, Gelin F (1998) Organic
Geochem 29:1163
44. Reuss N, Poulsen LK (2002) Mar Biol 141:423
45. Viso AC, Marty JC (1993) Phytochemistry 34:1521
46. Viron C, Saunois A, André P, Perly B, Lafosse M (2000) Anal Chim Acta 409:257
47. Mostaert AS, Karsten U, Hara Y, Watanabe MM (1998) Phycol Res 46:213
48. Cho ES, Rhodes LL, Kim HK (1999) J Fish Sci Tech 2:58–65
49. Marshall JA, Nichols PD, Hallegraeff GM (2002) J Applied Phycol 14:255
50. Khozin-Goldberg I, Zheng Yu H, Adlerstein D, Didi-Cohen S, Heimer YM, Cohen Z
(2000) Lipids 35:881
51. Budge SM, Parrish CC (1999) Phytochemistry 52:561
52. Bergé JP, Gouygou JP, Dubacq JP, Durand P (1995) Phytochemistry 39:1017
53. Xu XQ, Beardall J, Hallam ND (1998) Phytochemistry 49:1249
54. Bell MV, Dick JR, Pond DW (1997) Phytochemistry 45:303
55. Arzul G, Gentien P, Bodennec G, Toularastel F, Youenou A, Crassous MP (1998) Po-
tential toxicity of microalgal polyunsaturated fatty acids. In: Baudimant G, Guezen-
nec JH, Roy P, Samain JF (eds.), Marine Lipids, IFREMER, Plouzané, France, p 53
56. Bodennec G, Gentien P, Parrish CC, Crassous MP (1998) Lipid class and fatty acid
compositions of toxic Gymnodinium and Heterosigma strains: haemolytic and sig-
nature compounds. In: Baudimant G, Guezennec JH, Roy P, Samain JF (eds.), Marine
Lipids, IFREMER, Plouzané, France, p 66
57. Mansour MP, Volkman JK, Holdsworth DG, Jackson AE, Blackburn SI (1999a) Phy-
tochemistry 50:541
58. Mansour MP, Volkman JK, Jackson AE, Blackburn SI (1999b) J Phycol 35:710
59. Rezanka T (1990) J Chromatogr 513:344
60. Van Pelt CK, Huang MC, Tschanz CL, Brenna JT (1999) J Lipid Res 40:1501
61. Tanaka I, Matsuoka S, Murata M, Tachibana K (1998) J Nat Prod 61:685
62. Li X, Fan L, Lou Q (2002) Phytochemistry 59:157
63. Fleurence J, Gutbier G, Mabeau S, Leray C (1994) J Applied Phycol 6:527
64. Khotimchenko SV, Vaskovsky VE, Titlyanova TV (2002) Botanica Marina 45:17
65. Graeve M, Kattner G, Wiencke C, Karsten U (2002) Mar Ecol Progr Ser 231:67
66. Sajiki J, Kakimi H (1998) J Chromatogr 795A:227
67. Kornprobst JM, Barnathan G (1998) Recent Res Dev Lipid Res 2:371
68. Carballeira NM (2002) Progr Lipd Res 41:433
69. Barnathan G, Bourgougnon N, Kornprobst JM (1998) Phytochemistry 47:761
70. Smith SL, Schnack-Schiel SB (1990) Polar zooplankton. In: Smith WO (ed), Polar
Oceanography, Part B: Chemistry, Biology and Geology, Academic, San Diego, Cali-
fornia, p 527
71. Albers CS, Kattner G, Hagen W (1996) Mar Chem 55:347
72. Atkinson A, Snyder R (1997) Mar Ecol Progr 160:63
73. Mayzaud P, Albessard E, Cuzin-Roudy J (1998) Mar Ecol Progr Ser 173:19
74. Pond DW, Sargent JR (1998) J Plankton Res 20:169
75. Kattner G, Hagen W, Graeve M, Albers C (1998) Mar Chem 61:219
76. Kattner G, Hagen W (1998) Mar Ecol Progr Ser 170:203
77. Falk-Petersen S, Sargent JR, Lonne OJ, Timofeev SF (1999) Polar Biol 21:37
78. Falk-Petersen S, Hagen W, Kattner G, Clarke A, Sargent J (2000) Can J Fish Aquat Sci
57:178
79. Falk-Petersen S, Dahl TM, Scott CL, Sargent JR, Gulliksen B, Kwasniewski S, Hop H,
Millar RM (2002) Mar Ecol Progr Ser 187:187
80. Scott CL, Falk-Petersen S, Dahl TM, Sargent JR, Hop H, Lonne AJ, Poltermann M
(1999) Polar Biol 21:65
81. Scott CL, Kwasniewski S, Falk-Petersen S, Millar RM, Sargent JR, (2000) Polar Biol
23:510
82. Jones PJH, MacDougall DE, Ntanios P,Vanstone CA, Mayzaud P, Albessard E, Cuzin-
Roudy J (1998) Mar Biol Progr Ser 173:149
83. Cripps GC, Watkins JL, Hill HJ, Atkinson A (1999) Mar Ecol Progr Ser 181:177
84. Cho KW, Shin J, Jung K (1999) Ocean Res 21:109
85. Nelson MM, Phleger CF, Mooney BD, Nichols PD (2000) Lipids 35:551
86. Nelson MM, Mooney B, Nichols PD, Phleger CF (2001) Mar Chem 73:53
87. Phleger CF, Nelson MM, Mooney B, Nichols PD (2000) Polar Biol 23:329
88. Phleger CF, Nichols PD, Virtue P (1998) Comp Biochem Physiol 120B:311
89. Phleger CF, Nelson MM, Mooney B, Nichols PD (1999) Comp Biochem Physiol
124B:295
90. Swadling KM, Nichols PD, Gibson JAE, Ritz DA (2000) Mar Ecol Prog Ser 208:171
91. Litchfield C, Morales RW (1976) Are Demospongiae membranes unique in living or-
ganisms? In: Harrison FW, Cowden RR (eds.), Aspects of Sponge Biology, Academic,
New York, p 183
92. Bergquist P (ed) (1978) Sponges. Hutchinson University Library, London
93. Djerassi C, Lam WK (1991) Acc Chem Res 24:69
94. Christie WW, Brechany EY, Marekov IN, Stefanov KL, Andreev SN (1994) Comp
Biochem Physiol 109B:245
95. Carballeira NM, Emiliano A, Hernandez-Alonso N, Gonzalez FA (1998) J Nat Prod
61:1543
96. Barnathan G, Kornprobst JM (1998) Fatty acids from marine organisms: recent re-
search developments. In: Baudimant G, Guezennec J, Roy P, Samain JF (eds), Marine
Lipids. IFREMER, Brest, France, p 35
97. Barnathan G, Kornprobst JM (1998) Recent Res Devel Lipids Res 2:235
98. Carballeira NM, Shalabi F (1993) J Nat Prod 56:739
99. Barnathan G, Kornprobst JM, Doumenq P, Mirallès J (1995) Lipids 31:193
100. Carballeira NM (1997) Recent Res Develop Lipid Res 1:9
101. Carballeira NM, Alicea J (2001) Lipids 36:83
102. Barnathan G, Genin E, Velosaotsy NE, Kornprobst JM, Al-Lihaibi S, Al-Sofyani, Non-
gonierma R (2003) Comp Biochem Physiol 135B:297
103. Makarieva TN, Santalova EA, Gorshkova IA, Dmitrenok AS, Guzii AG, Gorbach VI,
Svetashev VI, Stonik VA (2002) Lipids 37:75
104. Rodkina SA, Latyshev NA, Imbs AB (2003) Russ J Bioorg Chem 29:382
105. Meyer M, Guyot M (2002) Lipids 37:1109
106. Nemoto T, Yoshino G, Ojika M, Sakagami Y (1997) Tetrahedron 53:166 699
107. Li Y, Ishibashi M, Sasaki T, Kabayashi J (1995) J Chem Res (S):126
108. Li Y, Ishibashi M, Sasaki T, Kabayashi J (1995) J Chem Res (M):901
109. Carballeira NM, Medina JR (1994) J Nat Prod 57:1688
110. Carballeira NM, Reyes M (1995) J Nat Prod 58:1689
111. Carballeira NM, Reyes ED, Sostre A, Rodriguez AD, Rodriguez JL, Gonzales FA
(1997) J Nat Prod 60:502
112. Kawakami A, Miyamoto T, Higuchi R, Uchiumi T, Kuwano M, Van Soest RWM
(2001) Tetrahedron Lett 42:3335
113. Carballeira NM, Pagan M (2000) J Nat Prod 63:666
114. Nechev J, Christie WW, Robaina R, de Diego F, Popov S, Stefanov K (2002) Eur J
Lipid Sci Technol 104:800
115. Nechev J, Christie WW, Robaina R, de Diego FM, Ivanova A, Popov S, Stefanov K
(2002) Hydrobiologia 489:91
116. Nechev J, Christie WW, Robaina R, de Diego F, Popov S, Stefanov K (2004) Comp
Biochem Physiol 137A: 365
117. Carballeira NM, Pagan M (2001) J Nat Prod 64:620
118. Thiel V, Jenisch A, Worheide G, Lowenberg A, Reitner J, Michaelis W (1999) Org
Geochem 30:1
119. Kornprobst JM, Barnathan G (2000) Recent Res Progr Lipid Res 2:371
120. Ayanoglu E, Kornprobst JM, Aboud-Bichara A, Djerassi C (1983) Tetrahedron Lett
24:1111
121. Ayanoglu E, Popov S, Kornprobst JM, Aboud-Bichara A, Djerassi C (1983) Lipids
18:830
122. Carballeira NM, Alicea J (2002) Lipids 37:305
123. Carballeira NM, Colon R (1999) Tetrahedron Asymmetry 10:3785
124. Soderquist JA, Rosado I, Marrero Y (1998) Tetrahedron Lett 39:3115
125. Quinn RJ, Tucker DJ (1985) Tetrahedron Lett 26:1671
126. Hirsch SC, Carmely S, Kashman Y (1987) Tetrahedron 43:3257
127. Van Soest RWM, Fusetani N, Andersen RJ (1997) Straight-chain acetylenes as
chemotaxonomic markers of the marine Haplosclerida. In: Watanabe Y, Fusetani N
(eds), Sponge Sciences–Multidisciplinary Perspectives, Springer-Verlag, Berlin Hei-
delberg New York, p 3
128. Pham NB, Butler MS, Hooper JNA, Moni RW, Quinn RJ (1999) J Nat Prod 62:1439
129. Matsunaga S, Okada Y, Fusetani N, Van Soest RWM (2000) J Nat Prod 63:690
130. Lee HS, Rho JR, Sim CJ, Shin J (2003) J Nat Prod 66:566
131. Fujita M, Nakao Y, Matsunaga S, Van Soest RWM, Itoh Y, Seiki M, Fusetani N (2003)
J Nat Prod 66:569
132. Zhao QC, Lee SY, Hong JK, Lee CO, Im KS, Lee DS, Sim CJ, Jung JH (2003) J Nat Prod
66:408
133. Hattori T, Adachi K, Shizuri Y (1998) J Nat Prod 61:823
134. Venkateswarlu Y, Srinivasa Reddy N, Ramesh P, Rama Rao M, Siva Ram T (1998)
Indian J Chem 37B:1264
135. Lo JM, Wang WL, Chiang YM, Chen CM (2001) J Chin Chem Soc 48:821
136. Natori T, Morita M, Akimoto K, Koezuka Y (1994) Tetrahedron 50:2771
137. Li HY, Matsunaga S, Fusetani N (1995) Tetrahedron 51:2273
138. Koezuka Y, Motoki K, Sakai T, Natori T (1999) Recent Res Dev Cancer 1:341
139. Costantino V, Fattorusso E, Mangoni A, Di Rosa M, Ianaro M (1997) J Am Chem Soc

119:12 465
140. Costantino V, Fattorusso E, Mangoni A (2000) Tetrahedron 56:5953
141. Costantino V, Fattorusso E, Mangoni A (2001) Glycolipids with immunomodulat-
ing activity from marine sponges. In: Tringali C (ed.), Bioactive Compounds from
Natural Sources. Taylor Francis, London, New York, Chap 14:557
142. Meguro S, Namikoshi M, Kobayashi H (2002) J Antibiotics 55:256
143. Hayakawa Y, Rovero S, Forni G, Smyth MJ (2003) Proc Nat Acad Sci 100:9464
144. Kobayashi E, Motoki K, Uchida T, Fukushima H, Koezuka Y (1998) Oncol Res 7:529
145. Morita M, Motoki K, Natori T, Sakai T, Sawa E, Yamaji K, Koezuka K, Kobayashi E,
Fukushima H (1995) J Med Chem 38:2176
146. Costantino V, Fattorusso E, Imperatore C, Mangoni A (2002) J Nat Prod 65:883
147. Vysotskii MV, Svetashev VI (1991) Biochim Biophys Acta 1083:161
148. Vysotskii MV, Svetashev VI (1998) Comp Biochem Physiol 119B:73
149. Mirallès J, Barnathan G, Galonnier R, Sall T, Samb A, Gaydou EM, Kornprobst JM
(1995) Lipids 30:459
150. Carballeira NM, Sostre A, Rodriguez AD (1996) Comp Biochem Physiol 113B:781
151. Carballeira NM, Sostre A, Rodriguez AD (1997) Comp Biochem Physiol 118B:257
152. Carballeira NM, Emiliano A, Rodrıguez J, Reyes E (1992) Lipids 27:681
153. Barnathan G, Doumenq P, Mirallès J, Boury-Esnault N, Kornprobst JM (1993) J Nat
Prod 56:2104
154. Carballeira NM, Miranda C, Rodrıguez AD (2002) Comp Biochem Physiol 131B:83
155. Urvois PA, Barnathan G, Biard JF, Débitus C, Verbist JF (1998) Fatty acid com-
position of the New Caledonian gorgonian Rumphella aggregata: identification of
9-methyl-6,9-heptadecadienoic acid. In: Marine Lipids, Baudimant G, Guezennec J,
Roy P, Samain JF (eds.), IFREMER, Brest, p 44
156. Mancini I, Guerriero A, Bakken T, Zibrowius G, Pietra F (1999) Helv Chim Acta
82:677
157. Henderson RJ, Burkow IC, Buzzi M, Bayer A (1998) Biochim Biophys Acta 1392:309
158. Henderson RJ (2000) J Mar Biol Ass UK 80:311
159. Yamashiro H, Oku H, Higa H, Chinen I, Sakai K (1999) Comp Biochem Physiol
122B:397
160. Jeong TS, Ahn JA, Kim YK, Bok SH, Kwon BM, (1999) Bioorganic Medicinal Chem
Lett 7:1481
161. Ota T, Chihara Y, Itabashi Y, Tagaki T (1994) Fisheries Sci 60:171
162. McKenzie JD, Black KD, Kelly MS, Newton LC, Handley LL, Scrimpgeour CM, Raven
JA, Henderson RJ (2000) J Mar Biol Ass UK 80:311
163. Kawasaki KI, Nabeshima YI, Ishihara K, Kaneniwa M, Ooizumi T (2000) Fisheries
Sci 66:614
164. Ishihara K, Murata M, Kaneniwa M (1998) Lipids 33:1107
165. Sato D, Ando Y, Tsujimoto R, Kawasaki K (2001) Lipids 36:1371
166. Inagaki M, Isobe R, Kawano Y, Miyamoto T, Komori T, Higuchi R (1998) Eur J Org
Chem 129
167. Yamada K, Matsubara R, Kaneko M, Miyamoto T, Higuchi R (2001) Chem Pham Bull
49:447
168. Yamada K, Sasaki K, Harada Y, Isobe R, Higuchi R (2002) Chem Pham Bull 50:1467
169. Yamada K, Hamada A, Kisa F, Miyamoto T, Higuchi R (2003) Chem Pham Bull 51:46
170. Jeong BY, Ohshima T, Koizumi C (1996) Lipids 31:9
171. Pond DW, Sargent JR (1998) J Plankton Res 20:169
172. Viracaoundin I, Barnathan G, Gaydou EM, Aknin M (2003) Lipids 38:85
173. Kraffe E, Soudant P, Marty Y, Kervarec N, Jehan P (2002) Lipids 37:507

174. Freites L, Fernandez-Reiriz MJ, Labarta U (2002a) Aquaculture 207: 97
175. Galap C, Netchitaılo P, Leboulenger F, Grillot JP (1999) Comp Biochem Physiol
122A:241
176. Kraffe E, Soudant P, Marty Y, Kervaec N, Jehan P (2002) Lipids 37:507
177. Freites L, Fernandez-Reiriz MJ, Labarta U (2002) Comp Biochem Physiol 132B:453
178. Caers M, Coutteau P, Cure K, Morales V, Gajardo G, Sorgeloos P (1999) Comp
179. Soudant P, Ryckeghem KV, Marty Y, Moal J, Samain JF, Sorgeloos P (1999) Comp
180. Garrido JL, Medina I (2002) Analytica Chim Acta 465:409
181. Murphy KJ, Mooney BD, Mann NJ, Nichols PD, Sinclair AJ (2002) Lipids 37:587
182. Abad M, Ruiz, C, Martinez D, Mosquera G, Sanchez JL (1995) Comp Biochem Phys-
iol 110C:109
183. Labarta U, Fernandez-Reiriz MJ, Perez-Camacho A (1999) Comp Biochem Physiol
123A:249
184. Soudant P, Moal J, Marty Y, Samain JF (1997) J Exp Mar Biol Ecol 215:103
185. Brazao S, Morais S, Boaventura D, Re P, Narciso L, Hawkins SJ (2003) Comp Biochem
Physiol 136B:425
186. Fernandez-Reiriz MJ, Labarta U, Albentosa M, Perez-Camacho A (1999) Comp
187. Le Pennec M, Beninger PG, Dorange G, Paulet YM (1991) J Mar Biol Assoc UK 71:451
188. Pazos AJ, Roman G, Acosta CP, Sanchez JL, Abad M (1997) Comp Biochem Physiol
117B:393
189. Le Pennec G, Le Pennec M, Beninger PG (2001) J Mar Biol Assoc UK 81:663
190. Caers M, Coutteau P, Cure K, Morales V, Gajardo G, Sorgeloos P (1999) Comp
191. Caers M, Coutteau P, Sorgeloos P (1999) Aquaculture 170:307
192. Marty Y, Soudant P, Perrotte S, Moal J, Dussauze J, Samain JF (1999) J Chromatogr
A 839:119
193. Jeong BY, Ohshima T, Koizumi C (1999) Comp Biochem Physiol 122B:415
194. de Moreno JEA, Moreno VJ, Ricci L, Roldan M, Gerpe M (1998) Comp Biochem
Physiol 119B:631
195. Hayashi K, Kishimura H (2002) J Oleo Sci 51:523
196. Suprayudi MA, Takeuchi T, Hamasaki K (2004) Aquaculture 231:403
197. Takeuchi T, Satoh N, Sekiya S, Shimizu T, Watanabe T (1999) Nippon Suisan
Gakkaishi 65:988
198. Kobayashi T, Takeuchi T, Arai D, Sekiya S (2000) Nippon Suisan Gakkaishi 66:1006
199. Hamasaki K, Suprayudi MA, Takeuchi T (2002) Suisan Zoshoku 50:333
200. Suprayudi MA, Takeuchi T, Hamasaki K, Hirokawa J (2002) Suisan Zoshoku 50:205
201. Suprayudi MA, Takeuchi T, Hamasaki, K, Hirokawa, J (2002) Fish Sci 68:1295
202. Lahdes E, Balogh G, Fodor E, Farkas T (2000) Lipids 35:1093
203. Fodor E, Jones RH, Buda C, Kitajka K, Dey I (1995) Lipids 30:1119
204. Cunnane SC (2003) Prog Lipid Res 42:544
205. Wada H, Gombos Z, Murata N (1990) Nature 347:200
206. Miquel M, James D, Dooner H, Browse J (1993) Proc Natl Acad Sci USA 90:6208
207. Meves H (1994) Prog Neurobiol 43:175
208. Xiao YF, Ke Q, Wang SY, Auktor K, Yang Y, Wang GK, Morgan JP, Leaf A (2001) Proc
Natl Acad Sci USA 98:3606
209. Schmidt A, Wolde M, Thiele C, Fest W, Kratzin H, Podtelejnikov AV, Witke W, Hut-
tner WB, Söling HD (1999) Nature 401:133
210. Wallis JG, Browse J (2002) Prog Lipid Res 41:254
211. Goldberg EM, Zidovetzki R (1997) Biophys J 73:2603
212. Tsutsumi T, Yamauci E, Suzuki E, Watanbe S, Kobayashi T, Okuyama H (1995) Biol
Pharm Bull 18:664
213. Wallis JG, Watts JL, Browse J (2002) Trends Biochem Sci 27:467
214. Napier JA (2002) Trends Plant Sci 7:51
215. Connor WE (2000) Am J Clin Nutr 71:171S
216. Albert, CM, Hennekens CH, O’Donnell CJ, Ajani UA, Carey VJ, Willett WC, Ruskin
JN, Manson JE (1998) JAMA 279:23
217. Kromhout D (1998) JAMA 279:65
218. Krauss RM, Eckel RH, Howard B, Appel LJ, Daniels SR, Deckelbaum RJ, Erdman
JW, Kris-Etherton P, Goldberg IJ, Kotchen TA, Lichtenstein AH, Mitch WE, Mullis
R, Robinson K, Wylie-Rosett J, St Jeor S, Suttie J, Tribble DL, Bazzarre TL (2000)
Circulation 102:2284
219. O’Keefe Jr, James H, Harris WS (2000) Am J Cardiol 85:1239
220. Oomen CM, Feskens EJ, Räsänen L, Fidanza F, Nissinen AM, Menotti A, Kok FJ,
Kromhout D (2000) Am J Epidemiol 151:999
221. Torres IC, Mira L, Ornelas CP, Melim A (2000) Br J Nutr 83:371
222. Iso H, Rexrode KM, Stampfer MJ, Manson JE, Colditz GA, Speizer FE, Hennekens
CH, Willett WC (2001) JAMA 285:304
223. Hu FB, Bronner L, Willett WC, Stampfer MJ, Rexrode KM, Albert CM, Hunter D,
Manson JE (2002) JAMA 287:1815
224. He K, Rimm EB, Merchant A, Rosner BA, Stampfer MJ, Willett WC, Ascherio A
(2002) JAMA 288:3130
225. Calder PC (2003) Ital Heart J 4:427
226. Thies F, Garry JMC, Yaqoob P, Rerkasem K, Williams J, Shearman CP, Gallagher PJ,
Calder PC, Grimble RF (2003) The Lancet 361:477
227. Madsen, T, Skou HA, Hansen VE, Fog L, Christensen JH, Toft E, Schmidt EB (2001)
Am J Cardiol 88:1139
228. Albert CM, Campos H, Stampfer MJ, Ridker PM, Manson JE, Willett WC, Ma J (2002)
N Engl J Med 346:1113
229. Rosenberg IH (2002) New Engl J Med 346:1102
230. Christensen JH, Skou HA, Fog L, Hansen V, Vesterlund T, Dyerberg J, Toft E, Schmidt
EB (2001) Circulation 103:651
231. Bigger JT, El-Sherif T (2001) Circulation 103:623
232. De Caterina R, Madonna R, Zucchi R, La Rovere MT (2003) Am Heart J 146:420
233. Dallongeville J, Yarnell J, Ducimetière P, Arveiler D, Ferrières J, Montaye M, Luc G,
Evans A, Bingham A, Hass B, Ruidavets JB (2003) Circulation 108:820
234. Marchioli R, Schweiger C, Tavazzi L, Valagussa F (2001) Lipids 36:S119
235. Marchioli R, Barzi F, Bomba E, Chieffo C, Di Gregorio D, Di Mascio R, Franzosi
MG, Geraci E, Levantesi G, Maggioni AP, Mantini L, Marfisi RM, Mastrogiuseppe
G, Mininni N, Nicolosi GL, Santini M, Schweiger C, Tavazzi L, Tognoni G, Tucci C,
Valagussa F, GISSI-Prevenzione Investigators (2002) Circulation 105:1897
236. Leaf A (2002) Circulation 105:1874
237. Lemaitre RN, King IB, (2003) n-3 polyunsaturated FA, fatal ischemic heart disease,
and nonfatal myocardial infarction in older adults: the cardiovascular health study.
Am J Clin Nutr 77:319
238. Harris WS (2003) Am J Clin Nutr 77:279
239. Cobiac L, Nestel PJ, Wing LM, Howe PR (1991) Clin Exp Pharmacol Physiol 18:265
240. Radack K, Deck C, Huster G (1991) Arch Intern Med 151:1173
241. Appel LJ, Miller ER, Seidler AJ, Whelton PK (1993) Arch Intern Med 153:1429
242. Morris MC, Sacks F, Rosner B (1993) Circulation 88:523
243. Toft I, Bonaa KH, Ingebretsen OC, Nordoy A, Jenssen T (1995) Ann Intern Med
123:911
244. Connor WE (1995) Ann Intern Med 123:950
245. Andreassen AK, Hartmann A, Offstad J, Geiran O, Kvernebo K, Simonsen S (1997) J
Am Coll Cardiol 29:1324
246. Bao DQ, Mori TA, Burke V, Puddey IB, Beilin LJ (1998) Hypertension 32:710
247. Mori TA, Bao DQ, Burke V, Puddey IB, Watts GF, Beilin LJ (1999) Am J Clin Nutr
70:817
248. Stark KD, Park EJ, Maines VA, Holub BJ (2000) Am J Clin Nutr 72:389
249. Laidlaw M, Holub BJ (2003) Am J Clin Nutr 77:37
250. Goodfellow J, Bellamy MF, Ramsey MW, Jones CJ, Lewis MJ (2000) J Am Coll Cardiol
35:265
251. Flaten H, Hostmark AT, Kierulf P, Lystad E, Trygg K, Bjerkedal T, Osland A (1990)
252. Norrish AE, Skeaff CM, Arribas GL, Sharpe SJ, Jackson RT (1999) Br J Cancer
81:1238
253. Terry P, Lichtenstein P, Feychting M, Ahlbom A, Wolk A (2001) The Lancet 357:1764
254. Takezaki T, Hirose K, Inoue M, Hamajima N, Yatabe Y, Mitsudomi T, Sugiura T,
Kuroishi T, Tajima K (2001) Br J Cancer 84:1199
255. Barber MD, Ross JA, Voss AC, Tisdale MJ, Fearon KC (1999) Br J Cancer 81:80
256. Gogos CA, Ginopoulos P, Salsa B, Apostolidou E, Zoumbos NC, Kalfarentzos F
(1998) Cancer 82:395
257. Kremer JM (2000) Am J Clin Nutr 71:349S
258. Volker D, Fitzgerald P, Major G, Garg M (2000) J Rheumatol 27:2343
259. Cleland LG, James MJ (2000) J Rheumatol 27:2305
260. Navarro E, Esteve M, Olivé A, Klaassen J, Cabré E, Tena X, Fernandez-Bañares F,
Pastor C, Gassull MA (2000) J Rheumatol 27:298
261. Darlington LG, Stone TW (2001) Brit J Nutr 85:251
262. Mayser P, Mrowietz U, Arenberger P, Bartak P, Buchwald J, Christophers E, Jablonska
S, Salmhofer W, Schill WB, Krämer HJ, Schlotzer E, Mayer K, Seeger W, Grimminger
F (1998) J Am Acad Dermatol 38:539
263. Danno K, Sugie N (1998) J Dermat 25:703
264. Hodge L, Salome CM, Peat JK, Haby MM, Xuan W, Woolcock AJ (1996) Med J Aust
164:137
265. Broughton KS, Johnson CS, Pace BK, Liebman M, Kleppinger KM (1997) Am J Clin
Nut 65:1011
266. Katz DP, Manner T, Furst P, Askanazi J (1996) Nutrition 12:334
267. Schwartz J (2000) Am J Clin Nutr 71:393S
268. Stevens LJ, Zentall SS, Deck JL, Abate ML, Watkins BA, Lipp SR, Burgess JR (1995)
269. Burgess JR, Stevens L, Zhang W, Peck L (2000) Am J Clin Nutr 71:327S
270. Stordy BJ (2000) Am J Clin Nutr 71:323S
271. Heude, B, Ducimetière P, Berr C, Study E (2003) Am J Clin Nutr 77:803
272. Edwards R, Peet M, Shay J, Horrobin D (1998) J Affect Disord 48:149
273. Calabrese, JR, Rapport DJ, Shelton MD (1999) Arch Gen Psychiatry 56:413
274. Kyle DJ, Schaefer E, Patton G, Beiser A (1999) Lipids 34:S245
275. Severus, WE, Ahrens B, Stoll AL (1999) Arch Gen Psychiatry 56:380
276. Stoll AL, Severus WE, Freeman MP, Rueter S, Zboyan HA, Diamond E, Cress KK,
Marangell LB (1999) Arch Gen Psychiatry 56:407
277. Bruinsma KA, Taren DL (2000) Nut Rev 58:98
278. Conquer JA, Tierney MC, Zecevic J, Bettger WJ, Fisher RH (2000) Lipids 35:1305
279. Joy CB, Mumby-Croft R, Joy LA (2000) Cochrane Database Syst Rev 4
280. Richardson AJ, Easton T, Puri BK (2000) European Neuropsychopharmacology
10:189
281. Tanskanen A, Hibbeln JR, Hintikka J, Haatainen K, Honkalampi K, Viinamäki H
(2001) Arch Gen Psychiatry 58:512
282. Peet M, Horrobin DF (2002) Arch Gen Psychiat 59:913
283. Small MF (2002) New Scientist, August 24:34
284. Levine BS (1997) Nutrition Today 32:248
285. Fidler N, Sauerwald T, Pohl A, Demmelmair H, Koletzko B (2000) J Lipid Res
41:1376–83
286. Olsen S,Secher NJ (2002) Brit Med J 324:1
287. Jensen CL, Maude M, Anderson RE, Heird WC (2000) Am J Clin Nutr 71:292S
288. Makrides M, Gibson RA (2000) Am J Clin Nutr 71:307S
289. Connor WE, Lowensohn R, Hatcher L (1996) Lipids 31:S183
290. Cunnane SC, Francescutti V, Brenna JT, Crawford MA (2000) Lipids 35:105
291. Carlson SE (1999) Acta Paediatr Suppl 88:72
292. Mitchell EA, Aman MG, Turbott SH, Manku M (1987) Clin Pediatr 26:406
293. Uauy-Dagach R, Valenzuela A (1996) Nutr Rev 54:S102
294. Pepping J (1999) Am J Health-Syst Ph 56:719
295. Simopoulos AP (2002) Biomed Pharmacother 56:365
296. de Lorgeril M RS, Mamelle N, Salen P, Martin JL, Mon-jaud I, Guidollet J, Touboul P,
Delaye J (1994) Lancet 343:1454
297. Bartram HP, Gostner A, Reddy BS, Rao CV, Scheppach W, Dusal G, Richter A,
Richter F, Kasper H (1995) Eur J Cancer Prev 4:231
298. Maillard V, Bougnoux P, Ferrari P, Jourdan M-L, Pinault M, Lavillonnieree FF,
Body G, Le Floch O, Chajes V (2002) Int J Cancer 98:78
299. James MJ, Cleland LG (1997) Semin Arthritis Rheum 27:85
300. Heath and Welfare Canada (1990). Table 19. Summary of examples of recommended
nutrients based on energy expressed as daily rates. In: Nutrition Recommendations.
The reports of the scientific review committee. Health and Welfare Canada, Scientific
review committee, Ottawa, 203 (H49-42/1990E)
301. ISSFAL (1999) Adequate intakes. International Society for the Study of FA and Lipids
(ISSFAL), Devon (http://www.issfal.org.uk/adequateintakes.htm)
302. BNF (2000) British Nutrition Foundation (BNF), London
303. IOM (2002) Dietary reference intakes for energy, carbohydrates, fiber, fat, pro-
tein and amino acids (macronutrients). National Academy of Sciences, food and
nutrition board, Institute of Medicine (IOM). National Academy Press (NAP), Wash-
ington, DC, 335–432
304. Watkins BA, Lippman HE, Le Bouteiller L, Seifert MF (2001) Prog Lipid Res 40:125
305. Ucciani E (1995) Nouveau Dictionnaire des Huiles Végétales. Compositions en
acides gras. Lavoisier TEC&DOC, Paris (France)
306. Abbadi A, Domergue F, Meyer A, Riedel K, Sperling P, Zank TK, Heinz E (2001) Eur
J Lipid Sci Technol 103:106
307. Naylor RL, Goldburg RJ, Primavera JH, Kautsky N, Beveridge MC, Clay J, Folke C,
Lubchenco J, Mooney H, Troell M (2000) Nature 405:1017
308. Tocher DR, Leaver MJ, Hodgson PA (1998) Prog Lipid Res 37:73
309. Shanklin J, Cahoon EB (1998) Annu Rev Plant Physiol Plant Mol Biol 49:611
310. Pereira SL, Leonard AE, Mukerji P (2003) Protaglandins, Leukotrienes and essential
FA 68:97
311. Napier JA, Sayanova O, Sperling P, Heinz E (1999) Trends Plant Sci 4:2
312. Napier JA, Michaelson LV, Sayanova O (2003) Prostaglandins Leukot Essent Fatty
Acids 68:135
313. Satouchi K, Hirano K, Sakaguchi M, Takehara H, Matsuura F (1993) Lipids 28:837
314. Beaudoin F, Michaelson LV, Hey SJ, Lewis, MJ, Shewry PR, Sayanova O, Napier J
(2000) Proc Natl Acad Sci USA 97:6421
315. Napier JA, Michaelson LV (2001) Lipids 36:761
316. Watts JL, Browse J (2002) Proc Natl Acad Sci USA 99:5854
317. Parker-Barnes JM, Das T, Bobik E, Leonard AE, Thurmond JM, Chaung LT, Huang
YS, Mukerji P (2000) Proc Natl Acad Sci USA 97:8284
318. Gunstone FD (1994) Prog Lipid Res 33:19
319. Khozin I, Adlerstein D, Bigongo C, Heimer YM, Cohen Z (1997) Plant Physiol
114:223
320. Wallis JG, Browse J (1999) Arch Biochem Biophys 365:307
321. Qi B, Beaudoin F, Fraser T, Stobart AK, Napier JA, Lazarus CM (2002) FEBS Lett
510:159
322. Qiu X, Hong H, Mc Kenzie SL (2001) J Biol Chem 276:31 561
323. Voss A, Reinhart M, Sankarappa S, Sprecher H (1991) J Biol Chem 266:19 995
324. Moore SA, Hurt E, Yoder E, Sprecher H, Spector AA (1995) J Lipid Res 36:2433
325. Ferdinandusse S, Denis S, Mooijer PA, Zhang Z, Reddy JK, Spector AA, Wanders RJ
(2001) J Lipid Res 42:1987
326. Su HM, Moser AB, Moser HW, Watkins PA (2001) J Biol Chem 276:38 115
327. de Antueno RJ, Knickle, LC, Smith H, Elliot ML, Allen SJ, Nwaka S, Winther MD
(2001) FEBS Lett 509:77
328. D’andrea S, Guillou H, Jan S, Catheline D, Thibault JN, Bouriel M, Rioux V, Le-
grand P (2002) Biochem J 364:49
329. Metz JG, Roessler P, Facciotti D, Levering C, Dittrich F, Lassner M, Valentine R,
Lardizabval K, Domergue F, Yamada A, Yazawa K, Knauf V, Browse J (2001) Science
293:290
330. Napier JA, Michaelson LV, Stobart AK (1999) Curr Opin Plant Biol 2:123
331. Cho HP, Nakamura M, Clarke SD (1999) J Biol Chem 274:37 335
332. Leonard AE, Kelder B, Bobik EG, Chuang LT, Parker-Barnes JM, Thurmond JM,
Kroeger PE, Kopchick JJ, Huang YS, Mukerji P (2000) Biochem J 347:719
333. Watts JL, Browse J (1999) Arch Biochem Biophys 362:175
334. Michaelson LV, Napier JA, Lewis M, Griffiths G, Lazarus CM, Stobart, AK (1998)
FEBS Lett 439:215
335. Michaelson LV, Lazarus CM, Griffiths G, Napier JA, Stobart AK (1998) J Biol Chem
273:19 055
336. Knutzon DS, Thurmond JM, Huang YS, Chaudhary S, Bobik Jr EG, Chan GM, Kirch-
ner SJ, Mukerji P (1998) J Biol Chem 273:29 360
337. Cho HP, Nakamura M, Clarke SD (1999) J Biol Chem 274:471
338. Napier JA, Hey SJ, Lacey DJ, Shewry PR (1998) Biochem J 330:611
339. Sayanova O, Smith MA, Lapinskas P, Stobart AK, Dobson G, Christie WW, Shewry
PR, Napier JA (1997) Proc Natl Acad Sci USA 94:4211
340. Sperling P, Lee M, Girke T, Zähringer U, Stymne S, Heinz E (2000) Eur J Biochem
267:3801
341. Girke T, Schmidt H, Zähringer U, Reski R, Heinz E (1998) Plant J 15:39

342. Yuan L, Kirchner SJ, Mukerji P, Knutzon DS (1999) Lipids 34:649
343. Sakuradani E, Kobayashi M, Shimizu S (1999) Gene 238:445
344. Spychalla JP, Kinney AK, Browse J (1997) Proc Natl Acad Sci USA 94:1142
345. Zank TK, Zähringer U, Lerchl JE, Heinz E (2000) Biochem Soc Trans 28:654
346. Nichols D, Bowman J, Sanderson K, Mancuso-Nichols C, Lewis T, McMeekin, T,
Nichols PD (1999) Curr Opin Biotechnol 10:240
347. Yazawa K (1996) Lipids 31:S297
348. Watanabe K, Yazawa K, Kondo K, Kawaguchi A (1997) J Biochem 122:467
349. Bisang C Long PF, Cortés J, Westcott J, Crosby J, Matharu AL, Cox RJ, Simpson TJ,
Staunton J, Leadlay PF (1999) Nature 401:502
350. Heath RJ, Rock CO (2000) Nature 406:145
351. Allen EE, Facciotti D, Bartlett DH (1999) Appl Environ Microbiol 65:1710
352. Tanaka M, Ueno A, Kawasaki K, Yumoto I, Ohgiya S, Hoshino T, Ishizaki K,
Okuyama H, Morita N (1999) Biotechnol Lett 21:939
353. Leonard AE, Bobik EG, Dorado J, Kroeger PE, Chuang LT, Thurmond JM, Parker-
Barnes JM, Das T, Huang YS, Mukerji P (2000) Biochem J 350:765
354. Huang J, Aki T, Yocochi T, Nakahara T, Honda D, Kawamoto S, Shigeta S, Ono K,
Suzuki O (2003) Mar Biotechnol 5:451
355. Müller-Navarra DC, Brett MT, Liston AM, Goldman CR (2000) Nature 403:74
356. Iida I, Nakahara T, Yocochi T, Kamisaka Y, Yagi H, Yamaoka M, Suzuki O (1996)
Journal Ferment Bioeng 81:76
357. Yokochi T, Honda D, Higashihara T, Nakahara T (1998) Appl Microbiol Biotechnol
49:72
358. Barclay WR, Meager KM, Abril JR (1994) J Appl Phycol 6:123
359. Lewis TE, Mooney BD, McMeekin TA, Nichols PD (1998) Chem Aust 65:37
360. Vazhappilly R, Chen F (1998) Bot Mar 41:553
361. Singh A, Ward OP (1997) Microbial production of docosahexaenoic acid (DHA,
C22:6 ). In: Neidleman SL, Laskin AI (eds.), Advances in Applied Microbiology, Vol
45, pp 271–312
362. Ratledge C (1998) Opportunities for marine microorganisms for the production of
polyunsaturated FA. In: Le Gal Y, Muller-Feuga A (eds.), Marine Microorganisms for
Industry. Actes de colloque 21. IFREMER, Plouzane, France, pp 18–25
363. Lewis TE, Nichols PD, McMeekin TA (1999) Mar Biotechnol 1:580
364. Ratledge C (1993) Trends Biotechnol 11:278 Circular 886 (Rev 1) 1
365. Sajbidor J, Dobronova S, Certik M (1990) Biotechnol Lett 12:455
366. Gandhi SR, Weete JD (1991) J Gen Microbiol 137:1825
367. Nichols DS, Nichols PD, McMeekin TA (1993) Antarct Sci 5:149
368. Jøstensen, JP, Landfald B (1997) FEMS Microbiol Lett 151:95
369. Watanabe K, Sezaki K, Yazawa K, Hino A (1992) Nipp Suis Gakk 58:271
370. Nichols DS, Hart P, Nichols PD, McMeekin TA (1996) Aquaculture 147:115
371. Lewis TE, Nichols PD, Hart PR, Nichols DS, McMeekin TA (1998) J World Aquacult
Soc 29:313
372. Gonzalezbaro MD, Pollero RJ (1998) Comp Biochem Physiol 119:747
373. Erwin J, Bloch K (1964) Science 143:1006
374. Zhukova NV, Kharlamenko VI, (1999) Aquat Microb Ecol 17:153
375. DeLong EF, Yayanos AA (1987) Appl Environ Microbiol 51:730
376. Bowman JP, McCammon SA, Nichols DS, Skerratt JS, Rea SM, Nichols PD, McMeekin
TA (1997) Int J Syst Bacteriol 47:1040
377. Bowman JP, Gosink JJ, McCammon SA, Lewis TE, Nichols DS, Nichols PD, Skerratt
JH, Staley JT, McMeekin TA (1998) Int J Syst Bacteriol 48:1171
378. Hugenholtz P, Goebel BM, Pace NR (1998) J Bacteriol 180:4765
379. Yano Y, Nakayama A, Yoshida K (1997) Appl Environ Microbiol 63:2572
380. Kato C (1999) Molecular analysis of the sediment and isolation of extreme
barophiles from the deepest Mariana Trench. In: Extremophiles in Deep-Sea Envi-
ronments, Tsujii K (Ed), Springer-Verlag, Tokyo, pp. 27–38
381. Venkateswaren K, Dollhopf ME, Aller R, Stackebrandt E, Nealson KH (1998) Int J
Syst Bacteriol 48:965
382. Ivanova EP, Mikhailov VV (2001) Microbiology 70:10
383. Bozal N, Montes MJ, Tudela E, Jimenez F, Guinea J (2002) Int J Syst Evol Microbiol
52:195
384. Nogi, Y, Kato C, Horikoshi K (1998) J Gen Appl Microbiol 44:289
385. Deming JW, Somers LK, Sraube WL, Swartz DG, MacDonnell MT (1988) Syst Appl
Microbiol 10:152
386. Yumoto I, Kawasaki K, Iwata H, Matsuyama H, Okuyama H (1998) Int J Syst Bacte-
riol 48:1357
387. Urakawa H, Kita-Tsukamoto K, Steven S, Ohwada K, Colwell RR (1998) FEMS Mi-
crobiol Lett 165:373
388. Nogi Y, Kato C (1999) Extremophiles 3:71
389. Benediktsdóttir E, Verdonck L, Sproër C, Helgason S, Swings J (2000) Int J Syst Evol
Microbiol 50:479
390. Mountfort DO, Rainey FA, Burghardt J, Kaspar HF, Stackebrandt E (1998) Arch Mi-
crobiol 169:231
391. Nogi Y, Kato C, Horikoshi K (2002) Int J Syst Evol Microbiol 52:1527
392. Kawasaki K, Nogi Y, Hishinuma M, Nodasaka Y, Matsuyama H, Yumoto I (2002) Int
J Syst Evol Microbiol 52:1455
393. Bowman JP, McCammon SA, Lewis TE, Skerratt JH, Brown JL, Nichols DS,
McMeekin TA (1998) Microbiology 144:1601
394. Nogi Y, Masui N, Kato C (1998) Extremophiles 2:1
395. Iwanami H, Yamaguchi T, Takeuchi M (1995) Nipp Suis Gakk 61:205
396. Watanabe K, Ishikawa C, Ohtsuka I, Kamata M, Tomita M, Yazawa K, Muramatsu H
(1997) Lipids 32:975
397. Barbieri E, Paster BJ, Hughes D, Zurek L, Moser, DP, Teske A, Sogin ML (2001)
Environ Microbiol 3:151
398. Ederington MC, Mcmanus GB, Harvey HR (1995) Limnol Oceanogr 40:860
399. Nichols PD, Nichols DS, Lewis T, Bowman JP, Skerrat JH, McMeekin TA (1998) Novel
bacteria as alternate sources of polyunsaturated FA for use in aquaculture and other
industries. In: Marine microorganisms for industry. Le Gal Y, Muller-Feuga A (eds.),
Plouzane: Editions IFREMER, 26–32
400. Russell NJ (1992) Physiology and molecular biology of psychrophilic micro-
organisms. In: Herbert RA, Sharpe RJ (eds.), Molecular Biology and Biotechnology
of Extremeophiles, Blackie, Glasgow, pp 203–224
401. Cronan JE, Rock CO (1996) Biosynthesis of membrane lipids. In: Escherichia coli and
Salmonella typhimurium: Cellular and Molecular Biology, p 612. Edited by Neidhardt
FC, and others. Washington, DC: American Society for Microbiology, 149–160
402. Fujii DK, Fulco AJ (1977) J Biol Chem 252:3660
403. Rawlings BJ (1998) Nat Prod Rep 15:275
404. Siegenthaler PA, Belsky MM, Goldstein S (1967) Science 155:93
405. Porter D (1990) Phylum Labyrinthulomycota. In: Handbook of Protoctista. Margulis

L, Corliss JO, Melkonian M, Chapman DJ (eds). Boston, Jones and Bartlett, pp 388–
398
406. Bahnweg G, Sparrow FK (1974) Am J Bot 61:754
407. Raghukumar S, Gaertner A (1980) Veroff Inst Meeresforsch Bremerhaven 18:289
408. Raghukumar S (1988) Transcr Br Mycol Soc 90:627
409. Honda D, Yokochi T, Nakahara T, Erata M, Higashihara T (1998) Mycol Res 102:439
410. Naganuma T, Takasugi H, Kimura H (1998) Mar Ecol Prog Ser 162:105
411. Cavalier-Smith T, Allsopp MTEP, Chao EE (1994) Philos Trans R Soc Lond B Biol Sci
346:387
412. Nakahara T, Yokochi T, Higashihara T, Tanaka S, Yaguchi T, Honda D (1996) J Am
Oil Chem Soc 73:1421
413. Yaguchi T, Tanaka S, Yokochi T, Nakahara T, Higashihara T (1997) J Am Oil Chem
Soc 74:1431
414. Bajpai P, Bajpai BP, Ward OP (1991) Appl Microbiol Biotechnol 35:706
415. Bajpai P, Bajpai BP, Ward OP (1991) J Am Oil Chem Soc 68:509
416. Li ZY, Ward OP (1994) J Indust Microbiol 13:238
417. Singh A, Ward OP (1996) J Indust Microbiol 16:370
418. Singh A, Wilson S, Ward OP (1996) World J Microbiol Biotechnol 12:76
419. Weete JD, Kim H, Ghandhi SR, Wang Y, Dute R (1997) Lipids 32:839
420. Ellenbogen BB, Aaronson S, Goldstein S, Belsky M, (1969) Comp Biochem Physiol
29:805
421. Findlay RH, Fell JW, Coleman NK, Vestal JR, (1986) Biochemical indicators of the
role of fungi and thraus-tochytrids in mangrove detrital systems. In: Moss ST (ed.),
The Biology of Marine Fungi. Cambridge University Press, Cambridge, pp 91–103
422. Barclay W (1992) US patent 5,130,242
423. Bowles RD, Hunt AE, Bremer GB, Duchars MG, Eaton RA (1999) J Biotechnol 70:193
424. Huang J, Aki T, Hachida K, Yokochi T, Kawamoto S, Shigeta S, Ono K, Suzuki O
(2001) J Am Oil Chem Soc 78:605
425. Hammond BG, Mayhew DA, Naylor MW, Ruecker FA, Mast RW, Sander WJ (2001)
Regul Toxicol Pharmacol 33:192
426. Barclay WR (1994) US Patent 5,340,742
427. Barclay W, Zeller S (1996) J World Aquacult Soc 27:314
428. Hammond BG, Mayhew DA, Robinson K, Mast RW, Sander WJ (2001c) Regul Toxicol
Pharmacol 33:356
429. Hammond BG, Mayhew DA, Naylor MW, Holson JF, Nemec MD, Mast RW, Sander
WJ (2001) Regul Toxicol Pharmacol 33:205
430. Fitch Haumann B (1999) INFORM 9:1108
431. Narciso I, Pousao-Ferreira P, Passos A, Luis O (1999) Aquacult Res 30:21
432. Carter CG, Bransden MP, Lewis TE, Nichols PD (2003) Mar Biotechnol 5:480
433. Bull AT, Goodfellow M, Slater JH (1992) Annu Rev Microbiol 46:219
434. Bull AT, Ward AC, Goodfellow M (2000) Microbiol Mol Biol R 46:573
435. Certik M, Shimizu S (1999) J Biosci Bioeng 87:1
436. Becker CC, Kyle DJ (1998) Food Technol 52:68
437. Arts MT, Ackman RG, Holub BJ (2001) Can J Fish Aquat Sci 58:122
438. Sargent JR, Tacon AGJ (1999) P Nutr Soc 58:377
439. Sargent JR (1995) (n-3) polyunsaturated FA and farmed fish. In: Hamilton, RJ, Rice,
RD (eds.), Fish Oil: Technology, Nutrition and Marketing. Barnes and Associates,
Bucks, pp 67–94
440. Peng J, Larondelle Y, Ackman RG, Rollin X (2003) Comp Biochem Physiol Pt B
134:335
441. Bell JG, Tocher DR, Farndale BM, Cox DI, McKinney RW, Sargent JR (1997) Lipids
32:515
442. Ackman RG (1980) Fish lipids. In: Connell, JJ (ed.), Advances in Fish Science and
Technology. Fishing News, Farnham, p 86
443. Viga A, Grahl-Nielsen O (1990) Comp Biochem Physiol Pt B 96:721
444. Pickova J, Kiessling A, Petterson A, Dutta PC (1999) Fish Physiol Biochem 21:147
445. Ould El Kebir MV, Barnathan G, Siau Y, Miralles J, Gaydou EM (2003) J Agric Food
Chem 51:1942
446. Fodor E, Jones RH, Buda C, Kitajka K, Dey I, Farkas T (1995) Lipids 30:1119
447. Lee KH, Jeong ICH, Suh JS, Jung WJ, Kim CG, Lee BH (1986) Han’guk Susan
Hakhoechi 19:423
448. Tritar B, Attia-Chaouch S, Hammami M (1997) Ichtyophysiol Acta 20:67
449. Saito H, Ishihara K, Murase T (1997) J Sci Food Agric 73:53
450. Bandarra MN, Batista I, Nunes ML, Empis JM, Christie WW (1997) J Food Sci 62:40
451. Gamez-Meza N, Higuera-Ciapara I, Calderon de la Barca AM, Vazquez-Moreno L,
Noriega-Rodriguez J, Angulo-Guerrero O (1999) Lipids 34:639
452. Tanakol R, Yazici Z, Sener E, Sencer, E (1999) Lipids 34:291
453. Marquez-Ruiz G, Velasco J, Dobarganes C (2000) Eur Food Res Technol 211:13
454. Hilbert G, Lillemark L, Balchen S, Højskov CS (1998) Chemosphere 37:1241
455. Njinkoué JM, Barnathan G, Mirallès J, Gaydou EM, Samb A (2002) Comp Biochem
Physiol 131B:395
456. Gunstone FD (2002) Market report. Lipid Technology Newsletter 8:5
457. Rees JF, Cure K, Piyatiratitivorakul S, Sorgeloos P, Menasveta P (1994) Aquaculture
122:193
458. Salhi M, Izquierdo MS, Hernandezcruz CM, Gonzalez M, Fernandezpalacios H
(1994) Aquaculture 124:275
459. Pike IH, Barlow SM (1999) Fish meal and oil to the year 2010: supplies for aquacul-
ture. Presented at World Aquaculture 1999, Sydney, Australia, April 26–May 2 1999,
Abstract, p 603
460. Molyneaux M, Chong ML (1998) Food Technol 52:56
461. Barlow SM (2002) 2nd Seafood By-Products Conference, Alaska, USA
462. Mukherjee KD (1999) INFORM 10:308
DOI 10.1007/b135783
Fish and Shellfish Upgrading, Traceability

Fabienne Guérard1 (u) · Daniel Sellos2 · Yves Le Gal2
1 ANTiOX-UBO, Pôle universitaire P.J. Helias, Creac’h Gwen, 29000 Quimper, France
guerard@univ-brest.fr
2 Marine Biology Station, Muséum National d’Histoire Naturelle, BP 225,
29182 Concarneau cedex, France
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
2 Enzymes From Fish and Other Marine Creatures . . . . . . . . . . . . . . 130
3 Fish and Shellfish Protein Hydrolysates . . . . . . . . . . . . . . . . . . . . 131

3.1 From Fish Silage to Fish Protein Hydrolysates . . . . . . . . . . . . . . . . 131
3.2 Advantages of Commercial Exogenous Enzyme Addition . . . . . . . . . . 133
3.3 Quantification of the Proteolysis Extent . . . . . . . . . . . . . . . . . . . . 137
3.4 Mechanism of Hydrolysis and General Properties of Hydrolysates . . . . . 138
4 Recent Developments in Fish Protein Hydrolysates . . . . . . . . . . . . . 140

4.1 Biologically Active Substances in By-Product Hydrolysates . . . . . . . . . 140
4.1.1 Neuroactive Peptides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
4.1.2 Enzyme Regulators and Inhibitors . . . . . . . . . . . . . . . . . . . . . . . 141
4.1.3 Immunoactive Peptides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142
4.1.4 Hormonal and Hormonal-Regulating Peptides . . . . . . . . . . . . . . . . 142
4.1.5 Antioxidant Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
4.2 Marine Waste as a Nutrient Source in Fermentation Processes . . . . . . . 145
4.3 Other Applications of FPHs . . . . . . . . . . . . . . . . . . . . . . . . . . . 146
5 Genetic Traceability of Fish and Shellfish Species and By-Products . . . . 146

5.1 Choice of Marker Sequences . . . . . . . . . . . . . . . . . . . . . . . . . . 147
5.2 Protocols for Fish and Fish Coproduct Identification . . . . . . . . . . . . . 150
6 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158
Abstract Recognition of the limited biological resources and the increasing environmen-
tal pollution has emphasised the need for better utilisation of by-products from the
fisheries. Currently, the seafood industry is dependent on the processing of the few
selected fish and shellfish species that are highly popular with consumers but, from eco-
nomic and nutritional points of view, it is essential to utilise the entire catch. In this
review, we will focus on recent developments and innovations in the field of underutilised
marine species and marine by-product upgrading and, more precisely, on two aspects
of the bioconversion of wastes from marine organisms, i.e. extraction of enzymes and
preparation of protein hydrolysates. We will deal with the question of accurate determin-
ation of fish species at the various steps of processing. Methods of genetic identification
applicable to fresh fish samples and to derived products will be described.
128 F. Guérard et al.
Keywords Marine by-products · Hydrolysates · Bioactivity · Genetic traceability
Abbreviations
ACE Angiotensin-converting enzyme
CCK Cholecystokinin
CGRP Calcitonine gene related peptide
CTAB Cetyltrimethylammonium bromide
Da Dalton
DH Degree of hydrolysis
DNA Deoxyribonucleic acid
E.C. Enzyme commission nomenclature
EDTA Ethyl diamine tetraacetic acid
EPB Epoxy-pseudoisoeugenol-(2-methylbutyrate)
EtBr Ethydium bromide
FP Functional properties
FPH Fish protein hydrolysate
FPLC Fast protein liquid chromatography
GPI Guinea pig ileum test
GRAS Generally recognised as safe
GRF Growth hormone releasing factor
KI Potasium iodide
MWDP Molecular weight distribution of peptides
N Nitrogen content
NaOAc Sodium acetate
NB Nitrogen balance
NP Nutritional properties
NPU Net protein utilisation
NR Nitrogen released
NSI Nitrogen solubility index
OD Optical density
OPA o-phtaldehyde
Pb Base pair
PCR Polymerase chain reaction
pH-st pH-stat method
RAG-1 Recombination activating gene-1
RFLP Restriction fragment length polymorphism
RNA Ribonucleic acid
RSM Response surface methodology
SC Soluble content
SNP Single nucleotide polymorphism
STR Short tandemly repeat
TAE Tris acetate EDTA
TCA Trichloroacetic soluble protein
TE Tris-HCl EDTA
TFA Trifluoroacetic acid
TL Tyrosine level
TNBS Trinitrobenzenesulfonic acid
TRH Thyrotropin releasing hormone
Tris Trishydroxymethylaminomethane
Fish and Shellfish Upgrading, Traceability 129
UF Ultrafiltration
UV Ultraviolet
1
Introduction
In the preparation of sea food products for today’s consumer market, up to

50% of the whole animal is commonly discarded. The remainder is consi-
dered as a waste or by-product, even though often high in protein. The wastes
from most fishes comprise the skeletal structure, intestinal organs and also
a large amount of edible fish muscle that cannot be easily removed from the
bone structure of the fish by conventional fish filleting processes. The prin-
ciple use for the waste has been for fish meal production, with some specific
types of waste being utilised for human consumption, e.g. cod livers for cod
liver oil [1].
Recognition of the limited biological resources and the increasing envi-
ronmental pollution has emphasised the need for better utilisation of by-
products from the fisheries. Currently, the seafood industry is dependent on
the processing of the few selected fish and shellfish species that are highly
popular with consumers, but, from economic and nutritional points of view,
it is essential to utilise the entire catch [2]. The increasing demand for protein
on a global scale also turns the focus on underutilised protein sources.
According to the 2002 FAO annual report [3], the world inland and marine
aquatic resources were estimated to be 128.8 million tonnes in 2001. Global
production from capture fisheries, aquaculture and the food fish supply is
currently the highest on record and remains very significant for global food
security, providing more than 15% of total animal protein supplies. Among
these resources, marine captures accounted for 86 million tonnes while ma-
rine aquaculture accounted for 14.2 million tonnes. This results in about
50 million tonnes of wastes available as a source of raw material including
fish guts, which could be further processed for recovering useful enzymes as
will be discussed below. Solid wastes generated by seafood plants range from
about 30 to 85% of the weight of the landed fish, that is, the portion left after
the fillets have been removed, depending upon the type of fishery. Processing
of fin fish, crab and shrimp can result in 30–60%, 75–85% and 40–80% waste,
respectively.
There are many ways in which the fish and shellfish waste could be better
utilised, including the following [1]:
• Extraction of chitin, enzymes, oils, vitamins, pigments, flavour material
• Production of gelatine, chitosan, fish leather
Production of novel food ingredients from such underutilised aquatic species
or by-products is desirable. According to Shahidi [4], fish proteins possess ex-
cellent amino acid scores and digestibility characteristics and as such, may be
used to enhance the nutritive value of cereal-based foods.
In this chapter, we will focus on recent developments and innovations
in the field of underutilised marine species and marine by-product upgrad-
ing and, more precisely, on two aspects of the bioconversion of wastes from
marine organisms, i.e. extraction of enzymes and preparation of protein hy-
drolysates.
We will deal with the question of accurate determination of fish species at
the various steps of processing. Methods of genetic identification applicable
to fresh fish samples as well as to derived products will be described.
The potential uses of marine hydrolysates in the near future may be in the
production of bioactive substances as this process is currently under control,
in the case of casein and soya hydrolysates. We will not deliberately discuss
fish meal for animal nutrition, fish protein concentrates as a cheap nutritious
protein source for developing countries, and fish silage product development
using mince from low-cost fishery resources (e.g. sausages, etc.) (see the re-
views of Sikorski & Naczk [5], Raa & Gildberg [6], Venugopal and Shahidi [7],
respectively).
2
Enzymes From Fish and Other Marine Creatures
In recent years, a number of enzymes from fish processing wastes have be-
come commercially available for food and other applications, as reviewed by
Haard [8]. Aquatic organisms include a wide and extensive taxonomic di-
versity and many organisms occupy unusual environmental habitats, thus
conferring to enzymes some unique characteristics such as psychrophilic
properties. The most extensively studied enzymes from the marine envi-
ronment include pepsin, trypsin, chymotrypsin, elastase, collagenase and
alkaline phosphatase isolated from Atlantic cod (Gadus morhua) viscera [9–
11], polar cod (Boreogadus saida) [12], dogfish [13–15], salmon [16, 17] and
tropical tuna [18]. Several of these enzymes from poikilothermal organisms
are cold-active and have a catalytic activity equal or higher than mammalian
enzymes.
For example, the temperature optimums of trypsin and alkaline phophatase
from cold-water fish are about 30 ◦ C lower than the homologues from warm-
water fish or mammals [19, 20]. This property is advantageous in applications
where it is desirable to inactivate the enzyme with a mild heat treatment [8].
Nevertheless, a trypsin purified from the pyloric caeca of white craker (Micro-
pogonias furnieri) exhibited a temperature optimum of 60 ◦ C. This could be
related to the warm water in which the fish lived [21]. Enzymes like LDH from
deep-water fish that live at high pressure have a tighter polypeptide struc-
ture than homologues at normal atmospheric temperature, thus making them
more resistant to proteolytic degradation and more suitable for applications

where proteases might interfere with their activity [22]. The gastric proteases
of fish that take in saltwater during feeding are salt-activated, in contrast to
homologues from mammals that are inhibited by NaCl. This property may
be advantageous in applications, such as fermentations, silage and fish sauce,
where significant amounts of salt are present [23]. Lysozyme from Artic scal-
lop [24] and other fish have a unique ability to attack both Gram-positive and
negative bacteria.
According to Vilhelmsson [25], research in this area dates back at least to
the early 1970s and the literature was sparse on the subject. However, there
has recently been a surge of interest in enzymes from the marine environment
and their potential use in food processing, mainly in North European coun-
tries. These include a commercially available collagenase preparation from
crab hepatopancreas that may have several applications, such as the deskin-
ning of squid (Loligo sp.,), production of caviar, and ripening of salt fish.
Cold-active fish pepsins from species such as Atlantic cod (G. morhua) and
orange roughly (Hoplostetus atlanticus) have been used for caviar produc-
tion from the roe of various species. These proteolytic enzymes are used to
ease the riddling process, increasing the yield from 70% to 90% for salmon
(S. salar) for example. A protease preparation from Novo Nordisk was found
to double the yield of roe from rainbow trout O. mykiss [26].
In conclusion, these examples illustrate the fact that enzymes from aquatic
organisms will never fit more than a niche in food processing because of
the cut-throat competition with enzymes of microbial origin. However, with
the advent of recombinant DNA technology, there is also growing interest
in cloning genes for unique biochemicals from exotic aquatic organisms for
mass production by microbial or other expression systems [8].
3
Fish and Shellfish Protein Hydrolysates
3.1
From Fish Silage to Fish Protein Hydrolysates
Fish silage is a liquid product, made from whole fish or parts of fish, to which no
material has been added other than a mineral acid to lower the pH to values be-
low 4.5. Liquefaction is carried out by endogenous enzymes naturally present
in the fish. Acid aids in accelerating the process by creating the right conditions
for the enzymes to work and by helping to break down bone. This procedure
efficiently prevents growth of spoilage bacteria [6]. After liquefaction, it is con-
venient to remove the oil coming from the raw material. The protein in the
aqueous layer may thereafter be dried or semi-dried. The main advantages of
fish silage are the recovery of fish offal and waste fish, low cost, good nutritional
value of the resulting product and long storage life. The main inconvenience is
the impossibility of regulating the degree of hydrolysis achieved.
In recent years the enzyme-catalysed process of hydrolysis, as applied to
protein-containing raw materials used by the food industry, has been the ob-
ject of numerous studies. It has been found that hydrolysis of the proteins
themselves may increase yields in recovery processes, improve functional
properties or improve process methodology, e.g. with regards to possible
means of control. In more general terms, in the mild conditions that charac-
terise enzymatic processes, a protein tends to retain its nutritive value better
than in traditional acidic or alkaline hydrolysis [27].
Fish protein hydrolysates (FPHs) are products with high protein content
and a wide variety of uses, as reviewed by Mackie [28] and Kristinsson and
Rasco [29]. There are several methods of FPHs production, which include
utilisation of acids, bases [30], endogenous enzymes or exogenous proteases.
Research during the past 20 years has greatly increased the understanding of
how to process fish or shellfish by-product hydrolysates [25, 31–34]. Gene-
rally, underutilised fish, fish frames or crustacean wastes are suspended in
water and enzyme is added to the slurry. In some cases, the meat is first
heated in order to denature the endogenous proteases [35]. The reaction is al-
lowed to proceed from under 1 h to 1 week, depending on the activity of the
enzyme employed, process temperature and other factors. After separation of
solids, pH is adjusted and the aqueous layer is clarified, and then dehydrated.
Figure 1 outlines the main steps of the production of protein hydrolysates
from the raw material.
Cassia et al. [36] described the obtention of FPHs using an autolytic pro-
cess. The authors concluded that enzymatic autolysis might be a simple and
efficient process for upgrading fish filleting wastes. However, although the
FPHs had high protein and low lipid content, together with an amino acid
composition similar to FAO/WHO standards, the process yield was rather
low (< 7%). Shahidi et al. [4] showed that endogenous enzyme alone pro-
duced hydrolysates with a protein recovery of approximately 23%, whereas
a yield of 51.6–70.6% was obtained for commercial enzymes. Shahidi & Syno-
wieck [30] described an alkali-assisted extraction of proteins from meat and
bone residues of harp seal with a high recovery of proteins, ranging from 57%
to 64%, together with a high level of taurine, excellent emulsifying capacity
and emulsion stability.
In addition, processing by-products from shellfish is made up of pro-
tein residues from body sections such as heads, carapace and exoskeleton.
Enzyme-assisted proteolysis of shellfish processing discards may be used to
recover the chitin and nutritionally valuable protein hydrolysate containing
up to 64% of protein and 81% of total nitrogen in the product [37], or to ex-
tract proteins with flavour-enhancing effects, including carotenoids and/or
carotenoproteins [38]. A new process for advanced utilisation of shrimp
wastes that includes enzymatic hydrolysis was recently described. The authors
Fig. 1 Flowsheet for the enzymatic hydrolysis of fish or shellfish proteins to make fish or
shellfish protein hydrolysates
demonstrated the recovery of amino acids, nitrogen and astaxanthin by Al-

calase pre-treatment of shrimp waste before further processing in chitosan.
The nitrogen recovery was about 70% as compared to only 15% by conven-
tional methods. The yield and quality of chitosan was not affected by the
enzymatic treatment. In addition, a concentrate of astaxanthin was recovered
and could constitute a valuable supplement in salmon feed, improving both
the growth and the disease resistance of the fish [39].
3.2
Advantages of Commercial Exogenous Enzyme Addition
The solubilisation of fish tissue in traditional silage production is a time-

consuming process. After 3–10 days, depending on the storage temperature,
the degree of hydrolysis (DH) is around 20–70%. Addition of commercial
exogenous enzymes to the fish tissue reduces the time needed to obtain
a similar DH and allows a control of the DH, and subsequently of the peptide
size obtained. The choice of hydrolysis process will depend on the targeted
applications. For dietary use, or in order to obtain a hydrolysate with a high
nutritional and therapeutic value, it has been shown that protein hydrolysates
should be rich in low molecular weight peptides, with as few free amino acids
as possible [40]. On the other hand, large molecular weight peptides (more
than 20 amino acid residues) are presumed to be associated with the improve-
ment functionality of hydrolysates.
Table 1 Comparison between chemical and enzymatic hydrolysis [41, 42, 48]
Specificity Advantages Disavantages
Acid/ Random Fast reaction High temperatures

alkaline process Complete hydrolysis Molecular weight
hydrolysis out of control
Low cost Large amount of salt
High solubility Undesirable side reactions
(destruction of tryptophan,
racemisation, etc.)
Enzymatic Unique Control of the Higher cost
hydrolysis specificity molecular weight
Digestion under mild Subsequent deactivation
conditions of the enzyme
Attractive functional Time consuming
product characteristics
Few side reactions
No destruction of
amino acids
Higher nutritional value
Enzymatic hydrolysis using commercial exogenous proteases presents a lot

of advantages compared to chemical hydrolysis (Table 1).
Most commercial proteases can be used to solubilise marine wastes. They
are obtained from animal viscera, plants and GRAS microorganisms. Selected
examples of proteolytic enzymes used to hydrolyse marine by-products, are
presented in Table 2. With regards to the effect of the concentration of enzyme
in the reaction solution, it has been found that the percent hydrolysis in-
creases with higher concentrations of enzyme, but only up to a certain point.
When using an endopeptidase, such as Alcalase 2,4 L for hydrolysis, so as to
moderate DH values (i.e. below DH 20%), the relative content of free amino
acids and dipeptides is likely to be low [43].
By selecting both the enzyme and the conditions of digestion, various de-
grees of hydrolysis or breakdown of the proteins can be achieved in order to
obtain products with a range of functional properties. Much of the work is
still at the laboratory or pilot-scale level, but there is good reason to be con-
fident that these biological processes will make some of this “waste” protein
available as hydrolysates containing bioactive substances (see Sect. 4).
In some cases, experimental designs were employed to optimise hydro-
lysis conditions. Simpson et al. [56] used a 3 × 3 factorial central composite
Table 2 Selected examples of proteolytic enzymes used to hydrolyse marine wastes
Enzymes Suppliers Substrates Appli- Evaluation Refe-

cations of hydrolysis rences
Papain Solvay Herring 1 TCA soluble N, [44]

Enzymes (Clupea harengus) total N, color,
sensory, MWDP
Sigma Lobster cephalothorax 1 TL, NP, NSI [31, 45]

(Palinurus sp.)
Sigma Capelin (Mallotus 1, 2 pH-st, FP, NP [4, 46]
villosus)
Merck Sardine 1 pH-st, NR [33]
(Sardina pilchardus)
Pepsin Sigma Lobster cephalothorax 1 TL, NP, NSI [31, 45]
(Palinurus sp.)
Sigma Atlantic cod 1 pH-stat, MWDP [46]
(Gadus morhua)
Fungal Sigma Lobster cephalothorax 1 TL, NP, NSI [31, 45]
protease (Palinurus sp.)
type II
from
A. oryzae
Alcalase Novo Capelin 1, 2 pH-st, FP, NP [4, 32, 46]
2, 4 L Nordisk (Mallotus villosus)
Shrimp wastes 1 pH-stat, NP [37]
(Crangon crangon)
Salmon muscle 1 pH-stat, NSI, FP [48]
(Samon salar)
Tuna stomach 1, 2 pH-stat, MWDP [35, 49]
(Tunus albacora)
Herring 1 TCA soluble N, [44]
(Clupea harengus) total N, colour,
sensory, MWDP
Pacific whiting 1 DH-α-amino acid, [50]
(Merluccius productus) NR, colour
Dogfish fillet np pH-stat, RSM,NR [34, 51]
(Squalus acanthias)
Atlantic cod 1 pH-stat, MWDP [47]
(Gadus morhua)
and salmon (Salmo salar)
Shrimp waste 1 NR [39]
(Pandalus borealis)
Sardine 1, 2 pH-stat, MWDP [52]
Harp seal 1,2 pH-stat, FP [4, 53]
(Phoca groenlandica)
Table 2 (continued)
Enzymes Suppliers Substrates Appli- Evaluation Refe-

cations of hydrolysis rences
Alcalase Novo Sardine 1 pH-st, NR [33]

0, 6 L Nordisk (Sardina pilchardus)
Neutrase Novo Capelin 1, 2 pH-st, FP, N, [4, 32, 46]
0.5 L Nordisk (Mallotus villosus)
Sardine 1 pH-st, NR [33]
Pacific whiting 1 DH-α-amino [50]
(Merluccius productus) acid, NR,
colour
Harp seal 1 pH-stat, FP [4, 53]
(Phoca groenlandica)
PTN 3.0 Novo Capelin 1 pH-st [32]
type special Nordisk (Mallotus villosus)
Corolase 7089, Novo Salmon muscle 1 pH-stat, [48]
Corolase PN-L, Nordisk (Salmo salar) NSI, FP
Flavourzyme
1000 L
Umamizyme Novo Tuna stomach 1 pH-stat, [54]
Nordisk (Tunus albacora) MWDP
Protamex Frames of Atlantic np NR [55]
Salmon
(Salmo salar L)
1 dietary protein source, 2 biological activities, np not precised, TL tyrosine level, pH-
st pH-stat method, SC soluble content, N nitrogen content, TCA TCA soluble protein, FP
functional properties, NP nutritional properties, NSI nitrogen solubility index, NR nitro-
gen released, RSM response surface methodology, MWDP molecular weight distribution
of peptides
design to optimise hydrolysis of shrimp for recovery of amino acids. The

second order polynomial models they proposed could be used to predict
the content of specific amino acids to a reasonable degree of accuracy. The
response surface regression procedure of the statistical analysis system was
used by Shahidi et al. [46, 53] in order to fit a quadratic polynomial equation
to the experimental data. The three-dimensional response surface indicated
that both the Alcalase concentration and the treatment temperature affected
the DH and thus the protein recovery. Response surface methodology was
used by several authors in order to study the effects of pH, temperature,
enzyme/substrate ratio and substrate concentration on the degree of hydro-
lysis of crayfish by-products [57] and dogfish muscle [51, 58]. The resulting
equations were adequate for predicting the DH under any combination of
values of the variables.
3.3
Quantification of the Proteolysis Extent
When using exogenous proteases, the hydrolysis reaction must be carefully

controlled in order to maintain uniform quality of the end products. The hy-
drolysis degree (DH), which is defined as the percentage of cleaved peptide
bonds, serves as the controlling parameter for the hydrolysis reaction. The
pH-stat technique consists in adding acid or base in order to titrate the re-
leased α-amino and α-carboxyl groups, thus maintaining the pH constant.
Equation 1 relates the DH to alkali consumption [59]:
1 1 1
DH = B × Nb 100% (1)
α MP htot
where α–1 is the calibration factor for the pH-stat, and is the reciprocal of the
degree of dissociation:
10pH-pK
α= (2)
1 + 10pH-pK
The principle of the pH-stat method has been used by many workers for ki-
netic studies and in order to monitor the degree of hydrolysis attained by
enzymatic reactions on food proteins.
In addition to the pH-stat method, the extent of proteolysis may also be
quantified by the depression of the freezing point, which is indicative of
the increasing osmolarity (osmometry), or by the increase in solubility in
trichloracetic acid. DH values determined by different methods are often not
directly comparable. Base consumption and osmometry methods are easy to
perform, allowing continuous monitoring of the hydrolysis process, whereas
the estimation of soluble-nitrogen content using the Kjeldahl method is time-
consuming and cannot be used as an on-line process control tool [60]. The
trinitrobenzenesulfonic acid (TNBS) method developed in 1979 by Adler-
Nissen [61] is always used to determine the DH of food protein hydrolysates.
However, the o-phtaldehyde (OPA) method used for analysing the protein hy-
drolysate DH, has been found to be more accurate, easier and faster to carry
out than the TNBS method [62]. This method has a broader application range
and is environmentally safer. In addition, Silvestre [63] proposed a review of
various methods used for the analysis of protein hydrolysates and discussed
the potential and limitations of the different techniques.
Finally, hydrolysates can be characterised according to the peptide size in
order to check that hydrolysates can be produced in a repeatable manner. In
this case, size-exclusion chromatography is a simple and quick method for
the evaluation of peptide molecular weight. Gel chromatography of protein
hydrolysates is generally performed on a filtered 5 or 10% solution of the
hydrolysate in eluent. Separations are carried out on Sephadex G-50 gel or
Biogel P-10, which have the nominal working range for protein and peptides
of 1500–30 000 Da and 1500–20 000 Da, respectively [36, 44]. New size exclu-
sion chromatography supports in FPLC mode are now available such as the
Superdex Peptide HR 10–30 and Superdex (Pharmacia Biotech, Sweden), with
fractionation range from 100 to 7000 Da and 300 to 30 000 Da respectively.
Acetonitrile is used as the mobile phase (acetonitrile/distilled water by vol-
ume ranging from 2 : 8 to 3 : 7, with 0.1% trifluoroacetic (TFA) [35, 55]. The
chemiluminescent nitrogen detection coupled with size exclusion chromato-
graphy is also a useful technique for estimating the average molecular weight
of peptides and for characterising protein hydrolysates [64]. In practice, the
fractionation range values can only serve as guidelines, especially because the
elution behaviour of peptides in non-dissociating media is influenced by ad-
sorption and aggregation [43] and because of the underestimation of small
peptides and free amino acids [49].
3.4
Mechanism of Hydrolysis and General Properties of Hydrolysates
Under optimal conditions of digestion by the enzyme, fish tissues are con-
verted rapidly from a viscous mince to a free-flowing liquid. Although the
detailed mechanism is not understood, it is believed that, on adding fish
mince to the suspension, the enzyme is absorbed onto the suspended par-
ticles. Simultaneously, hydrolysis of the enzyme-sensitive peptide linkages
takes place. The hydrolysis is characterised by an initial rapid phase, during
which a large number of peptide bonds are hydrolysed. Subsequently, the
rate of hydrolysis decreases and enters a stationary phase with no apparent
hydrolysis taking place (Fig. 2). Such kinetics are typical of fish protein hy-
drolysis, regardless of the enzyme or fish being used. It is also a feature of
such processes that approximately 20% of the total nitrogen remains insolu-
ble even when further amounts of enzyme are added during the stationary
phase of hydrolysis. To some extent this is believed to be product inhibition,
as higher yields of soluble protein can be obtained by reducing the concentra-
tion of solids [28, 46].
The nutritional value of FPH is determined both by utilisation of (i) seve-
ral data such as the proximate composition of the FPH (crude protein, dry
matter, ash, amino acid composition) and (ii) by experiments with living ani-
mals such as rats, with the calculation of various indexes such as net protein
utilisation (NPU), nitrogen balance (NB) and digestibility. In addition, for
the FPH to be of a high nutritional value, it has been shown that the dietary
proteins should be rich in low-molecular-weight peptides, especially di-and
tripeptides, with amounts of free amino acids as low as possible [40].
The nutritional value of a FPH made from cod frames hydrolysed by Al-
calase (150 min) and followed by treatment with Kojizyme (510 min), was
established in an experiment with rats. The apparent digestibility was signifi-
cantly (p < 0.05) higher for the group receiving diets in which all the dietary
Fig. 2 Effect of enzyme/substrate ratio (w/w protein) ranging from 0.1% to 1.5% on the
degree of hydrolysis. Substrate is tuna stomach and enzyme is Umamizyme [54]
proteins come from the FPH as compared to rats fed with either none or the
lowest inclusion levels of FPH. However, the nitrogen balance (that measures
the proportion of nitrogen retained within the body) was significantly higher
for the group receiving 10% FPH as compared to rats fed higher inclusion
levels [47].
The hydrolysates prepared by Shahidi [4] from capelin (Biocapelin) and
seal meat (Bioseal-L) have excellent solubility characteristics at pH values
ranging from 2.0 to 10.4. While 90.36–98.57% of nitrogenous compounds
of Biocapelin were soluble, corresponding values for Bioseal-L varied be-
tween 93.45% and 98.05%. The fat adsorption, moisture retention, emulsifica-
tion properties and whippability of the hydrolysates were also excellent. The
amino acid composition of hydrolysates obtained from the cod filleting waste
is closely similar to that of fillets, except for glycine and proline amounts,
whose highest concentrations are derived from the relatively higher amount
of connective tissue proteins [28, 65].
Most of hydrolysates, however, have varying degrees of a bitter flavour
which, although they are mild compared with those of casein hydrolysates,
does restrict their application. Bitter tastes are a common feature of en-
zymically produced protein hydrolysates and are believed to be due to low
molecular weight peptides (up to 6000 Da), with hydrophobic side chains nor-
mally located in the interior of an intact protein. Until now, the bitter taste
was reduced, but not eliminated, by controlling the degree of hydrolysis and
the choice of enzyme preparation, so that predominantly tasteless larger mo-
lecular weight peptides are produced [47].
4
Recent Developments in Fish Protein Hydrolysates
4.1
Biologically Active Substances in By-Product Hydrolysates
A large number of biologically active peptides have been isolated from bac-
terial, fungal, plant and animal sources or generated from proteins by enzy-
matic hydrolysis [66–70]. These peptides, which are inactive within the se-
quence of the parent protein, can be released by enzymatic proteolysis, for ex-
ample during gastrointestinal digestion or during food processing. Peptides
derived from milk proteins deserve special attention. A wide range of phy-
siological activities including opioid, hypotensive (anti-ACE), immunomo-
dulating, antithrombic, antimicrobial, antiviral and mineral absorption regu-
latory functions, have been associated with the specific sequences derived
from milk (for reviews, see Meisel [71, 72], Clare and Swaisgood [73]; Clare
et al. [74]; Floris et al. [75]). In addition, many milk-derived peptides re-
vealed multifunctional properties, i.e. specific peptide sequences having two
or more different biological activities such as opioid, ACE-inhibitory and im-
munomodulatory effects [71].
These bioactive peptides have been characterised in detail. Generally,
these structures usually contain 3–20amino acid residues per molecule. Some
of them are often further modified through glycosilation, phosphorylation,
and/or acylation of multifunctional amino acid residues [66]. The isolation
and characterisation of new biologically active peptides is ongoing and will un-
doubtedly continue in the future. This is partially due to increased knowledge of
enzymes and food proteins (inherent amino acid composition and sequence).
Consequently, some interesting and very promising new applications for
the FPHs have emerged and, at present, a few examples of peptides exhibi-
ting various activities (e.g. opiate, antithrombic or antihypertension activity,
immunomodulation, antioxidant) have been reported. The objective of this
section is to provide the reader with an up-to-date summary and analyse the
new trends and ideas that have emerged in the last few years in this rapidly
developing area.
4.1.1
Neuroactive Peptides
The endogenous opioids, enkephalins, endorphins and other neuroactives

such a somatostrain, bradykinin and thyrotropin-releasing hormone (TRH)
are a few examples of neuroactive peptides. These peptides play fundamen-
tal roles in the functioning of the nervous system such as in the regulation of
pain perception [66].
Opioid receptors are located in the nervous, endocrine and immune sys-
tems, as well as in the tract of the mammalian organism and can interact
with their endogenous ligands, as well as with exogenous opioids and opioid
antagonists.
It has been shown that a variety of neuroactive peptides are formed on
the hydrolysis of milk, soy, cereal and fish proteins (for review, see Schlimme
& Meisel [76]). For example, opioid peptides such as enkephalins have an
affinity for opiate receptors as well as opiate-like effects, inhibited by nalox-
one. Most of the typical opioid peptides have the same N-terminal sequence,
Tyr-Gly-Gly-Phe. Opioid peptides exert their activity by binding to specific
receptors of the target cell.
Recently, some “pseudo” opioid activities were found in shrimp and cod
head hydrolysates, since the inhibition of the contractions measured in the
GPI test was naturally reversed without the help of naloxone [77]. In addition,
fish protein hydrolysates commonly used as nutritional supplements (com-
mercial names PC60 and Stabilium 200) were reported to reduce anxiety in
humans and to improve memory and learning performances in rats and pa-
tients [78–80]. PC60 was compared to a potent anxiolytic drug – diazepam
(Valium), which acts on benzodiazepine receptors, confirming the anxiolytic
properties of the nutritional supplement previously reported in both rats and
humans [81].
4.1.2
Enzyme Regulators and Inhibitors
A very important group of peptides is the angiotensin-converting enzyme

(ACE) inhibitors, which are currently in use as antihypertensive agents. Hy-
pertension is a major risk factor in cardiovascular disease such as heart
disease and heart stroke. Angiotensin I-converting enzyme (ACE, peptidyl
dipeptide hydrolase, EC 3.4.15.1.) has been classically associated with the
renin-angiotensin system, which regulates peripheral blood pressure. ACE
may modulate blood pressure by catalysing the conversion of pro-peptide
angiotensin I to a potent vasoconstrictor peptide angiotensin II. Conse-
quently, ACE-inhibitors may exert an inhibitory effect. Moreover, inhibition
of ACE may influence different regulatory systems of the organisms involved
in modulating blood pressure, immune defence and nervous system activ-
ity [71]. These peptides often contain proline, lysine or arginine as the C-
terminal residue and have been found in the enzymatic hydrolysate of bovine
and human caseins [82–84], zein protein hydrolysates [85] and other food
proteins. Peptides obtained from enzymatic hydrolysis of tuna muscle [86,
87], sardine muscle [88], bonito bowels [89] and squid liver and mantle mus-
cle [90], were found to have potent inhibitory effects on ACE.
In addition, some purified fractions of an Alcalase sardine by-product

hydrolysate gave inhibition indexes reaching 90% [77] and may provide a po-
tential good source of antihypertensive molecules.
A cod frame hydrolysate was separated, based on the molecular weight
of the peptides, through a series of UF-membranes with molecular cut-offs
ranging from 30 to 3 kDa. The 3-K hydrolysate had excellent ACE inhibitory
activity, while the 10-K showed high antioxidative activity [91]. Until now,
antihypertensive effects in humans have not been proven for most of the pep-
tides obtained by processing food proteins. However, recent studies provided
proof of antihypertensive effect of the peptides Val-Pro-Pro, Ile-Prp-Pro and
Val-Tyr ingested with milk twice a day for several weeks by hypertensive pa-
tients in Japan and Finland [92–94].
4.1.3
Immunoactive Peptides
The bioactivity of immunopeptides is characterised by different in vitro and

in vivo tests. Many immunomodulating peptides that stimulate proliferation
of human lymphocytes and phagocytic activities of macrophages were iso-
lated from milk caseins. For example, Kayser & Meisel [95] reported that
the immunoreactivity of human peripheral blood lymphocytes was either
stimulated or suppressed by various bioactive peptides derived from milk.
A pepsin-chymosin digest of bovine casein induced a significant proliferative
response in rat lymphocytes [96].
The presence of immunomodulating effects was demonstrated in vari-
ous fish hydrolysates. For example, hydrolysates from Atlantic cod, Gadus
morhua L., were used both in vitro and in vivo in stimulatory experiments
with head kidney leucocytes from Atlantic salmon (Salmo salar). The authors
concluded that acid peptide fractions from fish protein hydrolysate may
be useful as adjuvants in fish vaccine and as an immune stimulant in fish
feed [97, 98].
4.1.4
Hormonal and Hormonal-Regulating Peptides
Selected examples of activities identified in marine waste hydrolysates are the

peptides gastrin, growth hormone releasing factors (GRFs), calcitonin and
CGRP.
These short peptides often exert complex and multiple physiological ef-
fects by serving as hormones themselves and/or regulating hormonal res-
ponses associated with the control of important metabolic, growth and devel-
opment processes [65]:
• Calcitonin gene related peptide (CGRP). This 37 amino acid neuropeptide

is derived from the same gene as calcitonin by a mechanism of alterna-
tive splicing. It is predominantly synthesised in neural tissue and is mainly
involved in the control of vasodilatation, with inotropic and chronotropic
effects on the heart [99], but is also involved in the regulation of gas-
tric acid secretion [100]. This peptide can also inhibit the proliferative
response of T lymphocytes to mitogens [101] and macrophage activa-
tion [102]. In addition, at high doses, CGRP induces the same effect as
calcitonin, that is hypocalcemia and hypophosphatemia [103]. The pres-
ence of CGRP immunorelated molecules was demonstrated in various
fish hydrolysates (cod, sardine, hake and tuna Alcalase 2,4 L-assisted
hydrolysates) [104]. CGRP-related molecules were purified from sardine
hydrolysates prepared using 0.1% Alcalase and 2 h hydrolysis. Twenty-
two mg of crude extract yielded 14 µg of CGRP-related molecules with
a purification factor of 12 500. The molecular weight determined by mass
spectrometry was 6000 Da. The purified molecules induced an inhibition
of the CGRP-stimulated adenylate cyclase activity. This effect was spe-
cific as no such effect was observed on the glucagon- stimulated adenylase
cyclase activity measured in the same rat liver membrane preparation,
suggesting that the purified molecules may act as antagonists for peptides
that bind to CGRP receptors in rat liver membranes [105].
• Cholecystokinins (CCK) and gastrins. These belong to a family of short
peptides exhibiting a large spectrum of activities including mediation and
stimulation of protein synthesis, control of intestinal mobility and secre-
tion of digestive enzymes. Hydrolysates derived from fish heads and vis-
cera (sardine and cod) and shrimp wastes presented a positive response to
gastrin radioimmunoassays, thus suggesting the presence of gastrin-like
and cholecystokinin-like peptides [106, 107]. In addition, Alcalase 2,4 L-
assisted hydrolysis of tuna, shrimp, cod heads and cod muscle significantly
stimulated the growth of 3T3 fibroblastic cells suggesting the presence of
growth factor-like molecules in the hydrolysates [49, 52].
4.1.5
Antioxidant Activities
In addition to the biological activities described above, another promising re-

search area for the coming years is the presence of antioxidant compounds
in marine hydrolysates. The term antioxidant is defined as “any substance
that, when present at low concentrations compared to that of an oxidisable
substrate, significantly delays or inhibits oxidation of that substrate” [108].
Antioxidants can act at different levels in an oxidative sequence. This may be
illustrated by considering one of the many mechanisms by which oxidative
stress can cause damage by stimulating the free radical chain reaction of lipid
peroxidation. Free radical chain reactions within a material may be inhibited
either by adding chemicals that retard the formation of free radicals (preven-
tive antioxidants), or by introducing substances that compete for the existing
radicals and remove them from the reaction medium (chain breaking antioxi-
dants). Synthetic antioxidants such as 3-ter-butyl-4-hydroxyanisole (BHA),
3,5-di-tert-butyl-4-hydroxytoluene (BHT), tertiary-butylhydroxyquinone and
propyl galate are used as food additives to retard lipid oxidation. However,
use of synthetic antioxidants in food products is under strict regulation due
to the potential health hazards caused by such compounds. Therefore, search
for natural and safer antioxidants as alternatives to synthetic ones is of great
interest among researchers.
Several studies have described the antioxidative activity of proteins and
protein hydrolysates such as milk casein, soybean protein, broad beans,
bovine serum albumin, wheat gliadin and sunflower meals [109–112]. For
example, a hexapeptide with strong free radical scavenging activity was sepa-
rated from casein hydrolysate. Six antioxidative peptides were isolated from
the hydrolysate of a soybean protein, β-conglycinin. These peptides were
composed of 5–16 amino acid residues and included hydrophobic amino
acids, Val and Leu, at the N-Terminus and Pro, His, or Tyr in their se-
quences [113]. Two peptides composed of 10 and 15 amino acid residues,
and both containing a leucine residue at their N-terminal position, were pu-
rified from an Alcalase digest of a by-product of lecithin extraction from egg
yolk [108].
A few antioxidant compounds were also isolated from marine hydrolysates
such as mackerel (Scomber australasicus) [114], capelin (Mallotus villosus)
and harp seal (Phoca groenlandica) [115, 116], and cod frames [91]. Kim
et al. [117] isolated two peptides from Alaska pollack skin, composed of 13
and 16 amino acid residues. Both peptides contained a Gly residue at the
C-terminus and the repeating motif Gly-Pro-Hyp.
In addition, antioxidant compounds were purified from shrimp shell
wastes and rockfish [118]. Some of these compounds were identified using
mass spectrometry. One antioxidant was proposed to be 1,2-diamino-1-(o-
hydroxyphenyl)propene [119]. Three antioxidant peptides were isolated and
identified from a pepsin digest of prawn (Penaeus japonicus) muscle [120].
Guérard et al. [121] hydrolysed shrimp wastes using Alcalase 2,4 L. By com-
bining membrane filtration separation and chromatography techniques, the
antioxidant fraction was partly purified and its molecular weight was esti-
mated to range from 300 to 400 Da. An oyster (Crassostera gigas) extract was
prepared from fresh raw oysters and demonstrated a high free radical scav-
enging activity towards superoxide and hydroxyradical. However, the authors
did not establish which compounds in this extract were responsible for the
scavenging effect on the radicals [122]
Maillard reaction products may also show antioxidant properties derived
from their ability to bind heavy metals (particularly iron), thereby giving rise
to oxidatively inactive complexes [123]. For example, when reacting a tuna
stomach hydrolysate with glucose, the antioxidant effect evaluated using the
β-carotene-linoleate system model, was increased by 20 to 30% [124].
To summarise this section, all the bioactive substances have been studied
by means of the following investigation techniques:
• Establishment of an in vitro assay system to determine the biological ac-
tivity
• Hydrolysis of proteins by proteases
• Partial isolation of peptides and, sometimes, purification and determi-
nation of the structure
• In a few cases, synthesis of peptides for the verification of activity
In the final report of the European research program FAIR CT 97-3097
(acronym HYDROFISH), numerous examples of biological activities identi-
fied in fish and shrimp waste hydrolysates are presented.
In conclusion to this section, marine hydrolysates or extracts, particularly
from fish viscera or marine invertebrates do contain various biological ac-
tivities that should be further investigated. Remarkable observations have
already been made during feeding with various extracts or hydrolysates from
marine fish and shrimps. Addition of these compounds to fish feed improves
the food intake normally occurring when fish are given feed containing an-
tibiotics. This observation may lead to possible improvements in aquaculture
that are both economically and environmentally compatible.
Thus, the occurrence of many biologically active peptides in marine by-
product hydrolysates is now well established, but numerous scientific and
technological issues have to be resolved before these substances can be opti-
mally exploited for human or animal nutrition and health. Biologically active
substances or peptides from marine origin could be produced on an indus-
trial scale as a consequence of the studies conducted on milk-derived pro-
teins. These compounds could find applications both as dietary supplements
in “functional foods” and as drugs, like bioactive peptides derived from milk
proteins. However, the successful application of these bioactive peptides will
require the demonstration of in vivo beneficial effects in animal models, so
that the bioactivity in humans may be validated and potential adverse effects
clarified.
4.2
Marine Waste as a Nutrient Source in Fermentation Processes
Industrial fermentation processes require the availability of abundant and

inexpensive substrate sources. As mentioned by Vecht-Lifshitz et al. [125],
growth substrates constitute a major cost in the production of microbial cells
and bioproductions; the nitrogen source tending to be the most expensive
medium constituent. At present, commercial nitrogen sources are obtained
from vegetable extracts, casein and slaughterhouse waste. Up to now, fish
peptones have been investigated only to a minor extent, and their use in
industrial processes is still poor despite their cheap price, as they consti-
tute a waste product from the fish industry. However, the results of several
studies have shown that in most cases fish peptones compared favourably to
commercially available peptones produced from meat, casein or plant pro-
teins [125–129]. The production of protease by Bacillus subtilis was strongly
induced when cells were grown in media containing a non-defatted flour pre-
pared from Sardinelle heads and viscera, compared to the same defatted fish
meal or commercial peptones [130]. A shrimp waste acid hydrolysate contain-
ing 80% of glucosamine has been used as a carbon and energy source for the
growth of Saccharomyces cerevisiae [131].
4.3
Other Applications of FPHs
Mackerel hydrolysates can be used to stimulate epoxy-pseudoisoeugenol-

(2-methylbutyrate) (EPB) production in transformed anise root culture [132].
EPB is potentially a valuable phenolic metabolite for regulation of nutraceut-
ical-type phytochemicals during seed germination. Such phenolic metabo-
lites are being targeted for food applications as antioxidants or as modulators
of seed germination, to obtain seed-based functional phenolics for nutraceut-
ical applications.
5
Genetic Traceability of Fish and Shellfish Species and By-Products
Genetic identification methods provide new tools for an accurate and effi-
cient determination of marine species specimens and also of derived products
and coproducts (for a review, see [133]). As far as the characterisation of
populations or the evaluation of stocks of commercially exploitable fishes are
concerned, however, the use of genetic markers can lead to results that are
often difficult to interpret and, therefore, could sometimes increase confu-
sion more than solve difficulties. The tools are still new and one needs to
establish consensus methods that have proved to be efficient and appropriate
at each level of identification. Here, we aim to provide an understanding of
a simple and reliable methodology using molecular genetics methods for the
identification of marine species and derived processed products.
Chemical signature and protein polymorphism have been already studied
using denaturing electrophoresis [134, 135], isoelectric focusing [136] and
high pressure liquid chromatography [137, 138]. These methods are pow-
erful and acute, giving clues on the specimen history (chemical or bio-
logical environments impregnate metabolism or modify gene expression in
organisms), but these parameters are too variable and too sensitive to be
helpful for an efficient and easy identification at the level of population,

species or upper [139]. On the other hand, molecules of nucleic acids are
very stable, and a large number of markers can be found as ubiquitous
sequences throughout living organisms. The accumulation of informative
characters leads to preference for the comparison of sequences for species
identification rather than use of methods showing a single nucleotide poly-
morphism (SNP)[140], or showing a fragment length polymorphism. The
polymorphisms can be shown directly, as in the case of the characterisa-
tion of short tandemly repeated fragments (STR), of microsatellite mark-
ers [141–145], or by the characterisation of fragments issued by restric-
tion digestion of a defined DNA fragment (RFLP) [146, 147]. Nevertheless,
these methods appear to be well adapted for population structure analyses
[144,148]. Methods based on protein characterisation have been also de-
veloped with the aim of identifying fish processed products obtained after
heat denaturation [149] or cooking [150, 151]. In the case of fish product
identification, these methods compete with DNA-based methods applied to
smoked or canned samples [152–157].
5.1
Choice of Marker Sequences
Markers can be chosen in DNA extracted either from the nucleus or from
mitochondria. Nuclear DNA is highly complex. Even if it can provide conside-
rable systematic and phylogenetic information using the rhodopsin gene or
the emergent use of RAG1 gene [158], its utilisation rather difficult for various
reasons: its great variability among organisms, the fact that a high number of
genes are unique in the genome and therefore difficult to isolate or amplify
for further sequencing, and the fact that numerous genes exist as multi-gene
families with several similar but different sequences. Some genes such as nu-
clear ribosomal RNA genes may occur inside one organism from several to
a thousand copies without significant variability and can be found in all living
materials. They are therefore good candidates for identification markers.
Mitochondrial DNA occurs in the mitochondria of all eukaryotic cells. It
is a simple molecule being a small circular DNA fragment typically contai-
ning 16 000 to 20 000 base pairs in length, haploid and maternally inherited.
The mitochondrial genome contains only 37 genes, one non-coding region
(the D-loop or control region), and is generally conserved and yet more vari-
able than nuclear genes. It is generally considered to be a useful phylogenetic
marker [159]. As mitochondria are numerous in each cell, the copy number
is very high for each of these genes and, thus, the material is abundant and
easy to extract, even from degraded (or processed) samples. The presence of
protein-coding genes, rRNA-coding genes and non-coding fragments offers
markers that are under different expression regulatory systems and therefore
under different selective pressure mechanisms.
Analysis of mtDNA, using RFLP analysis or DNA sequencing has indi-

cated that some fragments contained in this genome may be more variable
than others (Fig. 3). Genes encoding amino acid transfer RNAs (tRNA) are
highly conserved among different species for their location as well as for their
sequences. Mitochondrial ribosomal RNA genes show more variability: se-
lective pressure acts only on these genes for the necessary conservation of
the ribosomal RNA structure and allows changes in nucleotides for a high
number of positions in the sequence.
Structural genes coding for enzymes (the mitochondria contains the genes
implicated in the process of oxidative phosphorylation, i.e. the production
of energy and its storage) are more variable because most of the possible
changes of the third nucleotide of several codons do not affect the translation
meaning.
The control region of the mitochondrial DNA (also named D-loop) con-
tains DNA portions that are highly variable [160]. However, works performed
on different fish species, i.e. Salmo trutta [161], Salmo salar [162] and An-
guilla anguilla [163] have shown less variability in the non-coding D-loop
than elsewhere in the mtDNA genome. This observation could be used in two
ways. Firstly, one can concentrate on “slow evolving” parts of the genome in
order to establish species comparisons or use the “fast evolving” portions for
investigating populations.
Secondly, and technically speaking, these types of structures are very help-
ful when searching parts of DNA to design PCR primers usable on a large
variety of organisms. Starting from the weakly variable sequences of two
transfer RNA genes flanking a more variable region of the mitochondrial
genome, renders it easy to determine the sequences of this region from a large
number of species, using the same couple of primers. Here, these primers
could be tagged as “universal” primers as they could be used on different
biological samples targeting the same genetic marker.
Fig. 3 Relative position of the genes largely used as genetic markers along the mito-
chondrial genome. Schematic representation of the mean nucleotide variability for the
different genes
The mitochondrial genomes of several commercial fish have now been

completely sequenced, e.g. Atlantic cod [164], sea lamprey [165], salmon [166],
sardine [167], shark (gummy shark [168], dogfish [169], spiny dogfish [170])
and various cartillagenous fish such as ray [171] and chimaera [172]. The por-
tion represented in Fig.3 contains a set of genes, in particular cytochrome-b,
largely used to establish phylogenetic relationship, determination of geo-
graphical population structure, genetic differentiation in fish, and for identi-
fication of species in nature and after processing [157, 160, 173–176].
Focusing on a ribosomal gene, i.e. 16SrDNA, a similar type of organisation
with more variable–more stable regions is observed (Fig. 4). A portion of the
16SrDNA from 28 shark species representing three different orders was se-
quenced, aligned and compared. The analysis of the variability in nucleotide
for each of the position along the sequence (indexed by a level of disorder)
shows that parts of this gene are very stable (and could be used to design ex-
ternal PCR primers or internal sequencing primers necessary to achieve the
determination of the sequence in case of long enough fragments) framing
more variable regions whose changes in nucleotide are frequent and highly
informative.
An example of identification of an unknown “shark” processed product
is presented below. Several studies on various specimens of this family re-
vealed a low level of evolution of the mitochondrial genome [177] and the
risk of using some nuclear genes for phylogeny [178]. The interest in using
genetic markers for population studies [179–182] and for identification of
species [183] or parts of morphologically similar specimens [184] has been
demonstrated. In the domain of fish traceability, identification remains a ba-
sic problem strongly exacerbated when it comes to identifying detached shark
fins or the finless and headless shark carcasses in fish markets. It is also a
Fig. 4 Schematic nucleotide variability for each of the different positions along the
16SrDNA fragment, expressed as entropy value using the 28 shark sequences selected
from our shark sequence data library
problem in the identification of the origin of manufactured and processed

products with the aim of conservation and management controls on shark
catch and trade.
5.2
Protocols for Fish and Fish Coproduct Identification
With marine organisms, one frequently faces DNA extraction difficulties

due to the presence in tissues of large quantities of mucus polysaccharides.
An adapted protocol from the method described by Jones [185] using the
non-ionic detergent CTAB (cetyltrimethylammonium bromide with formula
C14 H29 N(CH3 )3 Br) proved to be very effective for these tissues. Starting with
a pinpoint amount of muscle, skin, liver, bone or cartilaginous material, tis-
sue was dissolved in 600 µL of buffered CTAB solution (2% (w/v) CTAB,
100 mM Tris-HCl, pH = 8, 20 mM EDTA, pH = 8 and 1.4 M NaCl), with ad-
dition of 0.2% 2-mercapto-ethanol. The sample was incubated for 30 min to
1 h at 60 ◦ C in the presence of 20 µL of a solution of 10 mg/mL of proteinase
K. Protein extraction was carried out with two successive rounds of mixing an
equal volume of chloroform/Isoamylol (24/1) and centrifugation (14 000 ×
g for 10 min). The upper aqueous solution was recovered and DNA precipi-
tated with one tenth volume of NaOAc (3 M at pH = 5.2) and two volumes of
ethanol. After homogenisation of the solution and centrifugation, the DNA
was washed twice with 1 mL of 70% ethanol, dried and solubilised in 200 µL
TE (Tris-HCl 10 mM, EDTA 10 Mm). The purity of the nucleic acid extract
can be estimated by establishing a UV spectrum of the solution. DNA ex-
hibits a maximum of absorption at 257 nm and ratios OD257/OD280 and
OD257/OD230 should be the highest (between 1.8 and 2). The whole extrac-
tion protocol can be carried out within 1 or 2 h, depending on the difficulty
of solubilisation of the tissues.
This protocol is illustrated with data obtained on a processed (boiled,
washed and dried) sample of “dry shark fin” collected on a fish market and
used to test our method of identification of a marine processed product for
which it is impossible to obtain any indication of origin (Fig. 5). In order to
test the reliability of the extraction and homogeneity of the biological pro-
duct, two different samples were taken and analysed separately.
In order to obtain a large amount of a defined DNA fragment, a prior
amplification of the selected marker was performed using PCR techno-
logy. The ready-to-go system (Amersham) was used where one has only
to add DNA (1 µL), the two primers (2 µL) of a 10 nM solution) and wa-
ter to a final volume of 25 µL. In the example shown here, a 22 mer-
sens primer (5 AGGCAAGTCGTAACATGGTAAG3 ) whose target sequence
is located in the 3 part of the 12 SrDNA and a 23 mer-antisens primer
(5 ATCCAACATCGAGGTCGTAAACC3 ) with a target sequence in the 5 part
of the 16 SrDNA were used. These sequences were determined according to
Fig. 5 Dry fin sample. This product is found on the market, tagged as shark’s fin, imported
from Thailand
the alignment of several mitochondrial sequences deposited in the gene bank.

The expected DNA product should be around 1550 bp in length. The duration
of such a program was around 3–4 h. Control of the result of a successful DNA
amplification can be performed optionally by electrophoresis on a 1% agarose
gel in TAE buffer [186]. After electrophoresis (1 h, 100 V), DNA fragments are
stained with ethydium bromide (Fig. 6). The size of the fragments and an es-
timation of the amount of DNA produced can be determined by comparison
with standard size markers (PstI digested Lambda phage DNA).
When using a high (60 ◦ C) extension temperature, the amplification is
highly specific and no interfering DNA fragments are observed. In the case
of both samples, DNA extractions and PCR amplifications were success-
ful. DNA can be easily extracted from the gel [187]. After excision of the
DNA-containing agarose fragment with a scalpel, dissolution in 600 µL of
a solubilisation mixture (QIAquick Gel Extraction Kit from Qiagen), and add-
ition of 200 µL of isopropanol, the solution was loaded on an adsorption
column. After a centrifugation (15 s), the fixed DNA was washed twice with
a saline/ethanol solution, dried and eluted with a small volume (80 µL) of
pure water or TE buffer.
This DNA can be directly sequenced using either of the external primers
that were used for the amplification process or using an internal primer. The
sequencing here was achieved on a ABI PRISM 310 genetic analyser (Applied
Biosystem) using a long read sequencing-61 cm capillary. Sequencing reac-
tions were performed with PCR technology using the purified DNA fragment,
one primer and a mixture of deoxynucleotides and fluorescent specifically
labelled dideoxynucleotides, with a PCR program: 94 ◦ C × 30 s, 50 ◦ C × 30 s,
60 ◦ C × 4 min and 40 cycles. After precipitation, the reaction products were
washed, dried, taken in 15 µL of formamide and subjected to electrophoresis
Fig. 6 Agarose gel electrophoresis of the 16SrDNA fragment obtained from the dry fin
sample after PCR amplification, EtBr staining and UV transillumination. The 1550 bp
fragment is characterized using size standard fragments generated after Pst I digestion
of Lambda phage DNA. Two different samples were set apart from the dry fin product to
test heterogeneity
in the genetic analyser. The result was obtained as a processed electrophore-

gram (Fig. 7a).
After checking for possible misinterpretations of the results of the elec-
trophoresis, the sequences obtained in an easily exploitable form (Fig. 7b)
from the two dry fin samples were aligned and compared. The first point to
note is evidence of the real validity of the protocol used for extraction, ampli-
fication and sequencing for a variety of fresh tissues and also for ethanol pre-
cipitated, dehydrated and even boiled samples. For the dry fin samples, there
were two different sequences for the two samples taken from the product. Be-
tween the two sequences, over 520 aligned nucleotides (data not shown) and
36 informative positions (2 deletions and 34 changes) are observed. Gaps in
the alignment, as non-existing nucleotide in a particular sequence, can only
be validated when aligning several sequences. Once fully valid as confirmed
with an insured alignment, the sequences can be used as informative charac-
ters as defined changes of nucleotide. As a result, the two sequences obtained
from this manufactured product appeared markedly different with 6.9% of
change on the extent of the sequenced fragment.
To determine the origin of the product, one can compare the sequence
obtained with all the sequences stored in the data library. The search for ho-
mology could be carried out in seconds using an internal program such as
BLAST [188]. Still very recently, the result of this research would have given
the table presented in Fig. 8.
Fig. 7 (a) Electrophoretic results of the direct sequencing of a portion of the 16SrDNA
fragment after PCR amplification using our “shark universal” primers S1 and R4
(b) Corresponding dry fin 1 sequence under an edited format
The result of the search placed, with the best scores, the four shark se-
quences present in the data library, then the only available sequence from
a rajidae, then the numerous sequences from bony fish. This search indicated
that our unknown sample sequence came from a shark and that this shark
could be a Carcharhiniforme. However, as only three orders (of the eight ex-
isting) are represented in the data library, it could arise from another order
not present. A rapid browse of the content of the library shows that more
than 100 000 sequences are from fish. Among them, more than 3000 contained
at least a part of the 16 SrRNA gene, and close to 200 are sequences of the
Fig. 8 Fourteen best scores of homology obtained after the search with “Blast n” using the
unidentified dry fin 16SrDNA sequence 1 against the gene bank “other vertebrates”
complete mitochondrial genome. Some 867 sequences concern fish D-loop,

more than 600 are part or complete cytochrome-b sequences. Nuclear genes
such as RAG-1 (20) or rhodopsin (1678) genes are also represented in diffe-
rent ways. Even with a large number of sequences, bony fish (27 000 species)
and cartilaginous fish (1000) species are only partially represented and the
search gave a very inaccurate result. Moreover, the order seen for this output
of the “Blast” search could be strongly biased because the comparison of the
“personal sequence” with the data library sequences could be done using se-
quences covering different parts of the given marker (slow- or fast-evolving
sequences) or fragment of different length. Another point is the alignment of
some of the sequences with homologous (supposedly from the same species)
sequences from the data library. Differences are sometimes observed that
could only be explained by inaccurate sequencing analysis or inappropriate
manipulation or errors in species identification. To eliminate these risks of
error, it is thus advisable to ensure the identification of the specimens and
to preserve the specimens used for the genetic signature determination in
collection.
Using the same program (Blast) we searched the sequence library that
had been established for phylogenetic purposes [189]. In this case, using
a set of sequences restricted to sequences from sharks that are supposed to
be used to produce shark fins, the search placed first the sequences from
Sphyrnidae, then numerous sequences from Carcharhinidae (Fig. 9). The very
Fig. 9 Result of the homology search with the program “Blast n” using the unidentified
dry shark fin sequence 2 against our MBS (Marine Biology Station) library. All the refer-
ence sequences used are with the same number of nucleotides. The score is very high for
the comparison with the Sphyrna zygaena reference sequence because the whole dry fin
sequence 2 is perfectly homologous to this one
high score obtained with the Sphyrna zygaena sequence is due to a perfect
alignment of this sequence with that of the processed product. In the case of
the other sample obtained from this product, it appeared that it also came
from a Sphyrnidae, but not one represented in our sequence library. The
result could be clearly shown by establishing a sequence similarity matrix ex-
pressing (as percentages) the levels of similitude of the different sequences
(Fig. 10).
From a rapid view of the percentages of similarities between the different
sequences given by the sequence similitude matrix, it is possible to estimate
interspecific variability at different levels, i.e. genus, family and order.
From this comparison of shark sequences, using only one (partial) marker
sequence, a level of nucleotidic changes of around 16.6% is observed when
comparing Orectolobiformes to Carcharhinoformes and around 19.1% when
comparing Orectolobiformes to Lamniformes. At the level of the order, the
comparison of sequences from two representatives is between 16 and 19%. In-
side an order (Lamniformes for example), 7.8 to 8% of changes are observed
between the four studied families. At the level of the species, comparing the
11 species from the genus Carcharhiniformes, one observed a mean value of
4.8% of changes between these sequences. Highest values are obtained when
Fig. 10 Similarity matrix of the sequences (expressed in percent). Cplu Carcarhinus

plumbeus, Nacu Negaprion acutidens, Fin1 dry fin sample 1, Szyg Sphyrna zygaena, Fin2
dry fin sample 2, Cobs Carcarhinus obscurus, Cgal Carcarhinus galapensis, Tobe Triaen-
odon obesus, Ofer Odontaspis ferox, Ctau Carcharias taurus, Avul Alopias vulpinus, Cmax
Cetorhinus maximus, Ipau Isurus paucus, Lnas Lamna nasus, Rtyp Rhincodon typus, Slew
Sphyrna lewini, Csor Carcarhinus sorrah, Gcuv Galeocerdo cuvier
comparing sequences for other genus (7.3% for Sphyrna, 7.1% for Alopias
and 6.7% for Isurus). These values for interspecies variability are very close to
those for interfamily variability. This could be due to the fact that these fami-
lies evolved a long time ago and a large number of the species are now extinct.
In contrast, Carcharhinus has a large number of living species and a short
evolution history (divergence time: 144 My). Applied to identification of the
processed sample, the similarity matrix immediately shows a 100% similar-
ity between the dry fin 2 sample and the Sphyrna zygaena sequence. This is
evidence for the presence of fin product from this species in the unknown
sample. The best observed score of similitude concerning the dry fin 1 sam-
ple is found with the Sphyrna lewini sequence (95.2%), then with the other
Carcharhiniformes, then with the Lamniformes, in accordance with morpho-
logical characters based phylogeny. This shows that the processed sample is
also composed from a second hammershark from the genus Sphyrna, proba-
bly Sphyrna mokaran, another species largely used for preparation of shark
fin product in Asia. A 100% similitude is also observed between two se-
quences of reference (Carcharinus obscurus and Carcharhinus galapensis). As
another genetic marker (Cytochrome-b gene) gave the same result for these
two close species, we should come back to the collected specimen to ensure
that no error could have occurred during the sampling of tissues. If not, com-
plementary experiments could lead to a decision of synonymy.
In conclusion, the use of genetic markers for species identification is

a powerful, reliable and easy technique on fresh, ethanol-preserved, dry,
boiled or even processed samples. It is, however, necessary to draw up con-
sensual protocols and to adapt the choice of markers to the level of the need
for identification. In addition, it is of primary importance that the sequences
used as reference are given with all the precision wanted on specimens per-
fectly identified and preserved indefinitely in collection.
6
Conclusion
In this review, we have attempted to survey the rapidly developing area of

seafood by-product upgrading. Chemical processes have been applied with
limited success for the recovery of seafood wastes and the production of
quality products from them. Because of this, it is expected that biological pro-
cesses will be prominent among those which will have to be developed for
seafood waste processing. The general development of biotechnologies and
the great diversity of commercial proteases should accelerate the application
of biotechnological processes to fisheries.
As far as species identification and traceabilty of fish and fish by-products
are concerned, several European programs are dealing with the use of genetic
markers for studying genetic diversity and the population structure of ma-
rine resources for stock identification and fisheries management. All these
programmes are focused on single model species (trout, lobster, horse mack-
erel, redfish, cod or herring). Only one (Fishtrace) aims to establish a publicly
accessible database compiling cytochrome-b and rhodopsin sequences from
150 fish species for identification purposes. There is a need to complete this
approach, assessing methodologies for acquiring data on a large panel of
commercial fish and shellfish species and related by-products.
We hope that the above survey adequately demonstrates the potential ap-
plications of marine waste molecules in the field of nutrition and flavour. In
addition to these well-established uses, we have shown that a significant re-
search effort is currently being made to demonstrate the huge existing scope
for the applications of biologically active peptides or molecules in the food,
pharmaceutical and nutraceutical industries.
However, the difficulties typically associated with supplying constant qua-
lity by-products remain the major practical obstacles for the introduction of
these new products to the market place. A further major difficulty will be the
development of economic processes to produce high added value hydrolysates
in a repeatable manner. Currently, the processes employed are still at a labora-
tory scale, and therefore most of the final products purified or semi-purified
are still not available as commercial products. It can be expected that in the
next few years, bioactive peptide production and purification will be scaled
up in collaboration with some companies who are convinced that it is abso-

lutely necessary to upgrade the entire fish or shrimp caught (i.e. from fillets
to viscera, including heads and frames). The growing demand for significant
quantities of peptides of natural origin in the developed countries is encou-
raging these biotechnological alternatives. Thus, the economy of industrial
fish and shrimp processing will be improved by the full utilisation of wastes
and of underutilised marine organisms.
Acknowledgements This work was performed within the integrated research project
SeafoodPlus, Contract No. FOOD-CT-2004-506359. The partial financing of this work by
the European Union is gratefully acknowledged. In addition, we thank Mr. Jean-Jacques
Le Yeuc’h for reviewing the English language of this document. The identification and
traceability programme “IDTRAMER” is a “research programme of regional interest of
the Brittany region, France”.
References
1. Taylor T, Alasalvar C (2002) In: Alasalvar C, Taylor T (eds) Seafoods – quality, tech-
nology and nutraceutical applications. Springer, Berlin Hedelberg New York, p 123
2. Venugopal V (1997) Trends Food Sci Technol 8:271
3. FAO Annual Report (2002) The state of world fisheries and aquaculture (SOFIA),
World review of fisheries and aquaculture, part 1, p 51
4. Shahidi F (1995) Protein concentrates from underutilized aquatic species In: Char-
alambous G (ed) Food flavors: generation, analysis and process influence. Elsevier,
Amsterdam, p 1441
5. Sikorski ZE, Naczk M (1981) CRC Crit Rev Food Sci Nutr 14:201
6. Raa J, Gildberg A (1982) CRC Crit Rev Food Sci Nutri April:383
7. Venugopal V, Shahidi F (1995) CRC Crit Reviews Food Sci Nutr 35:431
8. Haard NF (1998) Food Technol 52:64
9. Simpson BK, Haard NF (1984) J Appl Biochem 6:135
10. Simpson BK, Haard NF (1984) Can J Biochem Cell Biol 62:894
11. Gildberg A (1992) Bioresource Technol 39:271
12. Arunchalam K, Haard NF (1985) Comp Biochem Physiol 80B:467
13. Guérard F, Le Gal Y (1987) Comp Biochem Physiol 88:823
14. Guérard F, Le Gal Y (1989) Biochimie 7:767
15. Hajjou M, Smine A, Guérard F, Le Gal Y (1995) Comp Biochem Physiol 110:791
16. Haard NF, Dimes LE, Arndt RE, Dong FM (1996) Comp Biochem Physiol 115B:533
17. Kristinsson HG, Rasco BA (2000) J Food Biochem 24:177
18. Smine A, Guérard F, Le Gal Y (1993) J Mar Biotechnol 1:41–46
19. Simpson BK, Haard NF (1987) In: Knorr D (ed) Food biotechnology. Marcel Dekker,
New-York p 495
20. Gelman A, Mokadi S, Cogan U (1989) Comp Biochem Physiol 94B:113
21. Pavlisko A, Rial A, Coppes Z (1997) J Food Chem 21:383
22. Hennessey JR, Siebenaller JF (1987) J Exp Zoology 241:9
23. Squires EJ, Haard NF, Feltham LAW (1986) Can J Biochem Cell Biol 64:210
24. Myrnes B, Johansen A (1994) Prep Biochem 24:69
25. Vilhelmesson O (1997) Trends Food Sci Technol 8:266
26. Haard NF Simpson BK (1994) In: Martin AM (ed) Fisheries processing – biotechno-
logical applications. Chapman & Hall, p 132
27. Petersen BR, The impact of the enzymic hydrolysis process on recovery and use of
proteins. pp 149-175
28. Mackie IM (1982) Process Biochem Jan/Feb: 26
29. Kristinsson HG, Rasco BA (2000) CRC Crit Rev Food Sci Nutr 40:43
30. Shahidi F, Synowiecki J (1996) Food Chem 57:317
31. Vieira GHF, Martin AM, Saker-Sampaiao S, Omar S, Goncalves RCF (1995) J Sci Food
Agric 69:61
32. Martin AM, Porter D (1995) In: Charalambous G (ed) Food flavors: generation, an-
alysis and process influence. Elsevier, Amsterdam, p 1395
33. Quaglia GB, Orban E (1987) J Sci Food Agric 38:263
34. Diniz FM, Martin AM (1998) Food Sci Technol Intern 4:91
35. Guérard F, Dufossé L, De La Broise D, Binet A (2001) J Mol Cat B: Enz 11:1051
36. Cassia RO, Martone CB, Sanchez JJ (2000) Latin Am Appl Res 30:241
37. Synowiecki J, Al-Khateeb NAAQ (2000) Food Chem 68:147
38. Shahidi F (1995) Extraction of value-added components from shellfish processing
discards. In: Charalambous G (ed) Food flavors: generation, analysis and process
influence. Elsevier, Amsterdam, p 1427
39. Gilberg A, Stenberg S (2001) Process Biochem 36:809
40. Vijayalakshmi MA, Lemieux L, Amiot J (1986) J Liq Chromatogr 9:3559
41. Pianelli G (1999) Agro-Food-Industry Hi-Tech – sept/oct:46
42. Diniz FM, Martin AM (1997) Agro-Food-Industry Hi-Tech – May/June:9
43. Adler-Nissen J (1986) Enzymatic hydrolysis of food proteins. Elsevier , New York,
p 13
44. Hoyle NT, Merrit JH (1994) J Food Sci 59:76
45. Vieira GHF, Martin AM, Saker-Sampaiao S, Sobreira-Rocha CA, Goncalves RCF (1995)
In: Charalambous G (ed) Food flavors: generation, analysis and process influence.
Elsevier, Amsterdam, p 1405
46. Shahidi F, Han XQ, Synowiecki J (1995) Food Chem 53:285
47. Liaset B, Lied E, Espe M (2000) J Sci Food Agric 80:581
48. Kristinsson HG, Rasco BA (2000) J Agric Food Chem 48:657
49. Guérard F, Ravallec-Plé R, De La Broise D, Binet A, Dufosse L (2001a) In: Thonart P,
Hofman M (eds) Engineering and manufacturing for biotechnology, focus on
biotechnology, vol IV. Kluwer, p 39
50. Benjakul S, Morrissey MT (1997) J Agric Food Chem 45:3423
51. Diniz FM, Martin AM (1996) Int J Food Sci Technol 31:419
52. Ravallec-Plé R, Charlot C, Pires C, Braga V, Batista I, Van Wormhoudt A, Le Gal Y,
Fouchereau-Péron M (2001) J Sci Food Agric 81:1120
53. Shahidi F, Synowiecki J, Balejko J (1994) J Agric Food Chem 42:2634
54. Guérard F, Guimas L, Binet A (2002) J Mol Cat B: Enz 19-20:489
55. Liaset B, Nortvedt R, Lied E, Espe M (2002) Process Biochem 37:1263
56. Simpson BK, Nayeri G, Yaylayan V, Ashie INA (1998) Food Chem 61:131
57. Baek HH, Cadwallader KR (1995) J Food Sci 60:929
58. Diniz FM, Martin AM (1997) Int J Food Sci Nutr 48:191
59. Adler-Nissen J (1982) J Chem Tech Biotechnol 32:138
60. Panyam D, Kilara A (1996) Trends in Food Sci Technol 7:120
61. Adler-Nissen J (1979) J Agric Food Chem 27:1256
62. Nielsen PM, Petersen D, Dambmann C (2001) J Food Sci 66:642
63. Silvestre MPC (1997) Food Chem 60:263
64. Fujinari EM, Manes JD (1995) In: Charalambous G (ed) Food flavors: generation,
analysis and process influence. Elsevier, Amsterdam, p 929
65. Shahidi F, Naczk M, Pegg RB, Synowiecki J (1991) Food Chem 42:145
66. FitzGerald RJ (1998) Int Dairy J 8:451
67. Meisel H (1993) In: Sawatzki G, Renner B (eds), New perspectives in infant nutrition.
Thieme, Stuttgart, p 153
68. Pihlanto-Leppälä A (2001) Trends in Food Sci Technol 11:347
69. Yamamoto N (1997) Inc Biopoly 43:129
70. Yamamoto N, Ejiri M, Mizuno S (2003) Curr Pharm Design 9:1345
71. Meisel H (1997) Livestock Prod Sci 50:125
72. Meisel H (2001) Austral J Dairy Technol 56:83
73. Clare DA, Swaisgood HE (2000) J Dairy Sci 83:1187
74. Clare DA, Catignani GL, Swaisgood HE (2003) Curr Pharm Design 9:1239
75. Floris R, Recio I, Berklout B, Visser S (2003) Curr Pharm Design 9:1257
76. Schlimme E, Meisel H (1995) Nahrung Food 39:1
77. Bordenave S, Fruitier I, Ballandier I, Sannier F, Gildberg A, Batista I, Piot JM (2002)
Prep Biochem Biotechnol 32:65
78. Dorman T, Bernard L, Glaze P, Hogan J, Skinner R, Nelson D, Bowker L, Head D
(1995) J Adv Med 8:193
79. Le Poncin M (1996a) Eur Neuropsychopharmacol 6:110
80. Le Poncin M (1996b) Eur Neuropsychopharmacol 6:187
81. Bernet F, Montel V, Noel B, Dupouy JP (2000) Psychopharmacology 149:34
82. Maruyama S, Mitachi H, Awaya J, Suzuki H (1987) Agric Biol Chem 51:2557
83. Meisel H, FitzGerald RJ (2003) Curr Pharm Design 9:1289
84. Kohmura M, Nio N, Ariyoshi N (1990) Agric Biol Chem 54:835
85. Miyoshi S, Ishikawa H, Kaneko T, Fukui F, Tanaka H, Mayurama S (1991) Agric Biol
Chem 55:1313
86. Matsumara N, Fujii M, Takeda Y, Sugita K, Shimizu T (1993a) Biosci Biotech Biochem
57:695
87. Kohama Y, Oka H, Kayamori Y, Tsujikawa, Mimura T Nagase Y, Satake M (1991)
Agric Biol Chem 55:2169
88. Matsui T, Matsufuji H, Seki E, Osajima K, Nakashima M, Osajima Y (1993) Biosci
Biotech Biochem 57:922
89. Matsumara N, Fujii M, Takeda Y, Sugita K, Shimizu T (1993b) Biosci Biotech
Biochem 57:1743
90. Wako Y, Ishikawa Q, Muramoto K (1996) Biosci Biotech Biochem 60:1353
91. Jeon YJ, Byun HG, Kim SK (2000) Process Biochem 35:471
92. Hata Y, Yamamoto M, Ohni M, Nakajima K, Nakamura Y, Takano T (1996) Am J Clin
Nutr 64:767
93. Seppo L, Kerojoki O, Suomalainen T, Korpela R (2002) Milchwissenschaft 57:124
94. Kawasaki T, Seki E, Osajima K, Yoshida M, Asada K , Matsui T (2000) J Human
Hypertens 14:519
95. Kayser H, Meisel H (1996) FEBS Letter 383:18
96. Coste M, Rochet V, Léonil J, Mollé D, Bouhallab S, Tomé D (1992) Immunol Lett 33:41
97. Gildberg A, Bøgwald J, Johansen A, Stenberg E (1996) Comp Biochem Physiol B:
Biochem Mol Biol 114:97
98. Bogwald J, Dalmo R, McQueen Leifson R, Stenberg E, Gildberg A (1996) Fish Shell-
fish Immunol 6:3
99. Franco-Cereceda A, Gennari C, Nami R, Agnusdei D, Pernow J, Lundberg JM,
Fischer JA (1987) Circ Res 60:393
100. Hughes JJ, Levine AS, Morley JE, Gosnell B, Silvis SE (1984) Peptides 5:665
101. Umeda Y, Arizawa M (1989) Jap J Pharmacol 51:377
102. Nong YH, Titus RG, Ribeiro JMC, Remold HG (1989) J Immunol 143:45
103. Roos BA, Fischer JA, Pignat W, Alander CB, Raisz LG (1986) Endocrinol 118:46
104. Fouchereau-Péron M, Duvail L, Michel C, Gildberg A, Batista I, Le Gal Y (1999)
Biotechnol Appl Biochem 29:87
105. Rousseau M, Batista I, Le Gal Y, Fouchereau-Péron M (2001) Electronic J Biotechnol
(EJB) 4:1
106. Cancre I, Ravallec R, Van-Vormhoudt A, Stenberg E, Gildberg A, Le Gal Y (1999) Mar
Biotechnol 1:489
107. Ravallec-Plé R, Gilmartin L, Van Wormhoudt A, Le Gal Y (2000) J Sci Food Agric
80:2176
108. Park PJ, Jung WK, Nam KS, Shahidi F, Kim SK (2001) JAOCS 78:651
109. Chen HM, Muramoto K, Yamauchi F, Nokihara K (1996) J Agric Food Chem 44:2619
110. Chen HM, Muramoto K, Yamauchi F, Fujimoto K, Nokihara K (1998) J Agric Food
Chem 46:49
111. Okada Y, Okada M (1998) J Agric Food Chem 46:401
112. Rival SG, Boeriu C, Wichers HJ (2001) J Agric Food Chem 49:295
113. Chen HM, Muramoto K, Yamauchi F(1995) J Agric Food Chem 43:574
114. Chuang WL, Pan B S, Tsai JS (2000) J Food Biochem 24:333
115. Shahidi F, Amarowicz R (1996) JAOCS 73:1197
116. Amarowicz R, Shahidi F (1997) Food Chem 58:355
117. Kim SK, Kim YT, Byun HG, Nam KS, Joo DS, Shahidi (2001) J Agric Food Chem
49:1984
118. Li SJ, Seymour TA, King AJ, Morrissey MT (1998) J Food Sci 63:438
119. Seymour TA, Li SJ, Morrissey M (1996) J Agric Food Chem 44:682
120. Suetsuna K (2000) Mar Biotechnol 2:5
121. Guérard F, Sumaya-Martinez MT, Binet A (2002) In: Colliec-Joualt S (ed) Marine
biotechnology: an overview of leading fields. Actes du Colloque Européen IXth
ESMB, Marine Biotechnology, Nantes, France, 12-14 May 2002. IFREMER, INIST
0761-3962, p 155
122. Yoshikawa T, Naito Y, Masui K, Fujii T, Boku Y, Nakagawa S, Yoshida N, Kondo M
(1997) Biomed Pharmacother 51:328
123. Pokorny J (1991) Trends Food Sci Technol 2:223
124. Guérard F, Sumaya-Martinez MT (2003) JAOCS 80:467
125. Vecht-Lifshitz, Almas KA, Zomer E (1990) Lett Appl Microbiol 10:183
126. Gilberg A, Batista I, Strom E (1989) Biotechnol Appl Biochem 11:413
127. Dufossé L, De La Broise D, Guérard F (1997) Recent Res Develop Microbiol 1:365
128. Dufossé L, De La Broise D, Guérard F (2001) Current Microbiol 42:32
129. De La Broise D, Dauer G, Gildberg A, Guérard F (1998) J Mar Biotechnol 6:111
130. Ellouz Y, Bayoudh A, Kammoun S, Gharsallah N, Nasri M (2001) Bioresource Technol
80:49
131. Ferrer J, Paez G, Marmol Z, Ramones E, Garcia H, Forster CF (1996) Bioresource
Technol 57:55
132. Andarwulan N, Shetty K (2000) Food Biotechnol 14:1
133. Hastein T, Hill BJ, Berthe F, Lightner DV (2001) Rev Sci Tech 20:564
134. Verrez-Bagnis V, Ladrat C, Morzel M, Noel J, Fleurence J (2001) Electrophoresis
22:1539
135. Etienne M, Jérome M, Fleurence J, Rehbein H, Kundiger R, Malmhedem-Yman I,
Ferm M, Craig A, Mackie I, Jessen F, Smelt A, Luten J (1999) Electrophoresis 20:1923
136. Lunstrom R (1980) J Assoc Off Anal Chem 63:69

137. Osman MA, Ashoor SH, Marsh PC (1987) J Assoc Off Anal Chem 70:618
138. Pineiro C, Sotelo CG, Medina I, Gallardo JM, Pérez-Martin R (1997) Z Lebensm
Unters Forsch A 204:411
139. Rehbein H, Etienne M, Jérome M, Hattula T, Knudsen B, Jessen F, Luten JB, Bou-
quet W, Mackie IM, Ritchie AH, Martin R, Mendes R (1995) Food Chem 52:1193
140. Rehbein H, Kress G, Schmidt T (1997) J Sci Food Agric 74:35
141. Yu H-T, Lee Y-T, Huang S-W, Chiu T-S (2002) Mar Biotechnol 4 471
142. Yue GH, Li Y, Chao TM, Chou R, Orban L (2002) Mar Biotechnol 4:503
143. Rivera MAJ, Graham GC, Roderick GK (2003) Mar Biotechnol 5:126
144. Sekino M, Hamaguchi M, Aranishi F, Okoshi K (2003) Mar Biotechnol 5:227
145. Delghandi SR, Mortensen A, Westgaard J-I (2003) 5:141
146. Lopez-Pinon MJ, Insua A, Mendez J (2002) Mar Biotech 4, 495-502
147. Klinbunga S, Khamnamtong N, Tassanakajon A, Puanglarp N, Jarayabhand P, Yoo-
sukh W (2003) Mar Biotechnol 5:27
148. Was A, Wenne R (2003) Mar Biotechnol 5:234
149. Pineiro C, Barros-Velazquez J, Pérez-Martin R, Martinez I, Jacobsen T, Rehbein H,
Kundiger R, Mendes R, Etienne M, Jérome M, Craig A, Mackie I, Jessen, F (1999)
Electrophoresis 20:1425
150. Rehbein H, Kundiger R, Malmhedem-Yman I, Ferm M, Etienne M, Jérome M,
Craig A, Mackie I, Jessen F, Martinez I, Mendes R, Smelt A, Luten J, Pineiro C, Pérez-
Martin R (1999) Food Chem 67:333
151. Etienne M, Jérome M, Fleurence J, Rehbein H, Kundiger R, Mendes R, Costa H,
Pérez-Martin R, Pineiro-Gonzales C, Craig A, Mackie I, Malmhedem-Yman I,
Ferm M, Martinez I, Jessen F, Smelt A, Luten J (2000) J Agric Food Chem 48:653
152. Etienne M, Jérome M, Fleurence J, Rehbein H, Kundiger R, Mendes R, Costa H, Mar-
tinez I (2001) Food Chem 72:105
153. Lockley AK, Bardsley RG (2000) Trends Food Sci Technol 11:67
154. Mackie I, Craig A, Etienne M, Jérome M, Fleurence J, Jessen F, Smelt A, Kruijt A,
Malmheden-Yman I, Fern M, Martinez I, Pérez-Martin R, Pineiro C, Rehbein H,
Kundiger R (2000) Food Chem 71:1
155. Quintero J, Sotelo CG, Rehbein H, Pryde SE, Medine I, Pérez-Martin R, Rey-Mén-
dez M, Vidal R, Mackie IM (1998) J Agric Food Chem 46:1662
156. Ram JL, Ram ML, Baidoun F (1996) J Agric Food Chem 44:2460
157. Jerome M, Lemaire C, Verrez-Bagnis V, Etienne M (2003) J Agric Food Chem 25:7326
158. Bernstein RM, Schulter SF, Bernstein H, Marchalonis J (1996) Proc Natl Acad Sci
93:9454
159. Zardoya R, Meyer A, (1996) Mol Biol Evol 13:933
160. Murgia R, Tola G, Archer SN, Vallerga S, Hirano J (2002) Mar Biotechnol 4:119
161. Hall HJ, Nawrocki LW (1995) J Fish Biol 46(2):360
162. O’Connel M, Danzmann RG, Cornuet JM, Wright JM, Ferguson MM (1997) Can
J Fish Aquat Sci 54:1391
163. Daemen E, Cross T, Ollevier F, Volckaert F (2001) Mar Biol 139:755
164. Johansen S, Bakke I (1996) Mol Mar Biol Biotechnol 5:203
165. Lee WJ, Kocher TD (1995) Genetics 139:873
166. Hurst CD, Bartlett SE, Davidson W, Bruce IJ (1999) Gene 239:237
167. Inoue JG, Miya M, Tsukamoto K, Nishida M (2000) Fisheries Sci 66:924
168. Cao Y, Waddell PJ, Norihiro O, Hasegawa M (1998) Mol Biol Evol 15:1637
169. Delarbre C, Spruyt N, Delmarre C, Gallut C, Barriel V, Janvier P, Laudet V, Gachelin G
(1998) Genetics 150:331
170. Rasmussen AS, Arnason U (1999) J Mol Evol 48:118

171. Rasmussen AS, Arnason U (1999) Proc Natl Acad Sci USA 96:2177
172. Arnason U, Gullberg A, Janke A (2001) Zool Scr 30:249
173. Barlett SE, Davidson WS (1991) Can JF Aqua Sci 48:309
174. Sotelo CG, Calo-Mata P, Chapela MJ, Perez-Martin RI, Rehbein H, Hold GL, Rus-
sell VJ, Pryde S, Quinteiro J, Izquierdo M, Rey-Mendez M, Rosa C, Santos AT (2001)
J Agric Food Chem 49:4562
175. Sebastio P, Zanelli P, Neri TM (2001) J Agric Food Chem 49:1194
176. Sanjuan A, Comesana AS (2002) J Food Prot 6:1016
177. Martin AP, Naylor GJP, Palumbi SR (1992) Nature 357:153
178. Martin AP, Burg TM (2002) Syst Biol 51:570
179. Heist EJ, Musick JA, Graves JE (1996) Fishery Bull 94:664
180. Heist EJ, Musick JA, Graves JE (1996) Can J Fish Aquat Sci, 53:583
181. Gardner MG, Ward RD (1998) Mar Freshwater Res 49:733
182. Heist EJ, Gold JR (1999) Copeia 1999:182
183. Martin AP (1993) NOAA Technical Report NMFS 115:53
184. Pank M, Stanhope M, Natanson L, Kohler N, Shivji M (2001) Mar Biotechnol 3:231
185. Jones AS (1953) Biochim Biophys Acta 10:607
186. Southern E (1975) J Mol Biol 98:503
187. Smith HO (1980) Methods Enzymol 65:371
188. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) J Mol Biol 215:403
189. Iglesias SP, Lecointre G, Sellos DY (2005) Mol Phyl Evol 34(3):569
DOI 10.1007/b135784
Marine Microalgae
Tadashi Matsunaga1 (u) · Haruko Takeyama1 · Hideki Miyashita2 ·
Hiroko Yokouchi1
1 Department of Biotechnology, Tokyo University of Agriculture and Technology,
Koganei, 184-8588 Tokyo, Japan
tmatsuna@cc.tuat.ac.jp
2 Department of Technology and Ecology, Hall of Global Environmental Studies,
Kyoto University, Yoshida-Honmachi, Sakyo-ku, 606-8501 Kyoto, Japan
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
2 Production of Useful Chemicals by Marine Microalgae . . . . . . . . . . . 166

2.1 Cyanobacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
2.2 Rhodophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
2.3 Chlorophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
2.4 Cryptophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
2.5 Heterokontophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
2.6 Dinophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
2.7 Haptophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
2.8 Euglenophyta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
3 Metabolic Engineering of Marine Microalgae . . . . . . . . . . . . . . . . 173

3.1 Gene Transfer Methods for Marine Microalgae . . . . . . . . . . . . . . . . 173
3.2 Metabolic Engineering of Marine Microalgae
for Producing Valuable Metabolites . . . . . . . . . . . . . . . . . . . . . . 175
3.3 Whole genome analyses in marine microalgae . . . . . . . . . . . . . . . . 176
4 Microalgal Mass Cultivation Technologies . . . . . . . . . . . . . . . . . . 177

4.1 Open Culture Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178
4.2 Photobioreactor (Closed Culture Systems) . . . . . . . . . . . . . . . . . . 180
5 CO2 Fixation Using Microalgal Cultures in Industry . . . . . . . . . . . . 182
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
Abstract Marine microalgae, the largest primary biomass, have been attracting atten-
tion as resources for new metabolites and biotechnologically useful genes. The diversified
marine environment harbors a large variety of microalgae. In this paper, the biotechno-
logical aspects and fundamental characteristics of marine microalgae are reviewed.
Keywords Marine microalgae · Useful material production · Genetic manipulation ·

Mass cultivation · Photoreactor
166 T. Matsunaga et al.
1
Introduction
The primary producers of oxygen in aquatic environments are algae, espe-

cially planktonic microalgae. These microorganisms are widely distributed
in nature and have adapted to different environments with great diversity
in size, morphology, life cycle, pigments, and metabolism. About one half
of global photosynthesis and oxygen production is accomplished by marine
microalgae. They play an important role in CO2 recycling through photosyn-
thesis, which is similar to higher plants in O2 -evolved systems (PSI and PSII).
Research in microalgae has been carried out not only on physiological as-
pects but also to develop production of useful biomaterials. The advantages
of their utilization in production are (1) their ability to convert CO2 to useful
materials through photosynthesis and (2) their ability to grow in natural en-
vironments under inorganic conditions. For example, marine microalgae can
be cultivated using seawater, CO2 , and sunlight. Recent developments in the
biotechnology of microalgae have been focused on their production of useful
materials applicable to the cosmetic and medical fields.
Genetic modification and molecular tools have been developed mainly in
eubacterial microalgae, cyanobacteria (blue-green algae). In contrast, genetic
modification has been only gradually applied to eukaryotic microalgae. Re-
cently, whole genome sequences and EST analyses have been performed in
marine strains. The elucidation of genomewide information may help in the
development of new biotechnological applications using microalgae.
In this chapter, we review the useful applications of microalgae for genetic
engineering, cultivation technologies, and CO2 fixation as follows:
1. Production of useful chemicals by marine microalgae

2. Metabolic engineering of marine microalgae
3. Microalgal mass cultivation technologies
4. CO2 fixation using microalgal cultures in industry
2
Production of Useful Chemicals by Marine Microalgae
2.1
Cyanobacteria
The cyanobacteria are oxygenic photosynthetic prokaryotes that show large

diversity in their morphology, physiology, ecology, biochemistry, and other
characteristics. Currently, more than 2000 species are recognized, which com-
prise two fifths of known bacterial species (5000 species). Such variation com-
plicates estimation of species diversity. Cyanobacteria contain chlorophyll a,
Marine Microalgae 167
phycobiliproteins, and characteristic glycosylated xanthophylls, such as myx-

oxanthophyll and oscillaxanthin [1–3]. The phycobiliproteins are water-
soluble pigments consisting of red-colored phycoerythrin and blue-colored
phycocyanin and allophycocyanin. They have a characteristic structural fea-
ture, the phycobilisome, that is used as a photosynthetic light-harvesting an-
tenna. Cyanobacteria are unicellular, multicellular, colonial, and branched or
unbranched filamentous forms. Specialized cells, heterocystous and akinates,
are contained in some of the filamentous-form cells. Some cells produce ex-
tracellular matrix such as sheaths, capsules, and slimes that consist mainly of
polysaccharides. Cyanobacteria are distributed widely not only in salt water
but also freshwater, brackish water, polar regions, hot springs, and deserts.
Some also exist as symbionts in sponges, ascidians, echiuroid worms, plank-
tonic diatoms, and dinoflagellates in marine environments [4] and lichens
and azollae in terrestrial environments. Cyanobacteria, especially marine
pelagic Synechococcus and Prochlorococcus, contribute largely to global oxy-
gen production.
Many commercial applications have been proposed for marine cyanobac-
teria, although no marine strain presently is commercially supplied. Re-
cent proposals to evaluate potential commercial uses typically fall into three
categories: bioactive chemical compounds [5–10], polysaccharides [11–14],
and evaluation of new genes for recombinant expression. Cyanobacteria can
produce a large variety of complex chemical compounds. Bioactive com-
pounds isolated from marine cyanobacteria have recently been summa-
rized by Burja et al. [5] and Takeyama and Matsunaga [15]. Novel plant
growth regulators that promote redifferentiation, germination, and plantlet
formation [16], tyrosinase inhibitors [17], UV-A absorbing compounds [18],
sulfated polysaccharides showing anti-HIV activity, and novel antibiotics
with light-regulated activity [19] are among the many compounds that have
been studied. Matsunaga et al. [20] reported that several marine cyanobac-
terial strains, such as Phormidium sp. NKBG 041105 and Oscillatoria sp.
NKBG 091600, showed high cis-palmitoleic acid content (54.5% and 54.4% of
total fatty acid, respectively).
The discovery of biochemically active compounds from marine cyanobac-
teria, including enzyme inhibitors, herbicides, antimycotics, antifeedants,
multi-drug-resistance reversers, and antimalarial and immunosupressive
agents, has dramatically increased over the last few years. This has been
due to the adaptation and use of current cyanobacterial collections and
cyanobacteria-derived compounds for screening in new pharmaceutical and
industrial assays.
The focus on the polysaccharides of marine cyanobacteria as well as fresh-
water strains also has greatly increased in relation to interest in their exploita-
tion for various industrial applications [11–14]. Cyanobacteria produce three
types of extracellular matrix consisting mainly of polysaccharides, which
have unique bio- and physicochemical characteristics. Most of them are com-
posed of at least ten different monosaccharides and contain pentoses, which

have not been observed in other prokaryotic polysaccharides. The anionic na-
ture of these unique polysaccharides is due to the presence of acidic sugars
and anionic organic and inorganic compounds. Little work has been devoted
to potential applications of marine cyanobacterial polysaccharides. Extracel-
lular polysaccharide production by cyanobacteria, as well as their possible
applications, was reviewed by Philippis and Vincenzini [11] and Philippis
et al. [13].
Marine cyanobacteria also are attractive as a resource for useful en-
zymes and genes [21–29]. Cyanobacteria commonly produce complex macro-
molecules that often possess biological activities such as cytotoxicity or mi-
crobial toxicity [5]. Recent genetic analyses have revealed that most of these
macromolecules, as well as unusual small molecules, are coded for by large
gene clusters representing nonribosomal peptide synthetase and polyketide
synthetase [21–23, 25, 26, 28]. These gene clusters may be manipulated for
the production of new chemicals. Many varieties of the gene clusters are
present in most cyanobacteria [21, 24]. Therefore, cyanobacteria are attrac-
tive not only as producers of useful bioactive macromolecules and enzymes
but also for production of complex macromolecules that may become import-
ant pharmaceuticals.
2.2
Rhodophyta
The rhodophytes, or red algae, contain chlorophyll a, carotenoids, and phy-

cobiliproteins. Their red color is due to the presence of phycoerythrin in the
outermost part of the phycobilisomes, while other regions of the algae look
blue-green due to the absence of phycoerythrin. Rhodophytes are unicellu-
lar, or composed of simple or complex filamentous aggregates. Flagellated
cells have not been observed. Red macroalgae commonly inhabit tropical and
temperate zones near shores. About 600 genera and 5500 species have been
recognized. Most of them (98%) are marine macroalgal species.
Red macroalgae are of economic significance [30]. Porphyra and a few
other species are cultured for human food. The production of red algal
polysaccharides such as agar, agarose, and carrageenans is also an important
industry. These compounds are widely used for laboratory cell culture media,
nucleic acid purification, or food processing, respectively.
Although rhodophyte microalgae have not been produced commercially
as yet, their polysaccharides are considered to have commercial potential
[31–35]. For example, in concentrated solutions of polysaccharides from the
unicellular rhodophyte Porphyridium sp., viscosity is stable over a wide range
of pH, temperature, and salinity. These properties indicate possible applica-
tions for use as a thickening agent in aqueous systems or as a stabilizer for
emulsions and suspensions [31]. In addition to its potential application as
a viscosity stabilizer, the polysaccharide and the biomass of Porphyridium

sp. have been used as functional food additives [32]. The colon and jejunum
changed morphologically with hypertrophy in the muscularis layer in rats
fed diets containing pelleted biomass or sulfated polysaccharides. In addition,
it was shown in rats that the algal polysaccharide and biomass were potent
hypocholesterolemic agents active at low concentrations in the diet. More-
over, the sulfated polysaccharide of Porphyridium sp. has shown promising
antiviral activity against a variety of animal viruses including Herpes sim-
plex viruses types 1 and 2 (HSV 1, 2) Varicella zoster virus (VZV), and HIV
types 1 and 2. The compounds also showed significant inhibition of produc-
tive infection with retroviruses (murine leukenia virus, HIV-1, and HIV-2)
and cell transformation by murine sarcoma virus in vitro [33–35]. Thus, red
microalgae and their polysaccharides seem to be good candidates for the de-
velopment of antiviral drugs.
2.3
Chlorophyta
Cells of chlorophytes are green due to chlorophyll a and b, the same pre-
dominant photosynthetic pigments as those of land plants. Some algae show
yellowish-green or red-green colors due to the presence of a certain amount
of carotenoids such as β-carotene, prasinoxanthin, siphonaxanthin, and as-
taxanthin. These chlorophyta form starch in the chloroplast as a storage
product of photosynthesis. Chlorophytes are unicellular, multicellular, colo-
nial, filamentous, siphonous, and thallus. The Chlorophyta consist of five
classes, the Prasinophyceae, the Ulvophyceae, the Chlorophyceae, the Tre-
bouxiophyceae, and the Charophyceae. The Treboxiophyceae recently were
separated from the Chlorophyceae. The Chlorophyta are primarily freshwater
algae with approximately 500 genera comprising 16 000 species. Only about
10% of these are marine species. The Ulvophyceae are primarily multicellu-
lar marine green algae. In addition, some species from the Prasinophyceae,
Chlorophyceae, and Trebouxiophyceae families are found in the marine envi-
ronment. Depending on the class, it has been estimated that there would be at
least two to three times more species in this phylum.
A marine species of the Chlorophyceae, Dunaliella, has been cultivated
commercially for food supplements and β-carotene production [36]. The mi-
croalgal biomass of some marine Tetraselmis and Pyramimonas strains in
the Prasinophyceae family also are used for fish food additives [37]. Re-
cently, anti-inflammatory and immunosupressive properties were discovered
in the extracts [38] or extracted polysaccharides [39] of another marine
species, Chlorella stigmatophora. Miura et al. [40] reported that Chlorella sp.
NKG 042401 contains 10% γ -linolenic acid (C18 : 3), which is present in the
cells mainly in the form of galactolipid.
2.4
Cryptophyta
Cryptophytes are unicellular, cryptomonad flagellates with 12 to 23 genera

comprised of 200 species. A few species are colorless heterotrophs, but most
possess various colored plastids with chlorophylls a and c, carotenoids, and
phycobiliprotein. Alloxanthin is a xanthophyll that is unique to cryptomon-
ads. Morphologically, cells have a flattened asymmetrical shape with two
anterior flagella, slightly unequal in length. They are distributed widely both
in freshwater and marine environments. Approximately half of the known
species inhabit marine environments. It has been estimated that there would
be about six times more species in this phylum.
Only a few strains such as Rhodomonas minuta and Cryptomonas sp. have
been used for aquaculture feeds since they contain significant amounts of
polyunsaturated fatty acids (PUFAs) [37]. No further application has been
proposed.
2.5
Heterokontophyta
The phylum Heterokontophyta is the most diverse algal group with huge
commercial and biotechnological potentials [30, 37]. They range in size from
microscopic unicells to giant kelp averaging several meters. Cells of het-
erokontophytes contain chlorophyll a with chlorophyll c and carotenoids such
as fucoxanthin or vaucheriaxanthin. They are characterized primarily by the
similarities in their ultrastructural and biochemical characteristics.
Heterokontophyte microalgae are widely used as feed in mariculture/
aquaculture [30, 37, 41]. Diatoms such as Chaetoceros calcitrans, Chaetoceros
gracilis, Chaetoceros muelleri, Skeletonema costatum, and Thalasiosira pseu-
dodonana are commonly used as live feeds for all growth stages of bivalve
molluscs (e.g., oysters, scallops, clams, and mussels), for crustacean larvae,
and for zooplankton used as feed for larvae. The genera Navicula, Nitzschia,
Cocconeis, and Amphora also are used to feed juvenile abalone. Some Eu-
stigmatophyceae species of the genus Nannochloropsis are commonly fed to
Artemia or rotifers, which in turn are fed to crustacean and fish larvae.
The biotechnological potential of diatoms is also concerned with PUFA
production. Most diatoms have a high content of eicosapentenoic acid (EPA)
20:5 (n-3). Phaeodactylum tricornutum and Nitzschia laevis especially have
been investigated for EPA production. In addition, EPA production by di-
atoms has been reviewed recently by Lebeau and Robert [42, 43]. Recent
advances in heterotrophic production of EPA by microalgae were also re-
viewed by Wen and Chen [44].
The Pinguiophyceae also have significant biotechnological potential for use
in fish feed and for PUFA production [45]. Pinguiophyceae consist of five ma-
rine unicellular algal species, Pinguiochrysis pyriformis, Phaeomonas parva,

Pinguiococcus pyrenoidosus, Glossomastix chrysoplasta, and Polypodochrysis
teissieri. These algae have an unusually high percentage of PUFAs, especially
EPA. The EPA content ranges from 23.5% to 56.0% of the total fatty acids
in these five species. They also contain arachidonic acid (AA) 20:4 (n-6) and
docoahexaenoic acid (DHA) 22:6 (n-3). Pinguiococcus pyrenoidosus, Glosso-
mastix chrysoplasta, and Polypodochrysis teissieri have docosatetraenoic acid
(DTA) 22:4 (n-3) ranging from 4.4% to 9.5% of total fatty acid content. This
significant oil balance, as well as their lack of cell wall, indicates that they are
good candidates as food/feed sources. Evaluations of the utility of Pinguio-
phyceae for food/feed supplements and optimization of growth conditions
necessary for efficient production are being carried out.
Some marine colorless heterokontophytes also are being tested for the
production of DHA [36, 46–48]. Schizochytrium, Thraustochytrium, and Ulke-
nia are representatives of the class Labyrinthulea. They produce substantial
amounts of PUFAs, especially DHA [46–48]. The safety of biomass produc-
tion and differences in oil content are intensively studied [49–53]. Utilization
of fermented “okara” for DHA and/or EPA production by thraustochitrids
also has been reported, while the yield was lower by growth in a glucose-
yeast-extract medium than by fermentation [54].
2.6
Dinophyta
The Dinophyta include the dinoflagellates, most of which are unicellu-

lar, with two dissimilar flagella [1–3]. Flagellated cells show characteristic
forward-spiraling swimming motions. Organisms in this phylum have re-
markable morphological diversity including nonflagellate amoeboid, coccoid,
palmelloid, or filamentous. Approximately 130 genera with about 2000 liv-
ing and 2000 fossil species have been described in this group. Most are
marine and only about 220 species are from freshwater. About half of the
known species are colorless heterotrophs. Most of the plastid-containing
phototrophic dinoflagellates contain chlorophylls a and c2 and carotenoids
such as β-carotene and peridinin, the unique accessory xanthophyll in this
phylum. Dinoflagellates are also characterized by cell coverings consisting
of a layer containing many closely adjacent, flattened amphiesmal (thecal)
vesicles. In many species, each amphiesmal vesicle contains a thecal plate
composed of cellulose. About 60 dinoflagellate species are known to pro-
duce cytolytic, hepatotoxic, or neurotoxic compounds. Some form harmful
red tides. The majority of toxin-producing dinoflagellates are photosynthetic,
estuarine, or coastal shallow-water forms that are capable of producing ben-
thic resting cysts and that tend to form monospecific populations. Fresh-
water species are not known to produce toxins. The dinophytes comprise
autotrophs, mixotrophs, osmotrophs, phagotrophs, and parasites. Dinoflag-
ellate endosymbionts known as zooxanthellae are essential for the existence

of coral reef ecosystems. Symbiotic as well as parasitic forms also are present
within the cells or tissues of fish, invertebrates, and filamentous algae.
Biotechnological applications for dinoflagellates have not been intensively
performed, probably because most dinoflagellates can not be easily cultured.
The only exception is the DHA produced by heterotrophically grown Crypthe-
codinium cohnii [36]. DHA produced by these cells is distributed widely as
food supplements, such as for infant formula. Recently, significant biologi-
cal activities have been attributed to the polysaccharide from Gymnodinium
sp. [55–58]. For example, strong cytotoxicity against several human leukemic
cell lines leading to apoptosis [55] and potent anticancer activity mediated by
the inhibition of topoisomerase I and II [58]. Optimal growth conditions for
Gyrodinium impudicum were reported to produce a sulfated polysaccharide
that showed antiviral activity against encephalomyocarditis virus [59].
2.7
Haptophyta
The phylum Haptophyta (haptophytes or prymnesiophytes) is a group of uni-

cellular flagellates characterized by the presence of a haptonema between two
smooth flagella [1–3]. The role of haptonema is unclear, although it some-
times functions as a feed-capturing net, in avoidance reaction by coiling and
recoiling, and as an attachment organ on surfaces. There also are haptonema-
less flagellates or nonflagellate unicells or colonies. The cells of haptophytes
are brownish or yellowish-green containing chlorophylls a and c1 /c2 and
carotenoids such as β-carotene, fucoxanthin, diadinoxanthin, and diatoxan-
thin. The cells are commonly covered with scales made mainly by carbo-
hydrates or calcium bicarbonate. Many species known as coccolithophorids
produce calcified scales called coccoliths. About 70 genera with 300 species
have been recognized to date. Most are primarily marine species inhabiting
tropical seawater. The group is distributed worldwide and is often an im-
portant source of food for aquatic communities. Some haptophytes, however,
produce algal blooms and cause serious problems for fish and for fishermen
by producing dimethyl sulfide (DMS), a noxious-smelling compound that af-
fects fish migrations and alters their normal routes.
Microalgal biomass of haptophytes is commonly used as living feed in
aquaculture [37]. Isochrysis galbana and Pavlova lutheri, especially, are used
as living feeds for bivalve molluscs, crustacean larvae and zooplanktons that
in turn are used for crustacean and fish larvae. Some cells can produce PUFAs
such as DHA or EPA. In addition, the DHA content in I. galbana was shown to
be enhanced by low temperature or incubation of the culture in the dark after
reaching plateau phase growth [60]. Furthermore, it was shown that these al-
gae are useful for DHA enrichment of feed such as rotifers for the larvae of
several marine fish species [61].
2.8
Euglenophyta
Euglenophytes are unicellular organisms with two pantonematic flagella aris-

ing from the bottom of a flask-shaped invagination called a “gullet.” A few
have stages with colonies or are enclosed within a mucilaginous capsule.
There are about 40 genera comprised of 900 species, of which one third
have green plastids. The chloroplast originating from green algae contains
chlorophylls a and b and carotenoids such as diadinoxanthin, neoxanthin,
and β-carotene. Two thirds of the genera are heterotrophic, some having
colorless plastids and some lacking plastids altogether, living either sapro-
trophically or phagocytically. Cell walls are absent, but there is a character-
istic cell-covering structure called a pellicle, composed of protein-rich spiral
strips beneath the cell membrane. One to several flagella may be present,
and nonflagellate cells can undergo a type of motion involving changes in
cell shape. Although most species are found in highly eutrophic freshwater
environments such as ponds and ditches, some euglenoids have important
ecological roles in particular marine environments. Very few euglenoids have
been grown in axenic culture, and euglenoid culture media are generally
very nutrient rich. No direct economic significance has been associated with
this phylum, probably because of the difficulties in culturing. Although eu-
glenoids generally are harmless, toxin production has been demonstrated in
some freshwater Euglena sp. [62]. On the other hand, E. gracilis Z is one of the
few microorganisms that simultaneously produces antioxidant vitamins such
as β-carotene and vitamins C and E. Efficient production of these vitamins
consists of a two-step culture under photoheterotrophic/photoautotrophic
conditions [63].
3
Metabolic Engineering of Marine Microalgae
3.1
Gene Transfer Methods for Marine Microalgae
Genetic studies on microalgae have been redirected mainly toward analysis

of photosynthesis and metabolic pathways. A limited number of microalgae
such as cyanobacteria have been used in biotechnological applications. Devel-
opment of molecular techniques for physiological analysis and enhancement
of biotechnological applications is necessary.
Many attempts at gene transfer have been made in eukaryotic and prokary-
otic microalgae. Genetic manipulation in prokaryotic microalgae cyanobac-
teria have been studied extensively after several transformable unicellular
strains were discovered. At first, the freshwater cyanobacterium Synechococ-

cus PCC7942 was reported to have an ability to take up DNA. Subsequently,
several other naturally transformable freshwater strains have been found.
Gene transfer has been developed mainly in freshwater strains, Synechococ-
cus, Synechocystis, Anabaeba, and Nostoc [64]. Only a few marine cyanobac-
terial strains of the genus Synechococcus have been used for heterogeneous
gene expression and other genetic applications [65, 66]. There are two com-
monly used gene transfer procedures: transformation using naturally occur-
ring or artificially competent cells, e.g., conjugation with Escherichia coli,
or physical methods for gene introduction, e.g., electroporation and particle
bombardment.
In marine cyanobacteria, natural transformation has been reported for
Synechococcus sp. PCC7002 [67]. Other strains have been transformed suc-
cessfully by electroporation or conjugation. Further, plasmids harvested from
several marine microalgal species have been used as vector DNA for gene
transfer. Many cyanobacteria-harboring endogenous plasmids have been
reported. Some functional genes were found to be coded on freshwater
cyanobacterial plasmids [68]; however, most cyanobacterial plasmids are
cryptic. Marine plasmids have been found in Synechococcus sp. NKBG042902,
which has high phycocyanin content and a rapid growth rate. Extracts from
this strain promote plant germination [16]. This strain contains more than
three cryptic endogenous plasmids, pSY09 (> 10 kbp), pSY10 (2.6 kbp), and
pSY11 (2.3 kbp). Plasmid pSY10 has the unique replication characteristic that
their copy number increases under high salinity conditions [70]. To investi-
gate the function and replication mechanism of these plasmids, the plasmids
pAQ1 (4.8 kbp) of the marine strain Synechococcus PCC7002 and pSY10 of
NKBG 042902 were entirely sequenced [71, 73], and a gene transfer system
using pSY10 was established [69]. The complete sequence of Synechococcus
pSY10 (2561 bp) includes seven potential open reading frames (ORFs). The
longest ORF has homology with the replication region of plasmids from sev-
eral bacteria [72]. pSY10 did not hybridize with other plasmids purified from
Synechococcus sp. NKBG 042902.
Replication of these plasmids appears to be controlled by different mech-
anisms. Plasmids are maintained at high copy number in cyanobacteria,
suggesting the possibility that they act as a shuttle vector between cyanobac-
teria and E. coli. In fact, a shuttle vector with E. coli has been constructed
using pSY10.
Conjugative gene transfer has been reported mainly for the freshwater
filamentous cyanobacterium Anabaena PCC7120, which is not a naturally
transformable strain. Conjugation in Anabaena PCC7120 was carried out
using conjugal plasmids such as RP4 (IncP), a helper plasmid carrying a mo-
bilization gene, and a shuttle vector carrying cyanobacterial replicons [74].
The other filamentous freshwater cyanobacteria Plectonema boryanum [75]
and Fremyella diplosiphon [76] also can be successfully transformed by conju-
gation. A conjugative plasmid vector in unicellular freshwater cyanobacteria

has been constructed [77].
Conjugative gene transfer using a broad-host range vector pKT230 (IncQ,
Kmr , and Smr ) was successful for the marine cyanobacterium Synechococcus
sp. NKBG 15041C [78]. It was demonstrated that this plasmid is stably main-
tained in cyanobacterial cells [79]. This introduced a new tool in cyanobac-
teria biotechnology since most transformations were carried out using the
shuttle vector plasmid containing a cyanobacterial plasmid origin of repli-
cation. Random gene insertion into the genome using the transposon vector
pSUP 1021 (which carries the RP4-specific mob site) and the transposon Tn5
was demonstrated in NKBG 15041C.
In marine cyanobacteria, besides the plasmid vector system, the construc-
tion of a phage vector system also is required to enable the cloning of large
DNA fragments in specific cyanobacterial hosts. Since cyanophages were
first reported by Safferman and Morris [80], various types of cyanophages
have been found in seawater [81, 82] and have been characterized as to their
genetic diversity and phylogenetic affiliations [83]. These vectors could be
utilized for gene transfer in the near future.
The particle gun or microprojectile method has been developed for de-
livering DNA into plant cells and tissues. In prokaryotes, Shark et al. [84]
reported the biolistic transformation of Bacillus megaterium. Both gold and
tungsten particles have been used as DNA carriers in this system. However,
small particles are required for prokaryotic transformation. DNA (pSUP1021)
conjugated onto nano-sized bio-magnetic beads (50–100 nm in diameter),
purified from the magnetic bacterium Magnetospirillum sp. AMB-1 [85],
was used to successfully transform a marine cyanobacterium, Synechococcus
sp. NKBG15041c [86].
In eukaryotic microalgae, some unicellular and multicellular algae have
been successfully transformed, although most of them are freshwater strains
of diatom and chlorella. Marine strains, such as diatom Phaeodactylum tri-
cornutum, Thalassiosira weissflogii, and green algae Dunaliella salina, have
been reported to be transformed as well [87–90]. Particle bombardment and
electroporation are used mostly for these microalgae. Stable transformation
for the purpose of enhancing the production of useful materials or analyzing
gene expression has been carried out. However, the level of protein produc-
tion by transformants varied due to multiple insertion of the target gene into
the genome and to variation in transcriptional efficiency caused by random
integration.
3.2
Metabolic Engineering of Marine Microalgae
for Producing Valuable Metabolites
Enhanced production of valuable primary or secondary metabolites in mi-

croalgae can be rendered possible by high density cultivation and/or ap-
plication of genetic manipulation. Recent pharmaceutical interest in unsat-
urated fatty acids has triggered the search for sources of these valuable
compounds. Several eukaryotic microalgae are known to produce highly un-
saturated fatty acids such as EPA and DHA, which are valuable dietary com-
ponents [44, 61]. Genetic engineering has been applied to produce EPA in
the marine cyanobacterium Synechococcus sp. [66]. Cyanobacteria do not
have the biosynthetic pathway to produce them. The EPA synthesis gene clus-
ter (ca. 38 kbp) isolated from a marine bacterium Shewanella putrefaciens
SCRC-2738 was cloned to the marine cyanobacterium using a broad-host
cosmid vector, pJRD215 (10.2 kbp, Smr Kmr ). The cyanobacterial transcon-
jugants grown at 29 ◦ C produced EPA only at 0.12 mg/g dry cell, whereas
those grown at 23 ◦ C produced EPA at 0.56 mg/g dry cell. The content of EPA
grown at 23 ◦ C increased to 0.64 mg/g dry cell after 24 h incubation at 17 ◦ C.
Furthermore, EPA production was improved by partial deletion of the EPA
gene cluster to stabilize its expression and maintenance in host cyanobacte-
rial cells [91].
Most diatoms do not have the capacity to grow on exogenous glucose in the
absence of light. The transformable marine diatom Phaeodactylum tricornu-
tum exhibited heterotrophic growth after the introduction of a single gene for
glucose transporters glut1 or hup1 [92]. For this purpose, plasmid (pPha-T1;
glut1-gfp) was introduced into P. tricornutum by using a biolistic procedure,
and transformants were selected for zeocin resistance in the light. Exogenous
glucose entering the transformants can be metabolized at a high rate of flux,
allowing the cells to thrive in the absence of light. The trophic conversion of
microalgae, such as diatoms, is a critical first step in engineering algae for
successful large-scale cultivation.
The genetic engineering of microalgae for industrial purposes also has
been performed in freshwater cyanobacteria where the ketocarotenoid astax-
anthine, an extremely efficient antioxidant, was synthesized by introduction
of the beta-c-4-oxygenase gene (crtO) from the green alga Haematococ-
cus [93]. Ethylene production also was demonstrated in the cyanobacterium
Synechococcus elongates PCC7942 by chromosomal insertion of an ethylene-
forming enzyme [94]. However, the reaction catalyzed by the ethylene-
forming enzyme induced metabolic stress that was detrimental to the host
cell.
3.3
Whole genome analyses in marine microalgae
Sequencing of microbial genomes has become a routine procedure for

gene discovery. The most abundant population in marine cyanobacte-
ria is Prochlorococcus, which are the smallest phytoplankton known, with
a diameter of about 0.6 µm. Now the complete genomes of three strains
of Prochlorococcus [95, 96] and one strain of Synechococcus [97] have
been sequenced and analyzed. The information obtained from genome se-
quences and subsequently by comparative genome analyses takes on im-
portance as the 2000 genes of these minimal life units are sufficient to
generate the most abundant global biomass from solar energy and inor-
ganic compounds. The genome database for cyanobacteria is available at
(http://www.kazusa.or.jp/cyano/cyano.html).
In eukaryotic microalgae genomics, the genome composition of the genet-
ically transformable diatom strain Phaeodactylum tricornutum was analyzed
by the generation of approximately 1000 express sequence tags (ESTs) [98].
Interestingly, many sequences were shown to have more similarity with ani-
mal genes than with their plant counterparts.
4
Microalgal Mass Cultivation Technologies
Photosynthetic microorganisms play an important role in the conversion

of solar energy into chemical energy. Photosynthetic conversion is an effi-
cient and alternative process used in several industrial fields. Attempts to
develop large-scale methodologies for the cultivation of microalgae have been
performed using many different kinds of cultivation systems for providing
alternatives to fermentation and agriculture products [99]. Algal biomass
has historically served as fertilizer [100] and a food source for both hu-
mans and animals [101, 102] for secondary waste water treatment [103] and
bioremediation [104, 105]. This use of algal biomass is an important con-
sideration for industrial applications of microalgal cultures. With advances
in processing technology, algal biomass has come to be seen as a possible
source of fuels, fine chemicals, and pharmaceuticals [106]. Several species of
microalgae, which produce useful chemicals such as amino acids, vitamins,
carotenoids (β-carotene), fatty acids (DHA, EPA, γ -LA 18:3 (n-6)), polysac-
charides, and antibiotics have been reported. Many microalgal products have
already been commercialized [36, 107–109]. Further, microalgal production
of energy resources has been extensively investigated. Development of pro-
cesses that utilize the majority of the resulting microalgal biomass as energy
sources would be preferred. Such processes may allow the recycling of evolved
CO2 from human energy consumption rather than direct emission, as is the
present case for fossil fuels. The following six products for use as fuels can be
produced from microalgal biomass: hydrogen (through biophotolysis), me-
thane (through anaerobic digestion), ethanol (through yeast or other alcohol
fermentation), triglycerides (through extraction of lipids), methyl ester fuels
(through transesterification of lipids), and liquid hydrocarbons (from Botry-
ococcus braunii).
The development of efficient culture systems is necessary for algal mass
production and the industrial applications of microalgae. The growth rate
and maximum biomass yield of microalgal strains are affected by culture pa-
rameters (light, temperature, and pH) and nutritional status (CO2 , nitrogen,
and phosphate concentration). On the other hand, increasing the density of
cultures decreases photon availability to individual cells. Light penetration of
microalgal cultures is poor, especially at high cell densities, and such poor
photon availability decreases specific growth rates. Higher biomass yields can
be expected if sufficient photons are provided in high density cultures of
microalgae.
Large-scale culture systems have been constructed (classified as open
and closed systems) with the greatest attention directed to the light supply
(Fig. 1) [110]. Strains such as Chlorella, Scenedesmus, Dunaliella, Spirulina,
Porphyridium, and Haematococcus have been cultured using photobioreac-
tors to obtain several useful materials.
4.1
Open Culture Systems
Several different types of open culture systems have been proposed (Fig. 1a-d).
These open culture systems are the simplest method of algal cultivation
and offer advantages in low construction cost and ease of operation [111].
The open culture systems require large surface areas and shallow depth
(ca. 12–15 cm) to improve light penetration. Furthermore, agitation of the
culture prevents the cells from sinking to the bottom and facilitates efficient
cell growth with sunlight. The raceway pound has been developed into vari-
ous types, where those employing a paddle wheel for agitation have been used
most frequently for outdoor production of microalgae [112, 113]. The raceway
pound for commercial production of microalgae requires an area of 1000 to
5000 m2 .
Contamination by different algal species and other organisms is the biggest
problem in open culture systems, and therefore Chlorella, Dunaliella, and
Spirulina, which are tolerant to extreme conditions (high nutrient concen-
trations, high salinity, and high pH), are especially desirable strains for open
culture systems. Vonshak et al. [114] demonstrated that contamination by
Chlorella in outdoor Spirulina cultures was prevented by maintaining the cul-
ture medium at high bicarbonate concentration (0.2 M). Grazers sometimes
Fig. 1 Illustration of algal mass culture systems
found contaminants in Spirulina cultures could be arrested by addition of

ammonia (2 mM). The open culture system is easily affected by weather con-
ditions. For example, rain dilutes salinity, causing contamination. Outdoor
open culture systems are chosen mainly for production of food sources in
aquaculture [43, 115, 116]. However, several algae producing useful chemi-
cals require more restricted conditions for efficient growth and for metabolite
production.
4.2
Photobioreactor (Closed Culture Systems)
Closed systems have been expected to overcome the disadvantages of open

culture systems, and several types of photobioreactors have been devised.
EPA-producing microalgae diatoms have been cultured at various scales
in photobioreactors [43]. The closed system is required here because the
species used have no selective advantages like those of Dunaliella and Spir-
ulina. Figure 1e–i shows an example of large-scale closed photobioreactors.
These photobioreactors offer several advantages: (1) facilitate maintenance of
monoalgal cultures by protecting them from contamination; (2) reduce water
loss and the subsequent increase of salinity in the culture medium; (3) result
in higher productivity with greater cell densities, reducing harvesting costs;
and (4) are applicable to various microalgal species under favorable culture
conditions. However, for an efficient and reliable large-scale culture system,
several criteria need to be considered [117] such as light utilization efficiency,
homogeneous mixing (turbulence), low shear environment, temperature con-
trol, and efficient gas transfer.
The production yield of algal biomass depends on the light path length
to each cell, and therefore the surface-to-volume ratio is an important factor
for efficient light utilization in photobioreactors. The productivity of pho-
tobioreactors is determined by the light regime inside the bioreactors. In
addition to the light regime, oxygen accumulation and shear stress limit pro-
ductivity in certain designs [118]. Tubular reactors have been refined, and the
diameter of a tubular reactor is now less than 40 cm. Richmond et al. demon-
strated that reduction in the tube diameter from 5.0 cm to 2.8 cm enhanced
the biomass yield 1.8 times [119]. Narrower tube diameters may increase ef-
ficient light utilization as well as promote a faster flow rate, enhancing the
algal productivity and reducing fouling on the inside wall of the tubes. In
tubular reactors, flow rates of 30–50 cm/s generally are used and airlift is the
most effective circulation method of the culture rather than using centrifu-
gal, rotary positive displacement, and peristaltic pumps. The main advantages
of airlift systems are their low shear and relative simplicity of construction.
Several modifications in tube arrangement have been carried out for optimiz-
ing light penetration. Until recently, most of the tubular reactor was laid on
the ground such that the lower part of the tubes received less light than the
upper part. Torzillo et al. constructed a two-plane tubular bioreactor for op-
timizing light availability, where each tube in the lower plane is placed in the
vacant space between two tubes in the upper plane [120]. They showed that
this two-plane tubular bioreactor (145 L of culture volume) has an effective
surface-to-volume ratio (49 L/m) resulting in a net volumetric productivity of
1.5 g dry wt/L/d using Spirulina platensis.
The helical tubular reactor shown in Fig. 1e consists of a vertical tower
coiled up within a lone tube, increasing the land use efficiency. When biomass
productivity of various tubular reactors was compared on a footprint basis,

the values were in the range of 15 to 30 g dry wt/m/d for all reactor types.
The effect of temperature on biomass yield is significant in algal culture.
The culture in the tubular reactor often is maintained at higher tempera-
tures than that in the open raceway. Spirulina cultured in the tubular reactor
could be warmed faster than in the open raceway up to 35–37 ◦ C, the opti-
mal range for growth [119]. The closed reactors are sometimes overheated
and thus are more suitable for the thermophilic or thermotolerant strains.
Temperature control using a heat exchanger and/or evaporative cooling by
spraying water onto the surface is sometimes required for the cultivation of
general strains [120–122]. The effect of hydrodynamic stress on two differ-
ent microalgae strains, Dunaliella tertiolecta and D. salina, also was investi-
gated [121]. The data demonstrated that bubble rising and bubble bursting
were not responsible for cell death. Regarding nozzle diameter, small nozzles
were more detrimental to cells. Bubble formation at the sparger was the main
cause of cell death.
A problem in the closed system is photooxidative damage to the cells
caused by accumulation of dissolved oxygen produced by photosynthesis dur-
ing the light period. In the open system, evolved oxygen is diffused easily
to the atmosphere. By contrast, because oxygen cannot escape from closed
reactors, degasser systems sometimes are required.
The culture part of closed photobioreactors has been constructed with
several materials such as glass, methyl-polymethacrylate, polyethylene,
polypropylene, vinyl-polychlorine, silicone, and stainless steel. These photo-
bioreactors have been designed for optimal utilization of external illumina-
tion like sunlight. Optical fibers also have been employed as internal light
sources. Photobioreactors employing optical fibers have the advantage of
controlling illumination and light period duration and have a high surface-
area-to-volume ratio [123]. The efficiency of light utilization of microalgae
also was studied under light/dark cycles encountered in airlift photobioreac-
tors using D. tertiolecta [124]. Optimization of cultivation parameter growth
kinetics has increased productivity in photobioreactors. The Acceleration-
stat (A-stat) cultivation method has been proposed to determine the culture
steady state where the dilution rate is increased at a constant rate under
light-limiting conditions in a photobioreactor [125].
Open pond systems have lower productivity of algal biomass, require
larger land areas, and involve higher land costs. By contrast, closed culture
systems can achieve high-density culture and the overall volume of algal cul-
ture can be reduced, resulting in decreased land costs. However, a certain
amount of land area is still required for collecting a sufficient amount of so-
lar energy, and therefore operating costs are higher than for open systems.
Moreover, solar radiation, temperature, and other factors regulating algal
productivity are significantly affected by location. Suitable culture systems
should be chosen according to the target products and available environmen-

tal conditions.
5
CO2 Fixation Using Microalgal Cultures in Industry
The possible use of biological CO2 fixation to reduce anthropogenic CO2

emission has been investigated. However, the questions related to CO2 reduc-
tion on the basis of global net amount are debated because biomass must be
decomposed and CO2 is released into the atmosphere as a result.
For development of onsite CO2 fixation systems using microalgae, effi-
cient photobioreactors and strains that can fix large quantities of CO2 are
required. Several applied studies have been conducted that consider the direct
biological utilization of CO2 in emission gases from coal-fired power plants
and the steel and cement plants that produce large quantities of CO2 , NOx ,
and SOx (inhibitory gases for photosynthesis). Therefore, microalgae that can
grow under such extreme conditions will be required for direct CO2 fixation.
Many microalgal strains capable of rapid growth in water sparged with emit-
ted gases and under other extreme conditions such as high pH have been
screened, and a marine alga Chlorococcum littorale showing high CO2 toler-
ance and high growth rate in the linear growth phase was obtained [126].
In the report of the IEA Greenhouse Gas R&D Program, a system for the
reduction and recycling of CO2 emission from coal-fired power plants was de-
signed, where CO2 fixed products generated by microalgal culture are used as
biomass fuels, which will substitute eventually for fossil fuels [110]. Costs of
microalgae CO2 mitigation using the designed systems have been estimated
based on several design specifications such as (1) plant size, (2) gas condition,
(3) conditions for CO2 biofixation, (4) plant operation, (5) CO2 production
rate, and (6) algal strain (Nannochloropsis sp). Analyses of the designed sys-
tem showed that CO2 mitigation costs closely depend on productivity of algae
and solar radiation. In spite of these recent advances, microalgal strains that
can achieve higher photosynthetic efficiency at higher solar radiation are ne-
cessary. In addition, a photobioreactor, in which microalgae converts CO2 to
biomass at high photosynthetic efficiency, also is required.
One of the applications for CaCO3 recycling also was demonstrated [127,
128]. Coccolithophorids are unicellular planktonic marine algae that produce
elaborate structures called coccoliths comprised of scales or plates of CaCO3 .
In the oceans, huge blooms of coccolithophorid algae occur that have been
recognized as contributing to ocean floor sediment formation. Therefore, al-
gae play an important role in the global carbon cycle by CaCO3 recycling.
CO2 fixation by artificial weathering of waste concrete and coccol-
ithophorid algae cultures has been proposed (Fig. 2) [129]. During artificial
Fig. 2 Design of CO2 fixation by artificial weathering of waste concrete and culture of
coccolithophorid algae
weathering of waste concrete suspended in seawater, atmospheric CO2 can

be absorbed and dissolved as bicarbonate ions, which are a major source of
coccolith particles. Coccolithophorid algae can use bicarbonate ions to form
CaCO3 particles. Consequently, CO2 absorbed by artificial weathering can be
mineralized and fixed permanently. Artificial weathering of waste concrete
also is a useful method to supply bicarbonate ions to cells of the coccol-
ithophorid alga Emiliania huxleyi.
CO2 fixation by artificial weathering of waste concrete and coccol-
ithophorid algae cultures can be applied to the reduction of CO2 emission
from cement plants (Fig. 3). Coccoliths can be used as an alternative to lime-
stone, which is a carbonate source used for cement production. In the cement
industry, CO2 is produced mainly by decomposition of limestone during the
burning of cement clinker. If CaCO3 recycling can be achieved by artificial
weathering of waste concrete and coccolithophorid culture, CO2 emissions by
the cement industry might be reduced. It has been estimated that the amount
of CO2 absorbed by the weathering of waste concrete is greater than that of
CO2 emitted during a cement production when CO2 reduction and recycle
systems using microalgae are implemented. Moreover, CO2 is absorbed by the
coccolithophorid alga cultures themselves [128]. Glucose oxidase and uricase
have been immobilized onto purified ultrafine coccolith particles to illustrate
their potential as a support material for biotechnological application [130]. If
microalgal biomass can be stored in concrete without the decomposition of
the biomass back to CO2 , removal of anthropogenic CO2 may be achieved.
Extensive studies of biological CO2 fixation using microalgal cultures have
been pursued. A primary goal is the complete removal of CO2 in discharged
gas emitted by such an onsite system. Because of the land area require-
ments and a CO2 mitigation cost of $264 per ton as carbon, it is difficult at
present to apply microalgal cultures for CO2 removal. Most nations are seri-
ously concerned about the increase of atmospheric CO2 concentration, and
intensive efforts to reduce the anthropogenic CO2 emissions are being made.
Microalgae culture may be one of the important processes facilitating such ef-
forts [131]. Increasing attention is being paid to resource sustainability in all
Fig. 3 Design of CO2 fixation by artificial weathering of waste concrete and culture of
coccolithophorid algae
industries, and developing new technologies for microalgal culture will help
to provide sustainable resources.
References
1. Graham L, Wilcox L (2000) Algae. Prentice-Hall, Englewood Cliffs, NJ
2. Hoek C van den, Mann D, Jahns H (1995) Algae: An Introduction to Phycology. Cam-
bridge University Press, Cambridge, UK
3. Lee R (1999) Phycology. Cambridge University Press, Cambridge, UK
4. Raven J (2002) Biol Environ 102B:3
5. Burja A, Banaigs B, Abou-Mansour E, Burgess J, Wright P (2001) Tetrahedron 57:9347
6. Skulberg O (2000) J Appl Phycol 12:341
7. Mundt S, Kreitlow S, Nowotny A, Effmert U (2001) Int J Hyg Environ Health 203:327
8. Proksch P, Edrada R, Ebel R (2002) Appl Microbiol Biotechnol 59:125
9. Han B, McPhail K, Ligresti A, Marozo V, Gerwick W (2003) J Nat Prod 66:1364
10. Volkman J (2003) Appl Microbiol Biotechnol 60:495
11. De Philippis R, Vincenzini M (1998) FEMS Microbiol Rev 22:151
12. Shah V, Ray A, Garg N, Madamwar D (2000) Curr Microbiol 40:274
13. De Philippis R, Sili C, Paperi R, Vincenzini M (2001) J Appl Phycol 13:293
14. Otero A, Vincenzini M (2003) J Biotechnol 102:143
15. Takeyama H, Matsunaga T (1998) Production of useful materials from marine mi-
croalgae. Vijay Primlani for Oxford & IBH Publishing, New Delhi
16. Wake H, Akasaka A, Umetsu H, Ozeki Y, Shimomura K, Matsunaga T (1992) Plant Cell
Reports 11:62
17. Wachi Y, Sode K, Horikoshi K, Takeyama H, Matsunaga T (1995) Biotechnol Tech
9:633
18. Wachi Y, Burgess J, Iwamoto K, Yamada N, Nakamura N, Matsunaga T (1995) Biochim

Biophys Acta 1244:165
19. Matsunaga T, Sudo H, Takemasa H, Wachi Y, Nakamura N (1996) Appl Microbiol
Biotechnol 45:24
20. Matsunaga T, Takeyama H, Miura Y, Yamazaki T, Furuya H, Sode K (1995) FEMS Mi-
21. Neilan B, Dittmann E, Rouhiainen L, Bass R, Schaub V, Sivonen K, Borner T (1999)
J Bacteriol 181:4089
22. Berg H, Ziegler K, Piotukh K, Baier K, Lockau W, Volkmer-Engert R (2000) Eur
J Biochem 267:5561
23. Doekel S, Marahiel M (2001) Metab Eng 3:64
24. Christiansen G, Dittmann E, Ordorika L, Rippka R, Herdman M, Borner T (2001)
Arch Microbiol 176:452
25. Chang Z, Flatt P, Gerwick W, Nguyen V, Willis C, Sherman D (2002) Gene 296
26. Oppermann-Sanio F, Steinbuchel A (2002) Naturwissenschaften 89:11
27. Hutchinson C (2003) Proc Natl Acad Sci USA 100:3010
28. Hoffmann D, Hevel J, Moore R, Moore B (2003) Gene 311:171
29. Hook I, Ryan S, Sheridan H (2003) Phytochemistry 63:31
30. Wikfors G, Ohno M (2001) J Phycol 37:968
31. Arad S, Friedman O, Rotem A (1988) Appl Environ Microbiol 54:2411
32. Dvir I, Chayoth R, Sod-Moriah U, Shany S, Nyska A, Stark A, Madar Z, Arad S (2000)
Br J Nutr 84:469
33. Huleihel M, Ishanu V, Tal J, Arad S (2001) J Appl Phycol 13:127
34. Talyshinsky M, Souprun Y, Huleihel M (2002) Cancer Cell Int 2:8
35. Huleihel M, Ishanu V, Tal J, Arad S (2002) J Biochem Biophys Methods 50:189
36. Apt K, Behrens P (1999) J Phycol 35:215
37. Brown MR (2002) Nutritional value of microalgae for aquaculture. In: Cruz-Suárez LE,
Ricque-Marie D, Tapia-Salazar M, Gaxiola-Cortés MG, Simoes N (eds) Advances en
Nutrición Acuicola VI. Memorias del VI Simposium Internacional de Nutrición
Acuicola. 3–6 September 2002, Cancun, Quintana Roo, Mexico, p 282
38. Guzman S, Gato A, Calleja J (2001) Phytother Res 15:224
39. Guzman S, Gato A, Lamela M, Freire-Garabal M, Calleja J (2003) Phytother Res 17:665
40. Miura Y, Sode K, Nakamura N, Matsunaga N, Matsunaga T (1993) FEMS Microbiol
Lett 107:163
41. Browitzka M (1997) J Appl Phycol 9:393
42. Lebeau T, Robert J (2003) Appl Microbiol Biotechnol 60:612
43. Lebeau T, Robert J (2003) Appl Microbiol Biotechnol 60:624
44. Wen Z, Chen F (2003) Biotechnol Adv 21:273
45. Kawachi M, Inouye I, Honda D, O’Kelly C, Bailey C, Bidigare R, Andersen R (2002)
Phycol Res 50:31
46. Nakahara T, Yokochi T, Higashihara T, Tanaka S, Yaguchi T, Honda D (1996) J Am Oil
Chem Soc 73:1421
47. Yokochi T, Honda D, Higashihara T, Nakahara T (1998) Appl Microbiol Biotechnol
49:72
48. Lewis T, Nichols P, McMeekin T (1999) Mar Biotechnol 1:580
49. Abril R, Garrett J, Zeller S, Sander W, Mast R (2003) Regul Toxicol Pharmacol 37:73
50. Hammond B, Mayhew D, Holson J, Nemec M, Mast R, Sander W (2001) Regul Toxicol
Pharmacol 33:205
51. Hammond B, Mayhew D, Kier L, Mast R, Sander W (2002) Regul Toxicol Pharmacol
35:255
52. Hammond B, Mayhew D, Naylor M, Ruecker F, Mast R, Sander W (2001) Regul Toxicol
Pharmacol 33:192
53. Hammond B, Mayhew D, Robinson K, Mast R, Sander W (2001) Regul Toxicol Phar-
macol 33:356
54. Fan K, Chan F, Jones E, Vrijmoed L (2001) J Ind Microbiol Biotechnol 27:199
55. Sogawa K, Matsuda M, Okutani K (1998) J Mar Biotechnol 6:241
56. Sogawa K, Sumida T, Hamakawa H, Yamada T, Matsumoto K, Matsuda M, Oda H,
Miyake H, Tashiro S, Okutani K (1998) Res Commun Mol Pathol Pharmacol 99:259
57. Sogawa K, Yamada T, Muramatsu Y, Sumida T, Hamakawa H, Oda H, Miyake H,
Tashiro S, Matsuda M, Matsumoto K, Okutani K (1998) Res Commun Mol Pathol
Pharmacol 99:267
58. Umemura K, Yanase K, Suzuki M, Okutani K, Yamori T, Andoh T (2003) Biochem
Pharmacol 66:481
59. Yim J, Kim S, Ahn S, Lee H (2003) Biomol Eng 20:273
60. Burgess J, Iwamoto K, Miura Y, Takano H, Matsunaga T (1993) Appl Microbiol
Biotechnol 39:456
61. Takeyama H, Iwamoto K, Hata S, Matsunaga T (1996) J Mar Biotechnol 3:244
62. Triemer R, Zimba P, Rowan M (2003) 55th Annual Meeting of the Society of Protozo-
ologists
63. Takeyama H, Kanamaru A, Yoshino Y, Kakuta H, Kawamura Y, Matsunaga T (1997)
Biotechnol Bioeng 53:185
64. Elhai J (1994) J Appl Phycol 6:177
65. Murphy R, Stevens S (1992) Appl Environ Microbiol 58:1650
66. Takeyama H, Takeda D, Yazawa K, Yamada A, Matsunaga T (1997) Microbiology
143(Pt 8):2725
67. Buzby J, Porter R, Stevens Jr S (1983) J Bacteriol 154:1446
68. Muro-Pastor A, Kuritz T, Flores E, Herrero A, Wolk CP (1994) J Bacteriol 176:1093
69. Matsunaga T, Takeyama H, Nakamura N (1990) Appl Biochem Biotechnol 24/25:151
70. Takeyama H, Nakayama H, Matsunaga T (2000) Appl Biochem Biotechnol 84–86:447
71. Kawaguchi R, Nagaoka T, Burgess J, Takeyama H, Matsunaga T (1994) Plasmid
72. Yang X, McFadden B (1993) J Bacteriol 175:3981
73. Akiyama H, Kanai S, Hirano M, Miyasaka H (1998) DNA Res 5:127
74. Elhai J, Wolk C (1988) Methods Enzymol 167:747 754
75. Vachhani A, Ramkumar K, Tuli R (1993) J Gen Microbiol 139:569
76. Chiang G, Schaefer M, Grossman A (1992) Physiol Biochem 30:315
77. Marraccini P, Bulteau S, Cassier-Chauvat C, Mermet-Bouvier P, Chauvat F (1993) Plant
Mol Biol 23:905
78. Sode K, Tatara M, Takeyama H, Burgess J, Matsunaga T (1992) Appl Microbiol
Biotechnol 37:369
79. Sode K, Tatara M, Ogawa S, Matsunaga T (1992) FEMS Microbiol Lett 99:73
80. Safferman R, Morris M (1963) Science 140:679
81. Sode K, Oozeki M, Asakawa K, Burgess JG, Matsunaga T (1994) J Mar Biotechnol 1:189
82. Bergh O, Borsheim K, Bratbak G, Heldel M (1989) Nature 340:467
83. Zhong Y, Chen F, Wilhelm S, Poorvin L, Hodson R (2002) Appl Environ Microbiol
68:1576
84. Shark K, Smith F, Harpending P, Rasmussen JL, Sanford J (1991) Appl Environ Micro-
biol 57:480
85. Matsunaga T, Sakaguchi T, Tadokoro F (1991) Appl Microbiol Biotechnol 35:651
86. Takeyama H, Kudo S, Sode K, Nakamura N, Matsunaga T (1991) Kobunshi Ronbunshu
48:319
87. Apt KE, Kroth-Pancic P, Grossman A (1996) Mol Gen Genet 252:572
88. Dunahay T, Jarvis E, Roessler P (1995) J Phycol 31:1004
89. Falciatore A, Casotti R, Leblanc C, Abrescia C, Bowler C (1999) Mar Biotechnol 1:239
90. Geng D, Han Y, Wang Y, Wang P, Zhang L, Li W, Sun Y (2004) Acta Botanica Sinica
46:342
91. Yu R, Yamada A, Watanabe K, Yazawa K, Takeyama H, Matsunaga T, Kurane R (2000)
Lipids 35:1061
92. Zaslavskaia L, Lippmeier J, Shih C, Ehrhardt D, Grossman A, Apt K (2001) Science
292:2073
93. Harker M, Hirschberg J (1997) FEBS Lett 404:129
94. Takahama K, Matsuoka M, Nagahama K, Ogawa T (2003) J Biosci Bioeng 95:302
95. Rocap G, Larimer F, Lamerdin J, Malfatti S, Chain P, Ahlgren N, Arellano A, Cole-
man M, Hauser L, Hess WR, Johnson Z, Land M, Lindell D, Post A, Regala W, Shah M,
Shaw S, Steglich C, Sullivan M, Ting C, Tolonen A, Webb E, Zinser E, Chisholm S
(2003) Nature 424:1042
96. Dufresne A, Salanoubat M, Partensky F, Artiguenave F, Axmann I, Barbe V, Duprat S,
Galperin M, Koonin E, Le Gall F, Makarova K, Ostrowski M, Oztas S, Robert C, Ro-
gozin IB, Scanlan D, Tandeau de Marsac N, Weissenbach J, Wincker P, Wolf YI, Hess W
97. Palenik B, Brahamsha B, Larimer F, Land M, Hauser L, Chain P, Lamerdin J, Regala W,
Allen E, McCarren J, Paulsen I, Dufresne A, Partensky F, Webb EA, Waterbury J (2003)
Nature 424:1037
98. Scala S, Carels N, Falciatore A, Chiusano M, Bowler C (2002) Plant Physiol 129:993
99. Contreras-Flores C, Pena-Castro JM, Flores-Cotera LB, Canizares-Villanueva RO (2003)
Interciencia 28:450
100. Lopezruiz JL, Garcia RG, Soledad M, Almeda F (1995) Aquat Eng 14:367
101. Benemann J (1992) J Appl Phycol 4:233
102. Jimmy RA, Kelly MS, Beaumont AR (2003) Aquaculture 220:261
103. Kaya V, de la Noue J, Picard G (1995) J Appl Phycol 7:85
104. Stirk WA, van Staden J (2001) S Afr J Bot 67:615
105. Matsunaga T, Takeyama H, Nakao T, Yamazawa A (1999) J Biotechnol 70:33
106. Borowitzka M (1995) J Appl Phycol 7:3
107. Lorenz RT, Cysewski GR (2000) Trends Biotechnol 18:160
108. Olaizola M (2003) Biomol Eng 20:459
109. Radmer RJ, Parker BC (1994) J Appl Phycol 6:93
110. (1994) The IEA Greenhouse Gas R&D Program, Report G/93/OE16B, Chemical Soci-
ety of Japan
111. Torzillo G, Pushparaj B, Masojidek J, Vonshak A (2003) Biotechnol Bioprocess Eng
8:338
112. Richmond A (1992) J Appl Phycol 4:281
113. Chaumont D (1993) J Appl Phycol 5:593
114. Vonshak A, Boussiba S, Abeliovich A, Richmond A (1983) Biotechnol Bioeng 25:341
115. Duerr E, Molnar A, Sato V (1998) J Mar Biotechnol 6:65
116. Borowitzka M (1999) J Biotechnol 70:313
117. Borowitzka M (1996) J Mar Biotechnol 4:185
118. Janssen M, Tramper J, Mur LR, Wijffels RH (2003) Biotechnol Bioeng 81:193
119. Richmond A, Boussiba S, Vonshak A, Kopel R (1993) J Appl Phycol 5:327
120. Torzillo G, Carlozzi P, Pushparaj B, Montaini E, Materassi R (1993) Biotech Bioeng
42:891
121. Barbosa MJ, Hadiyanto, Wijffels RH (2004) Biotechnol Bioeng 85:78
122. Lee Y, Low C (1992) Biotechnol Bioeng 40:1119

123. Takano H, Takeyama H, Nakamura N, Sode K, Burgess J, Manabe E, Hirano M, Mat-
sunaga T (1992) Appl Biochem Biotechnol 34/35:449
124. Barbosa M, Janssen M, Ham N, Tramper J, Wijffels R (2003) Biotechnol Bioeng
82:170
125. Barbosa M, Hoogakker J, Wijffels RH (2003) Biomol Eng 20:115
126. Kodama M, Ikemoto H, Miyachi S (1993) J Mar Biotechnol 1:21
127. Takano H, Takei R, Manabe E, Burgess JG, Hirano M, Matsunaga T (1995) Appl Mi-
crobiol Biotechnol 43:460
128. Takano H, Jeon J, Burgess J, Manabe E, Izumi Y, Okazaki M, Matsunaga T (1994) Appl
Microbiol Biotechnol 40:946
129. Takano H, Matsunaga T (1995) Energ Convers Manage 36:697
130. Takano H, Manabe E, Hirano M, Okazaki M, Burgess J, Nakamura N, Matsunaga T
(1993) Appl Biochem Biotechnol 39:239
131. Murakami M, Ikenouchi M (1997) Energ Convers Manag 38S:493
DOI 10.1007/b135785
Marine Enzymes
Ghosh Debashish · Saha Malay · Sana Barindra · Mukherjee Joydeep (u)
Environmental Science Programme and Department of Life Science & Biotechnology,
Jadavpur University, 700 032 Kolkata, India
joymukherjee@vsnl.net
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
2 Source . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
2.1 Marine Microorganisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
2.1.1 Extremophiles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192
2.1.2 Marine Symbiotic Microorganisms . . . . . . . . . . . . . . . . . . . . . . . 194
2.1.3 Microorganisms from Marine Sediment and Seawater . . . . . . . . . . . . 195
2.2 Marine Animals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
2.3 Marine Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
3 Molecular Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203

3.1 Molecular Methods to Assess Diversity . . . . . . . . . . . . . . . . . . . . 204
3.1.1 Oxidoreductases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204
3.1.2 Hydrolases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206
3.1.3 Transferases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207
3.2 Cloning and Gene Characterization . . . . . . . . . . . . . . . . . . . . . . 208
4 Bioprocessing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210
5 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Abstract Marine enzyme biotechnology can offer novel biocatalysts with properties like
high salt tolerance, hyperthermostability, barophilicity, cold adaptivity, and ease in large-
scale cultivation. This review deals with the research and development work done on
the occurrence, molecular biology, and bioprocessing of marine enzymes during the last
decade. Exotic locations have been accessed for the search of novel enzymes. Scien-
tists have isolated proteases and carbohydrases from deep sea hydrothermal vents. Cold
active metabolic enzymes from psychrophilic marine microorganisms have received con-
siderable research attention. Marine symbiont microorganisms growing in association
with animals and plants were shown to produce enzymes of commercial interest. Mi-
croorganisms isolated from sediment and seawater have been the most widely studied,
proteases, carbohydrases, and peroxidases being noteworthy. Enzymes from marine an-
imals and plants were primarily studied for their metabolic roles, though proteases and
peroxidases have found industrial applications. Novel techniques in molecular biology
applied to assess the diversity of chitinases, nitrate, nitrite, ammonia-metabolizing, and
pollutant-degrading enzymes are discussed. Genes encoding chitinases, proteases, and
carbohydrases from microbial and animal sources have been cloned and characterized.
Research on the bioprocessing of marine-derived enzymes, however, has been scanty, fo-
190 G. Debashish et al.
cusing mainly on the application of solid-state fermentation to the production of enzymes

from microbial sources.
Keywords Marine · Enzyme · Microorganisms · Molecular biology · Bioprocess
Abbreviations
ArChi Arthrobacter chitinase
ATP Adenine triphosphate
BLAST Basic Local Alignment Search Tool
bp base pair
c-AMP 3 ,5 -cyclic adenosine monophosphate
3 ,5 -CNP cyclic nucleotide phosphodiesterase
cbp cellobiose phosphorylase
cDNA complementary deoxyribonucleic acid
chi chitinase genes
cht N-acetyl-β-glucosaminidase
DGGE denaturing gradient gel electrophoresis
DMS dimethyl sulfide
DMSP dimethylsulfoniopropionate
DNA deoxyribonucleic acid
GALT galactose-1-phosphate uridylyltransferase
GDH glucose dehydrogenase
h hour
IPNV infectious pancreatic necrosis virus
ISP iron-sulfur protein
kb kilo base
kbp kilo base pair
min minute
m RNA messenger ribonucleic acid
MABV marine birnavirus
MPa mega pascal
MUF-diNAG 4-methylumbelliferyl β-D-N, N -diacetylchitobioside
NAD(P) nicotinamide adenine dinucleotide (phosphate)
NADH hydrogenated nicotinamide adenine dinucleotide
nifH nitrogenase gene
nir nitrite reductase gene
nit Nitrosospira-like sequences
nos nitrous oxide reductase gene
nrtP nitrate/nitrite permease
PAGE polyacrylamide gel electrophoresis
PAH polyaromatic hydrocarbon
PCR polymerase chain reaction
rRNA ribosomal ribonucleic acid
RuBisCO ribulose-1,5-bisphosphate carboxylase/oxygenase
RdRp RNA-dependent RNA polymerase
SBEs starch-branching enzymes
SSF solid-state fermentation
β-HP β-hydroxypropionate
Marine Enzymes 191
1
Introduction
The biological and chemical diversity of the marine environment has been
the source of unique chemical compounds with the potential for industrial
development as pharmaceuticals, cosmetics, nutritional supplements, mo-
lecular probes, enzymes, fine chemicals, and agrichemicals [1]. The oceans
represent a virtually untapped resource for the discovery of even more novel
compounds with useful activity. Although the commercial success stories in
biotechnology are familiar, such stories in marine biotechnology are far less
familiar and far fewer [2].
In the last decade there has been a continuous effort to learn more about
the still largely unexplored realm of marine enzymes. In this review, the oc-
currence of enzymes from various marine sources will be described followed
by application of molecular biology and finally the bioprocessing aspects of
some marine biocatalysts.
A marine enzyme may be a unique protein molecule not found in any
terrestrial organism or it may be a known enzyme from a terrestrial source
but with novel properties. Beside microorganisms like bacteria, fungi, and
actinomycetes, many other marine organisms such as fishes, prawns, crabs,
snakes, plants, and algae have also been studied to tap the arsenal of
the marine world. Properties like high salt tolerance, hyperthermostability,
barophilicity, cold adaptivity, and ease in large-scale cultivation are the key
interests of scientists. These properties may not be expected in terrestrial
sources as marine organisms thrive in habitats such as hydrothermal vents,
oceanic caves, and some areas where high pressure and absence of light are
obvious.
2
Source
A survey of the literature of the past 10 years shows that the occurrence of ma-
rine enzymes has been most widely studied. Therefore, we begin the review
with a description of various sources classified as marine microorganisms,
marine animals, and plants.
2.1
Marine Microorganisms
As marine microorganisms are very easy to tap, cultivate, identify (by mo-
lecular phylogenetic method), and bioprocess, they are of major interest to
researchers worldwide. The symbiotic nature (microorganisms found asso-
ciated with various marine sponges, corals, and other species) and their
occurrence in extreme environments (extremophiles) like hydrothermal vents

have also been areas of recent research and are therefore reviewed in this
article.
2.1.1
Extremophiles
Diversa, an American company engaged in the application of microbial biodi-

versity in the biotechnology industry, recognized that thermophilic enzymes
from vents with temperatures of 350–400 ◦ C are stable protein molecules.
Even if they are to be used at mild temperatures, they remain active far longer
than regular enzymes. They also resist the destabilizing effects of organic
chemicals used in industrial downstream processes. A recent US National
Academy of Sciences report noted that in 1993, world enzyme sales equaled
US$ 1 billion, a market that was expected to grow about 10% each year.
Enzymes from extremophiles will constitute a part of this market [3]. A sec-
ond generation of thermostable polymerase chain reaction (PCR) enzymes
has already been harvested from bacteria living near thermal vents on the
ocean floor and is marketed as Vent and Deep Vent polymerases [4]. Simi-
larly, psychrophilic enzymes can be useful for commercial laundry detergents
as consumers can wash clothes in cold rather than hot water, which could
significantly reduce power consumption. Although such applications have
been projected, current literature, however, is limited to the occurrence of
metabolic enzymes in psychrophilic organisms [5, 6]. Major recent advances
in cold deep sea biotechnology have come in the form of continuing discov-
eries of novel microorganisms, with unexpected genetic diversity and new
natural products including enzymes of potential relevance to human health
or environmental bioremediation [7, 8]. Continuing explorations of subma-
rine hydrothermal vent environments have yielded new hyperthermophiles
and more evidence of pressure-regulated operons and elevated hydrostatic
pressure stabilization of cells and enzymes at high temperatures. This section
is broadly divided into three parts, describing enzymes from thermophiles,
psychrophiles, and piezophiles.
Michels et al. [9] reported the properties of a hyperthermophilic, barophilic
protease from Methanococcus jannaschii, the first protease to be isolated
from an organism adapted to a high-pressure-high-temperature environ-
ment. A protease was isolated and purified from the supernatant of a culture
of hyperthermophilic archaebacteria Pyrococcus abyssi by Dib et al. [10].
A novel intracellular serine proteinase (pernilase) was identified from a ma-
rine aerobic hyperthermophilic archaeon Aeropyrum pernix having enzyme
half-lives of 85 min at 100 ◦ C and 12 min at 110 ◦ C by Chavez et al. [11]. After
extensive investigation of shallow water and deep sea hydrothermal vents
for the isolation of hyperthermophilic microorganisms, mostly Pyrococcus
sp. and Thermococcus sp., thermostable hydrolytic enzymes were character-
Marine Enzymes 193
ized for potential applications. Optimal growth conditions were analyzed to

determine final yields and metabolic rates; the effects of temperature and
hydrostatic pressure on cell replication and enzymatic activities were also in-
vestigated [12].
Microorganisms growing above 60 ◦ C isolated from deep sea hydrother-
mal vents were screened for amylolytic activity. Nine archaea and one ther-
mophilic bacterium were selected for the determination of thermostability
and pH optima. Pullulanase, glucosidase, and amylase activities were de-
tected in four archaeal strains related to the genus Thermococcus [13]. Brown
and Kelly [14] purified extracellular pullulanases from cell-free culture su-
pernatants of the marine thermophilic archaea Thermococcus litoralis and
Pyrococcus furiosus. The enzymes from T. litoralis and P. furiosus appeared to
represent highly thermostable amylopullulanases, versions of which, however,
have been isolated from less thermophilic organisms. Gantelet and Duchiron
isolated the extremely thermophilic archaeon T. hydrothermalis from a deep
sea hydrothermal vent in the East Pacific Rise, which produced an extracel-
lular pullulanase [15]. The chitinoclastic enzyme system of T. chitonopha-
gus, isolated from a hydrothermal vent site off the Mexican west coast, was
oxygen-stable, cell-associated, and inducible by chitin [16].
The membrane-bound hydrogenase from a marine hydrogen-oxidizing
bacterium Hydrogenovibrio marinus was characterized by Nishihara et al.
as highly oxygen tolerant, extremely thermophilic, and thermostable in its
membrane-bound form [17]. The pyruvate carboxylase of Methanococcus
jannaschii was purified and expressed in cells grown without an external
source of biotin [18]. Four different tungsten-containing enzymes have been
purified from P. furiosus that oxidize aldehydes of various types and are
thought to play primary roles in the catabolism of sugars or amino acids [19].
Turning to psychrophiles and psychrotolerant organisms, recent studies
have elucidated that although microorganisms produce various psychrophilic
enzymes in order to carry out metabolism efficiently under cold conditions,
enzymes studied so far are heat stable. A psychrophile from Antarctic sea-
water identified as Cytophaga sp., which grows optimally at 15 ◦ C but cannot
grow above 30 ◦ C, produces a variety of NAD(P)-dependent dehydrogenases,
among which alcohol dehydrogenase and aldehyde dehydrogenase are ther-
mostable, that has been reported by Soda et al. [20]. Alanine dehydrogenase,
malate dehydrogenase, and glutamate dehydrogenase were detected in ex-
tracts from a psychrophilic bacterium, closest to Shewanella isolated from
a sea urchin off the Icelandic coast by Irwin et al. [21]. An extracellular
serine peptidase was purified from the culture supernatant of a sub-Arctic
psychrophilic bacterium. It was a remarkably stable enzyme from a psy-
chrophilic microorganism, remaining active after 1 week at 20 ◦ C and after
five freeze-thaw cycles [22]. Kazuoka et al. [23] reported that Cytophaga sp.
produces aspartase abundantly. The enzyme showed higher pH and thermal
stabilities than that from mesophiles. Two enzymes from Colwellia maris—
isocitrate lyase having maximum activity at 20 ◦ C but rapidly inactivated at

temperatures above 30 ◦ C and malate synthase having optimum tempera-
ture of activity of 45 ◦ C—were discovered [24]. Possible explanations for the
presence of a cold-active enzyme in Fibrobacter succinogenes, a mesophile,
are that cold-active enzymes are more broadly distributed and that lateral
transfer of the gene from a psychrophile occurred or that F. succinogenes
originated from the marine environment [25]. Marine psychrophilic bacte-
ria with β-1,3-glucanase activities have been isolated, and the strain with the
highest glucanase activity has been taxonomically identified and the enzyme
was purified [26]. A heat-labile β-lactamase similar to highly specialized
cephalosporinases from pathogenic mesophilic bacteria has been purified by
Feller et al. [27] from the cold-adapted psychrophile Psychrobacter immobilis.
A few studies have been reported on enzymes from piezophilic microor-
ganisms. Konisky et al. [28] noted that the application of 50 MPa pressure
did not increase the thermostabilities of adenylate kinases purified from four
related mesophilic and thermophilic marine methanogens in contrast to the
evidence on hyperbaric stabilization of enzymes from deep sea thermophiles.
Researchers investigated the respiratory chain system of a deep sea barophilic
bacterium Shewanella sp., and a novel heme c containing quinol oxidase was
purified from cells grown at 60 MPa pressure. A study of its properties by
Qureshi et al. suggested the presence of two kinds of respiratory chains reg-
ulated in response to pressure in this bacterium [29].
2.1.2
Marine Symbiotic Microorganisms
Marine invertebrates and their cultivatable bacterial symbionts have become

a focal point of marine natural product research. Basic research on some of
these associations have resulted in the biotechnological development of these
valuable resources. A bacterial protease was isolated from a marine shipworm
and tested in cleansing formulations [30]. Bacterial mats that grow on whales
have been found to be a rich source of lipases and esterases, two classes of en-
zymes important to the industry [5]. Marine microorganisms often survive as
intracellular or extracellular symbionts, and their hosts are mostly marine an-
imals (vertebrates or invertebrates), which are first described in this section,
followed by one example of a plant host.
The deep sea tube worm Riftia pachyptila (Vestimentifera) from hy-
drothermal vents lives in an intimate symbiosis with a sulfur-oxidizing bac-
terium, and investigations indicate that the animal is fully dependent on
the symbiont for the de novo biosynthesis of pyrimidines [31]. The arginine
biosynthetic enzymes are present in all the tissues of the worm and in the
bacteria [32]. Scientists present microscopical and enzymatic (presence of
methanol dehydrogenase) evidence that methylotrophic bacteria occur as in-
tracellular symbionts in a new species of mytilid mussel discovered at the
Marine Enzymes 195
mid-Atlantic ridge hydrothermal vents [33]. Pseudoalteromonas sp. isolated

from the alimentary tract of Antarctic krill Thyssanoessa macrura synthe-
sizes an intracellular cold-adapted β-galactosidase [34]. Mohapatra [35] re-
ported the isolation of carboxymethylcellulase from a Bacillus sp. associated
with the marine sponge Axinella sp. The marine sponge Spirastrella sp. was
found to be an interesting host organism as it harbored a Mucor sp. produc-
ing a novel amylase [36], a Micrococcus sp. producing urethenase [37], and
an acetylcholinesterase producing bacterium Arthrobactor ilicis [38]. An ex-
tracellular protease from the marine bacterium Sphingomonas paucimobilis
isolated from the stomach of Antarctic krill Euphausia superba Dana was pu-
rified and characterized [39]. Vibrio fischeri, a marine bacterium that forms
a bioluminescent symbiosis with certain fish and squids, exhibits the unusual
attribute of growth on 3 ,5 -cyclic adenosine monophosphate (c-AMP), ap-
parently through the activity of a 3 ,5 -cyclic nucleotide phosphodiesterase
(3 ,5 -CNP) with exceptionally high activity [40], which, due to its unusual
location in the periplasm, allows this symbiotic bacterium to utilize extracel-
lular 3 ,5 -cyclic nucleotides (e.g., c-AMP) as sole sources of carbon, nitrogen,
and phosphorus [41]. A Streptomycetes sp. isolated from the prawn Penaeus
indicus showed good L-asparaginase activity [42]. A Bacillus sp. [43] and
a Mucor sp. [44] associated with the intertidal marine alga Sargassum sp. also
were found to be L-asparaginase producers.
The only example of a plant host is Laminaria fronds that house a bac-
terium Alteromonas sp. producing extra- and intracellular alginate lyases and
utilizes alginate as its sole carbon source [45].
2.1.3
Microorganisms from Marine Sediment and Seawater
Near shore sediments, deep sea sediments, and seawater have been easily
reachable to marine biotechnologists, and therefore reports of marine en-
zymes from these sources have been numerous over the past decade. Among
them, proteases, carbohydrases, and peroxidases have been the most cited
ones. Some of them have found commercial applications. The extracellu-
lar proteases are of particular importance and can be used in detergents
and industrial cleaning applications, such as in cleaning reverse osmosis
membranes. Vibrio spp. have been found to produce a variety of extracellu-
lar proteases. V. alginolyticus produces six proteases, including an unusual
detergent-resistant, alkaline serine exoprotease. This marine bacterium also
produces collagenase, an enzyme with a variety of industrial and commer-
cial applications [46]. BAL 31 Nuclease, manufactured by the Japanese firm
TaKaRa, is produced by the marine bacterium Alteromonas espejiana BAL 31,
an endonuclease specific to single-stranded deoxyribonucleic acid (DNA)
(activity I) and also has exonuclease activity (activity II).
Hydrolases
Shibata et al. discovered a novel metalloproteinase, almelysin, which has high

activity at low temperatures, and another proteinase from the culture super-
natant of a marine bacterium, Alteromonas sp. [47]. A protamine-degrading
marine bacterium was isolated from marine soil and identified as Aeromonas
salmonicida subsp. [48]. Alteromonas sp. secretes a metalloprotease involved
in the chitin degradation system of the strain [49].
Rath and Herndl [50] reported that marine snow of the northern Adri-
atic Sea showed β-D-glucosidase activity. Results obtained by Arrieta and
Herndl [51] with natural bacterial communities analyzed by capillary elec-
trophoresis zymography from the coastal North Sea suggest that the diversity
of β-glucosidases in the marine environment might be much higher than pre-
viously observed. In order to identify strains with α-1,4- and 1,6-glucosidase
enzymes with potential uses in shrimp feed production, Bacillus subtilis
was isolated from marine environments by Arellano–Carbajal and Olmos–
Soto [52]. Optimal conditions for growth of a marine fungus Chaetomium
indicum and for biosynthesis of β-1,3-glucanase were determined by Burtseva
et al. [53]. The extracellular enzymatic activity of a mixed culture of anaerobic
marine bacteria enriched on pullulan was studied by Arnosti and Repeta [54].
A β-mannanase from Vibrio sp. was purified by Tamaru et al. [55].
A marine bacterial strain isolated from the Bay of San Vicente, Chile, iden-
tified as Alteromonas sp., produced high levels of an extracellular agarase
in the presence of agar [56]. A marine bacterial strain of genus Vibrio that
decomposes the cell walls of some seaweed, including a Laminaria sp. and
Undaria pinnatifida, was isolated from seawater by Sugano et al. [57]. A novel
enzyme, α-neoagarooligosaccharide hydrolase, which hydrolyzes the α-1,3
linkage of neoagarooligosaccharides to yield agaropentaose and D-galactose,
was isolated from the marine bacterium Vibrio sp. and characterized by Sug-
ano et al. [58]. The phenotypic and agarolytic features of a marine bacterium
Pseudoalteromonas antarctica that was isolated from the southern Pacific
coast was investigated. It produced a diffusible agarase that caused agar soft-
ening around the colonies [59]. β-agarase, from marine bacterium Bacillus
cereus, was purified and characterized and gave a single band on polyacry-
lamide gel electrophoresis (PAGE) with activity staining [60]. Another marine
bacterium degraded numerous complex carbohydrates, such as agar, chitin,
and alginate, with an agarase system that consisted of at least three enzymes,
β-agarase I, β-agarase II, and α-agarase, which acted in concert to degrade
polymeric agar to D-galactose and 3,6-anhydro-L-galactose [61].
The degradation of chitin, the most abundant polymer in marine environ-
ment, was studied. Chitinase from the marine bacterium Alteromonas sp. was
purified [62]. V. harveyi was found to have a higher growth rate and more
chitinase activity when grown on β-chitin (isolated from squid pen) than
on α-chitin (isolated from snow crab) probably because of the more open
Marine Enzymes 197
structure of β-chitin. When exposed to different types of chitin, V. harveyi

excreted several chitin-degrading proteins into the culture media [63]. Ma-
rine bacterial strains of Cytophaga diffluens, C. hutchinsonii, Pseudomonas sp.
(fluorescent) and V. fluvialis were examined for cellulase production using
four media by Vaidya et al. [64], and Araki et al. [65] reported that β-1,3-
xylanase was purified to gel electrophoretic homogeneity from a cell-free
culture fluid of Vibrio sp.
Phosphate solubilizing bacteria belonging to Bacillus sp. were found to be
highly adaptive and therefore can significantly contribute to the phosphate
economy of the marine environment [66]. A marine Vibrio sp. producing
a particularly heat-labile alkaline phosphatase was isolated by Hauksson et al.
from North Atlantic coastal waters [67]. Constitutive amidase with broad sub-
strate specificity from a number of deep sea Actinomycetes were reported by
Brandão and Bull [68].
Oxidoreductases
Chloroperoxidase isolated from the marine fungus Caldariomyces fumago is

unique among the peroxidases because it contains a cysteinic thiolate as the
fifth axial ligand of the heme instead of the imidazole ligand. This enzyme
is unusually versatile: it catalyzes not only the reactions typical of peroxi-
dases but also those of catalases and monooxygenases, and it is also almost
unique in catalyzing halogenation reactions (except fluorination) in the pres-
ence of halide ions and H2 O2 [69]. A basidiomycetes fungus Flavodon flavus
isolated from decaying sea grass from a coral lagoon off the west coast of In-
dia produced three major classes of extracellular lignin-modifying enzymes:
manganese-dependent peroxidase, lignin peroxidase, and laccase [70]. A yel-
low pigmented marine bacterium was isolated by Francis et al. from surface
sediments of San Diego Bay based on its ability to oxidize soluble Mn (II) to
insoluble Mn (III, IV) oxides [71]. Manganese-dependent peroxidase activi-
ties detected in culture supernatants of Debaryomyces polymorphus, Candida
tropicalis, and Umbelopsis isabellina were responsible for color removal of
synthetic dyes by enzymatic biodegradation [72]. Three constitutive forms
of superoxide dismutase (iron, copper/zinc, and an unidentified form) activ-
ity have been demonstrated in the marine cyanobacterium Synechococcus sp.
by Chadd et al. [73]. The cytosolic form of Cu-Zn superoxide dismutase has
been isolated from the marine yeast Debaryomyces hansenii [74]. A novel glu-
cose dehydrogenase (GDH) from a marine bacterium Cytophaga marinoflava
was isolated by Tsugawa et al. [75] from its membrane fraction. The GDH
can react under high salinity. Another novel GDH that reacts with a clini-
cal marker of diabetes was purified by the same group [76] from a soluble
fraction of a marine Gram-negative bacterium identified as a Deleya sp. Ni-
trite reductase was purified to electrophoretic homogeneity from the soluble
extract of the marine denitrifying bacterium Pseudomonas nautica [77].
Lyases
Dimethyl sulfide (DMS), the most abundant volatile sulfur compound emitted
from oceans, is formed primarily by the action of dimethylsulfoniopropionate
(DMSP) lyase, which cleaves DMSP, an algal osmolyte, to equimolar amounts
of DMS and acrylate. D’Souza and Yoch [78] reported the isolation and pu-
rification of DMSP lyase. The soluble enzyme was purified to electrophoretic
homogeneity from a facultatively anaerobic Gram-negative rod-shaped ma-
rine bacterium identified as an Alcaligenes sp., a salt marsh bacterial isolate.
The production of DMSP lyase from this organism and a marine strain, Pseu-
domonas doudoroffii, were induced at optimum rates by DMSP and vigorous
aeration [79]. DMSP lyase was also isolated from the sulfate-reducing bac-
terium by Jansen and Hansen [80]. It was demonstrated in an α-subclass of
Proteobacteria in marine bacterioplankton community that DMSP was taken
up and metabolized by an intracellular DMSP lyase and acrylase. Added acry-
late was β-hydroxylated on (or near) the cell surface to β-hydroxypropionate
(β-HP), which accumulated briefly and was then taken up by cells. DMSP,
acrylate, and β-HP all induced DMSP lyase activity [81]. Fucobacter marina,
a marine bacterial strain isolated by Sakai et al., produced extracellular sul-
fated fucoglucuronomannan lyase [82]. Highly active constitutive nitrile hy-
dratase with broad substrate specificity from several deep sea Actinomycetes
were reported by Brandão and Bull (2003) [68].
Ligases
Glutamine synthetase in cells of the marine diazotrophic cyanobacterium

Trichodesmium thiebautii was investigated by Carpenter et al. [83]. The phys-
iological regulation of glutamine synthetase in the axenic cyanobacterium
Prochlorococcus sp. was studied, and the unusual responses to darkness and
nitrogen starvation could reflect adaptation mechanisms of Prochlorococcus
sp. for coping with a light- and nutrient-limited environment [84].
Other enzymes
Recent reports of other marine microbial enzymes belonging to the above cat-
egories obtained from sediment and seawater include lycopene k-cyclase [85],
L-serine dehydratase [86], polyhydroxybutyrate depolymerase [87], quinol
oxidase [88], and arylsulphatase [89].
Our research group has, for the first time, conducted surveys in the deltaic
Sundarbans, the world’s largest tidal mangrove forest located in the delta of
the Ganges, Brahmaputra, and Meghna rivers on the Bay of Bengal. We have
isolated several sediment-dwelling marine bacteria producing salt-tolerant
and thermostable protease, esterase, nitrilase, ribonuclease, L-asparaginase,
and L-glutaminase [90].
Marine Enzymes 199
2.2
Marine Animals
In the past decade enzymes from marine animals have been explored for
their metabolic roles and potential industrial applications. Some products are
already available on the market and some are going through clinical trials.
The Sunlife Corporation (USA) marketed Penzim; the active ingredient pen-
zyme is a digestive protease trypsin from the North Atlantic cod. It is a very
powerful psychrophilic proteolytic enzyme. Neptune Technologies & Biore-
sources introduced Neptune Krill Enzymes, which has natural powerful di-
gestive enzymes like proteases, phosphatases, and phosphohydrolases com-
bined with peptides. Another product, Neptune Aquatein, is the dry frac-
tion remaining after the extraction of Neptune Krill Oil. Research has shown
that Aquatein enzymes are lipases, phospholipases, alkaline phosphatase, acid
phosphatase, esterase, trypsin, phosphohydrolase, glucoronidase, glucosidase,
proteases, hyalurinases, and nucleases. Participation of academia and indus-
try in marine enzyme biotechnology has been exemplified in the development
of a cold active lysozyme-chlamysin with antimicrobial activity. Nilsen et al.
have isolated this enzyme from the viscera of the marine bivalve Chlamys is-
landica [91]. Fiskeriforskning, a Norwegian biotechnology firm, has also iso-
lated this enzyme [92], and the encoding complementary DNA (cDNA) gene
that actuates the enzyme production in scallops has been analyzed by Nilsen
and Myrnes [93]. Table 1 presents an overview of biotechnological applications
and metabolic functions of enzymes isolated from marine animals.
Table 1 Functions and applications of enzymes isolated from various marine animal sources
Enzyme Enzyme Source Biotechnological applications/ Reference

Class metabolic functions
Hydrolase Protease Marine sponge Degrade casein, hide powder [94]

Spheciospongia azure, synthetic substrates
vesparia
Cathepsins Marine sponge Major digestive protease [95]
Geodia cydonium in sponges
Protease Marine crab, Collagenolytic metallopro-
Scylla serrata tease closely resembles [96]
metalloproteases of
vertebrates
Amylase Sparus aurata, Digestive enzymes [97]
Scophthalmus in marine fishes
maximus and
Sebastes mentella
Table 1 (continued)

class metabolic functions
Choline- Bivalve Mytilus Biomarker for aquatic [98]

sterases edulis, Mytilus pollution
galloprovincialis,
Corbicula fluminea
AMP- Teleost sea Purine nucleotide [99]
deaminase scorpion, metabolism
Scorpaena porcus
Na, Spiny lobster Generation of osmolyte [100]
K-ATPase Palinurus elephas gradient
Hyaluron- Venom of the Only marine hyaluronidase [101]
idase stonesh, Synanceja
horrida
ATP Marine sponge Conversion of adenosine- [102]
N-gly- Axinella polypoides 5-triphosphate into adenine
cosidase and ribose-5-triphosphate
Trans- α-N- Sea squirt Structural analyses of [103]
ferase acetyl- the carbohydrate epitopes
galactos-
aminidase
Citrate Northern krill, Metabolic key enzymes, [104]
synthase, Meganyctiphanes adaptive properties under
Pyruvate norvegica different thermal conditions
kinase
Trans- Red sea bream Transfer of amine groups [105]
glutaminase liver
Glutathione Sea bass (Dicen- Novel glutathione S [106]
S transferase trarchus labrax) transferases belonging
liver cytosol to θ and α classes
cAMP- Marine periwinkle, In reversible protein [107]
dependent Littorina littorea phosphorylation,
protein aerobic-anaerobic transitions
kinase
Oxido- Dehalo- Terebellid Removal of anthropogenic [108]
reductase genating polychaete, or biogenic haloaromatic
peroxidase Amphitrite ornata compounds
Catalase, Marine mussel, Antioxidant enzyme, [109]
Superoxide Mytilus edulis L. Potential use in
dismutase toxicological studies
Marine Enzymes 201
Table 1 (continued)

Mono- Sea bass Biomarkers of polycyclic [110]

oxygenase (Dicentrarchus aromatic hydrocarbon
labrax) exposure
Phenol- Marine mussel Oxidation of phenolic [111]
oxidase Perna viridis substrates
20 β- Japanese eel Key steroidogenic enzyme [112]
hydroxyster-
oid dehydro-
genase
Lyase Phospho- Sea snake Novel purification method [113]
lipases A2 Hydrophis
cyanocinctus
venom
Other Glucose Marine borer Metabolic enzyme [114]
metabolism Bankia setacea
enzymes
2.3
Marine Plants
Marine plants, especially marine algae, in recent years have been appealing
candidates for bioprospecting of novel enzymes. Many commercially import-
ant enzymes have been isolated from marine phytoplanktons. Research has
demonstrated the presence of unique haloperoxidases (e.g., vanadium bro-
moperoxidase with a high degree of stability to thermal and organic solvent
denaturation) in algae. These enzymes could become valuable products be-
cause halogenation is an important process in the chemical industry. Japanese
researchers have developed methods to induce a marine alga to produce large
amounts of the enzyme superoxide dismutase, which is used in enormous
quantities for a range of medical, cosmetic, and food applications. Table 2
shows the recent trends in research on the biotechnology of enzymes isolated
from marine plants.
Table 2 Functions and applications of enzymes isolated from various marine plant sources

Oxido- Iodoper- Marine diatom Iodine incorporating enzyme [115]

reductase oxidase cultures
Vanadium- Lithophyllum Potential substitute [116]
bromoper- yessoense for catalase
oxidase
Bromoper- Marine algae Regiospecific bromoper- [117]
oxidase Ascophyllum nod- oxidative oxidation
osum and Corallina of 1,3-di-tert-butylindole
officinalis
Nitrate Eelgrass, Key enzyme in nitrate [118]
reductase Zostera marina L. assimilation Metabolic
enzyme
Hydrogenase Marine green alga, New source [119]
Chlorococcum
littorale
Luciferase Marine dinoflagel- Enzymatic oxidation [120]
lates, Lingulodinium of luciferin
polyedrum and
Pyrocystis lunula
Xanthine Gonyaulax polyedra Role in circadian control [121]
oxido-
reductases
Hydrolase Protease Marine green alga, fibrinolytic enzyme [122]
Codium divaricatum
Cholin- Gracilaria Metabolic enzyme [123]
esterase corticata
(Rhodophyta)
ATPase Zostera marina Salt-tolerant [124]
metabolic enzyme
Urease Aureococcus Conversion of urea [125]
anophagefferens, to ammonia
Prorocentrum
minimum and
Thalassiosira
weissflogii
Lyase Carbonic Marine diatom Hydration of CO2 [126]
anhydrase Phaeodactylum and the dehydration
tricornutum of bicarbonate
Marine Enzymes 203
Table 2 (continued)

Myrcene Marine red alga Produces myrcene [127]

synthase Ochtodes from geranyl diphosphate
secundiramea
Ligase Glutamine Emiliani huxleye Activity related with [128]
synthetase light and nitrogen availability
Transferase Ribulose-1,5- Marine Calvin cycle enzyme, [129]
bisphosphate phytoplankton Metabolic enzyme
carboxylase/
oxygenase
Isomerase Polyenoic Marine alga Conversion of [130]
fatty acid Ptilota filicina J arachidonic acid
isomerase
3
Molecular Biology
A survey of the recent literature shows that molecular biology tools have been
applied for assessing the biodiversity of marine enzymes, cloning, and char-
acterizing enzyme genes. Investigations in this sphere of research should have
immense commercial applications. The cDNA encoding silicatein, the first
silica-synthesizing enzyme from the sponge Suberites domuncula, was used
as a probe to study the potential role of silicate on the expression of the sil-
icatein gene. It was found that after increasing the concentration of soluble
silicate in the seawater medium, this gene is strongly upregulated [131]. This
discovery has led to the European Community-funded project to develop new
routes for the structure-controlled biofabrication of silica nanostructure ma-
terials for biosensors, biomedical uses, and biosemiconductors by diatoms
and siliceous sponges and for the industrial and medical application of the
enzymes involved in synthesis and dissolution of biogenic silica. The gene
encoding Pyrolase 160 (Diversa), a broad-spectrum β-mannanase (from the
deep sea hydrothermal vent), was discovered via expression screening and
then inserted into a microorganism known to be an efficient and safe expres-
sion host.
3.1
Molecular Methods to Assess Diversity
Cloning ribosomal ribonucleic acid (rRNA) genes from mixed microbial as-
semblages is done to determine the phylogenetic identity of population con-
stituents. Such cultivation-independent molecular phylogenetic surveys have
revealed an astounding number of novel phylogenetic lineages [132]. Re-
cent advances include the recovery of greater overall amounts of DNA in
environmental DNA libraries. Rapid progress in high-throughput screening,
sequencing, and robotics have also greatly facilitated a more thorough analy-
sis of the recovered clones. These technological advances are vastly improving
the economic and technical feasibility of cloning, screening, and sequencing
large numbers of clones derived from natural environments. There has been
a good deal of interest in recovering microbial DNA from soil, with most stud-
ies concentrating on bioprospecting for drugs, enzymes, and other natural
products. This type of approach has been in use now for nearly a decade in
the biotechnology industry [133]. Nowadays genetic engineers not only cat-
alog rRNAs (or other single genetic loci), but also determine large portions
of the genomic content found within naturally occurring microbial com-
munities. Different opportunities have become perceptible through this new
approach. Bioprospecting, characterization of uncultivated microbes, and mi-
crobial population genomics are advancing by its application [134]. In the
early 1990s, molecular biology was fortified with the use of thermostable
DNA polymerases and the PCR [135], which became a major tool for phylo-
genetic diversity study of single genetic loci, especially rRNA genes [136].
3.1.1
Oxidoreductases
Genetic heterogeneity of denitrifying bacteria in sediment samples from

Puget Sound and two sites on the Washington continental margin was studied
by PCR approaches by amplifying nitrite reductase genes (nirK and nirS).
The findings demostrated a very high diversity of nir sequences within small
samples and that these novel nir clusters, some very divergent from known se-
quences, were not known in cultivated denitrifiers [137]. Grüntzig et al. [138]
used real-time PCR to quantify the denitrifying nitrite reductase gene of
Pseudomonas stutzeri, a functional gene of biogeochemical significance from
Puget Sound and from the Washington ocean margin. These results suggested
that P. stutzeri may not be a dominant marine denitrifier.
Diversity of the nitrous oxide reductase gene (nosZ) was examined by
Scala and Kerkhof in sediments obtained from the Atlantic Ocean and Pa-
cific Ocean continental shelves. Phylogenetic analysis illustrated three ma-
jor clusters of nosZ genes with little overlap between environmental and
culture-based groups. The two non-culture-based gene clusters generally cor-
Marine Enzymes 205
responded to the sampling location, implying that denitrifier communities

may be restricted geographically [139].
Nitrogenase gene (nifH) sequences amplified directly from oceanic waters
showed that the open ocean contains more diverse diazotrophic microbial
populations and more diverse habitats for nitrogen fixers than previously ob-
served by classical culture-based techniques. Nitrogenase genes derived from
unicellular and filamentous cyanobacteria, as well as from the α and γ subdi-
visions of the class Proteobacteria, were found in both the Atlantic and Pacific
oceans [140]. With the aim of testing the hypothesis that biological nitro-
gen fixation plays an important role in nitrogen cycling in the subseafloor
associated with unsedimented hydrothermal vents, degenerate PCR primers
were designed to amplify the nitrogenase protein gene nifH from hydrother-
mal vent fluid by Mehta et al. Potential nitrogen fixers were encountered in
anaerobic Clostridia, and sulfate reducers included Proteobacteria and di-
vergent Archaea. All of the nifH genes from the deep seawater sample were
most closely related to the thermophilic, anaerobic archaeon Methanococcus
thermolithotrophicus denoting that at least two sources contribute to the di-
verse assemblage of nifH genes detected in hydrothermal vent fluid, first, nifH
genes from an anaerobic hot subseafloor and second, nifH genes from cold
oxygenated deep seawater [141].
The spatial distribution and diversity of ammonia-oxidizing bacteria of
the β subdivision of the class Proteobacteria (ammonia oxidizers) in the
Arctic Ocean and Western Arctic Ocean were determined by Bano and Hol-
libaugh. The presence of ammonia oxidizers was detected by PCR ampli-
fication of 16S rRNA genes using a primer set specific for this group of
organisms. Analysis of nitA–nitB (Nitrosospira-like sequences) PCR product
by nested PCR denaturing gradient gel electrophoresis (DGGE) showed the
presence of a dominant, ubiquitous ammonia oxidizer in the Arctic Ocean
basin. 22% of the samples contained additional major bands. These sam-
ples were restricted to the areas influenced by Pacific inflow. The nucleotide
sequence of the 1.1-kb nitA–nitBPCR product grouped with sequences des-
ignated “Group 1-marine Nitrosospira-like sequences”. Results connote that
the Arctic Ocean β-proteobacterial ammonia oxidizers have low diversity and
are dominated by marine Nitrosospira-like organisms. Diversity appeared to
be higher in the Western Arctic Ocean [142]. The diversity of ammonia-
oxidizing bacteria in aquatic sediments of the Pacific Northwest was studied
by retrieving ammonia monooxygenase and methane monooxygenase gene
sequences by Nold et al. Methanotrophs dominated freshwater sediments,
while β-proteobacterial ammonia oxidizers dominated marine sediments.
These results show that γ -Proteobacteria such as Nitrosococcus oceani are mi-
nor members of marine sediment ammonia-oxidizing communities [143].
The diversity of a gene encoding a key ring cleaving enzyme of the
β-ketoadipate pathway, dioxygenase, amplified from bacterial communities
associated with decaying Spartina alterniflora as well as from enrichment
cultures with aromatic substrates (p-hydroxybenzoate, anthranilate, vanillate,

and dehydroabietate) was investigated by Buchan et al. 52% of the clones
could be assigned to the Roseobacter group of the class α-Proteobacteria
abundant in coastal ecosystems. Another 6% of the clones matched genes
retrieved from isolates belonging to the genera Acinetobacter, Bacillus, and
Stappia, and 42% of the clones could not be assigned to any cultured bac-
terium based on sequence identity [144].
Degenerate primers and the PCR were used to isolate a portion of a naph-
thalene dioxygenase iron-sulfur protein (ISP) gene from a new bacterium,
Neptunomonas naphthovorans. A phylogenetic analysis of polycyclic aromatic
hydrocarbon dioxygenase ISP-deduced amino acid sequences showed that
the genes isolated were distantly related to the genes encoding naphthalene
dioxygenases of Pseudomonas and Burkholderia. 16S rDNA-based phyloge-
netic analysis placed these bacteria in the γ -3 subgroup of the Proteobacteria,
most closely related to members of the genus Oceanospirillum. However, mor-
phologic, physiologic, and genotypic differences between the new isolates
and the Oceanospirilla justified the creation of a novel genus and species,
N. naphthovorans [145]. Two distinct Cycloclasticus partial polyaromatic hy-
drocarbon (PAH) dioxygenase ISP gene sequences were PCR amplified from
samples collected from Puget Sound and the Gulf of Mexico by Geisel-
brecht et al. Cycloclasticus species appeared to be numerically important and
widespread PAH-degrading bacteria in both Puget Sound and the Gulf of
Mexico [146].
3.1.2
Hydrolases
PCR primers were designed based on chitinase (chi) genes in four γ -Proteo-
bacteria in the families Alteromonadaceae and Enterobacteriaceae (Group I
chitinases) and used to explore the occurrence and diversity of these chi
genes in cultured and nonculturable marine bacteria from coastal Pacific
Ocean and estuarine Delaware Bay bacterioplankton. The PCR results from
104 bacterial strains indicated that this type of chi gene occurs in two major
groups of marine α and γ Proteobacteria, but not the Cytophaga-Flavobacter
group [147]. To examine the ecology and evolution of microbial chitinases,
especially the chitin-binding domain, one of the chi genes (chiA) from the
marine bacterium Vibrio harveyi was analyzed by Vsitil and Kirchman [148].
Cottrell et al. identified representative and abundant chi genes from uncul-
tivated marine bacteria and constructed libraries of genomic DNA isolated
from coastal and estuarine waters. The libraries were screened for genes
encoding proteins that hydrolyze a fluorogenic analog of chitin, 4-methyl-
umbelliferyl β-D-N,N -diacetylchitobioside (MUF-diNAG). The number of
clones detected with the plaque assay was consistent with estimates of the
portion of culturable bacteria that degrade chitin. Results signified that
Marine Enzymes 207
culture-dependent methods do not greatly underestimate the portion of ma-

rine bacterial communities capable of chitin degradation [149].
Urea appears to be a major nitrogen resource in the sea, but little mo-
lecular information exists about its utilization by marine organisms. Oligonu-
cleotide primers were used to amplify a conserved fragment of the urease
coding region from marine cyanobacteria. A 5.7-kbp region of the genome
of the unicellular marine cyanobacterium Synechococcus sp. was cloned, and
genes encoding three urease structural subunits and four urease accessory
proteins were sequenced and identified by homology. The urease had a pre-
dicted subunit composition typical of bacterial ureases, but the organization
of the urease genes was unique. Biochemical characteristics of the urease en-
zyme were consistent with the predictions of the sequence data. Physiological
data and sequence analysis both suggested that the urease operon may be
nitrogen regulated [150].
The cDNA encoding the putative prolidase was cloned from a library of
demosponge Suberites domuncula by Wiens et al. Two different forms of
cDNAs were identified, coding for the putative polypeptides of molecular
mass 55 805 Da and 51 684 Da. Phylogenetic analysis revealed that the sponge
prolidase branches off first from the common ancestor of metazoan proli-
dases and later from the yeast prolidase; only distantly related are the bacte-
rial enzymes [151].
A set of marine psychrophilic bacteria has been surveyed in a PCR screen-
ing in order to clone cold-adapted lytic enzymes with degenerate primers
deduced from conserved sequences of muramidases from Gram-negative bac-
teria. A Basic Local Alignment Search Tool (BLAST) sequence comparison
of the PCR products revealed highest similarity to the lytic transglycosylase
C of the bacteria Pasteurella multocida, and 16S rRNA sequencing indicated
highest similarity to the species Shewanella frigidimarina [152].
3.1.3
Transferases
The nitrate/nitrite permease (nrtP) gene of the marine cyanobacterium Syne-

chococcus sp. was described and characterized by Sakamoto et al. NrtP is
a member of the major facilitator superfamily and is unrelated to the ATP-
binding cassette-type nitrate transporters that have been described for fresh-
water strains of cyanobacteria. The discovery of a nitrate/nitrite permease
in Synechococcus sp. suggested that significant differences in nutrient trans-
porters may occur in marine and freshwater cyanobacteria [153].
A DNA polymerase gene of Cenarchaeum symbiosum was identified in the
vicinity of the rRNA operon on a large genomic contig. Its deduced amino
acid sequence is highly similar to those of the archaeal family B (α-type) DNA
polymerases. It shared highest overall sequence similarity with the crenar-
chaeal DNA polymerases from the extreme thermophiles Sulfolobus acidocal-
darius and Pyrodictium occultum [154]. The cDNA nucleotide sequence of the
genome segment B encoding the VP1 protein, the putative RNA-dependent
RNA polymerase (RdRp), was determined for five marine birnavirus (MABV)
strains from different host or geographic origins and one infectious pan-
creatic necrosis virus (IPNV) by Zhang and Suzuki [155]. This is the only
example of a study on marine viral enzymes.
The phylogenetic diversity of the ribulose-1,5-bisphosphate carboxylase/
oxygenase (RuBisCO) large-subunit genes of deep sea microorganisms was
analyzed in samples from the mid-Atlantic Ridge and various deep sea habi-
tats around Japan including symbiont-bearing tissues of the vent mussel,
Bathymodiolus sp., and the seep vestimentiferan tubeworm, Lamellibrachia
sp. The RuBisCO sequences from the symbiont-bearing tissues showed a phy-
logenetic relationship with those from the ambient bacteria [156].
3.2
Cloning and Gene Characterization
The cloning and expression of enzymes are still considered a challenging

job for marine biotechnologists. Nevertheless, cloning and characterization of
genes encoding for carbohydrases, proteases, and antioxidant enzymes have
been reported in recent years. In this section, the enzymes described are
classified as hydrolases, oxidoreductases, and transferases. Apart from these
reports, some other marine enzymes that have been cloned and expressed are
presented in Table 3 at the end of this section.
The gene encoding an extracellular chi from marine Alteromonas sp. was
cloned in E. coli JM109 using pUC18 [157]. One of the chi genes (chiC) of Al-
teromonas sp. was cloned, and the nucleotide sequence was determined by
Tsujibo et al. [158]. Three chitinolytic clones were isolated from a genomic DNA
library of Vibrio sp., a psychrotolerant bacterium from the Antarctic Ocean. The
chiA of the isolate was overexpressed in E. coli BL21(DE3) [159]. Arthrobacter
sp. isolated from the sea bottom along the Antarctic ice shell secretes two ma-
jor chitinases, chiA and chiB (Arthrobacter chitinase ArChiA and ArChiB), in
response to chitin induction. A single chromosomal DNA fragment contain-
ing the genes coding for both chitinases was cloned and sequenced in E. coli
by Lonhienne et al. [160]. Alteromonas sp. secretes chiA, chiB, and chiC in the
presence of chitin. A gene cluster involved in the chitinolytic system of the
strain was cloned and sequenced upstream of and including the chiA gene.
The gene cluster consisted of three different open reading frames organized
in the order chiD, cellobiose phosphorylase (cbp)1, and chiA [161]. The chiB
secreted by a marine Alteromonas sp. was purified, and the corresponding
gene was also cloned and sequenced by Orikoshi et al. [162]. The gene encod-
ing N-acetyl-β-glucosaminidase (cht) from the marine bacterium Alteromonas
sp. was cloned into pUC18 in E. coli JM109, sequenced and designated as
cht60 [163]. The manA gene encoding an extracellular β-1,4-mannanase of
Marine Enzymes 209
Table 3 Examples of some cloned marine enzymes
Enzyme Enzyme Source Reference

class
Hydrolase Poly (3-hydroxy Alcaligenes faecalis [174]

butyrate) depolymerase
β-1,3-xylanase Vibrio sp., Alcaligenes sp. [175, 176]
Uracil-DNA glycosylase Marine Gram-positive [177]
psychrophile
β-lactamase Vibrio harveyi [178]
Cellulase Marine mussel, [179]
Mytilus edulis
Sphingolipid ceramide Marine bacterium, [180]
N-deacylase Shewanella alga
β-agarase Marine Pseudomonas sp. [181]
Transferase Protein C kinase Marine sponge, [182]
Geodia cydonium
Aspartate trans- Deep-sea hyperthermophilic [183]
carbamylase archaeon Pyrococcus abyssi
ATP sulfurylase Hydrothermal vent tube- [184]
worm Riftia pachyptila
Polyketide synthase Streptomyces maritimus [185]
Oxido- Luciferase Marine dinoflagellate, [186]
reductase Gonyaulax polyedra
Sulfonic acid mono- Methylosulfonomonas [187]
oxygenase methylovora
Alanine dehydrogenase Marine psychrophilic [188]
bacterium
NADH-quinone reductase Vibrio alginolyticus [189]
Ligase Carbamoyl phosphate Pyrococcus abyssi [190]
synthetase
Glutamine synthetase Shewanella violacea [191]
a marine bacterium, Vibrio sp., was cloned and sequenced [164]. Screening
of expression libraries identified mannanase-positive clones in Rhodothermus
marimus, a thermophilic bacterium isolated from marine hot springs [165].
Characterization in Thermotoga neapolitana of a catabolic gene cluster en-
coding two glycosyl hydrolases, 1,4-β-D-glucan glucohydrolase and cellobiose
phosphorylase, was reported by Yernool et al. [166]. To achieve a better un-
derstanding of the molecular mechanisms underlying amylase expression, Ma

et al. cloned and sequenced a 318-base pair (bp) fragment of amylase cDNA
in developing sea bass (Lates calcarifer). Based on this sequence, a real-time
reverse transcriptase PCR technique to monitor the changes in the messenger
ribonucleic acid (mRNA) levels in the larvae was developed. A correlation be-
tween enzymatic activity and mRNA level of amylase could be demonstrated
during the early development of sea bass larvae. This suggests that the changes
in amylase are controlled at least at the transcriptional level during early lar-
val development of sea bass [167]. A nuclear gene from the red alga Gracilaria
gracilis was cloned by Lluisma and Ragan that encodes a homolog of starch-
branching enzymes (SBEs) [168].
The complete cDNA coding for cathepsin L (hydrolase) was identified and
characterized in the sponge Geodia cydonium by Krasko et al. The deduced
amino acid sequence contains 322 residues, has a molecular weight of 36 085 Da,
and shows the characteristic signatures known from other cathepsins of the
L subfamily [95]. The gene encoding an extracellular alkaline metalloprotease
was cloned, and its nucleotide sequence was analyzed and showed significant
similarity to metalloproteases classified in the thermolysin family [169].
The encoding region of the gene of copper-zinc superoxide dismutase (oxi-
doreductase) has been cloned from several strains of marine yeast belonging
to the genus Debaryomyces through genomic DNA-PCR amplification [170].
The encoding region of the superoxide dismutase enzyme gene of Udeniomyces
puniceus was cloned from three species of pigmented marine yeast through
genomic DNA-PCR amplification. For U. puniceus, the cloned nucleotide se-
quence contains all necessary information to produce a functional protein,
which correlates with activity detected in cell homogenates [171].
Lluisma and Ragan cloned and sequenced a gene from G. gracilis that en-
codes a key enzyme of D-galactose metabolism, galactose-1-phosphate uridy-
lyltransferase (GALT) [172]. A gene encoding an ADP-phosphofructokinase
homolog has been identified in the hyperthermophilic archaeon Methan-
ococcus jannaschii, which encodes a protein of 462 amino acids with a molecular
weight of 53 361 Da. The gene was overexpressed in E. coli, and the produced
enzyme was purified and characterized. The enzyme surprisingly showed
high ADP-dependent activities for both glucokinase and phosphofructoki-
nase [173].
4
Bioprocessing
The area in which marine biotechnology in general and marine bioprocess

engineering in particular have the greatest potential is in the design and opti-
mization of bioreactors for marine metabolite production. A variety of biore-
actor designs have been implemented, with varying degrees of success. The
Marine Enzymes 211
opportunity to produce new, bioactive structural analogs of known compounds

via manipulation of culture conditions presents marine biotechnologists with
a unique challenge for new bioproduct discovery. Innovations in media de-
velopment, bioreactor design, and transgenic production, coupled with effi-
cient downstream processing and product recovery, will be necessary to meet
the needs of both discovery and bulk production of novel marine bioprod-
ucts [192].
With the discovery of and increased research into extremophiles, the conven-
tional restrictions of low to moderate bioreactor temperatures and pressures
faced by engineers may be circumvented [193]. Running bioprocess systems
using marine hyperthermophiles poses interesting challenges such as biore-
actor design and manipulation of their products, high temperature bioreactor
operation, and corrosion of materials. Research in these areas examines the
biotechnological potential of marine extremophiles from a biochemical engin-
eering perspective [194].
Marine microorganisms often require special culture conditions such as
high hydrostatic pressure in the case of deep sea bacteria and an optimized pro-
duction medium for increased enzyme yield. They may also require an entirely
different kind of complex nutrient in the production medium, which may be
closer to the type of complex substances they are familiar with, unlike tradi-
tional sources such as soybean meal, corn steep liquor or molasses, or a chem-
ically defined medium with known inducers [195]. A halotolerant strain of
Bacillus licheniformis produced high protease activity during the early station-
ary phase of growth. The use of seawater in the production medium enhanced
the production of this activity by 150% [196]. A marine bacterium V. harveyi
was adapted to grow and produce extracellular proteases in a seawater/Zobell-
based medium, supplemented with skim milk under different hydrodynamic
conditions. The addition of skim milk to the Zobell medium enhanced the ex-
tracellular enzyme production fivefold. Specific growth rate increased as a con-
sequence of increasing agitation rates [197]. Keerthi et al. reported Beauveria
sp. isolated from marine sediment also produced extracellular L-glutaminase.
Maximal L-glutaminase yield was obtained in a medium supplemented with
yeast extract and sorbitol, sodium chloride, and methionine. This enzyme was
inducible and growth associated [198]. Pseudomonas pseudomelli produced
maximal chitinase activities during the late exponential and stationary phase
under submerged fermentation. Manganese significantly enhanced chitinase
production [199].
Immobilized cell technology has received the attention of marine biotech-
nologists. Cells from a marine bacterium, Teredinobacter turnirae, were immo-
bilized in calcium alginate beads and used for alkaline protease production.
There was no significant difference in the maximum protease activity between
the three bead sizes used. A drastic fall in protease production was observed
when the beads were treated with glutaraldehyde. The beads were used for eight
successive fermentation batches, each lasting 72 h. It was also observed by Elibol
and Moreira that there was an ∼ 3.5-fold increase in volumetric productivity of

protease after the fourth cycle [200]. A marine Pseudomonas sp. immobilized
by Ca-alginate gel entrapment was used for the production of extracellular L-
glutaminase under repeated batch process and continuous process employing
a packed bed reactor by Kumar and Chandrasekaran. In general, the volumetric
productivity increased with increased dilution rate and substrate concentra-
tions, and the substrate conversion efficiency declined [201].
Recently some investigations have been reported on the applications of solid
state fermentation (SSF) in marine bioprocessing. Prawn waste, a chitinous
solid waste of the shellfish processing industry, was used as a substrate for chiti-
nase production by the marine fungus Beauveria bassiana in a SSF culture. The
process parameters influencing SSF were optimized. The results indicate the
scope for the use of shellfish processing (prawn) waste for the industrial pro-
duction of chitinase by using SSF [202]. A chitinolytic fungus B. bassiana was
isolated from marine sediment, and significant process parameters influencing
chitinase production in SSF using wheat bran were optimized [203]. Process pa-
rameters influencing L-glutaminase production by marine V. costicola in SSF
using polystyrene as an inert support were optimized [204]. Extracellular L-
glutaminase production by Beauveria sp., isolated from marine sediment, was
observed during SSF using polystyrene as an inert support by Sabu et al. [205].
Results indicate the scope for the production of salt-tolerant L-glutaminase
using this marine fungus.
5
Conclusion
In the past decade, of the plentiful reports on enzymes from novel and exotic
sources few have reached the stage of commercial production. The problem lies
in providing the enzyme producers with the proper environmental conditions
of their ecological niches. Sustained production of the bioactive molecules by
novel molecular methods of gene cloning and expression and innovative biore-
actor designs like the so-called “niche-mimic” bioreactors [206] should play
a pivotal role. Marine enzyme biotechnology will be the focus of the industry in
the future. With mutual respect for each other’s commercial interests and intel-
lectual property rights, the biodiverse but resource-poor developing world and
the wealthy but bioresource-scarce developed world should join hands to un-
ravel the secrets of this unopened research treasure chest—the world’s oceans.
Acknowledgements Financial support through an ICMR Senior Research Fellowship to

Malay Saha and research grants (AICTE and DST, Government of India) to Joydeep Mukher-
jee are thankfully acknowledged.
Marine Enzymes 213
References
1. Ireland CM, Copp BR, Foster MD, McDonald LA, Radisky DC, Swersey JC (1993) Ma-
rine Biotechnology, Vol 1. In: Attaway DH, Zaborsky OR (eds) Pharmaceutical and
Bioactive Natural Products. Plenum, New York, pp 1–43
2. Zilinskas RA, Colwell RR, Lipton DW, Hill RT (1995) The global challenge of marine
biotechnology: a status report on the United States, Japan, Australia and Norway Mary-
land Sea Grant, College Park (MD), p 372
3. Colwell RR (2002) Biotechnol Adv 20:215
4. Grace ES (1997) Biotechnology in Seas and Trees, 6. In: Biotechnology Unzipped:
Promises and Realities, Natl Academies Press, Washington, DC, p 170
5. Wells W (1999) http://www.accessexcellence.org/
6. Deming JW (2002) Curr Opin Microbiol 5:301
7. Deming JW (1998) Curr Opin Biotechnol 9:283
8. Horikoshi K(1998) Curr Opin Microbiol 1:291
9. Michels PC, Clark DS (1997) Appl Environ Microbiol 63:3985
10. Dib R, Chobert JM, Dalgalarrondo M, Barbier G, Haertle T (1998) FEBS Lett 431:279
11. Chavez CP, Sako Y, Uchida A (1999) Extremophiles 3:3
12. Francesco C (2002) International Symposium on Natural Products from Marine Mi-
croorganisms. Greifswald, Germany
13. Legin E, Ladrat C, Godfroy A, Barbier G, Duchiron F (1997) Comptes Rendus de l’A-
cadémie des Sciences - Series III - Sciences de la Vie 320:893
14. Brown SH, Kelly RM (1993) Appl Environ Microbiol 59:2614
15. Gantelet H, Duchiron F (1998) Appl Microbiol Biotechnol 49:770
16. Huber R, Stöhr J, Hohenhaus S, Rachel R, Burggraf S, Jannasch HW, Karl O, Stetter KO
(1995) Arch Microbiol 164:255
17. Nishihara H, Miyashita Y, Aoyama K, Kodama T, Igarashi Y, Takamura Y (1997)
Biochem Biophys Res Commun 232:766
18. Mukhopadhyay B, Patel VJ, Wolfe RS (2000) Arch Microbiol 174:406
19. Roy R, Adams MWW (2002) J Bacteriol 184:6952
20. Soda K, Kazuoka T, Fukui Y, Oikawa T (2002) International Symposium on Natural
products from marine microorganisms, Greifswald, Germany
21. Irwin JA, Gudmundsson HM, Marteinsson VT, Hreggvidsson GO, Lanzetti AJ, Alfreds-
son GA, Engel PC (2001) Extremophiles 5:199
22. Irwin JA, Alfredsson GA, Lanzetti AJ, Gudmundsson HM, Engel PC (2001) FEMS Mi-
23. Kazuoka T, Masuda Y, Oikawa T, Soda K (2003) J Biochem (Tokyo) 133:51
24. Watanabe S, Takada Y, Fukunaga N (2001) Biosci Biotechnol Biochem 65:1095
25. Iyo AH, Forsberg CW (1999) Appl Environ Microbiol 65:995
26. Kammel U, Mennenga B, Hanschke R, Helmke E, Heinrich HW, Schweder T (2002)
International Symposium on Natural products from marine microorganisms, Greif-
swald, Germany
27. Feller G, Zekhnini Z, Lamotte-Brasseur J, Gerday C (1997) Eur J Biochem 244:186
28. Konisky J, Michels PC, Clark DS (1995) Appl Environ Microbiol 61:2762
29. Qureshi MH, Kato C, Horikoshi K (1998) Extremophiles 2:93
30. Greene RV, Griffin HL, Cotta MA (1995) Tektran, Agricultural Research Service, United
States Department of Agriculture, Washington, DC
31. Minic Z, Simon V, Penverne B, Gaill F, Hervé G (2001) J Biol Chem 276:23777
32. Minic Z, Pastra-Landis S, Gaill F, Hervé G (2003) J Biol Chem 278:40527
33. Cavanaugh CM, Wirsen CO, Jannasch HW (1992) Appl Environ Microbiol 58:3799
34. Turkiewicz M, Kur J, Bialkowska A, Cieslinski H, Kalinowska H, Bielecki S (2003)

Biomol Eng 20:317
35. Mohapatra BR (1997) Indian J Mar Sci 26:292
36. Mohapatra BR, Banerjee UC, Bapuji M (1998) J Biotechnol 60:113
37. Mohapatra BR, Bapuji M (1997) Lett Appl Microbiol 25:393
38. Mohapatra BR, Bapuji M (1998) J Appl Microbiol 84:393
39. Turkiewicz M, Gromek E, Kalinowska H, Zielinska M (1999) J Biotechnol 70:53
40. Dunlap PV, Callahan SM (1993) J Bacteriol 175:4615
41. Callahan SM, Cornell NW, Dunlap PV (1995) J Biol Chem 270:17627
42. Dhevendaran K, Annie K (1998) Indian J Mar Sci 28:335
43. Mohapatra BR, Sani RK, Banerjee UC (1996) Lett Appl Microbiol 21:380
44. Mohapatra BR, Bapuji M, Banerjee UC (1998) Cytobios 92:165
45. Sawabe T, Ohtsuka M, Ezura Y (1997) Carbohydr Res 304:69
46. Biotechnology for the 21st century: new horizons 5. Opportunities in marine biotech-
nology and aquaculture (1995) Reports prepared by Biotechnology Research Subcom-
mittee, Committee on Fundamental Science and National Science and Technology
Council, USA
47. Shibata M, Takahashi S, Sato R, Oda K (1997) Biosci Biotechnol Biochem 61:710
48. Obata H, Sugiyama A, Kawahara H, Muramatsu T (1997) Biosci Biotechnol Biochem
61:1102
49. Miyamoto K, Nukui E, Hirose M, Nagai F, Sato T, Inamori Y, Tsujibo H (2002) Appl
50. Rath J, Herndl GJ (1994) Appl Environ Microbiol 60:807
51. Arrieta JM, Herndl GJ (2001) Appl Environ Microbiol 67:4896
52. Arellano-Carbajal F, Olmos-Soto J (2002) World J Microbiol Biotechnol 18:791
53. Burtseva YV, Verigina NS, Sova VV, Pivkin MV, Zvyagintseva TN (2003) Mar Biotech-
nol 5:349
54. Arnosti C, Repeta DJ (1994) Appl Environ Microbiol 60:840
55. Tamaru Y, Araki T, Amagoi H, Mori H, Morishita T (1995) Appl Environ Microbiol
61:4454
56. Leon O, Quintana L, Peruzzo G, Slebe JC (1992) Appl Environ Microbiol 58:4060
57. Sugano Y, Terada I, Arita M, Noma M, Matsumoto T (1993) Appl Environ Microbiol
59:1549
58. Sugano Y, Kodama H, Terada I, Yamazaki Y, Noma M (1994) J Bacteriol 176:6812
59. Vera J, Alvarez R, Murano E, Slebe JC, Leon O (1998) Appl Environ Microbiol 64:4378
60. Kim BJ, Kim HJ, Ha SD, Hwang SH, Byun DS, Lee TH, Kong JY (1999) Biotechnol Lett
21:1011
61. Whitehead LA, Stosz SK, Weiner RM (2001) Cytobios 106:99
62. Tsujibo H, Yoshida Y, Miyamoto K, Imada C, Okami Y, Inamori Y (1992) Can J Micro-
biol 38:891
63. Svitil AL, Chadhain SMN, Moore JA, Kirchman DL (1997) Appl Environ Microbiol
63:408
64. Vaidya SY, Vala AK, Dube HC (2000) Indian J Mar Sci 29:336
65. Araki T, Tani S, Maeda K, Hashikawa S, Nakagawa H, Morishita T (1999) Biosci
Biotechnol Biochem 63:2017
66. D’Souza MBD, Nair S, Chandramohan D (2000) Indian J Mar Sci 29:48
67. Hauksson JB, Andrésson ÓS, Ásgeirsson B (2000) Enzyme Microb Technol 27:66
68. Brandão PFB, Bull AT (2003) Antonie Van Leeuwenhoek 84:89
69. Colonna S, Gaggero N, Richelmi C, Pasta P (1999) Trends Biotechnol 17:163
Marine Enzymes 215
70. Raghukumar C, D’Souza TM, Thorn RG, Reddy CA (1999) Appl Environ Microbiol
65:2103
71. Francis CA, Co EM, Tebo BM (2001) Appl Environ Microbiol 67:4024
72. Yang Q, Yang M, Pritsch K, Yediler A, Hagn A, Schloter M, Kettrup A (2003) Biotechnol
Lett 25:709
73. Chadd HE, Newman J, Mann NH, Carr NG (1996) FEMS Microbiol Lett 138:161
74. Hernandez-Saavedra NY, Ochoa JL (1999) Yeast 15:657
75. Tsugawa W, Horiuchi S, Tanaka M, Wake H, Sode K (1996) Appl Biochem Biotechnol
56:301
76. Tsugawa W, Ogasawara N, Sode K (1998) Enzyme Microb Technol 22:269
77. Besson S, Carneiro C, Moura JJG, Moura I, Fauque G (1995) Anaerobe 1:219
78. De Souza MP, Yoch DC (1995) Appl Environ Microbiol 61:21
79. De Souza MP, Yoch DC (1995) Appl Environ Microbiol 61:3986
80. Jansen M, Hansen TA (2000) J Sea Res 43:225
81. Ansede JH, Pellechia PJ, Yoch DC (2001) Appl Environ Microbiol 67:3134
82. Sakai T, Kimura H, Kojima K, Shimanaka K, Ikai K, Kato I (2003) Mar Biotechnol 5:380
83. Carpenter EJ, Bergman B, Dawson R, Siddiqui PJ, Soderback E, Capone DG (1992)
Appl Environ Microbiol 58:3122
84. Alaoui SE, Diez J, Humanes L, Toribio F, Partensky F, García-Fernández JM (2001) Appl
85. Stickforth P, Steiger S, Hess WR, Sandmann G (2003) Arch Microbiol 179:409
86. Laroche M, Ulber R (2002) International Symposium on Natural Products from Marine
Microorganisms, Greifswald, Germany
87. Kita K, Ishimaru K, Troika M, Yanase H, Kato N (1995) Appl Environ Microbiol 61:1727
88. Simpson H, Denis M, Malatesta F (1997) Biosci Rep 17:343
89. Barbeyron T, Potin P, Richard C, Collin O, Kloareg B (1995) Microbiology 141:2897
90. Ghosh D (2004) PhD Thesis, Jadavpur University, Kolkata, India
91. Nilsen IW, Overbo K, Sandsdalen E, Sandaker E, Sletten K, Myrnes B (1999) FEBS Lett
464:153
92. Gregersen F (2000) Norwegian Institute of Fisheries and Aquaculture (NIFA) Fiskeri-
forskning Info No. 3 July 2000
93. Nilsen IW, Myrnes B (2001) Gene 269:27
94. Arreguín R, Arreguín B, Soriano-García M, Hernández-Arana A, Rodríguez-Romero A
(1993) FEBS Lett 320:235
95. Krasko A, Gamulin V, Seack J, Steffen R, Schroder HC, Muller WE (1997) Mol Mar Biol
Biotechnol 6:296
96. Sivakumar P, Sampath P, Chandrakasan G (1999) Comp Biochem Physiol B Biochem
Mol Biol 123:273
97. Munilla-Morán R, Saborido-Rey F (1996) Comp Biochem Physiol B Biochem Mol Biol
113:827
98. Mora P, Fournier D, Narbonne J (1999) Comp Biochem Physiol C Pharmacol Toxicol
Endocrinol 122:353
99. Lushchak VI, Smirnova YD, Storey KB (1998) Comp Biochem Physiol B Biochem Mol
Biol 119:611
100. Lucu C, Devescovi M, Skaramuca B, Kozul V (2000) J Exp Mar Biol Ecol 246:163
101. Frost GI, Csoka T, Stern R (1996) Trends Glycosci Glycotechnol 8:419
102. Reintamm T, Lopp A, Kuusksalu A, Pehk T, Kelve M (2003) Eur J Biochem 270:4122
103. Shigeta S, Suzuki O, Aki Y, Kawamoto S, Ono K (2000) J Biosci Bioeng 89:84
104. Saborowski R, Buchholz F (2002) Mar Biol 140:557
105. Noguchi K, Ishikawa K, Yokoyama K, Ohtsuka T, Nio N, Suzuki E (2001) J Biol Chem
276:12055
106. Angelucci S, Sacchetta P, Moio P, Melino S, Petruzzelli R, Gervasi PG, Di Ilio C (2000)
Arch Biochem Biophys 373:435
107. MacDonald JA, Storey KB (1999) Mar Biol 133:193
108. Chen YP, Woodin SA, Lincoln DE, Lovell CR (1996) J Biol Chem 271:4609
109. Birmelin C, Pipe RK, Goldfarb PS, Livingstone DR (1999) Mar Biol 135:65
110. Novi S, Pretti C, Cognetti AM, Longo V, Marchetti S, Gervasi PG (1998) Aquat Toxicol
41:63
111. Rengasamy A, Munusamy A, Periasamy M (1997) Develop Comp Immunol 21:1
112. Kazeto Y, Adachi S, Yamauchi K (2001) Gen Comp Endocrinol 122:109
113. Ali SA, Alam JM, Stoeva S, Schütz J, Abbasi A, Zaidi ZH, Voelter W (1999) Toxicon
37:1505
114. Liu DL, Walden CC (1997) Fish Res Bd Canada 27:1141
115. Moore RM, Webb M, Tokarczyk R, Wever R (1996) J Geophys Res 101:899
116. Ohsawa N, Ogata Y, Okada N, Itoh N (2001) Phytochemistry 58:683
117. Martinez JS, Carroll GL, Tschirret-Guth RA, Altenhoff G, Little RD, Butler A (2001)
J Am Chem Soc 123:3289
118. Touchette BW, Burkholder J (2001) Plant Physiol Biochem 39:583
119. Ueno Y, Kurano N, Miyachi S (1999) FEBS Lett 443:144
120. Morishita H, Ohashi S, Oku T, Nakajima Y, Kojima S, Ryufuku M, Nakamura H,
Ohmiya Y (2002) Photochem Photobiol 75:311
121. Deng T, Roenneberg T (2002) Naturwissenschaften 89:171
122. Matsubara K, Hori K, Matsuura Y, Miyazawa K (2000) Comp Biochem Physiol B
Biochem Mol Biol 125:137
123. Gupta A, Vijayaraghavan MR, Gupta R (1998) Phytochemistry 49:1875
124. Muramatsu Y, Harada A, Ohwaki Y, Kasahara Y, Takagi S, Fukuhara T (2002) Plant Cell
Physiol 43:1137
125. Fan C, Glibert PM, Alexander J, Lomas MW (2003) Mar Biol 142:949
126. Satoh D, Hiraoka Y, Colman B, Matsuda Y (2001) Plant Physiol 126:1459
127. Wise ML, Rorrer GL, Polzin JJ, Croteau R (2002) Arch Biochem Biophys 400:125
128. Maurin C, Gal YL (1997) Plant Sci 122:61
129. Pichard SL, Campbell L, Paul JH (1997) Appl Environ Microbiol 63:3600
130. Zheng W, Wise ML, Wyrick A, Metz JG, Yuan L, Gerwick WH (2002) Arch Biochem
Biophys 401:11
131. Krasko A, Lorenz B, Bate R, Schröder HC, Müller IM, Müller WE (2000) Eur J Biochem
267:4878
132. Pace NR (1997) Science 276:734
133. Short JM (1997) Nat Biotechnol 15:1322
134. DeLong EF (2002) Curr Opin Microbiol 5:520
135. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA
(1988) Science 239:487
136. Giovannoni SJ, Britschgi TB, Moyer CL, Field KG (1990) Nature 345:60
137. Braker G, Zhou J, Wu L, Devol AH, Tiedje JM (2000) Appl Environ Microbiol 66:2096
138. Grüntzig V, Nold SC, Zhou J, Tiedje JM (2001) Appl Environ Microbiol 67:760
139. Scala DJ, Kerkhof LJ (1999) Appl Environ Microbiol 65:1681
140. Zehr JP, Mellon MT, Zani S (1998) Appl Environ Microbiol 64:3444
141. Mehta MP, Butterfield DA, Baross JA (2003) Appl Environ Microbiol 69:960
142. Bano N, Hollibaugh JT (2000) Appl Environ Microbiol 66:1960
143. Nold SC, Zhou J, Devol AH, Tiedje JM (2000) Appl Environ Microbiol 66:4532
Marine Enzymes 217
144. Buchan A, Neidle EL, Moran MA (2001) Appl Environ Microbiol 67:5801
145. Hedlund BP, Geiselbrecht AD, Bair TJ, Staley JT (1999) Appl Environ Microbiol 65:251
146. Geiselbrecht AD, Hedlund BP, Tichi MA, Staley JT (1998) Appl Environ Microbiol
64:4703
147. Cottrell MT, Wood DN, Yu L, Kirchman DL (2000) Appl Environ Microbiol 66:1195
148. Svitil AL, Kirchman DL (1998) Microbiology 144:1299
149. Cottrell MT, Moore JA, Kirchman DL (1999) Appl Environ Microbiol 65:2553
150. Collier JL, Brahamsha B, Palenik B (1999) Microbiology145:447
151. Wiens M, Koziol C, Batel R, Müller WE (1999) Mar Biotechnol 1:191
152. Borriss M, Hanschke R, Helmke E, Heinrich H, Schweder T (2002) International Sym-
posium on Natural Products from Marine Microorganisms, Greifswald, Germany
153. Sakamoto T, Inoue-Sakamoto K, Bryant DA (1999) J Bacteriol 181:7363
154. Schleper C, Swanson RV, Mathur EJ, DeLong EF (1997) J Bacteriol 179:7803
155. Zhang CX, Suzuki S (2003) Arch Virol 148:745
156. Elsaied H, Naganuma T (2001) Appl Environ Microbiol 67:1751
157. Tsujibo H, Orikoshi H, Tanno H, Fujimoto K, Miyamoto K, Imada C, Okami Y, In-
amori Y (1993) J Bacteriol 175:176
158. Tsujibo H, Orikoshi H, Shiotani K, Hayashi M, Umeda J, Miyamoto K, Imada C,
Okami Y, Inamori Y (1998) Appl Environ Microbiol 64:472
159. Bendt A, Hüller H, Kammel U, Helmke E, Schweder T (2001) Extremophiles 5:119
160. Lonhienne T, Mavromatis K, Vorgias CE, Buchon L, Gerday C, Bouriotis V (2001)
161. Tsujibo H, Orikoshi H, Baba N, Miyahara M, Miyamoto K, Yasuda M, Inamori Y (2002)
Appl Environ Microbiol 68:263
162. Orikoshi H, Baba N, Nakayama S, Kashu H, Miyamoto K, Yasuda M, Inamori Y, Tsu-
jibo H (2003) J Bacteriol 185:1153
163. Tsujibo H, Fujimoto K, Tanno H, Miyamoto K, Imada C, Okami Y, Inamori Y (1994)
Gene 146:111
164. Tamaru Y, Arakia T, Morishita T, Kimura T, Sakka K, Ohmiya K (1997) J Ferment Bio-
eng 83:201
165. Politz O, Krah M, Thomsen KK, Borriss R (2000) Appl Microbiol Biotechnol 53:715
166. Yernool DA, McCarthy JK, Eveleigh DE, Bok J (2000) J Bacteriol 182:5172
167. Ma P, Sivaloganathan B, Reddy PK, Chan WK, Lam TJ (2001) Mar Biotechnol 3:463
168. Lluisma AO, Ragan MA (1998) Curr Genet 34:105
169. Miyamoto K, Tsujibo H, Nukui E, Itoh H, Kaidzu Y, Inamori Y (2002) Biosci Biotechnol
Biochem 66:416
170. Hernandez-Saavedra NY, Romero-Geraldo R (2001) Yeast 18:1227
171. Hernandez-Saavedra NY (2003) Yeast 20:479
172. Lluisma AO, Ragan MA (1998) Curr Genet 34:112
173. Ohshima T, Sakuraba H (2002) International Symposium on Natural Products from
Marine Microorganisms, Greifswald, Germany
174. Kita K, Mashiba S, Nagita M, Ishimaru K, Okamoto K, Yanase H, Kato N (1997)
Biochim Biophys Acta 1352:113
175. Araki T, Hashikawa S, Morishita T (2000) Appl Environ Microbiol 66:1741
176. Okazaki F, Tamaru Y, Hashikawa S, Li Y, Araki T (2002) J Bacteriol 184:2399
177. Jaeger S, Schmuck R, Sobek H (2000) Extremophiles 4:115
178. Teo JWP, Suwanto A, Poh CL (2000) Antimicrob Agents Chemother 44:1309
179. Xu B, Janson JC, Sellos D (2001) Eur J Biochem 268:3718
180. Furusato M, Sueyoshi N, Mitsutake S, Sakaguchi K, Kita K, Okino N, Ichinose S,
Omori A, Ito M (2002) J Biol Chem 277:17300
181. Kang NY, Choi YL, Cho YS, Kim BK, Jeon BS, Cha JY, Kim CH, Lee YC (2003) Biotech-
nol Lett 25:1165
182. Seack J, Kruse M, Isabel M, Müller IM, Müller WE (1999) Biochim Biophys Acta
1444:241
183. Purcarea C, Herve G, Ladjimi MM, Cunin R (1997) J Bacteriol 179:4143
184. Laue BE, Nelson DC (1994) J Bacteriol 176:3723
185. Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS (2000) Chem Biol
7:943
186. Bae YM, Hastings JW (1994) Biochim Biophys Acta 1219:449
187. D’Marco P, Moradas-Ferreira P, Higgins TP, McDonald I, Kenna EM, Murrell JC (1999)
188. Irwin JA, Lynch SV, Coughlan S, Baker PJ, Gudmundsson HM, Alfredsson GA, Rice DW,
Engel PC (2003) Extremophiles 7:135
189. Nakayama Y, Hayashi M, Unemoto T (1998) FEBS Lett 422:240
190. Purcarea C, Hervé G, Cunin R, Evans DR (2001) Extremophiles 5:229
191. Ikegami A, Nakasone K, Kato C, Nakamura Y, Yoshikawa I, Usami R, Horikoshi K
(2000) FEMS Microbiol Lett 192:91
192. Pomponi SA (1998) The Potential for the Marine Biotechnology Industry. Harbor
Branch Oceanographic Institution, Florida; Trends and Future Challenges for US Na-
tional Ocean and Coastal Policy, vol 101
193. Wright PC, Stevenson C, McEvoy E, Burgess JG (1999) J Biotechnol 70:343
194. Bustard M, Burgess JG, Meeyoo V, Wright PC (2000) J Chem Technol Biotechnol
75:1095
195. Chandrasekaran M (1997) J Mar Biotechnol 5:86
196. Manachini PL, Fortina MG (1998) Biotechnol Lett 20:565
197. César EB, Facundo MR (2003) World J Microbiol Biotechnol 19:129
198. Keerthi TR, Suresh PV, Sabu A, Kumar SR, Chandrasekaran M (1999) World J Micro-
biol Biotechnol 15:751
199. Suresh PV, Sindhu R, Chandrasekaran M (1995) National symposium on relevance of
biotechnology in industry, Cochin, India
200. Elibol M, Moreira AR (2003) Process Biochem 38:1445
201. Kumar SR, Chandrasekaran M (2003) Process Biochem 38:1431
202. Suresh PV, Chandrasekaran M (1998) World J Microbiol Biotechnol 14:655
203. Suresh PV, Chandrasekaran M (1999) Process Biochem 34:257
204. Prabhu GN, Chandrasekaran M (1997) Process Biochem 32:285
205. Sabu A, Keerthi TR, Kumar SR, Chandrasekaran M (2000) Process Biochem 35:705
206. Yan L, Boyd KG, Adams DR, Burgess JG (2003) Appl Environ Microbiol 69:3719
DOI 10.1007/b135786
Extreme Environments as a Resource for Microorganisms

and Novel Biocatalysts
Garabed Antranikian1 (u) · Constantinos E. Vorgias2 · Costanzo Bertoldo1
1 Instituteof Technical Microbiology, Technical University Hamburg-Harburg,
Kasernenstraße 12, 21073 Hamburg, Germany
antranikian@tuhh.de
2 Faculty of Biology, Department of Biochemistry and Molecular Biology,
National and Kapodistrian University of Athens, Panepistimiopolis-Zographou,

157 84 Athens, Greece
cvorgias@biol.uoa.gr
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220
2 Extreme environments as a resource of unique genes and biocatalysts . . 222

2.1 Low-temperature-adapted microorganisms . . . . . . . . . . . . . . . . . . 224
2.2 Microorganisms that grow at elevated temperatures . . . . . . . . . . . . . 224
2.3 Life at extremes of pH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
2.4 High-salt-tolerant microorganisms . . . . . . . . . . . . . . . . . . . . . . . 227
3 Cellulases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
4 Xylan-degrading enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
5 Pectin-degrading enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . 232
6 Chitin-degrading enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . 234
7 Starch-processing enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . 235

7.1 Heat-stable amylases, glucoamylases and α-glucosidases . . . . . . . . . . . 235
7.2 Thermoactive pullulanase and CGTase . . . . . . . . . . . . . . . . . . . . 238
8 Proteolytic enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241
9 Lipases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
10 Glucose isomerases, alcohol dehydrogenases and esterases . . . . . . . . . 244
11 Amidases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 248
12 DNA-processing enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249

12.1 Polymerase chain reaction (PCR) . . . . . . . . . . . . . . . . . . . . . . . 249
12.2 DNA sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
12.3 Ligase chain reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 252
13 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
220 G. Antranikian et al.
Abstract The steady increase in the number of newly isolated extremophilic microor-
ganisms and the discovery of their enzymes by academic and industrial institutions
underlines the enormous potential of extremophiles for application in future biotech-
nological processes. Enzymes from extremophilic microorganisms offer versatile tools
for sustainable developments in a variety of industrial application as they show im-
portant environmental benefits due to their biodegradability, specific stability under
extreme conditions, improved use of raw materials and decreased amount of waste
products. Although major advances have been made in the last decade, our knowledge
of the physiology, metabolism, enzymology and genetics of this fascinating group of
extremophilic microorganisms and their related enzymes is still limited. In-depth in-
formation on the molecular properties of the enzymes and their genes, however, has
to be obtained to analyze the structure and function of proteins that are catalytically
active around the boiling and freezing points of water and extremes of pH. New tech-
niques, such as genomics, metanogenomics, DNA evolution and gene shuffling, will
lead to the production of enzymes that are highly specific for countless industrial ap-
plications. Due to the unusual properties of enzymes from extremophiles, they are
expected to optimize already existing processes or even develop new sustainable tech-
nologies.
Keywords Extremophiles · Stable biocatalysts · Thermophiles · Extremes of pH ·

Psychrophiles · Enantioselectivity
1
Introduction
Extremophiles are unique microorganisms that are adapted to survive in

ecological niches such as high or low temperatures, extremes of pH, high
salt concentrations and high pressure. Accordingly biological systems and
enzymes can even function at temperatures between – 5 and 130 ◦ C, pH 0–
12, salt 3–35% and 1000 bar. The majority of the organisms that grow
in these extreme environments belong to a group with distinct charac-
teristics. Carl Woese named this group archaea, and postulated the ar-
chaea as the third domain of life on earth, different form bacteria and
eukarya [1, 2]. A large number of these unique microorganisms have been
isolated from marine environments (Table 1). In many cases microbial bio-
catalysts, especially of extremophiles, are superior to traditional catalysts,
because they allow the performance of industrial processes even under
harsh condition, under which conventional proteins are completely dena-
tured. By virtue of their positive properties, stability, specificity, selectivity
and efficiency, enzymes already occupy a prominent position in modern
biotechnology. For many processes in the chemical and pharmaceutical in-
dustries, suitable microbial enzymes can be found that have the potential
to optimize or even replace chemical processes. By using robust enzymes
in biotechnical processes one is often able to better utilize raw materials,
minimize pollutant emissions and reduce energy consumption while sim-
Extreme Environments as a Resource for Microorganisms and Novel Biocatalysts 221
Table 1 Some representatives of microorganisms living under extreme conditions
Microbial life at various temperatures Optimal growth

(◦ C)
Phychrophiles
Vibrio sp < 20 ◦ C
Micrococcus criophilus < 20 ◦ C
Arthrobacter glacialis < 20 ◦ C
Vibrio psychroerythreus < 20 ◦ C
Aquaspirillum articum < 20 ◦ C
Moderate thermophiles (50–60 ◦ C)
Bacillus acidocaldarius 50
Bacillus stearothermophilus 55
Extreme thermophiles (60–80 ◦ C)
Thermus aquaticus 70
Thermoanaerobacter ethanolicus 65
Clostridium thermusolfurogenes 60
Fervidobacterium pennivorans 75
Hyperthermophiles (80–110 ◦ C)
Thermotoga maritima 90
Aquifex pyrophilus 85
Archeoglobus fulgidus 83
Methanopyrus kandleri 88
Sulfolobus sulfataricus 88
Thermococcus aggregans 88
Pyrobaculum islandicum 100
Pyrococcus furiosus 100
Pyrodictium occultum 105
Pyrolobus fumarii 106
ultaneously improving quality and purity of products, e.g. optically pure

compounds. The additional benefits in performing industrial processes at
high temperature include reduced risk of contamination, improved trans-
fer rates, lower viscosity and higher solubility of substrates. The recent
exciting results in the field of extremophile research, the high demands
of the biotechnology industries for tailor-made novel biocatalysts and the
simultaneous rapid development of new techniques will stimulate the de-
velopment of innovative processes on the basis of biocatalyst from ex-
tremophiles.
Table 1 (continued)
Microbial life at various temperatures Optimal growth conditions

and pH Temperature pH
Acidophilic microorganisms
Sarcina ventriculi 37 4.0
Thiobacillus ferrooxidans 37 2.5
Alyciclobacillus acidocaldarius 55 2.0–6.0
Picrophilus oshimae 60 0.7
Picrophilus torridus 60 0.7
Thermoplasma acidophilum 60 2.0
Sulfolobus acidocaldarius 75 2.5
Acidianus infernus 75 2.0
Alkaliphilic microorganisms
Anaerobranca gottschallki 60 9.5
Thermococcus alcaliphilus 85 9.0
Thermococcus acidoaminivorans 85 9.0
Range of NaCl concentration in M
required for growth (optimum)
Halophilic microorganisms
Dunaliella spp. 0.3–5.0
Clostridium halophilum 0.15–6.0 (0.6)
Haloanaerobium praevalens 0.8–4.3 (2.2)
Halobacterium denitrificans 1.5–4.5 (2.5)
Haloferax vulcanii 1.0–3.0 (1.5)
2
Extreme environments as a resource of unique genes and biocatalysts
Modern biotechnology has a steadily increasing demand for novel enzymes.

The classical approach to the isolation of new or improved biocatalysts re-
quires that the different microorganisms derived from an environmental
sample be cultured on an appropriate growth medium and separated until in-
dividual colonies are isolated. The enzymes and the corresponding genes are
then recovered from the identified microorganism. This value of the classical
method is substantial but it fails, however, to represent the scope of microbial
diversity in nature, since only a small proportion (1–3%) of viable microor-
ganisms in a sample have to date been recovered by culturing techniques. To
explore the diversity and the potential of microbial communities a method
was developed to analyze DNA in environmental samples that bypasses clas-
sical cultivation techniques [3]. Collectively, the term metagenome indicates
the genome of the total microbiota found in nature and contains vastly more
genetic information than is contained in the cultivable subset. Hence, the
construction of metagenomic libraries by direct extraction and cloning large

fragments of DNA isolated directly from microbes in natural environments
has represented an effective way of accessing the wealth of information of
microbial mixed populations. This method circumvents the loss of major por-
tions of the microbial communities in extreme environments, which derives
from the different growth requirements of the different microbes. Several dif-
ferent laboratories have successfully isolated novel genes encoding different
enzymes and secondary metabolites from microbial communities and their
metagenomes without cultivation of the microbes [4]. The microbial niches
studied were highly diverse and ranged from moderate environments, such
as river soil [4], to extreme environments, such as the deep sea [5–9]. Stud-
ies have shown that the metagenomic approach offers a valuable pool for
encountering novel genes encoding biotechnologically relevant gene prod-
ucts such as lipase [10] cellulases [11], amylases [12], chitinases [13, 14], and
esterases [10]. Rondon et al. [15, 16] used a bacterial artificial chromosome
(BAC) vector to express Bacillus cereus genomic DNA. The advantage of BAC
vectors is that they maintain very large DNA inserts (greater than 100 kb)
stably in E. coli, facilitating the cloning of large fragments of DNA. Their re-
sults demonstrated that expression of heterologous DNA from B. cereus in
an E. coli BAC system was detectable at a reasonable frequency, validating
the idea that the low-copy BAC vector (one to two per cell) could be used
to express foreign DNA from foreign promoters in E. coli [15, 16]. However,
a major difficulty associated with exploiting the metagenome directly from
the environment is related to contamination of purified DNA with polyphe-
nolic compounds that are copurified with the DNA. These compounds are
difficult to remove, and it is well known that polyphenols also interfere with
enzymatic modifications of isolated DNA [17, 18]. As a result, construction of
environmentally derived DNA libraries with large inserts is hindered due to
the poor quality of the isolated DNA. These known difficulties associated with
the construction of libraries directly derived from environmental DNA sam-
ples forced researchers to isolate DNA from the metagenome of a microbial
community after precultivation in the laboratory [19]. This technique, though
it limits the biodiversity of laboratory enrichment cultures, has proven to be
highly efficient for rapid isolation of large DNA fragments and for cloning of
operons and genes with great biotechnological value. For example, Voget et
al. [20] exploited the metagenome of an enrichment culture on agar plates
for isolation of genes encoding a variety of different biocatalysts, including
β-agarases, amylolytic enzymes, cellulases, lipases and many other enzymes
with high biotechnological potential. Given the immense uncultivated and
uncharacterized metabolic diversity in the environment, one would need to
sequence a relatively restricted number of clones to discover fundamentally
interesting sets of genes. However, this approach relies on the fortuitous ex-
pression of heterologous DNA by the library host strain. Although the speed
and effectiveness of brute-force sequencing are constantly improving, it is not
yet practical to assemble a complete bacterial genome from a metagenome.

There is still a need for new functional genomic approaches that systemati-
cally yield information about many of the elements in a metagenomic library.
If modern genomic techniques can be used to carry out more comprehensive
surveys of metagenomic libraries, the understanding of natural genetic diver-
sity would be greatly enhanced [21]. This technology has been established by
various biotechnological industries such as Diversa in San Diego and B.r.a.i.n.
in Germany. By applying a high-throughput system (HTS) extreme environ-
ments have been studied for the production of stable enzymes.
2.1
Low-temperature-adapted microorganisms
The Earth’s biosphere is predominantly aqueous and cold. Nearly 70% is wa-
ter and a high percentage of it seldom reaches temperatures above 5 ◦ C. The
polar region provides a permanently cold environment that is surrounded
by an aquatic belt of melting ice. Microorganisms able to grow at tempera-
tures close to 0 ◦ C have developed various adaptation mechanisms to survive
and function at low temperature. These microorganisms can be divided into
two main groups: psychrophiles and psychrotolerants. Psychrophilic microor-
ganisms grow at an optimum temperature of 15 ◦ C, with a maximum growth
temperature at about 20 ◦ C and a minimum around 0 ◦ C. Psychrotolerant
microorganisms generally do not grow at zero but do so at 3–5 ◦ C, and
have optimum and maximum growth temperatures above 20 ◦ C but less than
30 ◦ C [22]. Most of the cold-adapted microorganisms have been character-
ized from Arctic and Antarctic seawater and, despite the harsh conditions,
the density of bacterial cells in the Antarctic oceans is as high as the dens-
ity reported in temperate waters (Table 1). Psychrophiles can be found in
permanently cold environments such as the deep sea, glaciers, and moun-
tain regions, in soils, in fresh or saline waters associated with cold-blooded
animals such as fish or crustaceans. In general, cold-adapted enzymes have
higher specific activity at low and moderate temperatures than that of their
mesophilic counterparts, and are inactivated easily by a slight increase in
temperature [23, 24].
2.2
Microorganisms that grow at elevated temperatures
Microorganisms capable of growing optimally at temperatures between 50

and 60 ◦ C are designated as moderate thermophiles (Table 1). Most of these
microorganisms belong to many different taxonomic groups of eu- and
prokaryotic microorganisms such as protozoa, fungi, algae, streptomycetes
and cyanobacteria, which comprise mainly mesophilic species. It can be as-
sumed that moderate thermophiles, which are closely related phylogenetically
to mesophilic organisms, may be secondarily adapted to life in hot environ-

ments. Extreme thermophiles, which grow optimally between 60 and 80 ◦ C,
are widely distributed among the genera Bacillus, Clostridium, Thermoanaer-
obacter, Thermus, Fervidobacterium, Thermotoga and Aquifex. The relative
abundance of archaea and bacteria in high-temperature environments was,
until recently, mainly studied by cultivation-based techniques. Because of the
frequent isolation of archaea from these habitats, it was assumed that ar-
chaea dominate the high-temperature biotopes. Recently, the application of
molecular-biological methods revealed that bacterial communities are also
abundant in these environments. These results suggest that archaea may gen-
erally be of lower abundance in hot environments than could be assumed
from cultivation-based experiments. However, the factors that allow bacteria
to dominate in high-temperature habitats, that were once believed to be the
realm of archaea, remain unknown [25, 26].
Microorganisms that are adapted to grow optimally at very high tem-
peratures (80–108 ◦ C) have been isolated from high-temperature terres-
trial and marine habitats. The most common biotopes are volcanically and
geothermal-heated hydrothermal vent systems such as solfataric fields, neu-
tral hot springs, and submarine hot vents. Submarine hydrothermal systems
are situated at shallow and abyssal depth. They consist of hot fumaroles,
springs, sediments, and deep-sea vents with temperatures of up to 400 ◦ C
(“black smokers”) [27]. Because of their ability to convert volcanic gases and
sulphur compounds at high temperatures, hyperthermophilic communities
living in such hydrothermal vents are expected to play an important role in
marine ecological, geochemical and volcanic processes [28]. Shallow as well
as deep-sea hydrothermal systems harbour members of various genera in-
cluding Pyrococcus, Pyrodictium, Igneococcus, Thermococcus, Methanococcus,
Archaeoglobus and Thermotoga. So far, members of the genus Methanopy-
rus have been found only at greater depths, whereas Aquifex was isolated
exclusively from shallow hydrothermal vents. Recently, interesting biotopes
of extreme and hyperthermophiles were discovered in deep, geothermally
heated oil reservoirs around 3500 m below the bed of the North Sea and the
permafrost soil of North Alaska [29]. Interestingly, the majority of the hy-
perthermophiles isolated to date belong to the archaeal domain of life and
no eukaryotic organism has been found that can grow at the boiling point of
water. A 16S rDNA-based universal phylogenetic tree shows a tripartite di-
vision of the living world consisting of the domains Bacteria, Archaea and
Eukarya [1, 30].
2.3
Life at extremes of pH
Solfataric fields are the most important biotopes of microorganisms that pre-
fer to live under both thermophilic and acidic conditions. Solfataric soils con-
sist of two different layers that can be easily distinguished by their character-
istic colours: the upper, aerobic layer has an ochre colour due to the presence
of ferric iron. The layer below, which is anaerobic, appears rather blackish-
blue owing to the presence of ferrous iron. Thermophilic acidophiles, belong-
ing to the genera Sulfolobus [31, 32], Acidianus [33], Thermoplasma [34], and
Picrophilus [35], with growth optima between 60 and 90 ◦ C and pH 0.7–5.0
are commonly found in the aerobic upper layer, whereas slightly acidophilic
or neutrophilic anaerobes such as Thermoproteus tenax or Methanother-
mus fervidus can be isolated from the lower layer. Species of Thermoplasma
(growth optima: pH 2.0 and 60 ◦ C) have been found in hot springs, solfa-
taras and coal refuse piles [36]. Their closest known phylogenetic relatives,
also found in solfataras, are species of the genus Picrophilus, which are so far
the most extreme acidophiles, with growth close to pH 0. Picrophilus oshimae
and P. torridus are both aerobic, heterotrophic archaea that grow optimally at
60 ◦ C and pH 0.7 and utilize various polymers such as starch and proteins as
carbon source (Table 1) [37, 38].
Members of the genus Sulfolobus are strict aerobes growing either au-
totrophically, heterotrophically or facultative heterotrophically. During au-
totrophic growth, S0 , S2– and H2 are oxidized to sulphuric acid or water as
end products. Sulfolobus metallicus [39–42] and S. brierley [43] are able to
grow by oxidation of sulfidic ores. A dense biofilm of these microorganisms
is responsible for the microbial ore leaching process, in which heavy-metal
ions such as Fe2+ , Zn2+ and Cu2+ are solubilized. Other thermoacidophiles
have been affiliated to the genera Metallosphaera (growth range: 50–80 ◦ C,
pH 1–4.5) [44], Acidianus (growth range: 60–95 ◦ C, pH 1.5–5) [33] and Sty-
gioglobus (growth range: 57–90 ◦ C, pH 1–5.5).
The alkaliphiles that grow at high pH values are widely distributed
throughout the world. They have been found in carbonate-rich springs and
alkaline soils, where the pH can be around 10.0 or even higher, although
the internal pH is maintained around 8.0. In such places, several species
of cyanobacteria and Bacillus are normally abundant and provide organic
matter for diverse groups of heterotrophs [45]. Alkaliphiles require alkaline
environments and sodium ions not only for growth but also for sporulation
and germination. Sodium-ion-dependent uptakes of nutrients have been re-
ported in alkaliphiles. Many alkaliphiles require various nutrients for growth;
few alkaliphilic Bacillus strains can grow in simple minimal media containing
glycerol, glutamic acid, and citric acid [46]. In general, cultivation tempera-
ture is in the range of 20–55 ◦ C. Furthermore, many haloalkaliphiles isolated
from alkaline hypersaline lakes can grow in alkaline media containing 20%
NaCl. The soda lakes in the Rift Valley of Kenya and similar lakes found in
a few other places on earth are highly alkaline with pH values between 11.0 or
12.0 and represent a typical habitat where alkaliphilic microorganisms can be
isolated [47]. Thermophilic anaerobic spore-forming alkaliphiles, thermoal-
kaliphilic Clostridia, were isolated from sewage plants [48]. Very recently,
two thermoalkaliphilic bacteria, Anaerobranca gottschalkii and Anaerobranca

horikoshii have been isolated from Lake Bogoriae in Kenya and from Yellow-
stone National Park, respectively [49, 50] (Table 1). The new isolates represent
a new line within the Clostridium/Bacillus subphylum. The two archaeal
thermoalkaliphiles identified to date are Thermococcus alcaliphilus [51] and
Thermococcus acidoaminivorans [52], both growing at 85 ◦ C and pH 9.0.
2.4
High-salt-tolerant microorganisms
The halophiles comprise Bacteria and Archaea that grow optimally at NaCl
concentrations above that of seawater (> 0.6 M NaCl). In general, halophilic
microorganisms are classified as moderate halophiles if they can grow at salt
concentrations between 0.85 and 1.7 M NaCl and as extreme halophiles if
they require NaCl concentrations above 1.7 M for growth. Halophiles have
been mainly isolated from saline lakes, such as the Great Salt Lake in Utah
(salinity > 2.6 M) and from evaporated lagoons and coastal salterns with NaCl
concentrations between 1 and 2.6 M [53, 54]. The term “halobacteria” refers
to the red-pigmented extremely halophilic Archaea, members of the fam-
ily Halobacteriaceae, and the only family in the order Halobacteriales (15).
Most halobacteria require 1.5 M NaCl to grow and retain the structural in-
tegrity of the cell. Halobacteria can be distinguished from halophilic bacteria
by their archaeal characteristic, in particular the presence of ether-linked
lipids [55]. Most halobacteria are colored red or orange due to the presence
of carotenoids, but some species are colourless. Halobacteria are the most
halophilic organisms known so far and form the dominant microbial popu-
lation when hypersaline waters approach saturation [56, 57] (Table 1).
3
Cellulases
Due to the harsh living conditions extremophiles are interesting source of sta-
ble biocatalysts. Thermostable cellulases active towards crystalline cellulose
are of great biotechnological interest. Cellulose is the most abundant organic
biopolymer in nature since it is the structural polysaccharide of the cell wall
in the plant kingdom. It consists of glucose units linked by β-1,4-glycosidic
bonds with a polymerization grade of up to 15 000 glucose units in a linear
mode. The minimal molecular weight of cellulose from different sources has
been estimated to vary from about 50 000 to 2 500 000 in different species,
which is equivalent to 300 to 15 000 glucose residues. Although cellulose
has a high affinity to water, it is completely insoluble in it. Natural cellu-
lose compounds are structurally heterogeneous and have both amorphous
and highly ordered crystalline regions. The degree of crystallinity depends
on the source of the cellulose and the higher crystalline regions are more
resistant to enzymatic hydrolysis. Cellulose can be hydrolyzed into glucose
by the synergistic action of at least three different enzymes: endoglucanase
(cellulase), exoglucanase (cellobiohydrolase) and β-glucosidase (cellobiase).
Endoglucanase (E.C. 3.2.1.4) hydrolyzes cellulose in a random manner as
endo-hydrolase producing various oligosaccharides, cellobiose and glucose.
Exoglucanases (EC 3.2.1.91) hydrolyze β-1,4 D-glycosidic linkages in cellu-
lose and cellotetraose, releasing cellobiose from the non-reducing end of the
chain. β-Glucosidases (EC 3.2.1.21) catalyze the hydrolysis of terminal, non-
reducing β-D-glucose residues releasing β-D-glucose.
Several cellulose-degrading enzymes from various thermophilic organ-
isms have been investigated (Table 2). A thermostable cellulase from Ther-
motoga maritima MSB8 has been characterized [58]. The enzyme is rather
small, with a molecular weight (MW) of 27 kDa, and it is optimally active
at 95 ◦ C and between pH 6.0 and 7.0 [59]. Two thermostable cellulases, CelA
and CelB, with optimal activity between 95 ◦ C and 106 ◦ C, were purified
from Thermotoga neapolitana [60]. Cellulase and hemicellulase genes have
been found clustered together on the genome of the thermophilic anaerobic
bacterium Caldocellum saccharolyticum, which grows on cellulose and hemi-
cellulose as sole carbon sources. The gene for one of the cellulases (CelA)
was isolated and was found to consist of 1751 amino acids. This is the largest
cellulase gene described to date [61–63]. A large cellulolytic enzyme (CelA)
with the ability to hydrolyze microcrystalline cellulose was isolated from the
extremely thermophilic bacterium Anaerocellum thermophilum [61–63]. The
enzyme has an apparent molecular mass of 230 kDa and exhibits significant
activity towards Avicel and is most active towards soluble substrates such
Table 2 Bacterial and archaeal cellulolytic enzymes
Organism Endoglucanase Cellobiohydrolase β-Glucosidase
Bacteria
Cellulomonas fimi + + –
Clostridium thermocellum + – –
C. stercorarium + + –
Cytophaga sp. + + –
Fibrobacter succinogenes + – +
Ruminococcus albus + + +
Thermotoga maritima + + –
Thermotoga neapolitana + + –
Archaea
Pyroccus furiosus – + +
Sulfolobus solfataricus – – +
as carboxy-methyl-cellulose (CMC) and β-glucan. Maximal activity was ob-

served at pH 5–6 and 85–95 ◦ C. A thermostable β-glucosidase is produced by
Thermotoga sp. FjSS3-B1 [64]. The enzyme is highly thermostable and shows
maximal activity at 115 ◦ C at pH 6.8–7.8. The thermostability of the enzyme
is salt dependent. This enzyme is active on amorphous cellulose and carboxy-
methyl-cellulose. The thermophilic bacterium Rhodothermus marinus pro-
duces a hyperthermostable cellulase, with a temperature optimum of more
than 90 ◦ C [65], the structure of which was solved to 1.8 Å resolution. This is
the first structure of a thermophilic member of family glycoside hydrolase 12
to have been solved. The beta-jelly roll fold observed has identical topology
to those of the two mesophilic members of the family whose structures have
been elucidated previously. A Hepes buffer molecule bound in the active site
may have triggered a conformational change to an active configuration, as the
two catalytic residues Glu124 and Glu207, together with dependent residues,
are observed in a conformation similar to that seen in the structure of Strep-
tomyces lividans CelB2 complexed with an inhibitor. The structural similarity
between this cellulase and the mesophilic enzymes serves to highlight fea-
tures that may be responsible for its thermostability, chiefly an increase in
ion-pair number and the considerable stabilization of a mobile region seen in
S. lividans CelB2. Additional aromatic residues in the active site region may
also contribute to the difference in thermophilicity [66].
Recently, a thermostable endoglucanase, which is capable of degrading
β-1,4 bonds of β-glucans and cellulose, has been identified in the archaeon
Pyrococcus furiosus. The gene encoding this enzyme has been cloned and se-
quenced in E. coli. The purified recombinant endoglucanase hydrolyzes β-1,4
but not β-1,3 glycosidic linkages and has the highest specific activity with
cellopentaose and cellohexaose as substrates [67]. In contrast to this, several
β-glucosidases have been detected in archaea. In fact, archaeal β-glucosidases
have been found in Sulfolobus solfataricus MT4 [68], S. acidocaldarius, S. shi-
batae and P. furiosus [69–71]. The enzyme from the latter microorganism
is very stable and shows optimal activity at 103 ◦ C. The β-glucosidase from
S. solfataricus MT4 is very resistant to various denaturants with activity up
to 85 ◦ C. The gene for this β-glucosidase has been cloned and overexpressed
in E. coli [72]. The less-thermoactive cellulases that are widespread in fungi
and bacteria, have already found various biotechnological applications. The
most effective enzyme of commercial interest is the cellulase produced by
Trichoderma sp. Cellulases were also obtained from strains of Aspergillus,
Penicillium and Basidomycetes [73, 74]. Cellulolytic enzymes can be used
in alcohol production to improve juice yields and effective color extraction
of juices. The presence of cellulases in detergents causes color brightening,
softening and improves particulate soil removal [75]. Cellulase (Denimax®
Novozymes) is also used for the “biostoning” of jeans instead of using stones.
Other suitable applications of cellulases include the pretreatment of cellulosic
biomass and forage crops to improve nutritional quality and digestibility, en-
zymatic saccharification of agricultural and industrial wastes and production

of fine chemicals [76].
4
Xylan-degrading enzymes
To date only a few extreme thermophilic microorganisms are able to grow

on xylan and secrete thermoactive xylanolytic enzymes (Table 3). Xylan is
a heterogeneous molecule that constitutes the main polymeric compound
of hemicellulose, a fraction of the plant cell wall, which is a major reser-
voir of fixed carbon in nature. The main chain of the heteropolymer is
composed of xylose residues linked by β-1,4-glycosidic bonds. Approxi-
mately half of the xylose residues have substitution at the O-2 or O-3
positions with acetyl, arabinosyl and glucuronosyl groups. The complete
degradation of xylan requires the action of several enzymes. The endo-
β-1,4-xylanase (E.C.3.2.1.8) hydrolyzes β-1,4-xylosydic linkages in xylans,
while β-1,4-xylosidase (EC 3.2.1.37) hydrolyzes β-1,4-xylans and xylobiose
by removing the successive xylose residues from the non-reducing ter-
mini [77]. Members of the order Thermotogales and Dictyoglomus ther-
mophilum Rt46B.1 have been described to produce xylanases that are active
and stable at high temperatures [78, 79]. The most thermostable endoxy-
lanases that have been described so far are those derived from Thermotoga
sp. strain FjSS3-B.1, Thermotoga maritima [59, 80, 81], T. neapolitana [82, 83]
and T. thermarum [84]). These enzymes, which are active between 80 and
105 ◦ C, are mainly cell-associated and most probably localized within the
toga, which covers the cells. Several genes encoding xylanases have already
been cloned and sequenced. The gene from T. maritima, encoding a ther-
mostable xylanase has been cloned and expressed in E. coli. Comparison be-
tween the T. maritima recombinant xylanase and the commercially available
enzyme, Pulpenzyme™ indicates that the thermostable xylanase could be of
interest for application in pulp and paper industry [85]. Recently, Bacillus
thermantarcticus, a thermophilic bacterium isolated from Antarctic geother-
mal soil near the crater of Mount Melbourne, was found to produce an extra-
cellular xylanase and β-xylosidase. The optimum temperatures are 80 ◦ C for
xylanase at pH 5.6 and 70 ◦ C for β-xylosidase at pH 6.0. The isoelectric points
and molecular masses are 4.8 and 45 kDa for xylanase and 4.2 and 150 kDa
for β-xylosidase, respectively. Xylanase is stable at 60 ◦ C for 24 h, whereas it
shows a half-life at 70 ◦ C of 24 h and at 80 ◦ C of 50 min. β-Xylosidase activity
does not decrease after 1 h at 60 ◦ C. Interestingly, the action of two enzymes
on xylan leads to the formation of xylose [86].
The extracellular thermostable endo-1,4-β-xylanase (XT6) produced by
the thermophilic bacterium Geobacillus stearothermophilus T-6 was shown to
bleach pulp optimally at pH 9 and 65 ◦ C and was successfully used in a large-
Table 3 Bacterial and archaeal xylanolytic enzymes
Organism Endoxylanase β-Xylosidase β-L-Arabinofuranosidase β-Glucuronidase Acetyl Xylan

esterase
Bacteria
Bacillus subtilis + + + + +
Streptomyces olivochromogenes + + + ND +
Thermoactinomyces vulgaris + ND + ND +
Thermoanaerobacter saccharolyticum + + + ND +
Thermonospora fusca + + + ND +
Thermotoga maritima + ND ND ND ND
Thermotoga neapolitana + ND ND ND ND
Archaea
Thermococcus zilligii + ND ND ND ND
ND: Not determined

Extreme Environments as a Resource for Microorganisms and Novel Biocatalysts
231
scale biobleaching mill trial. The xylanase gene was cloned and sequenced.
The mature enzyme consists of 379 amino acids, with a calculated molecular
weight of 43.8 kDa and a pI of 9.0. In order to study the mechanism of cataly-
sis and to provide a structural basis for the rational introduction of enhanced
thermostability by site-specific mutagenesis, the structure of wild type was
refined at 2.4 Å resolution. The structure demonstrates that XT6 is made up
of an eightfold TIM barrel containing a deep active-site groove, consistent
with its “endo” mode of action. The two essential catalytic carboxylic residues
(Glu159 and Glu265) are located at the active site within 5.5 Å of each other,
as expected for “retaining” glycoside hydrolases. A unique subdomain was
identified in the carboxy-terminal part of the enzyme and was suggested to
have a role in xylan binding. The three-dimensional structure of XT6 is of
great interest since it provides a favourable starting point for the rational im-
provement of its already high thermal and pH stabilities, which are required
for a number of biotechnological and industrial applications [87]. Among
the thermophilic Archaea, xylanase production has been demonstrated only
in the hyperthermophilic archaeon Pyrodictium abyssi [88]. The enzyme has
an optimum temperature of 110 ◦ C, which is one of the highest reported
for a xylanase. Recently, an endo-1,4-xylanase and a β-xylosidase have been
characterized from the extremely halophilic archaeon, Halorhabdus utahen-
sis [89]. This is the first report on hemicellulose-degrading enzymes produced
by an extremely halophilic archaeon.
Xylanases from bacteria and eukarya have a wide range of potential
biotechnological applications. They are already produced on industrial scale
and are used as food additives in poultry, for increasing feed efficiency diets
and in wheat flour for improving dough handling and the quality of baked
products. In recent years, the major interest in thermostable xylanases is
found in enzyme-aided bleaching of paper. The chlorinated lignin derivatives
generated by this process constitute a major environmental problem caused
by the pulp and paper industry. Recent investigations have demonstrated the
feasibility of enzymatic treatments as alternatives to chlorine bleaching for
the removal of residual lignin from pulp. Treatment of craft pulp with xy-
lanase leads to a release of xylan and residual lignin without undue loss of
other pulp components. Xylanase treatment at elevated temperatures opens
up the cell wall structure, thereby facilitating lignin removal in subsequent
bleaching stages [90, 91].
5
Pectin-degrading enzymes
Pectin is a branched heteropolysaccharide consisting of a main chain of

α-1,4-D-polygalacturonate, which is partially methyl-esterified. Along the
chain, L-rhamnopyranose residues are present that are the binding sites for
side chains composed of neutral sugars. Pectin is an important plant ma-

terial that is present in the middle lamellae as well as in the primary cell
walls. Pectin is degraded by pectinolytic enzymes that can be classified into
two major groups. The first group comprises methylesterases, whose func-
tion is to remove the methoxy groups from pectin. The second group com-
prises the depolymerases (hydrolases and lyases), that attack both pectin
and pectate (polygalacturonic acid). A great variety of pectinolytic bacteria
have been isolated from various habitats such as trees, lakes, soil, tumen,
mullet gut, and human intestinal track. Pectin hydrolases are predomin-
antly synthesized by fungi whereas pectate lyases are mostly produced by
bacteria and usually act at alkaline pH and are Ca2+ -dependent. Pectin degra-
dation by thermophilic bacteria has been reported for Thermoanaerobac-
ter thermohydrosulfuricus, Thermoanaerobacter thermosulfurigenes, Clostrid-
ium thermocellum, Desulfurococcus amylolyticus, Clostridium thermosaccha-
rolyticum and Bacillus stearothermophilus [92–101]. Although many microor-
ganisms have been screened for pectinolytic activity, little attention has been
paid to pectinolytic enzymes from thermophilic and hyperthermophilic mi-
croorganisms. Previously a novel anaerobic strain from a thermal spa in Italy
was isolated that produces two thermoactive lyases that have a very high
affinity for polygalacturonate. This is a spore-forming anaerobic microor-
ganism able to grow on citrus pectin and pectate optimally at 70 ◦ C, which
has been identified as Thermoanaerobacter italicus. After growth on citrus
pectin, two pectate lyases were induced, purified and biochemically char-
acterized [102]. Both enzymes display similar catalytic properties and can
function at temperatures up to 80 ◦ C. An increase in the enzymatic activity
of both pectate lyases was observed after the addition of Ca+2 . The ability of
the hyperthermophilic bacterium Thermotoga maritima to grow on pectin as
a sole carbon source coincides with the secretion of a pectate lyase A (PelA)
in the extracellular medium. The pel A gene of T. maritima was function-
ally expressed in E. coli as the first heterologously produced thermophilic
pectinase, and purified to homogeneity [103]. Gel filtration indicated that
the native form of PelA is tetrameric. Highest activity (422 U/mg, with a Km
of 0.06 mM), was demonstrated on polygalacturonic acid (PGA), whereas
pectins with an increasing degree of methylation were degraded at a decreas-
ing rate. Similar to pectate lyases, PelA demonstrated full dependency on
Ca2+ for stability and activity. The enzyme is highly thermoactive and ther-
mostable, operating optimally at 90 ◦ C and pH 9.0, with a half-life for thermal
inactivation of almost 2 h at 95 ◦ C, and an apparent melting temperature
of 102.5 ◦ C. Detailed characterization of the product formation with poly-
galacturonic acid indicated that PelA has a unique eliminative exo-cleavage
pattern liberating unsaturated trigalacturonate as the major product, in con-
trast with unsaturated digalacturonate for other exopectate lyases known.
To date pectin-hydrolyzing enzymes from archaea have not been identified
and characterized. Enzymatic pectin degradation is widely applied in food-
technology processes, as in fruit-juice extraction, to increase the juice yield,

to reduce its viscosity, improve color extraction from the skin and to macerate
fruit and vegetable tissues [103].
6
Chitin-degrading enzymes
Chitin is a linear β-1,4 homopolymer of N-acetyl-glucosamine residues and

it is one of the most abundant natural biopolymers on earth. Particularly in
the marine environment, chitin is produced in enormous amounts and its
turnover is due to the action of chitinolytic enzymes. Chitin is the major
structural component of most fungi and some invertebrates (crustacea and
insects), while for soil or marine bacteria chitin serves as a nutrient (41).
Chitin degradation is known to proceed with the endo-acting chitin hydro-
lase (chitinase A; EC 3.2.1.14) and the chitin-oligomer-degrading exo-acting
hydrolases (chitinase B) and N-acetyl-D-glycosaminidase (trivial name: chi-
tobiase; EC 3.2.1.52). Chitin exhibits interesting properties that make it a valu-
able raw material for several applications. It has been estimated that the
annual worldwide formation rate and steady-state amount of chitin is of the
order of 1010 to 1011 tons per year. Therefore, application of thermostable
chitin-hydrolyzing enzymes (chitinases) is expected for effective utilization
of this abundant biomass [104–106]. Although a large number of chitin-
hydrolyzing enzymes has been isolated and their corresponding genes have
been cloned and characterized, only a few thermostable chitin hydrolyz-
ing enzymes are known. These enzymes have been isolated from the ther-
mophilic bacterium Bacillus licheniformis X-7u [107], Bacillus sp. BG-11 [108]
and Streptomyces thermoviolaceus OPC-520 [109]. So far, only three hyper-
thermophilic archaea, Thermococcus chitonophagus [110], Thermococcus ko-
dakaraensis KOD1 [111, 112], and Pyrococcus furiosus [113] have been shown
to grow on chitin. The extreme thermophilic anaerobic archaeon Thermococ-
cus chitonophagus has been reported to posses an enzymatic system able to
hydrolyze chitin. From this microorganism, a chitinase (1,4-beta-D-N-acetyl-
glucosaminidase, EC 3.2.1.14) was detected and purified to homogeneity in
its native form. This is the first nonrecombinant chitinase purified and char-
acterized from archaea and also constitutes the first case of a membrane-
associated chitinase isolated from archaea. The enzyme is a monomer with
an apparent molecular weight of 70 kDa and appears to be associated with
the outer side of the cell membrane. The enzyme is optimally active at 70 ◦ C
and pH 7.0 and exhibits remarkable thermostability, maintaining 50% activ-
ity even after 1 h at 120 ◦ C. The enzyme was not inhibited by allosamidin,
the natural inhibitor of chitinolytic activity, and was also resistant to denat-
uration by urea and SDS. Chi70 shows broad substrate specificity for several
chitinous substrates and derivatives and has been classified as an endochiti-
nase due to its ability to release chitobiose from colloidal chitin [110]. Very
recently, the gene encoding a chitinase from a hyperthermophilic archaeon
Thermococcus kodakaraensis KOD1 was cloned, sequenced and expressed in
E. coli. The purified recombinant protein is optimally active at 85 ◦ C and
pH 5.0. This multidomain protein consists of two active sites with different
cleavage specificities and three substrate-binding domains, which are related
to two families of cellulose-binding domains. The enzyme produces chito-
biose as the major end product. This thermostable chitinase, which is active
in the presence of detergents and organic solvents, can be applied as use-
ful catalyst in the industry e.g. production of N-acetyl-chitooligosaccharides
with biological activity [111]. Pyrococcus furiosus was also found to grow on
chitin, adding this polysaccharide to the inventory of carbohydrates utilized
by this hyperthermophilic archaeon. Accordingly, two open reading frames
(chiA and chiB) were identified in the genome of P. furiosus, which encode
chitinases with sequence similarity to proteins from the glycosyl hydrolase
family 18 in less-thermophilic organisms. The two chitinases share little se-
quence homology with each other, except in the catalytic region, where both
have the catalytic glutamic acid residue that is conserved in all family 18 bac-
terial chitinases. The genes encoding ChiA, without its signal peptide, and
ChiB were cloned and expressed in E. coli. The pH optima of both enzymes
is about 6.0 with a broad temperature optima between 90 and 95 ◦ C. ChiA
melted at 101 ◦ C, whereas ChiB was found to be extremely thermostable, with
a melting temperature of 114 ◦ C. ChiA exhibited no detectable activity to-
ward chitooligomers smaller than chitotetraose, indicating that the enzyme
is an endochitinase whereas ChiB is a chitobiosidase, progressively cleaving
off chitobiose from the non-reducing end of chitin or other chitooligomers.
Synergistic activity was observed for the two chitinases on colloidal chitin,
indicating that these two enzymes work together to recruit chitin-based sub-
strates for P. furiosus growth. This was supported by the observed growth on
chitin as the sole carbon source in a sulfur-free media [113].
7
Starch-processing enzymes
7.1
Heat-stable amylases, glucoamylases and α-glucosidases
Extremely thermostable α-amylases have been characterized from a number

of hyperthermophilic archaea belonging to the genera Pyrococcus [114–118]
and Thermococcus [119, 120]. α-Amylase (α-1,4-glucan-4-glucanohydrolase;
EC 3.2.1.1), hydrolyzes linkages in the interior of the starch polymer in a ran-
dom fashion that leads to the formation of linear and branched oligosac-
charides. The sugar-reducing groups are liberated in the α-anomeric config-
uration. Most starch-hydrolyzing enzymes belong to the α-amylase family,

which contains a characteristic catalytic (β α)8 -barrel domain. Throughout
the α-amylase family, only eight amino acid residues are invariant, seven at
the active site and a glycine in a short turn. The optimal temperatures for
the activity of these enzymes range between 80 ◦ C and 100 ◦ C. Thermoactive
amylolytic enzymes have also been detected in hyperthermophilic archaea
of the genera Sulfolobus, Thermophilum, Desulfurococcus, and Staphylother-
mus [121–123] (Table 4). Molecular cloning of the corresponding genes and
their expression in heterologous hosts circumvent the problem of insuffi-
cient expression in the natural host. The gene encoding an extracellular
α-amylase from Pyrococcus furiosus has recently been cloned and the recom-
Table 4 Starch-hydrolyzing enzymes from extreme thermophilic and hyperthermophilic

Archaea
Enzyme Organism (growth temperature) Enzyme properties

Optimal Optimal
temperature pH
α-Amylase Desulfurococcus mucosus (85) 85 5.5

Pyrococcus furiosus (100) 100 6.5–7.5
Pyrococcus sp. KOD1 (100) 90 6.5
Pyrococcus woesei (100) 100 5.5
Pyrodictium abyssi (98) 100 5.0
Staphylothermus marinus (90) 100 5.0
Sulfolobus solfatatricus (88)
Thermococcus celer (85) 90 5.5
Thermococcus profundus DT5432 (80) 80 5.5
Thermococcus profundus (80) 80 4.0–5.0
Thermococcus aggregans (85) 95 6.5
Dictyoglomus thermophilum Rt46B.1 (73) 90 5.5
Pullulanase type II Desulfurococcus mucosus (88) 100 5.0
Pyrococcus woesei (100) 100 6.0
Pyrodictium abyssi (98) 100 9.0
Thermococcus litoralis (90) 98 5.5
Thermococcus hydrothermalis (80) 95 5.5
Pullulan-hydrolase Thermococcus aggregans (85) 100 6.5
type III
Glucoamylase Thermoplasma acidophilum (60) 90 6.5
Picrophilus oshimae (60) 90 2.0
Picrophilus torridus (60) 90 2.0
CGTase Thermococcus sp.B1001 (75) 100 2.0
α-Glucosidase Thermococcus strain AN1 (80) 130 63
Thermococcus hydrothermalis (80) – –
binant enzyme has been expressed in Bacillus subtilis and E. coli (48, 49).
The high thermostability of the pyrococcal extracellular α-amylase (thermal
activity even at 130 ◦ C) makes this enzyme an interesting candidate for indus-
trial application. α-Amylases with lower thermostability have been isolated
from the archaea Thermococcus profundus [124], Pyrococcus kodakaraen-
sis [125] and the bacteria Thermotoga maritima [126] and Dictioglomus
thermophilum [127, 128]. The genes encoding these enzymes were success-
fully expressed in E. coli. Similar to the amylase from Bacillus licheniformis,
which is commonly used in liquefaction of starch in the industry, the en-
zyme from T. maritima requires Ca2+ for activity. Further investigations have
shown that the extreme marine hyperthermophilic archaeon Pyrodictium
abyssi can grow on various polysaccharides and also secretes a heat-stable
α-amylase [88].
Unlike α-amylase, the production of glucoamylase seems to be very
rare in extremely thermophilic and hyperthermophilic bacteria and archaea
(Table 4). Glucoamylases (EC 3.2.1.3) hydrolyze terminal α-1,4-linked-D-
glucose residues successively from non-reducing ends of the chains, releasing
β-D-glucose. Among the thermophilic anaerobic bacteria, glucoamylases
have been purified and characterized from Clostridium thermohydrosulfu-
ricum 39, Clostridium thermosaccharolyticum and Thermoanaerobacterium
thermosaccharolyticum DSM 571 [129–141]. Recently, it has been shown
that the thermoacidophilic archaea Thermoplasma acidophilum, Picrophilus
torridus and Picrophilus oshimae produce heat- and acid-stable glucoamy-
lases. The purified archaeal glucoamylases are optimally active at pH 2 and
90 ◦ C. Catalytic activity is still detectable at pH 0.5 and 100 ◦ C. These en-
zymes are more thermostable than the aforementioned glucoamylases from
bacteria, yeast and fungi. This has been the first report on the produc-
tion of glucoamylase in archaea [142]. However, the lack of suitable genetic
methods for thermoacidophiles have precluded structural studies aimed at
discovering their adaptation at very low pH. Very recently, the gene (ssg) en-
coding a putative glucoamylase from Sulfolobus solfataricus, was cloned and
expressed in E. coli, and the properties of the recombinant protein were ex-
amined in relation to the glucose production process. This represents the
first successful cloning of a glucoamylase gene from a thermoacidophilic
archaeon in a mesophilic host [143]. The recombinant glucoamylase is ex-
tremely thermostable, with an optimal temperature at 90 ◦ C, however the
intracellular enzyme is most active in the slightly acidic pH range from 5.5
to 6.0. The enzyme liberated β-D-glucose from the substrate maltotriose,
and the substrate preference for maltotriose distinguishes this enzyme from
fungal glucoamylases. Gel permeation chromatography and sedimentation
equilibrium analytical ultracentrifugation analysis revealed that the en-
zyme exists as a tetramer [143]. The glucoamylase from S. solfataricus has
a potential for improving industrial starch processing by eliminating the
need to adjust both pH and temperature. However it is remarkably less
acidic than the glucoamylases from P. torridus, P. oshima and T. acidophy-

lum.
In addition to the glucoamylase, S. solfataricus produces an α-amylase,
which is secreted into the culture supernatant during growth on starch as
the sole carbon and energy source. The purified enzyme is a homodimer
with a subunit size of 120 kDa and catalyzes the hydrolysis of starch, dex-
trin, and α-cyclodextrin [123]. Assimilation of starch-derived carbon in this
organism is coupled to production of a cell-associated α-glucosidase, which
converts maltodextrins into glucose. S. solfataricus employs a catabolite re-
pression (CR) system to regulate production of glycosyl hydrolases, including
synthesis of the secreted α-amylase.
α-Glucosidases (E C 3.2.1.20) attack the α-1,4 linkages of oligosaccha-
rides that are produced by the action of other amylolytic enzymes. Unlike
glucoamylase, α-glucosidase prefers smaller oligosaccharides, e.g. maltose
and maltotriose, and liberates glucose with an α-anomeric configuration.
α-Glucosidases are present in thermophilic archaea and bacteria. An intracel-
lular and an extracellular α-glucosidase have been purified from P. furiosus
and Thermococcus strain AN1 [144–148]. The enzyme exhibits optimal ac-
tivity at pH 5.0–6.0 over a temperature range of 105 to 115 ◦ C; the half-life
at 98 ◦ C is 48 h. An α-glucosidase (maltase) and flanking sequences from
Sulfolobus solfataricus were cloned and characterized. malA is 2,083 bp and
encodes a protein of 693 amino acids with a calculated mass of 80.5 kDa. It
is flanked on the 5 side by an unusual 1-kb intergenic region. The puri-
fied recombinant enzyme hydrolyzes p-nitrophenyl–D-glucopyranoside with
a Km of 2.16 mM and a Vmax of 3.08 µmol of p-nitrophenol/min at 85 ◦ C.
It exhibited a pH optimum for maltose hydrolysis of 4.5. In contrast to its
apparent greater tendency to dissociate during SDS-PAGE, the recombinant
α-glucosidase exhibits greater thermostability than the native enzyme, with
a half-life of 39 h at 85 ◦ C at a pH of 6.0. Unlike maltose hydrolysis, glycogen
hydrolysis is optimal at the intracellular pH of the organism. These results
indicate a unique role for the S. solfataricus α-glucosidase in carbohydrate
metabolism [149].
7.2
Thermoactive pullulanase and CGTase
Enzymes capable of hydrolyzing α-1,6 glycosidic bonds in pullulan are de-

fined as pullulanases. Pullulan is a linear α-glucan consisting of maltotriose
units joined by α-1,6 glycosidic linkages and it is produced by Aureobasid-
ium pullulans with a chain length of 480 maltotriose units [150]. On the basis
of substrate specificity and product formation, pullulanases have been classi-
fied into two groups: pullulanase type I and pullulanase type II. Pullulanase
type I (EC 3.2.1.41) specifically hydrolyzes the α-1,6-linkages in pullulan as
well as in branched oligosaccharides (debranching enzyme), and its degrada-
tion products are maltotriose and linear oligosaccharides, respectively. Pul-

lulanase type I is unable to attack α-1,4-linkages in α-glucans. Pullulanase
type II (amylopullulanase) attacks α-1,6-glycosidic linkages in pullulan and
α-1,4-linkages in branched and linear oligosaccharides. The enzyme has mul-
tiple specificity and is able to fully convert polysaccharides (e.g. amylopectin)
to small sugars (e.g. glucose, maltose, maltotriose) in the absence of other
enzymes, such as α-amylase or β-amylase [151, 152].
Thermostable and thermoactive pullulanases from extremophilic microor-
ganisms have been detected in Pyrococcus furiosus [153], Thermococcus
celer [154], Desulfurococcus mucosus [155], Staphylothermus marinus, Ther-
mococcus hydrothermalis [156] and Thermococcus aggregans [157] (Table 4).
Temperature optima between 90 ◦ C and 105 ◦ C, as well as remarkable ther-
mostability even in the absence of substrate and calcium ions, have been
observed. Most thermoactive pullulanases identified to date belong to the
type II group. Pullulanases type II from P. furiosus and P. woesei have been
expressed in E. coli [153, 158, 159]. The unfolding and refolding of the pul-
lulanase from P. woesei has been investigated using guanidinium chloride as
denaturant. The monomeric enzyme (90 kDa) was found to be very resis-
tant to chemical denaturation and the transition midpoint for guanidinium
chloride-induced unfolding was determined to be 4.8. The unfolding process
was reversible. Reactivation of the completely denatured enzyme (in 7.8 M
guanidinium chloride) was obtained upon removal of the denaturant by step-
wise dilution, 100% reactivation was observed when refolding was carried
out via a guanidinium chloride concentration of 4 M in the first dilution
step [160]. On the basis of the amino-acid sequence, the pullulanase type II
(amylopullulanase) from T. hydrothermalis and P. furiosus belong to family 57
(GH-57) of the glycoside hydrolases. Five conserved regions were identified,
which are postulated to be GH-57 consensus motifs by comparison to the 659-
amino-acid-long 4–glucanotransferase from Thermococcus litoralis. These
motifs correspond to 13_HQP (region I), 76_GQLEIV (region II), 120_WL-
TERV (region III), 212_HDDGEKFGVW (region IV), and 350_AQCNDAYWH
(region V). The third and fourth conserved regions contain the hypothetical
catalytic nucleophile E291 and the proton donor D394, respectively. To vali-
date this prediction, the characterization of catalytic sites of certain members
of GH-57 has been started recently. Site-directed mutagenesis performed by
Zona et al. [161] on pullulanase type II from T. hydrothermalis reveals that
both residues are indeed critical for the pullulanolytic and amylolytic activi-
ties of the pullulanase type II [161]. The crucial role of E291 as the catalytic
nucleophile has also been confirmed by Kang et al. [162], who performed
similar experiment on the pullulanase type II from P. furiosus (PfAPU). The
apparent catalytic efficiencies (kcat /Km ) of mutants E291Q and D394N on pul-
lulan were 123.0 and 24.4 times lower, respectively, than that of PfAPU. The
activity of mutant E396Q on pullulan was too low to allow reliable deter-
mination of its catalytic efficiency. The apparent specific activities of these
enzymes on starch also decreased 91.0 times (E291Q), 11.7 times (D394N),
and 37.2 times (E396Q). The hydrolytic patterns for pullulan and starch were
the same, while the hydrolysis rates differed as reported. Therefore, these data
support the prediction and strongly suggest that the biofunctionality of the
pullulanase type II is determined by a single catalytic centre.
Interestingly, pullulanase type I has not been isolated in Archaea so far,
whereas the enzyme has been characterized in several thermophilic microor-
ganisms. The aerobic thermophilic bacterium Thermus caldophilus GK-24
produces a thermostable pullulanase of type I when grown on starch [163].
The pullulanase is optimally active at 75 ◦ C and pH 5.5, is thermostable up to
90 ◦ C, and does not require Ca2+ for either activity or stability. The first de-
branching enzyme (pullulanase type I) from an anaerobic thermophile was
identified in the bacterium Fervidobacterium pennivorans Ven5 which was
cloned and expressed in E. coli. The enzyme from F. pennivorans Ven5 at-
tacks exclusively the α-1,6-glycosidic linkages in polysaccharides [164, 165].
This thermostable debranching enzyme leads to formation of long-chain lin-
ear polysaccharides from amylopectin [166]. The same enzyme has been also
characterized from the related microorganism T. maritima [167]. Interest-
ingly, data concerning the physico-chemical properties of all debranching
enzymes reported so far show that they are mostly active in the acidic or
neutral pH range. Until very recently, no reports have been present on the
ability of thermophilic microorganisms to produce heat and alkaline stable
pullulanase type I. After sequencing the whole genome of the thermoalka-
liphile A. gottschalkii, an open reading frame with high pairwise similarity
to the pullulanases from the thermophilic anaerobic bacteria F. pennivorans
and T. maritima was identified and the gene (encoding 865 amino acids with
a predicted molecular mass of 98 kDa) was cloned and expressed in E. coli.
Pullulan hydrolysis activity was optimal at pH 8.0 and 70 ◦ C, and under these
physicochemical conditions the half-life of rPulAg was 22 h. The pullulanase
from A. gottschalkii, therefore, is the first thermoalkalistable type I pullu-
lanase that has been described [168].
Thermostable cyclodextrin glycosyltransferases (CGTases) are produced
by Thermoanaerobacter species [169], Thermoanaerobacterium thermosulfu-
rigenes [170] and Anaerobranca gottschalkii (13, 66, 67). Cyclodextrin glyco-
syltransferase (CGTase, EC 2.4.1.19) is an enzyme that is generally found in
bacteria and was recently discovered in archaea. The archaeal enzyme was
found in Thermococcus sp. and is optimally active at 100 ◦ C (Table 4). This en-
zyme produces a series of non-reducing cyclic dextrins from starch, amylose,
and other polysaccharides. α-, β- and γ -cyclodextrins are rings formed by 6,
7, and 8 glucose units, respectively, that are linked by α-1,4-bonds [171].
The finding of extremely thermophilic bacteria and archaea capable of
producing novel thermostable starch-hydrolyzing enzymes is a valuable con-
tribution to the starch-processing industry. By using robust starch-modifying
enzymes from thermophiles, innovative and environmentally friendly pro-
cesses can be developed, aiming at the formation of products of high added

value for the food industry. At elevated temperatures starch is more soluble
(30 to 35% w/v) and the risk of contamination is reduced. This is of advan-
tage when starch will be converted to high-glucose and high-fructose syrups.
Industrial production of fructose from starch consists of three steps: lique-
faction, saccharification and isomerization. This multistage process (step 1:
pH 6.5, 98 ◦ C; step 2: pH 4.5, 60 ◦ C: step 3; pH 8.0, 65 ◦ C) leads to the conver-
sion of starch to fructose with concurrent formation of high concentrations of
salts that have to be removed by ion exchangers. Furthermore, high energy is
required for cooling from 100 ◦ C to 60 ◦ C in step 2. The application of ther-
mostable enzymes such as amylases, glucoamylases, pullulanases and glucose
isomerases that are active and stable above 100 ◦ C and at acidic pH values
can simplify this complicated process. Therefore, strong efforts have been in-
vested in the isolation of thermostable and thermoactive amylolytic enzymes
from hyperthermophiles, since they could improve the starch conversion pro-
cess and lower the cost of sugar-syrup production. The use of the extremely
thermostable amylolytic enzymes can lead to other valuable products, which
include innovative starch-based materials with gelatine-like characteristics
and defined linear dextrins that can be used as fat substitutes, texturizers,
aroma stabilizers and prebiotics. CGTases are used for the production of cy-
clodextrins that can be used as a gelling, thickening or stabilizing agent in
jelly desserts, dressing, confectionery, dairy and meat products. Due to the
ability of cyclodextrins to form inclusion complexes with a variety of organic
molecules, cyclodextrins improve the solubility of hydrophobic compounds
in aqueous solution. This is of interest for the pharmaceutical and cosmetic
industries. Cyclodextrin production is a multistage process in which starch
is first liquefied by a heat-stable amylase followed by a second step in which
a less-thermostable CGTase from Bacillus sp. is used. The application of heat-
stable CGTase in jet cooking, where temperatures up to 105 ◦ C are achieved,
will allow liquefaction and cyclization to take place in one step [172].
8
Proteolytic enzymes
Proteases are involved in the conversion of proteins to amino acids and pep-
tides. They have been classified according to the nature of their catalytic
site in the following groups: serine, cysteine, aspartic, or metallo proteases.
A variety of heat-stable proteases has been identified in hyperthermophilic
archaea belonging to the genera Desulfurococcus [173], Sulfolobus [174, 175],
Staphylothermus [176], Thermococcus [177, 178], Pyrobaculum [179] and
Pyrococcus [180, 181] (Table 5). It has been found that most proteases from
extremophiles belong to the serine type, are stable at high temperatures even
in the presence of high concentrations of detergents and denaturing agents
Table 5 Properties of thermoactive proteolytic enzymes from extreme thermophilic and

hyperthermophilic Archaea
Protease Organism (growth temperature) Enzyme properties

Optimal Optimal
temperature pH
Serine protease Desulfurococcus mucosus (85) 95 7.5

Pyrococcus furiosus (100) 8.5 6.3
Pyrobaculum aerophilum (95) – –
Thermococcus aggregans (75) 90 7.0
Thermococcus litoralis (90) 95 9.5
Thermococcus stetteri (75) 85 8.5
Staphylothermus marinus (90) – 9.0
Sulfolobus solfataricus (88) – 6.5–8
Thiol protease Pyrococcus sp. KOD1 (95) 110 7
Acidic protease Sulfolobus acidocaldarius (70) 90 2.0
Aminopeptidase I Sulfolobus solfataricus (88) – –
Aminopeptidase II – –
Endopeptidase I,II,III – –
Carboxypeptidase – –
(59, 68, 69). A heat-stable serine protease was isolated from the cell-free su-
pernatant of the hyperthermophilic archaeon Desulfurococcus strain Tok12 S1 .
Recently, a cell-associated serine protease was characterized from the Desul-
furococcus strain SY that has a half-life of 4.3 h at 95 ◦ C [173]. A globular
serine protease from Staphylothermus marinus was found to be extremely
thermostable. The properties of extracellular serine proteases from a num-
ber of Thermococcus species have been analyzed [177, 178]. The extracellular
enzyme from T. stetteri has a molecular mass of 68 kDa and is highly sta-
ble and resistant to chemical denaturation, as illustrated by a half-life of
2.5 h at 100 ◦ C and retention of 70% of its activity in the presence of 1%
SDS [182]. A novel intracellular serine protease (pernisine) from the aerobic
hyperthermophilic archaeon Aeropyrum pernix K1 was purified and char-
acterized. At 90 ◦ C, the enzyme has a broad pH profile and an optimum at
pH 9.0 for peptide hydrolysis [183, 184]. The pernisine, lacking the leader
sequence, was expressed in E. coli as a fusion protein with glutathione-S-
transferase. The biochemical properties of the recombinant enzyme were
found to be similar to those of the native enzyme [185]. Several proteases
from hyperthermophiles have been cloned and sequenced but, in general,
their expression in mesophilic hosts is difficult. A gene encoding a subtilisin-
like serine protease, named aereolysin has been cloned from Pyrobaculum
aerophilum and the protein was modeled based on structures of subtilisin-
type proteases [184]. Multiple proteolytic activities have been observed in P.
furiosus. The cell-envelope-associated serine protease of P. furiosus called py-

rolysin was found to be highly stable with a half-life of 20 min at 105 ◦ C [186].
The pyrolysin gene was cloned and sequenced and it was shown that this en-
zyme is a subtilisin-like serine protease [187, 188]. A serine protease from
Aquifex pyrophilus was cloned and weakly expressed in E coli as active and
processed forms. The activity of the enzyme was highest at 85 ◦ C and pH 9.
The half-life of the protein (6 h at 105 ◦ C) makes it one of the most heat-stable
protease known to date [189].
Proteases have also been characterized from the thermoacidophilic ar-
chaea Sulfolobus solfataricus [175] and S. acidocaldarius [190–192]. In add-
ition to the serine proteases other types of enzymes have been identified
in extremophiles: a thiol protease from Pyrococcus sp. KOD1, a propylpep-
tidase (PEPase) and a new type of protease from P. furiosus [178, 181, 193].
Thermostable serine proteases were also detected in a number of extreme
thermophilic bacteria blonging to the genera Thermotoga and Fervidobac-
terium. The enzyme system from Fervidobacterium pennivorans is able to
hydrolyze feather keratin-forming high-value products such as amino acids
and peptides. The enzyme, which has been named fervidolysin, is optimally
active at 80 ◦ C and pH 10.0 [194]. The gene encoding fervidolysin was isolated
using degenerate primers combined with Southern hybridization and in-
verse polymerase chain reaction. Amino-terminal-sequence analysis of these
bands and their comparison with that determined from biochemically puri-
fied keratinase and its predicted protein sequence identified them as a 73-kDa
fervidolysin precursor, a 58-kDa mature fervidolysin, and a 14-kDa fervi-
dolysin propeptide. Using site-directed mutagenesis, the active-site histidine
residue at position 79 was replaced by an alanine residue. The resulting fer-
vidolysin showed a single protein band corresponding in size to the 73-kDa
fervidolysin precursor, indicating that its proteolytic cleavage resulted from
an autoproteolytic process. Assays using keratin and other proteinaceous sub-
strates did not display fervidolysin activity, perhaps because of the tight
binding of the propeptide in the substrate-binding site, where it could then
function as an inhibitor. Finally, the recombinant fervidolysin has been crys-
tallized and the structure has been determined at 1.7-Å resolution. The
crystal structure shows that the protease is composed of four domains: a cata-
lytic domain (CD), two beta-sandwich domains (SDs), and the PD domain.
A structural alignment shows a distant relationship between the PD–CD sub-
structure of fervidolysin and pro-subtilisin E. Tight binding of PD to the
remaining part of the protease is mediated by hydrogen bonds along the do-
main surfaces and around the active cleft, and by the clamps to SD1 and
SD2 [195, 196].
The amount of proteolytic enzymes produced worldwide on a commer-
cial scale is the largest compared to the other biotechnological enzymes in
use. Serine alkaline proteases are used as additives to household detergents
for laundering, where they have to resist denaturation by detergents and al-
kaline conditions. Proteases showing high keratinolytic activity are used for
soaking in the leather industry. Proteases are also used as catalysts for peptide
synthesis using their reverse reaction.
9
Lipases
Lipases, triacylglycerol hydrolases, are an important group of biotechnologi-

cally relevant enzymes and they find immense applications in the food, dairy,
detergent and pharmaceutical industries. Lipases are produced by microbes
and specifically bacterial lipases play a vital role in commercial ventures.
Some important lipase-producing bacterial genera include Bacillus, Pseu-
domonas and Burkholderia. Lipases are generally produced on lipidic carbon,
such as oils, fatty acids, glycerol or tweens in the presence of an organic ni-
trogen source. Bacterial lipases are mostly extracellular and are produced
by submerged fermentation. The enzyme is most commonly purified by
hydrophobic interaction chromatography, in addition to some modern ap-
proaches such as reverse micellar and aqueous two-phase systems.
Most lipases can act in a wide range of pH and temperature, though al-
kaline bacterial lipases are more common. Bacterial lipases generally have
temperature optima in the range 30–60 ◦ C [197]. However, highly thermotol-
erant lipases have been reported from B. stearothermophilus, with a half-life
of 15–25 min at 100 ◦ C [198] and B. thermoleovorans [199, 200]. Lipases are
serine hydrolases and have high stability in organic solvents. Besides these,
some lipases exhibit chemo-, regio- and enantioselectivity. Very recently,
more than five anaerobic thermophilic bacteria were found to produce ex-
tremely heat-stable lipases. They are active at a broad temperature (50–95 ◦ C)
and pH (3–11) (unpublished results, Antranikian). The latest trend in lipase
research is the development of novel and improved lipases through molecular
approaches such as directed evolution and exploring natural communities by
the metagenomic approach. The recent determination of structure of Bacil-
lus stearothermophilus P1 lipase provides a template for other thermostable
lipases, and offers insight into mechanisms used to enhance thermal stabil-
ity which may be of commercial value in engineering lipases for industrial
uses [201].
10
Glucose isomerases, alcohol dehydrogenases and esterases
In addition to the described extracellular enzymes, intracellular enzymes

from extremophiles are of interest for various applications (Table 6). Glucose
isomerase or xylose isomerase (D-xylose ketol-isomerase; EC 5.3.1.5) cat-
Table 6 Enzymes with potential biotechnological application from extreme thermophilic

and hyperthermophilic archaea and bacteria
Enzyme Organism Biocatalysis Application

(growth temperature)
α-Amylase Pyrococcus woesei Hydrolysis of α-1,4 Starch industry, bio-

(100 ◦ C) glycosidic linkages conversion of starch
in starch to glucose syrup
Debranching Fervidobacterium Debranching of Starch bioconversion
enzyme pennivorans Ven5 amylopectin to glucose
(pullulanase (75 ◦ C) to linear
type I) oligosaccharides
CGTase Thermococcus sp. Production of Gelling, thickening,
(75 ◦ C), Anaerobranca cyclodextrins stabilizing agents
gottschalkii (60 ◦ C) in food industry
Cellulase Pyrococcus furiosus Hydrolysis of Color extraction of
(100 ◦ C) cellulose to juice, color brightening,
glucose improving nutritional
quality
Endoxylanases Thermotoga maritima Degradation Bleaching of paper
MSB8 (80 ◦ C) of xylan
Chitinase Thermococcus Degradation Utilization of biomass
kodakaraensis (95 ◦ C) of chitin of marine environment
Serine Fervidobacterium Keratin hydrolysis Soaking in leather
protease pennivorans (70 ◦ C) industry, production
of amino acids and
peptides from feathers
Glucose Thermotoga Isomerization Production of high-
isomerase maritima (80 ◦ C) of glucose fructose corn syrup
to fructose
Alcohol Sulfolobus Oxidation of Reduction of ketones

deydrogenase solfataricus (88 ◦ C) secondary alcohols
Esterase Sulfolobus Cleavage of esters Biotransformation
tokadaii (100 ◦ C) in organic solvents
DNA polymerase Thermus aquaticus DNA synthesis Taq polymerase,
(75 ◦ C) polymerase chain
reaction (PCR)
alyzes the reversible isomerization of D-glucose and D-xylose to D-fructose

and D-xylulose, respectively. The enzyme has the largest market in the
food industry because of its application in the production of high-fructose
corn syrup (HFCS). HFCS, an equilibrium mixture of glucose and fruc-
tose, is 1.3 times sweeter than sucrose. Glucose isomerase is widely dis-
tributed in mesophilic microorganisms. Intensive research efforts are dir-
ected toward improving the suitability of glucose isomerase for industrial
application. To reach fructose concentration of 55% the reaction must ap-
proach 110 ◦ C. Improved thermostable glucose isomerases have been engi-
neered from mesophilic enzymes [202]. The gene encoding a xylose iso-
merase (XylA) of Thermus flavus AT62 was cloned and the DNA sequence
was determined. XylA has an optimum temperature at 90 ◦ C and pH 7.0;
divalent cations such as Mn2+ , Co2+ and Mg2+ are required for enzyme ac-
tivity [203]. Thermoanaerobacterium strain JW/SL-YS 489 forms a xylose
isomerase, which is optimally active at pH 6.4 and 60 ◦ C or pH 6.8 and 80 ◦ C.
Like other xylose isomerases, this enzyme requires Mn2+ , Co2+ and Mg2+
for thermal stability (stable for 1 h at 82 ◦ C in the absence of substrate). The
gene encoding the xylose isomerase of the Thermoanaerobacterium strain
JW/SL-YS 489 was cloned and expressed in E. coli [204]. Comparison of the
deduced amino acid sequence with sequences of other xylose isomerases
showed that the enzyme has 98% homology with a xylose isomerase from
a closely related bacterium Thermoanaerobacterium saccharolyticum B6A-
RI. A thermostable glucose isomerase was purified and characterized from
Thermotoga maritima. This enzyme is stable up to 100 ◦ C, with a half-life
of 10 min at 115 ◦ C [205]. Interestingly, the glucose isomerase from Thermo-
toga neapolitana displays a catalytic efficiency at 90 ◦ C, which is 2 to 14 times
higher than any other thermoactive glucose isomerases at temperatures be-
tween 60 ◦ C and 90 ◦ C [205–208].
Dehydrogenases are enzymes belonging to the class of oxidoreductases.
Within this class, alcohol dehydrogenases (E.C.1.1.1.1, also named keto-
reductases) represent an important group of biocatalysts due to their ability
to stereospecifically reduce prochiral carbonyl compounds. Alcohol dehydro-
genases can be used efficiently in the synthesis of optically active alcohols,
which are key building blocks for the fine-chemicals industry [209]. From
a practical point of view, alcohol dehydrogenases that use nicotinamide ade-
nine dinucleotide (NADH) as cofactor are of particular importance, because
the formate/formate dehydrogenase system represents an established method
to regenerate NADH efficiently. By contrast, for nicotinamide adenine din-
ucleotide phosphate (NADP)-dependent enzymes the cofactor-recycling sys-
tems that are available are much less efficient. The secondary specific alcohol
dehydrogenase (ADH), which catalyzes the oxidation of secondary alcohols
and, less readily, the reverse reaction (the reduction of ketones) has a promis-
ing future in biotechnology [209]. Although ADHs are widely distributed
among microorganisms, only few examples derived from hyperthermophilic
microorganisms are currently known. Among the extreme thermophilic bac-
teria, Thermoanaerobacter ethanolicus 39E was shown to produce an ADH,
whose gene was cloned and expressed in E. coli. Interestingly, a mutant has
been found to posses an advantage over the wild-type enzyme by using the
more-stable cofactor NAD instead of NADP [210–213]. An alcohol dehydro-

genase (ADH) was purified from an extremely thermophilic bacterium, Ther-
momicrobium roseum. The native enzyme is a homodimer of 43-kDa sub-
units. The pI of the enzyme was determined to be 6.2, while its optimum pH
is 10.0. The enzyme oxidized mainly primary aliphatic alcohols and exhibited
high substrate specificity towards ethanol, n-propanol and crotyl alcohol. The
highest reaction rate was observed when ethanol was used as substrate and
the Km value of the enzyme for ethanol was 24.2 mM. Pyrazole notably inhib-
ited the enzymatic activity. The enzyme had an optimal temperature of 70 ◦ C
and is highly stable [214, 215]. In addition, a novel NADH-dependent alcohol
dehydrogenase (RE-ADH) was found in Rhodococcus erythropolis. This ADH
catalyzes the reduction of ketones to the corresponding (S)-alcohols. The en-
zyme was purified and its biochemical characteristics were investigated. The
gene encoding for 348 amino acids was cloned in E. coli cells and successfully
expressed [216]. The subunit molecular mass as deduced from the amino acid
sequence was determined to be 36 kDa. The recombinant enzyme exhibits
high thermostability, which facilitated its purification by heat treatment, fol-
lowed by two column-chromatography steps. RE-ADH shows high similarity
to several zinc-containing medium-chain alcohol dehydrogenases. All zinc
ligands seem to be conserved except for one of the catalytic zinc ligands,
where Cys is probably substituted by Asp. In extreme thermophilic archaea,
ADHs have been studied from Sulfolobus solfataricus and Thermococcus stet-
teri [217, 218]. The enzyme from S. solfataricus requires NAD as a cofactor
and contains Zn ions. In contrast to ADHs from bacteria and Eukarya, the
enzyme from T. stetteri lacks metal ions. The enzyme catalyzes preferentially
the oxidation of primary alcohols, using NADP as cofactor and it is very ther-
mostable, showing half-lives of 15 min at 98 ◦ C and 2 h at 85 ◦ C. Compared
to mesophilic enzymes, the ADH from T. litoralis represents a new type of
alcohol-oxidizing enzyme system [217, 218]. The gene of ADHs from S. solfa-
taricus was expressed in E. coli and characterized.
In the field of biotechnology, esterases are gaining increasing attention
because of their application in organic biosynthesis. In aqueous solution,
esterases catalyze the hydrolytic cleavage of esters to form the constituent
acid and alcohol, whereas in organic solutions, the transesterification reac-
tion is promoted. Both the reactants and the products of transesterification
are usually highly soluble in the organic phase and the reactants may even
form the organic phase themselves. The lipA gene encoding a thermostable
esterase was cloned from Thermoanaerobacter tengcongensis and overex-
pressed in E. coli. The recombinant esterase, with a molecular mass of 43 kDa,
hydrolyzes tributyrin but not olive oil. The esterase was optimally active at
70 ◦ C (over 15 min) and at pH 9. It is highly thermostable, with a residual ac-
tivity greater than 80% after incubation at 50 ◦ C for more than 10 h [219]. An
esterase from the putative esterase gene selected from the total genome an-
alysis from the thermoacidophilic archaeon Sulfolobus tokodaii strain 7 was
cloned and expressed as a fusion protein in E. coli. The optimum activity

for ester cleavage against p-nitrophenyl esters was observed at around 70 ◦ C
and pH 7.5–8.0. The enzyme exhibits high thermostability and also shows ac-
tivity in a mixture of a buffer and water-miscible organic solvents, such as
acetonitrile and dimethyl sulfoxide. From the kinetic analysis, p-nitrophenyl
butyrate was found to be a better substrate than caproate and caprylate [220].
The Pyrococcus furiosus esterase gene was cloned in E. coli and the functional
properties were determined. The archaeal enzyme is the most thermostable
(a half-life of 50 min at 126 ◦ C) and thermoactive (temperature optimum
100 ◦ C) esterase known to date [221].
11
Amidases
Amidases [EC 3.5.1.4] catalyze the conversion of amides to the correspond-

ing carboxylic acids and ammonia, according to the following reaction:
RCONH2 + H2 O → RCOOH + NH3 . A number of amidases from bacteria
have been purified and characterized and the crystal structure of the peptide
amidase from Stenotrophomonas maltophilia [222] was also resolved recently.
Amidases exhibit different physicochemical characteristics and a diverse
substrate spectrum. The enzymes that lack the characteristic signature GGSS-
(GAS)-S [223] in the primary structure are only able to hydrolyze aliphatic
substrates. In contrast, amidases containing this signature are able to con-
vert cyclic and aromatic amides as well [224–228]. These amidases are
highly S-enantioselective, usually forming the optically pure acids with an
enantiomeric excess above 99% [229]. Only in chemical and pharmaceuti-
cal industries for the production of optically pure compounds [230–232],
drugs [225, 233], acrylic [234] and hydroxamic acids [235]. In general the
application of efficient biocatalysts in industrial processes allows the forma-
tion of highly pure products with a concomitant reduction of wastes [233].
Running such processes at elevated temperatures also has many advantages,
including significant improvement of transfer rates, higher substrate solubil-
ity and reduced risk of contamination. Very little, however, is known about
amidases that are active at high temperatures.
Three thermoactive amidases described so far were isolated from Bre-
vibacillus borstelensis BCS-1 [236], Klebsiella pneumoniae NCTR 1 [237]
and Sulfolobus solfataricus [238]. Very recently, the first thermoactive and
thermostable amidase from the thermophilic actinomycete Pseudonocardia
thermophila has been purified and characterized [239]. The amidase is ac-
tive over a broad pH (pH 4–9) and temperature range (40–80 ◦ C) and has
a half-life of 1.2 h at 70 ◦ C. The amidase has a broad substrate spectrum, in-
cluding aliphatic, aromatic and amino acid amides. The presence of a double
bond or a methyl group near the carboxamide group of aliphatic and amino
acid amides enhances the enzymatic activity. The highest acyl transferase
activity was detected with hexanoamide, isobutyramide and propionamide.
The amidase is highly S-stereoselective for 2-phenylpropionamide; and the
racemic amide was converted to the corresponding S-acid with an enan-
tiomeric excess of > 95% at 50% conversion of the substrate. In contrast, the
d,l-tryptophanamide and d,l-methioninamide were converted to the corres-
ponding d,l-acids at the same rate.
12
DNA-processing enzymes
12.1
Polymerase chain reaction (PCR)
DNA polymerases (EC 2.7.7.7) are the key enzymes in the replication of cel-
lular information present in all life forms. They catalyze, in the presence of
Mg2+ -ions, the addition of a deoxyribonucleotide 5 -triphosphate onto the
growing 3 -OH end of a primer strand, forming complementary base pairs to
a second strand. More than 100 DNA polymerase genes have been cloned and
sequenced from various organisms, including thermophilic bacteria and ar-
chaea [256]. Thermostable DNA polymerases play a major role in a variety
of molecular biological applications, e.g. DNA amplification, sequencing or
labelling (Table 7).
One of the most important advances in molecular biology during the last
ten years is the development of polymerase chain reaction (PCR) [257–259].
The first described PCR procedure utilized the Klenow fragment of E. coli
DNA polymerase I, which was heat-labile and had to be added during each
cycle following the denaturation and primer-hybridization steps. Introduc-
tion of thermostable DNA polymerases in PCR facilitated the automation
of the thermal cycling part of the procedure. The DNA polymerase I from
the bacterium Thermus aquaticus, called Taq polymerase, was the first ther-
mostable DNA polymerase characterized and applied in PCR.
The Taq polymerase has a 5 -3 -exonuclease activity, but no detectable 3 -
5 -exonuclease activity. Due to the absence of a 3 -5 -exonuclease activity,

this enzyme is unable to excise mismatches and, as a result, the base in-
sertion fidelity is low. The use of high-fidelity DNA polymerases is essential
for reducing the increase of amplification errors in PCR products that will
be cloned, sequenced and expressed. Several thermostable DNA polymerases
with 3 -5 -exonuclease-dependent proofreading activity have been described
and the error rates (number of misincorporated nucleotides per base syn-
thesized) for these enzymes have been determined. A thermostable DNA
polymerase from Thermotoga maritima was reported to have a 3 -5 -exo-
nuclease activity [260]. Archaeal proofreading polymerases such as Pwo pol
Table 7 The most commonly used thermoactive DNA polymerases
Enzyme Organism of origin
Bacterial DNA polymerases

Taq pol I Thermus aquaticus
Tth pol Thermus thermophilus
Tfi pol Thermus filiformis
Tfl pol Thermus flavus
Tca pol Thermus caldophilus GK24
BstI pol Bacillus stearothermophilus
Tma pol Thermotoga maritima
Archaeal DNA polymerases
Pwo pol Pyrococcus woesei
Pfu pol Pyrococcus furiosus
DeepVent pol Pyrococcus sp. GB-D
KOD1 pol Pyrococcus sp. KOD1
Vent pol Thermococcus litoralis
9◦ N-7 pol Thermococcus sp. 9◦ N-7
from Pyrococcus woesei, Pfu pol from Pyrococcus furiosus, Deep Vent™ pol
from Pyrococcus strain GB-D [261–268] or Vent™ pol from Thermococcus
litoralis [269–274] have an error rate that is up to ten times lower than that
of Taq polymerase. The 9◦ N-7 has a fivefold higher 3 -5 -exonuclease activity
than T. litoralis DNA polymerase. However, Taq polymerase was not replaced
by these DNA polymerases because of their low extension rates among other
factors. DNA polymerases with higher fidelity are not necessarily suitable
for amplification of long DNA fragments because of their potentially strong
exonuclease activity. The recombinant KOD1 DNA polymerase from Ther-
mococcus kodakaraensis KOD1 has been reported to show low error rates
(similar values to those of Pfu), high processivity (persistence of sequential
nucleotide polymerization) and high extension rates, resulting in an accurate
amplification of target DNA sequences up to 6 kb [275–278]. To optimize the
delicate competition of polymerase and exonuclease activity, the exo-motif of
the The 9◦ N-7 DNA polymerase was mutated in an attempt to reduce the level
of exonuclease activity without totally eliminating it. An additional problem
in the performance of PCR is the generation of nonspecific templates prior to
thermal cycling. Several approaches have been made to prevent the elonga-
tion of polymerase before cycling temperatures are reached. As well as using
wax as a mechanical barrier between DNA and the enzyme, more sophisti-
cated methods were invented such as the inhibition of Taq polymerase by
a neutralizing antibody at mesophilic temperatures or heat-mediated activa-
tion of the immobilized enzyme.
Recently, the PCR technique has been improved to allow low-error synthe-
sis of long amplificates (20–40 kb) by adding small amounts of thermostable,
archaeal proofreading DNA polymerases, containing 3 -5 -exonuclease activ-
ity, to Taq or other non-proofreading DNA polymerases. In this long PCR, the
reaction conditions are optimized for long extension by adding different com-
ponents such as gelatin, Triton X-100 or bovine serum albumin to stabilize
the enzymes and mineral oil to prevent evaporation of water in the reaction
mixture. In order to enhance specificity, glycerol or formamide are added.
12.2
DNA sequencing
DNA sequencing by the Sanger method [279] has undergone countless re-
finements in the last 20 years. A major step forward was the introduction of
thermostable DNA polymerases leading in the cycle sequencing procedure.
This method uses repeated cycles of temperature denaturation, annealing and
extension with dideoxy-termination to increase the amount of sequencing
product by recycling the template DNA. Due to this “PCR-like” amplification
of the sequencing products several problems could be overcome. Caused by
the cycle denaturation, only fmoles of template DNA are required, no sep-
arate primer annealing step is needed and unwanted secondary structures
within the template are resolved at high-temperature elongation. The first en-
zyme used for cycle sequencing was the thermostable DNA polymerase I from
Thermus aquaticus [280, 281]. As described by Longley et al. (118) the enzyme
displays 5 -3 -exonuclease activity that is undesirable because of the degrada-
tion of sequencing fragments. A combination of thermostable enzymes has
been developed that produces higher quality cycle sequences. Thermo Se-
quenase DNA polymerase is a thermostable enzyme engineered to catalyze
the incorporation of ddNTPs with an efficiency several thousand times better
than other thermostable DNA polymerases. Since the enzyme also catalyzes
pyrophosphorolysis at dideoxy termini, a thermostable inorganic pyrophos-
phatase is needed to remove the pyrophosphate produced during sequencing
reactions. Thermoplasma acidophilum inorganic pyrophosphatase (TAP) is
thermostable and effective for converting pyrophosphate to orthophosphate.
The use of the combination of Thermo Sequenase polymerase and TAP for
cycle sequencing yields sequence data with uniform band intensities, allow-
ing the determination of longer, more accurate sequence reads. Uniform band
intensities also facilitate interpretation of sequence anomalies and the pres-
ence of mixed templates. Sequencing PCR products of DNA amplified from
heterozygous diploid individuals results in signals of equal intensity from
each allele [282].
12.3
Ligase chain reaction
A variety of analytical methods are based on the use of thermostable lig-

ases. Of considerable potential is the construction of sequencing primers by
high-temperature ligation of hexameric primers [283], the detection of trin-
ucleotide repeats through repeat expansion detection (RED) [284] or DNA
detection by circularization of oligonucleotides [285]. Over the years sev-
eral additional thermostable DNA ligases were discovered. Bacterial enzymes
were derived and cloned from Thermus scotoductus and Rhodothermus mar-
inus [286–289]. Recent studies in the crude extract of 103 strains of the
genera Thermus, Bacillus, Rhodothermus and Hydrogenobacter revealed the
presence of thermostable DNA ligases in 23 of the Thermus strains [290].
To date an archaeal DNA ligase has been described from Desulfurolobus am-
bivalens [291]. Unlike bacterial enzymes, this ligase is NAD+ -independent but
ATP-dependent similar to the enzymes from bacteriophages, eukaryotes and
viruses. A gene encoding DNA ligase (ligTk) from a hyperthermophilic ar-
chaeon, Thermococcus kodakaraensis KOD1, has been cloned and sequenced,
and its protein product has been characterized: ligTk consists of 1686 bp,
corresponding to a polypeptide of 562 amino acids with a predicted molecu-
lar mass of 64 079 Da. Sequence comparison with previously reported DNA
ligases and the presence of conserved motifs suggested that ligTk was an
ATP-dependent DNA ligase. Phylogenetic analysis indicated that ligTk was
closely related to the ATP-dependent DNA ligase from Methanobacterium
thermoautotrophicum H, a moderately thermophilic archaeon, along with
putative DNA ligases from Euryarchaeota and Crenarchaeota. Recombinant
ligTk was monomeric, as is the case for other DNA ligases. The protein
displayed DNA ligase activity in the presence of ATP and Mg2+ . The opti-
mum pH of ligTk was 8.0, the optimum concentration of Mg2+ , which was
indispensable for the enzyme activity, was 14 to 18 mM, and the optimum
concentration of K+ was 10 to 30 mM. ligTk did not display single-stranded
DNA ligase activity. At enzyme concentrations of 200 nM, significant DNA
ligase activity was observed even at 100 ◦ C. Unexpectedly, ligTk displayed
a relatively small, but significant, DNA ligase activity when NAD+ was added
as cofactor. Treatment of NAD+ with hexokinase did not affect this activ-
ity, excluding the possibility of contaminant ATP in the NAD+ solution. This
unique cofactor specificity was also supported by the observation of adeny-
lation of ligTk with NAD+ . This was the first biochemical study of a DNA
ligase from a hyperthermophilic archaeon [292]. The ability of DNA ligases to
use either ATP or NAD+ as a cofactor appears to be specific to DNA ligases
from Thermococcales. An archaeal DNA ligase has been cloned from Ther-
mococcus fumicolans (Tfu). The optimum temperature and pH of Tfu DNA
ligase were 65 ◦ C and 7.0, respectively. The optimum concentration of MgCl2 ,
which is indispensable for the enzyme activity, was 2 mM. Tfu DNA ligase dis-
plays nick joining and blunt-end ligation activity using either ATP or NAD+ ,
as a cofactor [293].
13
Conclusion
Owing to their properties such as activity over a wide temperature and pH

range, substrate specificity, stability in organic solvents, diverse substrate
range and enantioselectivity, biocatalysts from extremophilic microorgan-
isms will represent the choice for countless future applications in industry.
Their importance is increasing daily in several fields, such as food additives,
detergent industry, chemicals, pharmaceuticals, etc. The growing demand for
more robust biocatalysts has shifted the trend towards improving the prop-
erties of existing proteins for established industrial processes and producing
new enzymes that are tailor-made for entirely new areas of application. Cur-
rently, the number of novel microbial extremophilic enzymes being cloned
and biochemically characterized is steadily increasing. New technologies such
as genomics, metanogenomics, gene shuffling, and DNA evolution provide
valuable tools for improving or adapting enzyme properties to the desired
requirements. However, the success of these techniques demands the pro-
duction of recombinant enzymes at a high level, allowing experimental trials
and application tests. Thus, the modern methods of genetic engineering com-
bined with an increasing knowledge of structure, function relationship and
process engineering will allow further adaptation of enzymes to industrial
needs, the exploration of novel applications and protection of the environ-
ment.
References
1. Woese CR, Kandler O, Wheelis ML (1990) Proc Natl Acad Sci USA 87:4576
2. Woese CR, Achenbach L, Rouviere P, Mandelco L (1991) Syst Appl Microbiol 14:364
3. Lorenz P, Liebeton K, Niehaus F, Eck J (2002) Curr Opin Biotechnol 13:572
4. Kauffmann IM, Schmitt J, Schmid RD (2004) Appl Microbiol Biotechnol 64:665
5. Beja O (2004) Curr Opin Biotechnol 15:187
6. Beja O, Suzuki MT, Heidelberg JF, Nelson WC, Preston CM, Hamada T, Eisen JA,
Fraser CM, DeLong EF (2002) Nature 415:630
7. Beja O, Koonin EV, Aravind L, Taylor LT, Seitz H, Stein JL, Bensen DC, Feldman RA,
Swanson RV, DeLong EF (2002) Appl Environ Microbiol 68:335
8. Beja O, Suzuki MT, Koonin EV, Aravind L, Hadd A, Nguyen LP, Villacorta R, Amjadi
M, Garrigues C, Jovanovich SB, Feldman RA, DeLong EF (2000) Environ Microbiol
2:516
9. Beja O, Aravind L, Koonin EV, Suzuki MT, Hadd A, Nguyen LP, Jovanovich SB, Gates
CM, Feldman RA, Spudich JL, Spudich EN, DeLong EF (2000) Science 289:1902
10. Henne A, Schmitz RA, Bomeke M, Gottschalk G, Daniel R (2000) Appl Environ
Microbiol 66:3113
11. Healy FG, Ray RM, Aldrich HC, Wilkie AC, Ingram LO, Shanmugam KT (1995) Appl
12. Richardson TH, Tan X, Frey G, Callen W, Cabell M, Lam D, Macomber J, Short JM,
Robertson DE, Miller C (2002) J Biol Chem 277:26 501
13. Cottrell MT, Moore JA, Kirchman DL (1999) Appl Environ Microbiol 65:2553
14. Cottrell MT, Wood DN, Yu L, Kirchman DL (2000) Appl Environ Microbiol 66:1195
15. Rondon MR, Raffel SJ, Goodman RM, Handelsman J (1999) Proc Natl Acad Sci USA
96:6451
16. Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loia-
cono KA, Lynch BA, MacNeil IA, Minor C, Tiong CL, Gilman M, Osburne MS,
Clardy J, Handelsman J, Goodman RM (2000) Appl Environ Microbiol 66:2541
17. Torsvik V, Ovreas L (2002) Curr Opin Microbiol 5:240
18. Torsvik V, Ovreas L, Thingstad TF (2002) Science 296:1064
19. Entcheva P, Liebl W, Johann A, Hartsch T, Streit WR (2001) Appl Environ Microbiol
67:89
20. Voget S, Leggewie C, Uesbeck A, Raasch C, Jaeger KE, Streit WR (2003) Appl Environ
Microbiol 69:6235
21. Lorenz P, Scleper C (2002) J Mol Catal B 19–20:13
22. Morita RY (1975) Bacteriol Rev 39:144
23. Gerday C, Aittaleb M, Bentahir M, Chessa JP, Claverie P, Collins T, D’Amico S, Du-
mont J, Garsoux G, Georlette D, Hoyoux A, Lonhienne T, Meuwis MA, Feller G (2000)
Trends Biotechnol 18:103
24. Lonhienne T, Gerday C, Feller G (2000) Biochim Biophys Acta 1543:1
25. Stetter KO (1996) Ciba Found Symp 202:1
26. Huber R, Huber H, Stetter KO (2000) FEMS Microbiol Rev 24:615
27. Segerer AH, Burggraf S, Fiala G, Huber G, Huber R, Pley U, Stetter KO (1993) Orig
Life Evol Biosph 23:77
28. Stetter KO (1999) FEBS Lett 452:22
29. Lien T, Madsen M, Rainey FA, Birkeland NK (1998) Int J Syst Bacteriol 48 Pt 3:1007
30. Woese CR, Fox GE (1977) Proc Natl Acad Sci USA 74:5088
31. Jan RL, Wu J, Chaw SM, Tsai CW, Tsen SD (1999) Int J Syst Bacteriol 49 Pt 4:1809
32. Xiang X, Dong X, Huang L (2003) Extremophiles 7:493
33. He ZG, Zhong H, Li Y (2004) Curr Microbiol 48:159
34. Searcy DG, Stein DB (1980) Biochim Biophys Acta 609:180
35. Schleper C, Puehler G, Holz I, Gambacorta A, Janekovic D, Santarius U, Klenk HP,
Zillig W (1995) J Bacteriol 177:7050
36. Smith PF (1980) Biochim Biophys Acta 619:367
37. van de Vossenberg, Driessen AJ, Zillig W, Konings WN (1998) Extremophiles 2:67
38. Futterer O, Angelov A, Liesegang H, Gottschalk G, Schleper C, Schepers B, Dock C,
Antranikian G, Liebl W (2004) Proc Natl Acad Sci USA 101:9091
39. Bandeiras TM, Salgueiro CA, Huber H, Gomes CM, Teixeira M (2003) Biochim Bio-
phys Acta 1557:13
40. Nemati M, Lowenadler J, Harrison ST (2000) Appl Microbiol Biotechnol 53:173
41. Burton NP, Williams TD, Norris PR (1999) Arch Microbiol 172:349
42. Gomes CM, Huber H, Stetter KO, Teixeira M (1998) FEBS Lett 432:99
43. Brierley CL, Brierley JA (1973) Can J Microbiol 19:183
44. Kurosawa N, Itoh YH, Itoh T (2003) Int J Syst Evol Microbiol 53:1607
45. Krulwich TA, Guffanti AA, Ito M (1999) Novartis Found Symp 221:167
46. Horikoshi K (1999) Microbiol Mol Biol Rev 63:735

47. Jones BE, Grant WD, Duckworth AW, Owenson GG (1998) Extremophiles 2:191
48. Wiegel J, Kevbrin VV (2004) Biochem Soc Trans 32:193
49. Prowe SG, Antranikian G (2001) Int J Syst Evol Microbiol 51:457
50. Engle M, Li Y, Woese C, Wiegel J (1995) Int J Syst Bacteriol 45:454
51. Keller M, Braun FJ, Dirmeier R, Hafenbradl D, Burggraf S, Rachel R, Stetter KO
(1995) Arch Microbiol 164:390
52. Dirmeier R, Keller M, Hafenbradl D, Braun FJ, Rachel R, Burggraf S, Stetter KO
(1998) Extremophiles 2:109
53. Litchfield CD, Gillevet PM (2002) J Ind Microbiol Biotechnol 28:48
54. Sanchez-Porro C, Martin S, Mellado E, Ventosa A (2003) J Appl Microbiol 94:295
55. Ventosa A, Marquez MC, Garabito MJ, Arahal DR (1998) Extremophiles 2:297
56. Ollivier B, Caumette P, Garcia JL, Mah RA (1994) Microbiol Rev 58:27
57. Ventosa A, Nieto JJ, Oren A (1998) Microbiol Mol Biol Rev 62:504
58. Liebl W (2001) Methods Enzymol 330:290
59. Bronnenmeier K, Kern A, Liebl W, Staudenbauer WL (1995) Appl Environ Microbiol
61:1399
60. Bok JD, Yernool DA, Eveleigh DE (1998) Appl Environ Microbiol 64:4774
61. Te’o VS, Saul DJ, Bergquist PL (1995) Appl Microbiol Biotechnol 43:291
62. Saul DJ, Williams LC, Grayling RA, Chamley LW, Love DR, Bergquist PL (1990) Appl
63. Saul DJ, Williams LC, Love DR, Chamley LW, Bergquist PL (1989) Nucleic Acids Res
17:439
64. Ruttersmith LD, Daniel RM (1991) Biochem J 277 (Pt 3):887
65. Halldorsdottir S, Thorolfsdottir ET, Spilliaert R, Johansson M, Thorbjarnardottir SH,
Palsdottir A, Hreggvidsson GO, Kristjansson JK, Holst O, Eggertsson G (1998) Appl
66. Crennell SJ, Hreggvidsson GO, Nordberg Karlsson E (2002) J Mol Biol 320:883
67. Bauer MW, Driskill LE, Callen W, Snead MA, Mathur EJ, Kelly RM (1999) J Bacteriol
181:284
68. Moracci M, Ciaramella M, Rossi M (2001) Methods Enzymol 330:201
69. Bauer MW, Bylina EJ, Swanson RV, Kelly RM (1996) J Biol Chem 271:23 749
70. Bauer MW, Kelly RM (1998) Biochemistry 37:17 170
71. Nucci R, Moracci M, Vaccaro C, Vespa N, Rossi M (1993) Biotechnol Appl Biochem
17 (Pt 2):239
72. Moracci M, Nucci R, Febbraio F, Vaccaro C, Vespa N, La Cara F, Rossi M (1995)
Enzyme Microb Technol 17:992
73. Sivori AS, Mercuri OA, Forchiassin F (1996) Rev Argent Microbiol 28:9
74. Durrant LR, Mello AB, Reginatto V (1992) Biochem Soc Trans 20:227S
75. Allen WG (1976) Biotechnol Bioeng Symp 6:303
76. Schulein M (2000) Biochim Biophys Acta 1543:239
77. Jeffries TW (1996) Curr Opin Biotechnol 7:337
78. Te’o VS, Cziferszky AE, Bergquist PL, Nevalainen KM (2000) FEMS Microbiol Lett
190:13
79. McCarthy AA, Morris DD, Bergquist PL, Baker EN (2000) Acta Crystallogr D Biol
Crystallogr 56 (Pt 11):1367
80. Simpson HD, Haufler UR, Daniel RM (1991) Biochem J 277 (Pt 2):413
81. Winterhalter C, Heinrich P, Candussio A, Wich G, Liebl W (1995) Mol Microbiol
15:431
82. Velikodvorskaya TV, Volkov I, Vasilevko VT, Zverlov VV, Piruzian ES (1997) Bio-
chemistry (Mosc) 62:66
83. Zverlov V, Piotukh K, Dakhova O, Velikodvorskaya G, Borriss R (1996) Appl Micro-
biol Biotechnol 45:245
84. Walsh DJ, Gibbs MD, Bergquist PL (1998) Extremophiles 2:9
85. Meissner K, Wassenberg D, Liebl W (2000) Mol Microbiol 36:898
86. Lama L, Calandrelli V, Gambacorta A, Nicolaus B (2004) Res Microbiol 155:283
87. Teplitsky A, Mechaly A, Stojanoff V, Sainz G, Golan G, Feinberg H, Gilboa R, Rei-
land V, Zolotnitsky G, Shallom D, Thompson A, Shoham Y, Shoham G (2004) Acta
Crystallogr D Biol Crystallogr 60:836
88. Andrade CM, Aguiar WB, Antranikian G (2001) Appl Biochem Biotechnol 91-93:655
89. Waino M, Ingvorsen K (2003) Extremophiles 7:87
90. Linko M, Viikari L, Suihko ML (1984) Biotechnol Adv 2:233
91. Oksanen T, Pere J, Paavilainen L, Buchert J, Viikari L (2000) J Biotechnol 78:39
92. Schink B, Zeikus JB (1983) FEMS Microbiol Lett 17:295
93. Tamaru Y, Doi RH (2001) Proc Natl Acad Sci USA 98:4125
94. Van Rijssel M, Gerwig GJ, Hansen TA (1993) Appl Environ Microbiol 59:828
95. Hoondal GS, Tiwari RP, Tewari R, Dahiya N, Beg QK (2002) Appl Microbiol Biotech-
nol 59:409
96. Kashyap DR, Vohra PK, Chopra S, Tewari R (2001) Bioresour Technol 77:215
97. Herron SR, Benen JA, Scavetta RD, Visser J, Jurnak F (2000) Proc Natl Acad Sci USA
97:8762
98. Prade RA, Zhan D, Ayoubi P, Mort AJ (1999) Biotechnol Genet Eng Rev 16:361
99. Lang C, Dornenburg H (2000) Appl Microbiol Biotechnol 53:366
100. Sakai T, Sakamoto T, Hallaert J, Vandamme EJ (1993) Adv Appl Microbiol 39:213
101. Rexova-Benkova L, Markovic O (1976) Adv Carbohydr Chem Biochem 33:323
102. Kozianowski G, Canganella F, Rainey FA, Hippe H, Antranikian G (1997) Ex-
tremophiles 1:171
103. Kluskens LD, van Alebeek GJ, Voragen AG, de Vos WM, van der Oost J (2003)
Biochem J 370:651
104. Cohen-Kupiec R, Chet I (1998) Curr Opin Biotechnol 9:270
105. Koga D, Mitsutomi M, Kono M, Matsumiya M (1999) EXS 87:111
106. Fukamizo T (2000) Curr Protein Pept Sci 1:105
107. Takayanagi T, Ajisaka K, Takiguchi Y, Shimahara K (1991) Biochim Biophys Acta
1078:404
108. Sakai K, Yokota A, Kurokawa H, Wakayama M, Moriguchi M (1998) Appl Environ
Microbiol 64:3397
109. Tsujibo H, Minoura K, Miyamoto K, Endo H, Moriwaki M, Inamori Y (1993) Appl
110. Andronopoulou E, Vorgias CE (2004) Protein Expr Purif 35:264
111. Imanaka T, Fukui T, Fujiwara S (2001) Methods Enzymol 330:319
112. Tanaka T, Fujiwara S, Nishikori S, Fukui T, Takagi M, Imanaka T (1999) Appl Environ
Microbiol 65:5338
113. Gao J, Bauer MW, Shockley KR, Pysz MA, Kelly RM (2003) Appl Environ Microbiol
69:3119
114. Grzybowska B, Szweda P, Synowiecki J (2004) Mol Biotechnol 26:101
115. Berk H, Lebbink RJ (2003) Methods Mol Biol 230:127
116. Linden A, Mayans O, Meyer-Klaucke W, Antranikian G, Wilmanns M (2003) J Biol
Chem 278:9875
117. Savchenko A, Vieille C, Kang S, Zeikus JG (2002) Biochemistry 41:6193
118. Savchenko A, Vieille C, Zeikus JG (2001) Methods Enzymol 330:354

119. Leveque E, Haye B, Belarbi A (2000) FEMS Microbiol Lett 186:67
120. Canganella F, Gambacorta A, Kato C, Horikoshi K (2000) Microbiol Res 154:297
121. Kato M, Miura Y, Kettoku M, Shindo K, Iwamatsu A, Kobayashi K (1996) Biosci
122. Kobayashi K, Kato M, Miura Y, Kettoku M, Komeda T, Iwamatsu A (1996) Biosci
123. Haseltine C, Rolfsmeier M, Blum P (1996) J Bacteriol 178:945
124. Lee J, Kanai H, Kobayashi T, Akiba T, Kudo T (1996) J Ferment Bioeng 82:432
125. Tachibana Y, Mendez L, Fujiwara S, Takagi M, Imanaka T (1996) J Ferment Bioeng
82:224
126. Liebl W, Stemplinger I, Ruile P (1997) J Bacteriol 179:941
127. Horinouchi S, Fukusumi S, Ohshima T, Beppu T (1988) Eur J Biochem 176:243
128. Fukusumi S, Kamizono A, Horinouchi S, Beppu T (1988) Eur J Biochem 174:15
129. Ducki A, Grundmann O, Konermann L, Mayer F, Hoppert M (1998) J Gen Appl
Microbiol 44:327
130. Ganghofner D, Kellermann J, Staudenbauer WL, Bronnenmeier K (1998) Biosci
131. Coutinho PM, Reilly PJ (1994) Protein Eng 7:749
132. Coutinho PM, Reilly PJ (1994) Protein Eng 7:393
133. Ohnishi H, Matsumoto H, Sakai H, Ohta T (1994) J Biol Chem 269:3503
134. Ohnishi H, Kitamura H, Minowa T, Sakai H, Ohta T (1992) Eur J Biochem 207:413
135. Paquet V, Croux C, Goma G, Soucaille P (1991) Appl Environ Microbiol 57:212
136. Glushchenko EV, Kozlov DG, Podkovyrov SM, Mogutov MA (1990) Mol Biol (Mosk)
24:744
137. Kozlov DG, Kurepina NE, Glushchenko EV, Mogutov MA, Podkovyrov SM (1990)
Mol Biol (Mosk) 24:736
138. Saha BC, Mathupala SP, Zeikus JG (1988) Biochem J 252:343
139. Hyun HH, Shen GJ, Zeikus JG (1985) J Bacteriol 164:1153
140. Hyun HH, Zeikus JG (1985) J Bacteriol 164:1146
141. Hyun HH, Zeikus JG (1985) J Bacteriol 164:1162
142. Serour E, Antranikian G (2002) Antonie Van Leeuwenhoek 81:73
143. Kim MS, Park JT, Kim YW, Lee HS, Nyawira R, Shin HS, Park CS, Yoo SH, Kim YR,
Moon TW, Park KH (2004) Appl Environ Microbiol 70:3933
144. Chang ST, Parker KN, Bauer MW, Kelly RM (2001) Methods Enzymol 330:260
145. Galichet A, Belarbi A (1999) FEBS Lett 458:188
146. Xavier KB, Peist R, Kossmann M, Boos W, Santos H (1999) J Bacteriol 181:3358
147. Schicho RN, Ma K, Adams MW, Kelly RM (1993) J Bacteriol 175:1823
148. Costantino HR, Brown SH, Kelly RM (1990) J Bacteriol 172:3654
149. Miura Y, Kettoku M, Kato M, Kobayashi K, Kondo K (1999) J Mol Microbiol Biotech-
nol 1:129
150. Campbell BS, Siddique AB, McDougall BM, Seviour RJ (2004) FEMS Microbiol Lett
232:225
151. Bertoldo C, Antranikian G (2002) Curr Opin Chem Biol 6:151
152. Bertoldo C, Antranikian G (2001) Methods Enzymol 330:269
153. Dong G, Vieille C, Zeikus JG (1997) Appl Environ Microbiol 63:3577
154. Canganella F, Jones WJ, Gambacorta A, Antranikian G (1997) Arch Microbiol
167:233
155. Duffner F, Bertoldo C, Andersen JT, Wagner K, Antranikian G (2000) J Bacteriol
182:6331
156. Erra-Pujada M, Debeire P, Duchiron F, O’Donohue MJ (1999) J Bacteriol 181:3284

157. Niehaus F, Peters A, Groudieva T, Antranikian G (2000) FEMS Microbiol Lett 190:223
158. Knapp S, Rudiger A, Antranikian G, Jorgensen PL, Ladenstein R (1995) Proteins
23:595
159. Rudiger A, Jorgensen PL, Antranikian G (1995) Appl Environ Microbiol 61:567
160. Schwerdtfeger RM, Chiaraluce R, Consalvi V, Scandurra R, Antranikian G (1999) Eur
J Biochem 264:479
161. Zona R, Chang-Pi-Hin F, O’Donohue MJ, Janecek S (2004) Eur J Biochem 271:2863
162. Kang S, Vieille C, Zeikus JG (2005) Appl Microbiol Biotechnol 66:408
163. Kim CH, Nashiru O, Ko JH (1996) FEMS Microbiol Lett 138:147
164. Bertoldo C, Duffner F, Jorgensen PL, Antranikian G (1999) Appl Environ Microbiol
65:2084
165. Lebbink JH, Bertoldo C, Tibbelin G, Andersen JT, Duffner F, Antranikian G, Laden-
stein R (2000) Acta Crystallogr D Biol Crystallogr 56 (Pt 11):1470
166. Koch R, Canganella F, Hippe H, Jahnke K, Antranikian G (1997) Appl Environ Mi-
crobiol 63:1088
167. Bibel M, Brettl C, Gosslar U, Kriegshauser G, Liebl W (1998) FEMS Microbiol Lett
158:9
168. Bertoldo C, Armbrecht M, Becker F, Schafer T, Antranikian G, Liebl W (2004) Appl
169. Wind RD, Liebl W, Buitelaar RM, Penninga D, Spreinat A, Dijkhuizen L, Bahl H
(1995) Appl Environ Microbiol 61:1257
170. Knegtel RM, Wind RD, Rozeboom HJ, Kalk KH, Buitelaar RM, Dijkhuizen L, Dijkstra
BW (1996) J Mol Biol 256:611
171. Tachibana Y, Kuramura A, Shirasaka N, Suzuki Y, Yamamoto T, Fujiwara S, Takagi M,
Imanaka T (1999) Appl Environ Microbiol 65:1991
172. Biwer A, Antranikian G, Heinzle E (2002) Appl Microbiol Biotechnol 59:609
173. Cowan DA, Smolenski KA, Daniel RM, Morgan HW (1987) Biochem J 247:121
174. Guagliardi A, Cerchia L, Rossi M (2002) Biochem J 368:357
175. Burlini N, Magnani P, Villa A, Macchi F, Tortora P, Guerritore A (1992) Biochim
Biophys Acta 1122:283
176. Mayr J, Lupas A, Kellermann J, Eckerskorn C, Baumeister W, Peters J (1996) Curr
Biol 6:739
177. Kannan Y, Koga Y, Inoue Y, Haruki M, Takagi M, Imanaka T, Morikawa M, Kanaya S
(2001) Appl Environ Microbiol 67:2445
178. Morikawa M, Imanaka T (2001) Methods Enzymol 330:424
179. Volkl P, Markiewicz P, Stetter KO, Miller JH (1994) Protein Sci 3:1329
180. Chang LS, Hicks PM, Kelly RM (2001) Methods Enzymol 330:403
181. Morikawa M, Izawa Y, Rashid N, Hoaki T, Imanaka T (1994) Appl Environ Microbiol
60:4559
182. Klingeberg M, Galunsky B, Sjoholm C, Kasche V, Antranikian G (1995) Appl Environ
Microbiol 61:3098
183. Chavez Croocker P, Sako Y, Uchida A (1999) Extremophiles 3:3
184. Sako Y, Croocker PC, Ishida Y (1997) FEBS Lett 415:329
185. Catara G, Ruggiero G, La Cara F, Digilio FA, Capasso A, Rossi M (2003) Ex-
tremophiles 7:391
186. Voorhorst WG, Eggen RI, Geerling AC, Platteeuw C, Siezen RJ, Vos WM (1996) J Biol
Chem 271:20 426
187. de Vos WM, Voorhorst WG, Dijkgraaf M, Kluskens LD, Van der Oost J, Siezen RJ
(2001) Methods Enzymol 330:383
188. Voorhorst WG, Warner A, de Vos WM, Siezen RJ (1997) Protein Eng 10:905
189. Choi IG, Bang WG, Kim SH, Yu YG (1999) J Biol Chem 274:881
190. Lin X, Fusek M, Tang J (1991) Adv Exp Med Biol 306:255
191. Fusek M, Lin XL, Tang J (1990) J Biol Chem 265:1496
192. Lin X, Tang J (1990) J Biol Chem 265:1490
193. Fujiwara S, Okuyama S, Imanaka T (1996) Gene 179:165
194. Friedrich A, Antranikian G (1996) Appl Environ Microbiol 62:2875
195. Kim JS, Kluskens LD, de Vos WM, Huber R, van der Oost J (2004) J Mol Biol 335:787
196. Kluskens LD, Voorhorst WG, Siezen RJ, Schwerdtfeger RM, Antranikian G, van der
Oost J, de Vos WM (2002) Extremophiles 6:185
197. Lesuisse E, Schanck K, Colson C (1993) Eur J Biochem 216:155
198. Sinchaikul S, Sookkheo B, Phutrakul S, Pan FM, Chen ST (2001) Protein Expr Purif
22:388
199. Cho AR, Yoo SK, Kim EJ (2000) FEMS Microbiol Lett 186:235
200. Lee D, Koh Y, Kim K, Kim B, Choi H, Kim D, Suhartono MT, Pyun Y (1999) FEMS
Microbiol Lett 179:393
201. Tyndall JD, Sinchaikul S, Fothergill-Gilmore LA, Taylor P, Walkinshaw MD (2002) J
Mol Biol 323:859
202. Crabb WD, Shetty JK (1999) Curr Opin Microbiol 2:252
203. Park BC, Koh S, Chang C, Suh SW, Lee DS, Byun SM (1997) Appl Biochem Biotechnol
62:15
204. Liu SY, Wiegel J, Gherardini FC (1996) J Bacteriol 178:5938
205. Vieille C, Hess JM, Kelly RM, Zeikus JG (1995) Appl Environ Microbiol 61:1867
206. Vieille C, Sriprapundh D, Kelly RM, Zeikus JG (2001) Methods Enzymol 330:215
207. Hess JM, Kelly RM (1999) Biotechnol Bioeng 62:509
208. Hess JM, Tchernajenko V, Vieille C, Zeikus JG, Kelly RM (1998) Appl Environ Micro-
biol 64:2357
209. Cowan D (1996) Trends Biotech 14:177
210. Burdette DS, Vieille C, Zeikus JG (1996) Biochem J 316 (Pt 1):115
211. Burdette DS, Jung SH, Shen GJ, Hollingsworth RI, Zeikus JG (2002) Appl Environ
Microbiol 68:1914
212. Burdette DS, Tchernajencko VV, Zeikus JG (2000) Enzyme Microb Technol 27:11
213. Burdette DS, Secundo F, Phillips RS, Dong J, Scott RA, Zeikus JG (1997) Biochem J
326 (Pt 3):717
214. Yoon SY, Noh HS, Kim EH, Kong KH (2002) Comp Biochem Physiol B Biochem Mol
Biol 132:415
215. Kong KH, Hong MP, Choi SS, Kim YT, Cho SH (2000) Biotechnol Appl Biochem 31
(Pt 2):113
216. Abokitse K, Hummel W (2003) Appl Microbiol Biotechnol 62:380
217. Ma K, Adams MW (2001) Methods Enzymol 331:195
218. Li D, Stevenson KJ (2001) Methods Enzymol 331:201
219. Zhang J, Liu J, Zhou J, Ren Y, Dai X, Xiang H (2003) Biotechnol Lett 25:1463
220. Suzuki Y, Miyamoto K, Ohta H (2004) FEMS Microbiol Lett 236:97
221. Ikeda M, Clark DS (1998) Biotechnol Bioeng 57:624
222. Labahn J, Neumann S, Buldt G, Kula MR, Granzin J (2002) J Mol Biol 322:1053
223. Chebrou H, Bigey F, Arnaud A, Galzy P (1996) Biochim Biophys Acta 1298:285
224. Kobayashi M, Komeda H, Nagasawa T, Nishiyama M, Horinouchi S, Beppu T, Ya-
mada H, Shimizu S (1993) Eur J Biochem 217:327
225. Ciskanik l, Wilczek JM, Fallon RD (1995) Appl Environ Microbiol 61:998
226. Trott S, Bauer R, Knackmuss HJ, Stolz A (2001) Microbiology 147:1815
227. Mayaux J, Cerbelaud E, Soubrier F, Yeh P, Blanche F, Petre D (1991) J Bacteriol

173:6694
228. Hirrlinger B, Stolz A, Knackmuss HJ (1996) J Bacteriol 178:3501
229. Layh N, Hirrlinger B, Stolz A, Knackmuss HJ (1997) Appl Microbiol Biotechnol
47:668
230. Hermes H, Tandler RF, Sonke T, Dijkhuizen L, Meijer EM (1994) Appl Environ Mi-
crobiol 1:153
231. Sonke T, Kaptein B, Boesten WHJ, Boxterman QB, Schoemaker HE, Kamphuis J, For-
maggio F, Toniolo C, Rutjes FP (2000) In: RN P (ed) Stereoselective Biocatalysis.
Marcel Dekker, New York p 23
232. Kamphuis J, Boesten WHJ, Kaptein B, Hermes HFM, Sonke T, Broxterman QB, van
den Tweel WJJ, Schoemaker HE (1992) in: Collins AN, Sheldrake GN, Crosby J (eds)
Chirality in industry: the commercial manufacture and applications of optically ac-
tive compounds. Wiley, Chichester, UK p 187
233. Alcantara A-R, Sanchez-Montero JM, Sinisterra JV (2000) In: RN P (ed) Stereoselec-
tive biocatalysis. Marcel Dekker, New York p 659
234. Webster N, Ramsden DK, Hughes J (2001) Biotechnol Lett 23:95
235. Fournand D, Arnaud A, Galzy P (1998) J Mol Catal 4:77
236. Baek DH, Song JJ, Lee SG, Kwon SJ, Asano Y, Sung MH (2003) Enzyme Microb
Technol 32:131
237. Nawaz M, Khan AA, Bhattacharayya D, Siitonen PH, Cerniglia CE (1996) J Bacteriol
178:2397
238. d’Abusco AS, Ammendola S, Scandurra R, Politi L (2001) Extremophiles 5:183
239. Egorova K, Trauthwein H, Verseck S, Antranikian G (2004) Appl Microbiol Biotech-
nol 65:38
240. Mahadevan S, Thimann KV (1964) Arch Biochem Biophys 107:62
241. Thimann KV, Mahadevan S (1964) Arch Biochem Biophys 105:133
242. Hook RH, Robinson WG (1964) J Biol Chem 239:4263
243. Robinson WG, Hook RH (1964) J Biol Chem 239:4257
244. Arnaud A, Galzy P, Jallageas JC (1976) C R Acad Sci Hebd Seances Acad Sci D
283:571
245. Harper DB (1977) Biochem J 167:685
246. Harper DB (1977) Biochem J 165:309
247. Wajant H, Effenberger F (2002) Eur J Biochem 269:680
248. Pekarsky Y, Campiglio M, Siprashvili Z, Druck T, Sedkov Y, Tillib S, Draganescu A,
Wermuth P, Rothman JH, Huebner K, Buchberg AM, Mazo A, Brenner C, Croce CM
249. Pace HC, Hodawadekar SC, Draganescu A, Huang J, Bieganowski P, Pekarsky Y,
Croce CM, Brenner C (2000) Curr Biol 10:907
250. Harper DB (1985) Int J Biochem 17:677
251. Stevenson DE, Feng R, Dumas F, Groleau D, Mihoc A, Storer AC (1992) Biotechnol
Appl Biochem 15:283
252. Nagasawa T, Mauger J, Yamada H (1990) Eur J Biochem 194:765
253. Kobayashi M, Komeda H, Yanaka N, Nagasawa T, Yamada H (1992) J Biol Chem
267:20 746
254. Kobayashi M, Yanaka N, Nagasawa T, Yamada H (1992) Biochemistry 31:9000
255. Banerjee A, Sharma R, Banerjee UC (2002) Appl Microbiol Biotechnol 60:33
256. Perler FB, Kumar S, Kong H (1996) Adv Protein Chem 48:377
257. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H (1992) Biotechnology 24:17
258. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA
(1988) Science 239:487
259. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H (1986) Cold Spring Harb
Symp Quant Biol 51 Pt 1:263
260. Diaz RS, Sabino EC (1998) Braz J Med Biol Res 31:1239
261. Komori K, Ishino Y (2000) Protein Eng 13:41
262. Evans SJ, Fogg MJ, Mamone A, Davis M, Pearl LH, Connolly BA (2000) Nucleic Acids
Res 28:1059
263. Hayashi I, Morikawa K, Ishino Y (1999) Nucleic Acids Res 27:4695
264. Goldman S, Kim R, Hung LW, Jancarik J, Kim SH (1998) Acta Crystallogr D Biol
Crystallogr 54 (Pt 5):986
265. Lu C, Erickson HP (1997) Protein Expr Purif 11:179
266. Uemori T, Sato Y, Kato I, Doi H, Ishino Y (1997) Genes Cells 2:499
267. Imamura M, Uemori T, Kato I, Ishino Y (1995) Biol Pharm Bull 18:1647
268. Uemori T, Ishino Y, Toh H, Asada K, Kato I (1993) Nucleic Acids Res 21:259
269. Ogata N, Miura T (2000) Biochemistry 39:13 993
270. Ogata N, Miura T (1998) Nucleic Acids Res 26:4652
271. Keohavong P, Ling L, Dias C, Thilly WG (1993) PCR Methods Appl 2:288
272. Kong H, Kucera RB, Jack WE (1993) J Biol Chem 268:1965
273. Mattila P, Korpela J, Tenkanen T, Pitkanen K (1991) Nucleic Acids Res 19:4967
274. Cariello NF, Swenberg JA, Skopek TR (1991) Nucleic Acids Res 19:4193
275. Hashimoto H, Nishioka M, Fujiwara S, Takagi M, Imanaka T, Inoue T, Kai Y (2001)
J Mol Biol 306:469
276. Hashimoto H, Matsumoto T, Nishioka M, Yuasa T, Takeuchi S, Inoue T, Fujiwara S,
Takagi M, Imanaka T, Kai Y (1999) J Biochem (Tokyo) 125:983
277. Nishioka M, Fujiwara S, Takagi M, Imanaka T (1998) Nucleic Acids Res 26:4409
278. Takagi M, Nishioka M, Kakihara H, Kitabayashi M, Inoue H, Kawakami B, Oka M,
Imanaka T (1997) Appl Environ Microbiol 63:4504
279. Sanger F, Nicklen S, Coulson AR (1992) Biotechnology 24:104
280. Bechtereva TA, Pavlov YI, Kramorov VI, Migunova B, Kiselev OI (1989) Nucleic
Acids Res 17:10 507
281. Rao VB, Saunders NB (1992) Gene 113:17
282. Vander Horn PB, Davis MC, Cunniff JJ, Ruan C, McArdle BF, Samols SB, Szasz J,
Hu G, Hujer KM, Domke ST, Brummet SR, Moffett RB, Fuller CW (1997) Biotech-
niques 22:758
283. Szybalski W (1990) Gene 90:177
284. Schalling M, Hudson TJ, Buetow KH, Housman DE (1993) Nat Genet 4:135
285. Landegren U, Schallmeiner E, Nilsson M, Fredriksson S, Baner J, Gullberg M,
Jarvius J, Gustafsdottir S, Dahl F, Soderberg O, Ericsson O, Stenberg J (2004) J Mol
Recognit 17:194
286. Georlette D, Blaise V, Bouillenne F, Damien B, Thorbjarnardottir SH, Depiereux E,
Gerday C, Uversky VN, Feller G (2004) Biophys J 86:1089
287. Housby JN, Southern EM (2002) Anal Biochem 302:88
288. Jonsson ZO, Thorbjarnardottir SH, Eggertsson G, Palsdottir A (1994) Gene 151:177
289. Thorbjarnardottir SH, Jonsson ZO, Andresson OS, Kristjansson JK, Eggertsson G,
Palsdottir A (1995) Gene 161:1
290. Blondel T, Hjorleifsdottir SH, Fridjonsson OF, Aevarsson A, Skirnisdottir S, Her-
mannsdottir AG, Hreggvidsson GO, Smith AV, Kristjansson JK (2003) Nucleic Acid
Res 31:7247
291. Kletzin A (1992) Nucleic Acid Res 20:5389

292. Nakatani M, Ezaki S, Atomi H, Imanaka T (2002) Eur J Biochem 269:650
293. Rolland JL, Guenguen Y, Persillon C, Masson JM, Dietrich J (2004) FEMS Microbiol
Lett 236:267
Author Index Volumes 51–97
Author Index Volumes 1–50 see Volume 50
Ackermann, J.-U. see Babel, W.: Vol. 71, p. 125

Adam, W., Lazarus, M., Saha-Möller, C. R., Weichhold, O., Hoch, U., Häring, D., Schreier, Ü.:
Biotransformations with Peroxidases. Vol. 63, p. 73
Ahring, B. K.: Perspectives for Anaerobic Digestion. Vol. 81, p. 1
Ahring, B. K. see Angelidaki, I.: Vol. 82, p. 1
Ahring, B. K. see Gavala, H. N.: Vol. 81, p. 57
Ahring, B. K. see Hofman-Bang, J.: Vol. 81, p. 151
Ahring, B. K. see Mogensen, A. S.: Vol. 82, p. 69
Ahring, B. K. see Pind, P. F.: Vol. 82, p. 135
Ahring, B. K. see Skiadas, I. V.: Vol. 82, p. 35
Aivasidis, A., Diamantis, V. I.: Biochemical Reaction Engineering and Process Development
in Anaerobic Wastewater Treatment. Vol. 92, p. 49
Akhtar, M., Blanchette, R. A., Kirk, T. K.: Fungal Delignification and Biochemical Pulping of
Wood. Vol. 57, p. 159
Allan, J. V., Roberts, S. M., Williamson, N. M.: Polyamino Acids as Man-Made Catalysts.
Vol. 63, p. 125
Allington, R. W. see Xie, S.: Vol. 76, p. 87
Al-Abdallah, Q. see Brakhage, A. A.: Vol. 88, p. 45
Al-Rubeai, M.: Apoptosis and Cell Culture Technology. Vol. 59, p. 225
Al-Rubeai, M. see Singh, R. P.: Vol. 62, p. 167
Alsberg, B. K. see Shaw, A. D.: Vol. 66, p. 83
Angelidaki, I., Ellegaard, L., Ahring, B. K.: Applications of the Anaerobic Digestion Process.
Vol. 82, p. 1
Angelidaki, I. see Gavala, H. N.: Vol. 81, p. 57
Angelidaki, I. see Pind, P. F.: Vol. 82, p. 135
Antranikian, G. see Ladenstein, R.: Vol. 61, p. 37
Antranikian, G. see Müller, R.: Vol. 61, p. 155
Antranikian, G., Vorgias, C. E., Bertoldo, C.: Extreme Environments as a Resource for Mi-
croorganisms and Novel Biocatalysts. Vol. 96, p. 219
Archelas, A. see Orru, R. V. A.: Vol. 63, p. 145
Argyropoulos, D. S.: Lignin. Vol. 57, p. 127
Arnold, F. H., Moore, J. C.: Optimizing Industrial Enzymes by Directed Evolution. Vol. 58,
p. 1
Atala, A.: Regeneration of Urologic Tissues and Organs. Vol. 94, p. 181
Autuori, F., Farrace, M. G., Oliverio, S., Piredda, L., Piacentini, G.: “Tissieâ” Transglutaminase
and Apoptosis. Vol. 62, p. 129
Azerad, R.: Microbial Models for Drug Metabolism. Vol. 63, p. 169
264 Author Index Volumes 51–97
Babel, W., Ackermann, J.-U., Breuer, U.: Physiology, Regulation and Limits of the Synthesis
of Poly(3HB). Vol. 71, p. 125
Bajpai, P., Bajpai, P. K.: Realities and Trends in Emzymatic Prebleaching of Kraft Pulp.
Vol. 56, p. 1
Bajpai, P., Bajpai, P. K.: Reduction of Organochlorine Compounds in Bleach Plant Effluents.
Vol. 57, p. 213
Bajpai, P. K. see Bajpai, P.: Vol. 56, p. 1
Bajpai, P. K. see Bajpai, P.: Vol. 57, p. 213
Banks, M. K., Schwab, P., Liu, B., Kulakow, P. A., Smith, J. S., Kim, R.: The Effect of Plants on
the Degradation and Toxicity of Petroleum Contaminants in Soil: A Field Assessment.
Vol. 78, p. 75
Barber, M. S., Giesecke, U., Reichert, A., Minas, W.: Industrial Enzymatic Production of
Cephalosporin-Based b-Lactams. Vol. 88, p. 179
Barindra, S. see Debashish, G.: Vol. 96, p. 189
Barnathan, G. see Bergé, J.-P.: Vol. 96, p. 49
Barut, M. see Strancar, A.: Vol. 76, p. 49
Bárzana, E.: Gas Phase Biosensors. Vol. 53, p. 1
Basu, S. K. see Mukhopadhyay, A.: Vol. 84, p. 183
Bathe, B. see Pfefferle, W.: Vol. 79, p. 59
Bazin, M. J. see Markov, S. A.: Vol. 52, p. 59
Bellgardt, K.-H.: Process Models for Production of b-Lactam Antibiotics. Vol. 60, p. 153
Beppu, T.: Development of Applied Microbiology to Modern Biotechnology in Japan. Vol. 69,
p. 41
van den Berg, M. A. see Evers, M. E.: Vol. 88, p. 111
Bergé, J.-P., Barnathan, G.: Fatty Acids from Lipids of Marine Organisms: Molecular Biodi-
versity, Roles as Biomarkers, Biologically-Active Compounds, and Economical Aspects.
Vol. 96, p. 49
Berovic, M. see Mitchell, D. A.: Vol. 68, p. 61
Bertoldo, C. see Antranikian, G.: Vol. 96, p. 219
Beyeler, W., DaPra, E., Schneider, K.: Automation of Industrial Bioprocesses. Vol. 70, p. 139
Beyer, M. see Seidel, G.: Vol. 66, p. 115
Beyer, M. see Tollnick, C.: Vol. 86, p. 1
Bhardwaj, D. see Chauhan, V. S.: Vol. 84, p. 143
Bhatia, P. K., Mukhopadhyay, A.: Protein Glycosylation: Implications for in vivo Functions
and Thereapeutic Applications. Vol. 64, p. 155
Bisaria, V. S. see Ghose, T. K.: Vol. 69, p. 87
Blanchette R. A. see Akhtar, M.: Vol. 57, p. 159
Bocker, H., Knorre, W. A.: Antibiotica Research in Jena from Penicillin and Nourseothricin
to Interferon. Vol. 70, p. 35
de Bont, J. A. M. see van der Werf, M. J.: Vol. 55, p. 147
van den Boom, D. see Jurinke, C.: Vol. 77, p. 57
Borah, M. M. see Dutta, M.: Vol. 86, p. 255
Bourguet-Kondracki, M.-L., Kornprobst, J.-M.: Marine Pharmacology: Potentialities in the
Treatment of Infectious Diseases, Osteoporosis and Alzheimer’s Disease. Vol. 97, p. 105
Bovenberg, R. A. L. see Evers, M. E.: Vol. 88, p. 111
Brainard, A. P. see Ho, N. W. Y.: Vol. 65, p. 163
Brakhage, A. A., Spröte, P., Al-Abdallah, Q., Gehrke, A., Plattner, H., Tüncher, A.: Regulation
of Penicillin Biosynthesis in Filamentous Fungi. Vol. 88, p. 45
Brazma, A., Sarkans, U., Robinson, A., Vilo, J., Vingron, M., Hoheisel, J., Fellenberg, K.:
Microarray Data Representation, Annotation and Storage. Vol. 77, p. 113
Author Index Volumes 51–97 265
Breuer, U. see Babel, W.: Vol. 71, p. 125

Broadhurst, D. see Shaw, A. D.: Vol. 66, p. 83
Bruckheimer, E. M., Cho, S. H., Sarkiss, M., Herrmann, J., McDonell, T. J.: The Bcl-2 Gene
Family and Apoptosis. Vol. 62, p. 75
Brüggemann, O.: Molecularly Imprinted Materials – Receptors More Durable than Nature
Can Provide. Vol. 76, p. 127
Bruggink, A., Straathof, A. J. J., van der Wielen, L. A. M.: A ‘Fine’ Chemical Industry for Life
Science Products: Green Solutions to Chemical Challenges. Vol. 80, p. 69
Buchert, J. see Suurnäkki, A.: Vol. 57, p. 261
Büchs, J. see Knoll, A.: Vol. 92, p. 77
Bungay, H. R. see Mühlemann, H. M.: Vol. 65, p. 193
Bungay, H. R., Isermann, H. P.: Computer Applications in Bioprocessin. Vol. 70, p. 109
Büssow, K. see Eickhoff, H.: Vol. 77, p. 103
Butler, C. E., Orgill, D. P.: Simultaneous In Vivo Regeneration of Neodermis, Epidermis, and
Basement Membrane. Vol. 94, p. 23
Butler, C. E. see Orgill, D. P.: Vol. 93, p. 161
Byun, S. Y. see Choi, J. W.: Vol. 72, p. 63
Cabral, J. M. S. see Fernandes, P.: Vol. 80, p. 115

Cahill, D. J., Nordhoff, E.: Protein Arrays and Their Role in Proteomics. Vol. 83, p. 177
Call, M. K., Tsonis, P. A.: Vertebrate Limb Regeneration. Vol. 93, p. 67
Cantor, C. R. see Jurinke, C.: Vol. 77, p. 57
Cao, N. J. see Gong, C. S.: Vol. 65, p. 207
Cao, N. J. see Tsao, G. T.: Vol. 65, p. 243
Capito, R. M. see Kinner, B.: Vol. 94, p. 91
Carnell, A. J.: Stereoinversions Using Microbial Redox-Reactions. Vol. 63, p. 57
Cash, P.: Proteomics of Bacterial Pathogens. Vol. 83, p. 93
Casqueiro, J. see Martín, J. F.: Vol. 88, p. 91
Cen, P., Xia, L.: Production of Cellulase by Solid-State Fermentation. Vol. 65, p. 69
Chand, S., Mishra, P.: Research and Application of Microbial Enzymes – India’s Contribution.
Vol. 85, p. 95
Chang, H. N. see Lee, S. Y.: Vol. 52, p. 27
Chauhan, V. S., Bhardwaj, D.: Current Status of Malaria Vaccine Development. Vol. 84, p. 143
Cheetham, P. S. J.: Combining the Technical Push and the Business Pull for Natural Flavours.
Vol. 55, p. 1
Cheetham, P. S. J.: Bioprocesses for the Manufacture of Ingredients for Foods and Cosmetics.
Vol. 86, p. 83
Chen, C. see Yang, S.-T.: Vol. 87, p. 61
Chen, Z. see Ho, N. W. Y.: Vol. 65, p. 163
Chenchik, A. see Zhumabayeva, B.: Vol. 86, p. 191
Cho, S. H. see Bruckheimer, E. M.: Vol. 62, p. 75
Cho, G. H. see Choi, J. W.: Vol. 72, p. 63
Choi, J. see Lee, S. Y.: Vol. 71, p. 183
Choi, J. W., Cho, G. H., Byun, S. Y., Kim, D.-I.: Integrated Bioprocessing for Plant Cultures.
Vol. 72, p. 63
Christensen, B., Nielsen, J.: Metabolic Network Analysis – A Powerful Tool in Metabolic
Engineering. Vol. 66, p. 209
Christians, F. C. see McGall, G. H.: Vol. 77, p. 21
Christmann, M. see Hassfeld, J.: Vol. 97, p. 133
Chu, J. see Zhang, S.: Vol. 87, p. 97
Chu, K. H., Tang, C. Y., Wu, A., Leung, P. S. C.: Seafood Allergy: Lessons from Clinical Symp-
toms, Immunological Mechanisms and Molecular Biology. Vol. 97, p. 205
Chui, G. see Drmanac, R.: Vol. 77, p. 75
Ciaramella, M. see van der Oost, J.: Vol. 61, p. 87
Colwell, A. S., Longaker, M. T., Lorenz, H. P.: Mammalian Fetal Organ Regeneration. Vol. 93,
p. 83
Contreras, B. see Sablon, E.: Vol. 68, p. 21
Conway de Macario, E., Macario, A. J. L.: Molecular Biology of Stress Genes in Methanogens:
Potential for Bioreactor Technology. Vol. 81, p. 95
Cordero Otero, R. R. see Hahn-Hägerdal, B.: Vol. 73, p. 53
Cordwell S. J. see Nouwens, A. S.: Vol. 83, p. 117
Cornet, J.-F., Dussap, C. G., Gros, J.-B.: Kinetics and Energetics of Photosynthetic Micro-
Organisms in Photobioreactors. Vol. 59, p. 153
da Costa, M. S., Santos, H., Galinski, E. A.: An Overview of the Role and Diversity of Com-
patible Solutes in Bacteria and Archaea. Vol. 61, p. 117
Cotter, T. G. see McKenna, S. L.: Vol. 62, p. 1
Croteau, R. see McCaskill, D.: Vol. 55, p. 107
Danielsson, B. see Xie, B.: Vol. 64, p. 1

DaPra, E. see Beyeler, W.: Vol. 70, p. 139
Darzynkiewicz, Z., Traganos, F.: Measurement of Apoptosis. Vol. 62, p. 33
Davey, H. M. see Shaw, A. D.: Vol. 66, p. 83
Dean, J. F. D., LaFayette, P. R., Eriksson, K.-E. L., Merkle, S. A.: Forest Tree Biotechnolgy.
Vol. 57, p. 1
Debabov, V. G.: The Threonine Story. Vol. 79, p. 113
Debashish, G., Malay, S., Barindra, S., Joydeep, M.: Marine Enzymes. Vol. 96, p. 189
DeFrances M. see Michalopoulos, G. K.: Vol. 93, p. 101
Demain, A. L., Fang, A.: The Natural Functions of Secondary Metabolites. Vol. 69, p. 1
Dhar, N. see Tyagi, A. K.: Vol. 84, p. 211
Diamantis, V. I. see Aivasidis, A.: Vol. 92, p. 49
Diaz, R. see Drmanac, R.: Vol. 77, p. 75
Dochain, D., Perrier, M.: Dynamical Modelling, Analysis, Monitoring and Control Design
for Nonlinear Bioprocesses. Vol. 56, p. 147
von Döhren, H.: Biochemistry and General Genetics of Nonribosomal Peptide Synthetases
in Fungi. Vol. 88, p. 217
Dolfing, J. see Mogensen, A. S.: Vol. 82, p. 69
Drauz K. see Wöltinger, J.: Vol. 92, p. 289
Driessen, A. J. M. see Evers, M. E.: Vol. 88, p. 111
Drmanac, R., Drmanac, S., Chui, G., Diaz, R., Hou, A., Jin, H., Jin, P., Kwon, S., Lacy, S., Moeur,
B., Shafto, J., Swanson, D., Ukrainczyk, T., Xu, C., Little, D.: Sequencing by Hybridization
(SBH): Advantages, Achievements, and Opportunities. Vol. 77, p. 75
Drmanac, S. see Drmanac, R.: Vol. 77, p. 75
Du, J. see Gong, C. S.: Vol. 65, p. 207
Du, J. see Tsao, G. T.: Vol. 65, p. 243
Dueser, M. see Raghavarao, K. S. M. S.: Vol. 68, p. 139
Dussap, C. G. see Cornet J.-F.: Vol. 59, p. 153
Dutta, M., Borah, M. M., Dutta, N. N.: Adsorptive Separation of b-Lactam Antibiotics: Tech-
nological Perspectives. Vol. 86, p. 255
Dutta, N. N. see Ghosh, A. C.: Vol. 56, p. 111
Dutta, N. N. see Sahoo, G. C.: Vol. 75, p. 209
Dutta, N. N. see Dutta, M.: Vol. 86, p. 255

Dynesen, J. see McIntyre, M.: Vol. 73, p. 103
Eggeling, L., Sahm, H., de Graaf, A. A.: Quantifying and Directing Metabolite Flux: Applica-
tion to Amino Acid Overproduction. Vol. 54, p. 1
Eggeling, L. see de Graaf, A. A.: Vol. 73, p. 9
Eggink, G., see Kessler, B.: Vol. 71, p. 159
Eggink, G., see van der Walle, G. J. M.: Vol. 71, p. 263
Egli, T. see Wick, L. M.: Vol. 89, p. 1
Ehrlich, H. L. see Rusin, P.: Vol. 52, p. 1
Eickhoff, H., Konthur, Z., Lueking, A., Lehrach, H., Walter, G., Nordhoff, E., Nyarsik, L., Büssow,
K.: Protein Array Technology: The Tool to Bridge Genomics and Proteomics. Vol. 77,
p. 103
Elias, C. B., Joshi, J. B.: Role of Hydrodynamic Shear on Activity and Structure of Proteins.
Vol. 59, p. 47
Eliasson, A. see Gunnarsson, N.: Vol. 88, p. 137
Ellegaard, L. see Angelidaki, I.: Vol. 82, p. 1
Elling, L.: Glycobiotechnology: Enzymes for the Synthesis of Nucleotide Sugars. Vol. 58,
p. 89
Enfors, S.-O. see Rozkov, A.: Vol. 89, p. 163
Eriksson, K.-E. L. see Kuhad, R. C.: Vol. 57, p. 45
Eriksson, K.-E. L. see Dean, J. F. D.: Vol. 57, p. 1
Evers, M. E., Trip, H., van den Berg, M. A., Bovenberg, R. A. L., Driessen, A. J. M.: Compart-
mentalization and Transport in b-Lactam Antibiotics Biosynthesis. Vol. 88, p. 111
Faber, K. see Orru, R. V. A.: Vol. 63, p. 145

Fahnert, B., Lilie, H., Neubauer, P.: Inclusion Bodies: Formation and Utilisation. Vol. 89, p. 93
Fang, A. see Demain, A. L.: Vol. 69, p. 1
Farrace, M. G. see Autuori, F.: Vol. 62, p. 129
Farrell, R. L., Hata, K., Wall, M. B.: Solving Pitch Problems in Pulp and Paper Processes.
Vol. 57, p. 197
Fawcett, J. see Verma, P.: Vol. 94, p. 43
Fellenberg, K. see Brazma, A.: Vol. 77, p. 113
Fernandes, P., Prazeres, D. M. F., Cabral, J. M. S.: Membrane-Assisted Extractive Bioconver-
sions. Vol. 80, p. 115
Ferro, A., Gefell, M., Kjelgren, R., Lipson, D. S., Zollinger, N., Jackson, S.: Maintaining Hy-
draulic Control Using Deep Rooted Tree Systems. Vol. 78, p. 125
Fiechter, A.: Biotechnology in Switzerland and a Glance at Germany. Vol. 69, p. 175
Fiechter, A. see Ochsner, U. A.: Vol. 53, p. 89
Flechas, F. W., Latady, M.: Regulatory Evaluation and Acceptance Issues for Phytotechnology
Projects. Vol. 78, p. 171
Foody, B. see Tolan, J. S.: Vol. 65, p. 41
Fréchet, J. M. J. see Xie, S.: Vol. 76, p. 87
Freitag, R., Hórvath, C.: Chromatography in the Downstream Processing of Biotechnological
Products. Vol. 53, p. 17
Friehs, K.: Plasmid Copy Number and Plasmid Stability. Vol. 86, p. 47
Furstoss, R. see Orru, R. V. A.: Vol. 63, p. 145
Gadella, T. W. J. see van Munster, E. B.: Vol. 95, p. 143

Le Gal, Y. see Guérard, F.: Vol. 96, p. 127
Galinski, E. A. see da Costa, M. S.: Vol. 61, p. 117

Gàrdonyi, M. see Hahn-Hägerdal, B.: Vol. 73, p. 53
Gatfield, I. L.: Biotechnological Production of Flavour-Active Lactones. Vol. 55, p. 221
Gavala, H. N., Angelidaki, I., Ahring, B. K.: Kinetics and Modeling of Anaerobic Digestion
Process. Vol. 81, p. 57
Gavala, H. N. see Skiadas, I. V.: Vol. 82, p. 35
Gefell, M. see Ferro, A.: Vol. 78, p. 125
Gehrke, A. see Brakhage, A. A.: Vol. 88, p. 45
Gemeiner, P. see Stefuca, V.: Vol. 64, p. 69
Gerlach, S. R. see Schügerl, K.: Vol. 60, p. 195
Ghose, T. K., Bisaria, V. S.: Development of Biotechnology in India. Vol. 69, p. 71
Ghose, T. K. see Ghosh, P.: Vol. 85, p. 1
Ghosh, A. C., Mathur, R. K., Dutta, N. N.: Extraction and Purification of Cephalosporin
Antibiotics. Vol. 56, p. 111
Ghosh, P., Ghose, T. K.: Bioethanol in India: Recent Past and Emerging Future. Vol. 85, p. 1
Ghosh, P. see Singh, A.: Vol. 51, p. 47
Giesecke, U. see Barber, M. S.: Vol. 88, p. 179
Gilbert, R. J. see Shaw, A. D.: Vol. 66, p. 83
Gill, R. T. see Stephanopoulos, G.: Vol. 73, p. 1
Gomes, J., Menawat, A. S.: Fed-Batch Bioproduction of Spectinomycin. Vol. 59, p. 1
Gong, C. S., Cao, N. J., Du, J., Tsao, G. T.: Ethanol Production from Renewable Resources.
Vol. 65, p. 207
Gong, C. S. see Tsao, G. T.: Vol. 65, p. 243
Goodacre, R. see Shaw, A. D.: Vol. 66, p. 83
de Graaf, A. A., Eggeling, L., Sahm, H.: Metabolic Engineering for L-Lysine Production by
Corynebacterium glutamicum. Vol. 73, p. 9
de Graaf, A. A. see Eggeling, L.: Vol. 54, p. 1
de Graaf, A. A. see Weuster-Botz, D.: Vol. 54, p. 75
de Graaf, A. A. see Wiechert, W.: Vol. 54, p. 109
Grabley, S., Thiericke, R.: Bioactive Agents from Natural Sources: Trends in Discovery and
Application. Vol. 64, p. 101
Gräf, R., Rietdorf, J., Zimmermann, T.: Live Cell Spinning Disk Microscopy. Vol. 95, p. 57
Griengl, H. see Johnson, D. V.: Vol. 63, p. 31
Gros, J.-B. see Larroche, C.: Vol. 55, p. 179
Gros, J.-B. see Cornet, J. F.: Vol. 59, p. 153
Gu, M. B., Mitchell, R. J., Kim, B. C.: Whole-Cell-Based Biosensors for Environmental Biomon-
itoring and Application. Vol. 87, p. 269
Guenette M. see Tolan, J. S.: Vol. 57, p. 289
Guérard, F., Sellos, D., Le Gal, Y.: Fish and Shellfish Upgrading, Traceability. Vol. 96, p. 127
Gunnarsson, N., Eliasson, A., Nielsen, J.: Control of Fluxes Towards Antibiotics and the Role
of Primary Metabolism in Production of Antibiotics. Vol. 88, p. 137
Gupta, M. N. see Roy, I.: Vol. 86, p. 159
Gupta, S. K.: Status of Immunodiagnosis and Immunocontraceptive Vaccines in India.
Vol. 85, p. 181
Gutman, A. L., Shapira, M.: Synthetic Applications of Enzymatic Reactions in Organic Sol-
vents. Vol. 52, p. 87
Haagensen, F. see Mogensen, A. S.: Vol. 82, p. 69

Hahn-Hägerdal, B., Wahlbom, C. F., Gárdonyi, M., van Zyl, W. H., Cordero Otero, R. R., Jöns-
son, L. J.: Metabolic Engineering of Saccharomyces cerevisiae for Xylose Utilization.
Vol. 73, p. 53
Haigh, J. R. see Linden, J. C.: Vol. 72, p. 27
Hall, D. O. see Markov, S. A.: Vol. 52, p. 59
Hall, P. see Mosier, N. S.: Vol. 65, p. 23
Hammar, F.: History of Modern Genetics in Germany. Vol. 75, p. 1
Hanai, T., Honda, H.: Application of Knowledge Information Processing Methods to Bio-
chemical Engineering, Biomedical and Bioinformatics Field. Vol. 91, p. 51
Hannenhalli, S., Hubbell, E., Lipshutz, R., Pevzner, P. A.: Combinatorial Algorithms for Design
of DNA Arrays. Vol. 77, p. 1
Haralampidis, D., Trojanowska, M., Osbourn, A. E.: Biosynthesis of Triterpenoid Saponins
in Plants. Vol. 75, p. 31
Häring, D. see Adam, E.: Vol. 63, p. 73
Harvey, N. L., Kumar, S.: The Role of Caspases in Apoptosis. Vol. 62, p. 107
Hasegawa, S., Shimizu, K.: Noninferior Periodic Operation of Bioreactor Systems. Vol. 51,
p. 91
Hassfeld, J., Kalesse, M., Stellfeld, T., Christmann, M.: Asymmetric Total Synthesis of Complex
Marine Natural Products. Vol. 97, p. 133
Hata, K. see Farrell, R. L.: Vol. 57, p. 197
Hatton, M. P., Rubin, P. A. D.: Conjunctival Regeneration. Vol. 94, p. 125
Hecker, M.: A Proteomic View of Cell Physiology of Bacillus subtilis – Bringing the Genome
Sequence to Life. Vol. 83, p. 57
Hecker, M. see Schweder, T.: Vol. 89, p. 47
van der Heijden, R. see Memelink, J.: Vol. 72, p. 103
Hein, S. see Steinbüchel, A.: Vol. 71, p. 81
Hembach, T. see Ochsner, U. A.: Vol. 53, p. 89
Henzler, H.-J.: Particle Stress in Bioreactor. Vol. 67, p. 35
Herrler, M. see Zhumabayeva, B.: Vol. 86, p. 191
Herrmann, J. see Bruckheimer, E. M.: Vol. 62, p. 75
Hewitt, C. J., Nebe-Von-Caron, G.: The Application of Multi-Parameter Flow Cytometry to
Monitor Individual Microbial Cell Physiological State. Vol. 89, p. 197
Hill, D. C., Wrigley, S. K., Nisbet, L. J.: Novel Screen Methodologies for Identification of New
Microbial Metabolites with Pharmacological Activity. Vol. 59, p. 73
Hiroto, M. see Inada, Y.: Vol. 52, p. 129
Ho, N. W. Y., Chen, Z., Brainard, A. P., Sedlak, M.: Successful Design and Development of
Genetically Engineering Saccharomyces Yeasts for Effective Cofermentation of Glucose
and Xylose from Cellulosic Biomass to Fuel Ethanol. Vol. 65, p. 163
Hoch, U. see Adam, W.: Vol. 63, p. 73
Hoff, B. see Schmitt, E. K.: Vol. 88, p. 1
Hoffmann, F., Rinas, U.: Stress Induced by Recombinant Protein Production in Escherichia
coli. Vol. 89, p. 73
Hoffmann, F., Rinas, U.: Roles of Heat-Shock Chaperones in the Production of Recombinant
Proteins in Escherichia coli. Vol. 89, p. 143
Hofman-Bang, J., Zheng, D., Westermann, P., Ahring, B. K., Raskin, L.: Molecular Ecology of
Anaerobic Reactor Systems. Vol. 81, p. 151
Hoheisel, J. see Brazma, A.: Vol. 77, p. 113
Holló, J., Kralovánsky, U. P.: Biotechnology in Hungary. Vol. 69, p. 151
Honda, H., Kobayashi, T.: Industrial Application of Fuzzy Control in Bioprocesses. Vol. 87,
p. 151
Honda, H., Liu, C., Kobayashi, T.: Large-Scale Plant Micropropagation. Vol. 72, p. 157
Honda, H. see Hanai, T.: Vol. 91, p. 51
Honda, H., Kobayashi, T.: Large-Scale Micropropagation System of Plant Cells. Vol. 91, p. 105
Hórvath, C. see Freitag, R.: Vol. 53, p. 17
Hou, A. see Drmanac, R.: Vol. 77, p. 75
Houtsmuller, A. B.: Fluorescence Recovery After Photoleaching: Application to Nuclear Pro-
teins. Vol. 95, p. 177
Hubbell, E. see Hannenhalli, S.: Vol. 77, p. 1
Hubbuch, J., Thömmes, J., Kula, M.-R.: Biochemical Engineering Aspects of Expanded Bed
Adsorption. Vol. 92, p. 101
Huebner, S. see Mueller, U.: Vol. 79, p. 137
Hummel, W.: New Alcohol Dehydrogenases for the Synthesis of Chiral Compounds. Vol. 58,
p. 145
Hüners, M. see Lang, S.: Vol. 97, p. 29
Iijima, S. see Miyake, K.: Vol. 90, p. 89

Iijima, S. see Kamihira, M.: Vol. 91, p. 171
Ikeda, M.: Amino Acid Production Processes. Vol. 79, p. 1
Imamoglu, S.: Simulated Moving Bed Chromatography (SMB) for Application in Biosepa-
ration. Vol. 76, p. 211
Inada, Y., Matsushima, A., Hiroto, M., Nishimura, H., Kodera, Y.: Chemical Modifications of
Proteins with Polyethylen Glycols. Vol. 52, p. 129
Irwin, D. C. see Wilson, D. B.: Vol. 65, p. 1
Isermann, H. P. see Bungay, H. R.: Vol. 70, p. 109
Ito, A. see Shinkai, M.: Vol. 91, p. 191
Iwasaki, Y., Yamane, T.: Enzymatic Synthesis of Structured Lipids. Vol. 90, p. 151
Iyer, P. see Lee, Y. Y.: Vol. 65, p. 93
Jackson, S. see Ferro, A.: Vol. 78, p. 125

James, E., Lee, J. M.: The Production of Foreign Proteins from Genetically Modified Plant
Cells. Vol. 72, p. 127
Jeffries, T. W., Shi, N.-Q.: Genetic Engineering for Improved Xylose Fementation by Yeasts.
Vol. 65, p. 117
Jendrossek, D.: Microbial Degradation of Polyesters. Vol. 71, p. 293
Jenne, M. see Schmalzriedt, S.: Vol. 80, p. 19
Jin, H. see Drmanac, R.: Vol. 77, p. 75
Jin, P. see Drmanac, R.: Vol. 77, p. 75
Johnson, D. V., Griengl, H.: Biocatalytic Applications of Hydroxynitrile. Vol. 63, p. 31
Johnson, E. A., Schroeder, W. A.: Microbial Carotenoids. Vol. 53, p. 119
Johnsurd, S. C.: Biotechnolgy for Solving Slime Problems in the Pulp and Paper Industry.
Vol. 57, p. 311
Johri, B. N., Sharma, A., Virdi, J. S.: Rhizobacterial Diversity in India and its Influence on
Soil and Plant Health. Vol. 84, p. 49
Jönsson, L. J. see Hahn-Hägerdal, B.: Vol. 73, p. 53
Joshi, J. B. see Elias, C. B.: Vol. 59, p. 47
Joydeep, M. see Debashish, G.: Vol. 96, p. 189
Jurinke, C., van den Boom, D., Cantor, C. R., Köster, H.: The Use of MassARRAY Technology
for High Throughput Genotyping. Vol. 77, p. 57
Kaderbhai, N. see Shaw, A. D.: Vol. 66, p. 83

Kalesse, M. see Hassfeld, J.: Vol. 97, p. 133
Kamihira, M., Nishijima, K., Iijima, S.: Transgenic Birds for the Production of Recombinant
Proteins. Vol. 91, p. 171
Karanth, N. G. see Krishna, S. H.: Vol. 75, p. 119
Karau, A. see Wöltinger, J.: Vol. 92, p. 289
Karthikeyan, R., Kulakow, P. A.: Soil Plant Microbe Interactions in Phytoremediation. Vol. 78,
p. 51
Kataoka, M. see Shimizu, S.: Vol. 58, p. 45
Kataoka, M. see Shimizu, S.: Vol. 63, p. 109
Katzen, R., Tsao, G. T.: A View of the History of Biochemical Engineering. Vol. 70, p. 77
Kawai, F.: Breakdown of Plastics and Polymers by Microorganisms. Vol. 52, p. 151
Kawarasaki, Y. see Nakano, H.: Vol. 90, p. 135
Kell, D. B. see Shaw, A. D.: Vol. 66, p. 83
Kessler, B., Weusthuis, R., Witholt, B., Eggink, G.: Production of Microbial Polyesters: Fer-
mentation and Downstream Processes. Vol. 71, p. 159
Khosla, C. see McDaniel, R.: Vol. 73, p. 31
Khurana, J. P. see Tyagi, A. K.: Vol. 84, p. 91
Kieran, P. M., Malone, D. M., MacLoughlin, P. F.: Effects of Hydrodynamic and Interfacial
Forces on Plant Cell Suspension Systems. Vol. 67, p. 139
Kijne, J. W. see Memelink, J.: Vol. 72, p. 103
Kim, B. C. see Gu, M. B.: Vol. 87, p. 269
Kim, D.-I. see Choi, J. W.: Vol. 72, p. 63
Kim, R. see Banks, M. K.: Vol. 78, p. 75
Kim, Y. B., Lenz, R. W.: Polyesters from Microorganisms. Vol. 71, p. 51
Kimura, E.: Metabolic Engineering of Glutamate Production. Vol. 79, p. 37
King, R.: Mathematical Modelling of the Morphology of Streptomyces Species. Vol. 60, p. 95
Kinner, B., Capito, R. M., Spector, M.: Regeneration of Articular Cartilage. Vol. 94, p. 91
Kino-oka, M., Nagatome, H., Taya, M.: Characterization and Application of Plant Hairy
Roots Endowed with Photosynthetic Functions. Vol. 72, p. 183
Kino-oka, M., Taya M.: Development of Culture Techniques of Keratinocytes for Skin Graft
Production. Vol. 91, p. 135
Kirk, T. K. see Akhtar, M.: Vol. 57, p. 159
Kjelgren, R. see Ferro, A.: Vol. 78, p. 125
Knoll, A., Maier, B., Tscherrig, H., Büchs, J.: The Oxygen Mass Transfer, Carbon Dioxide
Inhibition, Heat Removal, and the Energy and Cost Efficiencies of High Pressure Fer-
mentation. Vol. 92, p. 77
Knorre, W. A. see Bocker, H.: Vol. 70, p. 35
Kobayashi, M. see Shimizu, S.: Vol. 58, p. 45
Kobayashi, S., Uyama, H.: In vitro Biosynthesis of Polyesters. Vol. 71, p. 241
Kobayashi, T. see Honda, H.: Vol. 72, p. 157
Kodera, F. see Inada, Y.: Vol. 52, p. 129
Kohl, T., Schwille, P.: Fluorescence Correlation Spectroscopy with Autofluorescent Proteins.
Vol. 95, p. 107
Kolattukudy, P. E.: Polyesters in Higher Plants. Vol. 71, p. 1
König, A. see Riedel, K.: Vol. 75, p. 81
de Koning, G. J. M. see van der Walle, G. A. M.: Vol. 71, p. 263
Konthur, Z. see Eickhoff, H.: Vol. 77, p. 103
Koo, Y.-M. see Lee, S.-M.: Vol. 87, p. 173

Kornprobst, J.-M. see Bourguet-Kondracki, M.-L.: Vol. 97, p. 105
Kossen, N. W. F.: The Morphology of Filamentous Fungi. Vol. 70, p. 1
Köster, H. see Jurinke, C.: Vol. 77, p. 57
Koutinas, A. A. see Webb, C.: Vol. 87, p. 195
Krabben, P., Nielsen, J.: Modeling the Mycelium Morphology of Penicilium Species in Sub-
merged Cultures. Vol. 60, p. 125
Kralovánszky, U. P. see Holló, J.: Vol. 69, p. 151
Krämer, R.: Analysis and Modeling of Substrate Uptake and Product Release by Procaryotic
and Eucaryotik Cells. Vol. 54, p. 31
Kretzmer, G.: Influence of Stress on Adherent Cells. Vol. 67, p. 123
Krieger, N. see Mitchell, D. A.: Vol. 68, p. 61
Krishna, S. H., Srinivas, N. D., Raghavarao, K. S. M. S., Karanth, N. G.: Reverse Micellar Ex-
traction for Downstream Processeing of Proteins/Enzymes. Vol. 75, p. 119
Kück, U. see Schmitt, E. K.: Vol. 88, p. 1
Kuhad, R. C., Singh, A., Eriksson, K.-E. L.: Microorganisms and Enzymes Involved in the
Degradation of Plant Cell Walls. Vol. 57, p. 45
Kuhad, R. Ch. see Singh, A.: Vol. 51, p. 47
Kula, M.-R. see Hubbuch, J.: Vol. 92, p. 101
Kulakow, P. A. see Karthikeyan, R.: Vol. 78, p. 51
Kulakow, P. A. see Banks, M. K.: Vol. 78, p. 75
Kumagai, H.: Microbial Production of Amino Acids in Japan. Vol. 69, p. 71
Kumar, R. see Mukhopadhyay, A.: Vol. 86, p. 215
Kumar, S. see Harvey, N. L.: Vol. 62, p. 107
Kunze, G. see Riedel, K.: Vol. 75, p. 81
Kwon, S. see Drmanac, R.: Vol. 77, p. 75
Lacy, S. see Drmanac, R.: Vol. 77, p. 75 Ladenstein, R., Antranikian, G.: Proteins from
Hyperthermophiles: Stability and Enzamatic Catalysis Close to the Boiling Point of
Water. Vol. 61, p. 37
Ladisch, C. M. see Mosier, N. S.: Vol. 65, p. 23
Ladisch, M. R. see Mosier, N. S.: Vol. 65, p. 23
LaFayette, P. R. see Dean, J. F. D.: Vol. 57, p. 1
Lalk, M. see Schweder, T.: Vol. 96, p. 1
Lammers, F., Scheper, T.: Thermal Biosensors in Biotechnology. Vol. 64, p. 35
Lang, S., Hüners, M., Lurtz, V.: Bioprocess Engineering Data on the Cultivation of Marine
Prokaryotes and Fungi. Vol. 97, p. 29
Larroche, C., Gros, J.-B.: Special Transformation Processes Using Fungal Spares and Immo-
bilized Cells. Vol. 55, p. 179
Latady, M. see Flechas, F. W.: Vol. 78, p. 171
Lazarus, M. see Adam, W.: Vol. 63, p. 73
Leak, D. J. see van der Werf, M. J.: Vol. 55, p. 147
Lee, J. M. see James, E.: Vol. 72, p. 127
Lee, S.-M., Lin, J., Koo, Y.-M.: Production of Lactic Acid from Paper Sludge by Simultaneous
Saccharification and Fermentation. Vol. 87, p. 173
Lee, S. Y., Chang, H. N.: Production of Poly(hydroxyalkanoic Acid). Vol. 52, p. 27
Lee, S. Y., Choi, J.: Production of Microbial Polyester by Fermentation of Recombinant
Microorganisms. Vol. 71, p. 183
Lee, Y. Y., Iyer, P., Torget, R. W.: Dilute-Acid Hydrolysis of Lignocellulosic Biomass. Vol. 65,
p. 93
Lehrach, H. see Eickhoff, H.: Vol. 77, p. 103

Lenz, R. W. see Kim, Y. B.: Vol. 71, p. 51
Leuchtenberger, W. see Wöltinger, J.: Vol. 92, p. 289
Leung, P. S. C. see Chu, K. H.: Vol. 97, p. 205
Licari, P. see McDaniel, R.: Vol. 73, p. 31
Liebezeit, G.: Aquaculture of “Non-Food Organisms” for Natural Substance Production.
Vol. 97, p. 1
Liese, A.: Technical Application of Biological Principles in Asymmetric Catalysis. Vol. 92,
p. 197
Lievense, L. C., van’t Riet, K.: Convective Drying of Bacteria II. Factors Influencing Survival.
Vol. 51, p. 71
Lilie, H. see Fahnert, B.: Vol. 89, p. 93
Lin, J. see Lee, S.-M.: Vol. 87, p. 173
Linden, J. C., Haigh, J. R., Mirjalili, N., Phisaphalong, M.: Gas Concentration Effects on
Secondary Metabolite Production by Plant Cell Cultures. Vol. 72, p. 27
Lindequist, U. see Schweder, T.: Vol. 96, p. 1
Lipshutz, R. see Hannenhalli, S.: Vol. 77, p. 1
Lipson, D. S. see Ferro, A.: Vol. 78, p. 125
Little, D. see Drmanac, R.: Vol. 77, p. 75
Liu, B. see Banks, M. K.: Vol. 78, p. 75
Liu, C. see Honda, H.: Vol. 72, p. 157
Lohray, B. B.: Medical Biotechnology in India. Vol. 85, p. 215
Longaker, M. T. see Colwell, A. S.: Vol. 93, p. 83
Lorenz, H. P. see Colwell, A. S.: Vol. 93, p. 83
Lueking, A. see Eickhoff, H.: Vol. 77, p. 103
Luo, J. see Yang, S.-T.: Vol. 87, p. 61
Lurtz, V. see Lang, S.: Vol. 97, p. 29
Lyberatos, G. see Pind, P. F.: Vol. 82, p. 135
Mac Loughlin, P. F. see Kieran, P. M.: Vol. 67, p. 139

Macario, A. J. L. see Conway de Macario, E.: Vol. 81, p. 95
Madhusudhan, T. see Mukhopadhyay, A.: Vol. 86, p. 215
Maier, B. see Knoll, A.: Vol. 92, p. 77
Malay, S. see Debashish, G.: Vol. 96, p. 189
Malone, D. M. see Kieran, P. M.: Vol. 67, p. 139
Maloney, S. see Müller, R.: Vol. 61, p. 155
Mandenius, C.-F.: Electronic Noses for Bioreactor Monitoring. Vol. 66, p. 65
Markov, S. A., Bazin, M. J., Hall, D. O.: The Potential of Using Cyanobacteria in Photobiore-
actors for Hydrogen Production. Vol. 52, p. 59
Marteinsson, V. T. see Prieur, D.: Vol. 61, p. 23
Martín, J. F., Ullán, R. V., Casqueiro, J.: Novel Genes Involved in Cephalosporin Biosynthesis:
The Three-component Isopenicillin N Epimerase System. Vol. 88, p. 91
Marx, A. see Pfefferle, W.: Vol. 79, p. 59
Mathur, R. K. see Ghosh, A. C.: Vol. 56, p. 111
Matsunaga, T., Takeyama, H., Miyashita, H., Yokouchi, H.: Marine Microalgae. Vol. 96, p. 165
Matsushima, A. see Inada, Y.: Vol. 52, p. 129
Mauch, K. see Schmalzriedt, S.: Vol. 80, p. 19
Mayer Jr., J. E. see Rabkin-Aikawa, E.: Vol. 94, p. 141
Mazumdar-Shaw, K., Suryanarayan, S.: Commercialization of a Novel Fermentation Con-
cept. Vol. 85, p. 29
McCaskill, D., Croteau, R.: Prospects for the Bioengineering of Isoprenoid Biosynthesis.
Vol. 55, p. 107
McDaniel, R., Licari, P., Khosla, C.: Process Development and Metabolic Engineering for the
Overproduction of Natural and Unnatural Polyketides. Vol. 73, p. 31
McDonell, T. J. see Bruckheimer, E. M.: Vol. 62, p. 75
McGall, G. H., Christians, F. C.: High-Density GeneChip Oligonucleotide Probe Arrays.
Vol. 77, p. 21
McGovern, A. see Shaw, A. D.: Vol. 66, p. 83
McGowan, A. J. see McKenna, S. L.: Vol. 62, p. 1
McIntyre, M., Müller, C., Dynesen, J., Nielsen, J.: Metabolic Engineering of the Aspergillus.
Vol. 73, p. 103
McIntyre, T.: Phytoremediation of Heavy Metals from Soils. Vol. 78, p. 97
McKenna, S. L., McGowan, A. J., Cotter, T. G.: Molecular Mechanisms of Programmed Cell
Death. Vol. 62, p. 1
McLoughlin, A. J.: Controlled Release of Immobilized Cells as a Strategy to Regulate Ecolog-
ical Competence of Inocula. Vol. 51, p. 1
Memelink, J., Kijne, J. W., van der Heijden, R., Verpoorte, R.: Genetic Modification of Plant
Secondary Metabolite Pathways Using Transcriptional Regulators. Vol. 72, p. 103
Menachem, S. B. see Argyropoulos, D. S.: Vol. 57, p. 127
Menawat, A. S. see Gomes J.: Vol. 59, p. 1
Menge, M. see Mukerjee, J.: Vol. 68, p. 1
Merkle, S. A. see Dean, J. F. D.: Vol. 57, p. 1
Mescher, A. L., Neff, A. W.: Regenerative Capacity and the Developing Immune System.
Vol. 93, p. 39
Meyer, H. E. see Sickmann, A.: Vol. 83, p. 141
Michalopoulos, G. K., DeFrances M.: Liver Regeneration. Vol. 93, p. 101
Mikos, A. G. see Mistry, A. S.: Vol. 94, p. 1
Minas, W. see Barber, M. S.: Vol. 88, p. 179
Mirjalili, N. see Linden, J. C.: Vol. 72, p. 27
Mishra, P. see Chand, S.: Vol. 85, p. 95
Mistry, A. S., Mikos, A. G.: Tissue Engineering Strategies for Bone Regeneration. Vol. 94, p. 1
Mitchell, D. A., Berovic, M., Krieger, N.: Biochemical Engineering Aspects of Solid State
Bioprocessing. Vol. 68, p. 61
Mitchell, R. J. see Gu, M. B.: Vol. 87, p. 269
Miura, K.: Tracking Movement in Cell Biology. Vol. 95, p. 267
Miyake, K., Iijima, S.: Bacterial Capsular Polysaccharide and Sugar Transferases. Vol. 90,
p. 89
Miyashita, H. see Matsunaga, T.: Vol. 96, p. 165
Miyawaki, A., Nagai, T., Mizuno, H.: Engineering Fluorescent Proteins. Vol. 95, p. 1
Mizuno, H. see Miyawaki, A.: Vol. 95, p. 1
Möckel, B. see Pfefferle, W.: Vol. 79, p. 59
Moeur, B. see Drmanac, R.: Vol. 77, p. 75
Mogensen, A. S., Dolfing, J., Haagensen, F., Ahring, B. K.: Potential for Anaerobic Conversion
of Xenobiotics. Vol. 82, p. 69
Moore, J. C. see Arnold, F. H.: Vol. 58, p. 1
Moracci, M. see van der Oost, J.: Vol. 61, p. 87
Mosier, N. S., Hall, P., Ladisch, C. M., Ladisch, M. R.: Reaction Kinetics, Molecular Action,
and Mechanisms of Cellulolytic Proteins. Vol. 65, p. 23
Mreyen, M. see Sickmann, A.: Vol. 83, p. 141
Mueller, U., Huebner, S.: Economic Aspects of Amino Acids Production. Vol. 79, p. 137
Muffler, K., Ulber R.: Downstream Processing in Marine Biotechnology. Vol. 97, p. 63
Mühlemann, H. M., Bungay, H. R.: Research Perspectives for Bioconversion of Scrap Paper.
Vol. 65, p. 193
Mukherjee, J., Menge, M.: Progress and Prospects of Ergot Alkaloid Research. Vol. 68, p. 1
Mukhopadhyay, A.: Inclusion Bodies and Purification of Proteins in Biologically Active
Forms. Vol. 56, p. 61
Mukhopadhyay, A. see Bhatia, P. K.: Vol. 64, p. 155
Mukhopadhyay, A., Basu, S. K.: Intracellular Delivery of Drugs to Macrophages. Vol. 84,
p. 183
Mukhopadhyay, A., Madhusudhan, T., Kumar, R.: Hematopoietic Stem Cells: Clinical Re-
quirements and Developments in Ex-Vivo Culture. Vol. 86, p. 215
Müller, C. see McIntyre, M.: Vol. 73, p. 103
Müller, M., Wolberg, M., Schubert, T.: Enzyme-Catalyzed Regio- and Enantioselective Ketone
Reductions. Vol. 92, p. 261
Müller, R., Antranikian, G., Maloney, S., Sharp, R.: Thermophilic Degradation of Environ-
mental Pollutants. Vol. 61, p. 155
Müllner, S.: The Impact of Proteomics on Products and Processes. Vol. 83, p. 1
van Munster, E. B., Gadella, T. W. J.: Fluorescence Lifetime Imaging Microscopy (FLIM),
Vol. 95, p. 143
Nagai, T. see Miyawaki, A.: Vol. 95, p. 1

Nagatome, H. see Kino-oka, M.: Vol. 72, p. 183
Nagy, E.: Three-Phase Oxygen Absorption and its Effect on Fermentation. Vol. 75, p. 51
Nakano, H., Kawarasaki, Y., Yamane, T.: Cell-free Protein Synthesis Systems: Increasing their
Performance and Applications. Vol. 90, p. 135
Nakashimada, Y. see Nishio, N.: Vol. 90, p. 63
Nath, S.: Molecular Mechanisms of Energy Transduction in Cells: Engineering Applications
and Biological Implications. Vol. 85, p. 125
Nebe-Von-Caron, G. see Hewitt, C. J.: Vol. 89, p. 197
Necina, R. see Strancar, A.: Vol. 76, p. 49
Neff, A. W. see Mescher, A. L.: Vol. 93, p. 39
Neubauer, P. see Fahnert, B.: Vol. 89, p. 93
Nielsen, J. see Christensen, B.: Vol. 66, p. 209
Nielsen, J. see Gunnarsson, N.: Vol. 88, p. 137
Nielsen, J. see Krabben, P.: Vol. 60, p. 125
Nielsen, J. see McIntyre, M.: Vol. 73, p. 103
Nisbet, L. J. see Hill, D. C.: Vol. 59, p. 73
Nishijima, K. see Kamihira, M.: Vol. 91, p. 171
Nishimura, H. see Inada, Y.: Vol. 52, p. 123
Nishio, N., Nakashimada, Y.: High Rate Production of Hydrogen/Methane from Various
Substrates and Wastes. Vol. 90, p. 63
Nöh, K. see Wiechert, W.: Vol. 92, p. 145
Nordhoff, E. see Cahill, D. J.: Vol. 83, p. 177
Nordhoff, E. see Eickhoff, H.: Vol. 77, p. 103
Nouwens, A. S., Walsh, B. J., Cordwell S. J.: Application of Proteomics to Pseudomonas aerug-
inosa. Vol. 83, p. 117
Nyarsik, L. see Eickhoff, H.: Vol. 77, p. 103
Ochsner, U. A., Hembach, T., Fiechter, A.: Produktion of Rhamnolipid Biosurfactants. Vol. 53,
p. 89
O’Connor, R.: Survival Factors and Apoptosis: Vol. 62, p. 137

Ogawa, J. see Shimizu, S.: Vol. 58, p. 45
Ohshima, T., Sato, M.: Bacterial Sterilization and Intracellular Protein Release by Pulsed
Electric Field. Vol. 90, p. 113
Ohta, H.: Biocatalytic Asymmetric Decarboxylation. Vol. 63, p. 1
Oldiges, M., Takors, R.: Applying Metabolic Profiling Techniques for Stimulus-Response
Experiments: Chances and Pitfalls. Vol. 92, p. 173
Oliverio, S. see Autuori, F.: Vol. 62, p. 129
van der Oost, J., Ciaramella, M., Moracci, M., Pisani, F. M., Rossi, M., de Vos, W. M.: Molecular
Biology of Hyperthermophilic Archaea. Vol. 61, p. 87
Orgill, D. P., Butler, C. E.: Island Grafts: A Model for Studying Skin Regeneration in Isolation
from Other Processes. Vol. 93, p. 161
Orgill, D. P. see Butler, C. E.: Vol. 94, p. 23
Orlich, B., Schomäcker, R.: Enzyme Catalysis in Reverse Micelles. Vol. 75, p. 185
Orru, R. V. A., Archelas, A., Furstoss, R., Faber, K.: Epoxide Hydrolases and Their Synthetic
Applications. Vol. 63, p. 145
Osbourn, A. E. see Haralampidis, D.: Vol. 75, p. 31
Oude Elferink, S. J. W. H. see Stams, A. J. M.: Vol. 81, p. 31
Padmanaban, G.: Drug Targets in Malaria Parasites. Vol. 84, p. 123

Panda, A. K.: Bioprocessing of Therapeutic Proteins from the Inclusion Bodies of Escherichia
coli. Vol. 85, p. 43
Park, E. Y.: Recent Progress in Microbial Cultivation Techniques. Vol. 90, p. 1
Paul, G. C., Thomas, C. R.: Characterisation of Mycelial Morphology Using Image Analysis.
Vol. 60, p. 1
Perrier, M. see Dochain, D.: Vol. 56, p. 147
Pevzner, P. A. see Hannenhalli, S.: Vol. 77, p. 1
Pfefferle, W., Möckel, B., Bathe, B., Marx, A.: Biotechnological Manufacture of Lysine. Vol. 79,
p. 59
Phisaphalong, M. see Linden, J. C.: Vol. 72, p. 27
Piacentini, G. see Autuori, F.: Vol. 62, p. 129
Pind, P. F., Angelidaki, I., Ahring, B. K., Stamatelatou, K., Lyberatos, G.: Monitoring and
Control of Anaerobic Reactors. Vol. 82, p. 135
Piredda, L. see Autuori, F.: Vol. 62, p. 129
Pisani, F. M. see van der Oost, J.: Vol. 61, p. 87
Plattner, H. see Brakhage, A. A.: Vol. 88, p. 45
Podgornik, A. see Strancar, A.: Vol. 76, p. 49
Podgornik, A., Tennikova, T. B.: Chromatographic Reactors Based on Biological Activity.
Vol. 76, p. 165
Pohl, M.: Protein Design on Pyruvate Decarboxylase (PDC) by Site-Directed Mutagenesis.
Vol. 58, p. 15
Poirier, Y.: Production of Polyesters in Transgenic Plants. Vol. 71, p. 209
Pons, M.-N., Vivier, H.: Beyond Filamentous Species. Vol. 60, p. 61
Pons, M.-N., Vivier, H.: Biomass Quantification by Image Analysis. Vol. 66, p. 133
Prazeres, D. M. F. see Fernandes, P.: Vol. 80, p. 115
Prieur, D., Marteinsson, V. T.: Prokaryotes Living Under Elevated Hydrostatic Pressure.
Vol. 61, p. 23
Prior, A. see Wolfgang, J.: Vol. 76, p. 233
Pulz, O., Scheibenbogen, K.: Photobioreactors: Design and Performance with Respect to
Light Energy Input. Vol. 59, p. 123
Rabkin-Aikawa, E., Mayer Jr., J. E., Schoen, F. J.: Heart Valve Regeneration. Vol. 94, p. 141
Raghavarao, K. S. M. S., Dueser, M., Todd, P.: Multistage Magnetic and Electrophoretic Ex-
traction of Cells, Particles and Macromolecules. Vol. 68, p. 139
Raghavarao, K. S. M. S. see Krishna, S. H.: Vol. 75, p. 119
Ramanathan, K. see Xie, B.: Vol. 64, p. 1
Raskin, L. see Hofman-Bang, J.: Vol. 81, p. 151
Reichert, A. see Barber, M. S.: Vol. 88, p. 179
Reuss, M. see Schmalzriedt, S.: Vol. 80, p. 19
Riedel, K., Kunze, G., König, A.: Microbial Sensor on a Respiratory Basis for Wastewater
Monitoring. Vol. 75, p. 81
van’t Riet, K. see Lievense, L. C.: Vol. 51, p. 71
Rietdorf, J. see Gräf, R.: Vol. 95, p. 57
Rinas, U. see Hoffmann, F.: Vol. 89, p. 73
Rinas, U. see Hoffmann, F.: Vol. 89, p. 143
Roberts, S. M. see Allan, J. V.: Vol. 63, p. 125
Robinson, A. see Brazma, A.: Vol. 77, p. 113
Rock, S. A.: Vegetative Covers for Waste Containment. Vol. 78, p. 157
Roehr, M.: History of Biotechnology in Austria. Vol. 69, p. 125
Rogers, P. L., Shin, H. S., Wang, B.: Biotransformation for L-Ephedrine Production. Vol. 56,
p. 33
Rossi, M. see van der Oost, J.: Vol. 61, p. 87
Rowland, J. J. see Shaw, A. D.: Vol. 66, p. 83
Roy, I., Sharma, S., Gupta, M. N.: Smart Biocatalysts: Design and Applications. Vol. 86, p. 159
Roychoudhury, P. K., Srivastava, A., Sahai, V.: Extractive Bioconversion of Lactic Acid. Vol. 53,
p. 61
Rozkov, A., Enfors, S.-O.: Analysis and Control of Proteolysis of Recombinant Proteins in
Escherichia coli. Vol. 89, p. 163
Rubin, P. A. D. see Hatton, M. P.: Vol. 94, p. 125
Rusin, P., Ehrlich, H. L.: Developments in Microbial Leaching – Mechanisms of Manganese
Solubilization. Vol. 52, p. 1
Russell, N. J.: Molecular Adaptations in Psychrophilic Bacteria: Potential for Biotechnological
Applications. Vol. 61, p. 1
Sablon, E., Contreras, B., Vandamme, E.: Antimicrobial Peptides of Lactic Acid Bacteria:
Mode of Action, Genetics and Biosynthesis. Vol. 68, p. 21
Sahai, V. see Singh, A.: Vol. 51, p. 47
Sahai, V. see Roychoudhury, P. K.: Vol. 53, p. 61
Saha-Möller, C. R. see Adam, W.: Vol. 63, p. 73
Sahm, H. see Eggeling, L.: Vol. 54, p. 1
Sahm, H. see de Graaf, A. A.: Vol. 73, p. 9
Sahoo, G. C., Dutta, N. N.: Perspectives in Liquid Membrane Extraction of Cephalosporin
Antibiotics: Vol. 75, p. 209
Saleemuddin, M.: Bioaffinity Based Immobilization of Enzymes. Vol. 64, p. 203
Santos, H. see da Costa, M. S.: Vol. 61, p. 117
Sarkans, U. see Brazma, A.: Vol. 77, p. 113
Sarkiss, M. see Bruckheimer, E. M.: Vol. 62, p. 75
Sato, M. see Ohshima, T.: Vol. 90, p. 113
Sauer, U.: Evolutionary Engineering of Industrially Important Microbial Phenotypes. Vol. 73,
p. 129
Scheibenbogen, K. see Pulz, O.: Vol. 59, p. 123
Scheper, T. see Lammers, F.: Vol. 64, p. 35

Schmalzriedt, S., Jenne, M., Mauch, K., Reuss, M.: Integration of Physiology and Fluid Dy-
namics. Vol. 80, p. 19
Schmidt, J. E. see Skiadas, I. V.: Vol. 82, p. 35
Schmitt, E. K., Hoff, B., Kück, U.: Regulation of Cephalosporin Biosynthesis. Vol. 88, p. 1
Schneider, K. see Beyeler, W.: Vol. 70, p. 139
Schoen, F. J. see Rabkin-Aikawa, E.: Vol. 94, p. 141
Schomäcker, R. see Orlich, B.: Vol. 75, p. 185
Schreier, P.: Enzymes and Flavour Biotechnology. Vol. 55, p. 51
Schreier, P. see Adam, W.: Vol. 63, p. 73
Schroeder, W. A. see Johnson, E. A.: Vol. 53, p. 119
Schubert, T. see Müller, M.: Vol. 92, p. 261
Schubert, W.: Topological Proteomics, Toponomics, MELK-Technology. Vol. 83, p. 189
Schügerl, K.: Extraction of Primary and Secondary Metabolites. Vol. 92, p. 1
Schügerl, K., Gerlach, S. R., Siedenberg, D.: Influence of the Process Parameters on the
Morphology and Enzyme Production of Aspergilli. Vol. 60, p. 195
Schügerl, K. see Seidel, G.: Vol. 66, p. 115
Schügerl, K.: Recovery of Proteins and Microorganisms from Cultivation Media by Foam
Flotation. Vol. 68, p. 191
Schügerl, K.: Development of Bioreaction Engineering. Vol. 70, p. 41
Schügerl, K. see Tollnick, C.: Vol. 86, p. 1
Schumann, W.: Function and Regulation of Temperature-Inducible Bacterial Proteins on the
Cellular Metabolism. Vol. 67, p. 1
Schuster, K. C.: Monitoring the Physiological Status in Bioprocesses on the Cellular Level.
Vol. 66, p. 185
Schwab, P. see Banks, M. K.: Vol. 78, p. 75
Schweder, T., Hecker, M.: Monitoring of Stress Responses. Vol. 89, p. 47
Schweder, T., Lindequist, U., Lalk, M.: Screening for New Metabolites from Marine Microor-
ganisms. Vol. 96, p. 1
Schwille, P. see Kohl, T.: Vol. 95, p. 107
Scouroumounis, G. K. see Winterhalter, P.: Vol. 55, p. 73
Scragg, A. H.: The Production of Aromas by Plant Cell Cultures. Vol. 55, p. 239
Sedlak, M. see Ho, N. W. Y.: Vol. 65, p. 163
Seidel, G., Tollnick, C., Beyer, M., Schügerl, K.: On-line and Off-line Monitoring of the
Production of Cephalosporin C by Acremonium Chrysogenum. Vol. 66, p. 115
Seidel, G. see Tollnick, C.: Vol. 86, p. 1
Sellos, D. see Guérard, F.: Vol. 96, p. 127
Shafto, J. see Drmanac, R.: Vol. 77, p. 75
Sharma, A. see Johri, B. N.: Vol. 84, p. 49
Sharma, M., Swarup, R.: The Way Ahead – The New Technology in an Old Society. Vol. 84,
p. 1
Sharma, S. see Roy, I.: Vol. 86, p. 159
Shamlou, P. A. see Yim, S. S.: Vol. 67, p. 83
Shapira, M. see Gutman, A. L.: Vol. 52, p. 87
Sharp, R. see Müller, R.: Vol. 61, p. 155
Shaw, A. D., Winson, M. K., Woodward, A. M., McGovern, A., Davey, H. M., Kaderbhai, N.,
Broadhurst, D., Gilbert, R. J., Taylor, J., Timmins, E. M., Alsberg, B. K., Rowland, J. J.,
Goodacre, R., Kell, D. B.: Rapid Analysis of High-Dimensional Bioprocesses Using Mul-
tivariate Spectroscopies and Advanced Chemometrics. Vol. 66, p. 83
Shi, N.-Q. see Jeffries, T. W.: Vol. 65, p. 117
Shimizu, K.: Metabolic Flux Analysis Based on 13C-Labeling Experiments and Integration
of the Information with Gene and Protein Expression Patterns. Vol. 91, p. 1
Shimizu, K. see Hasegawa, S.: Vol. 51, p. 91
Shimizu, S., Ogawa, J., Kataoka, M., Kobayashi, M.: Screening of Novel Microbial for the
Enzymes Production of Biologically and Chemically Useful Compounds. Vol. 58, p. 45
Shimizu, S., Kataoka, M.: Production of Chiral C3- and C4-Units by Microbial Enzymes.
Vol. 63, p. 109
Shin, H. S. see Rogers, P. L.: Vol. 56, p. 33
Shinkai, M., Ito, A.: Functional Magnetic Particles for Medical Application. Vol. 91, p. 191
Sibarita, J.-B.: Deconvolution Microscopy. Vol. 95, p. 201
Sickmann, A., Mreyen, M., Meyer, H. E.: Mass Spectrometry – a Key Technology in Proteome
Research. Vol. 83, p. 141
Siebert, P. D. see Zhumabayeva, B.: Vol. 86, p. 191
Siedenberg, D. see Schügerl, K.: Vol. 60, p. 195
Singh, A., Kuhad, R. Ch., Sahai, V., Ghosh, P.: Evaluation of Biomass. Vol. 51, p. 47
Singh, A. see Kuhad, R. C.: Vol. 57, p. 45
Singh, R. P., Al-Rubeai, M.: Apoptosis and Bioprocess Technology. Vol. 62, p. 167
Skiadas, I. V., Gavala, H. N., Schmidt, J. E., Ahring, B. K.: Anaerobic Granular Sludge and
Biofilm Reactors. Vol. 82, p. 35
Smith, J. S. see Banks, M. K.: Vol. 78, p. 75
Sohail, M., Southern, E. M.: Oligonucleotide Scanning Arrays: Application to High-Through-
put Screening for Effective Antisense Reagents and the Study of Nucleic Acid Interactions.
Vol. 77, p. 43
Sonnleitner, B.: New Concepts for Quantitative Bioprocess Research and Development.
Vol. 54, p. 155
Sonnleitner, B.: Instrumentation of Biotechnological Processes. Vol. 66, p. 1
Southern, E. M. see Sohail, M.: Vol. 77, p. 43
Spector, M. see Kinner, B.: Vol. 94, p. 91
Spröte, P. see Brakhage, A. A.: Vol. 88, p. 45
Srinivas, N. D. see Krishna, S. H.: Vol. 75, p. 119
Srivastava, A. see Roychoudhury, P. K.: Vol. 53, p. 61
Stafford, D. E., Yanagimachi, K. S., Stephanopoulos, G.: Metabolic Engineering of Indene
Bioconversion in Rhodococcus sp. Vol. 73, p. 85
Stamatelatou, K. see Pind, P. F.: Vol. 82, p. 135
Stams, A. J. M., Oude Elferink, S. J. W. H., Westermann, P.: Metabolic Interactions Between
Methanogenic Consortia and Anaerobic Respiring Bacteria. Vol. 81, p. 31
Stark, D., von Stockar, U.: In Situ Product Removal (ISPR) in Whole Cell Biotechnology
During the Last Twenty Years. Vol. 80, p. 149
Stefuca, V., Gemeiner, P.: Investigation of Catalytic Properties of Immobilized Enzymes and
Cells by Flow Microcalorimetry. Vol. 64, p. 69
Steinbüchel, A., Hein, S.: Biochemical and Molecular Basis of Microbial Synthesis of Poly-
hydroxyalkanoates in Microorganisms. Vol. 71, p. 81
Stellfeld, T. see Hassfeld, J.: Vol. 97, p. 133
Stephanopoulos, G., Gill, R. T.: After a Decade of Progress, an Expanded Role for Metabolic
Stephanopoulos, G. see Stafford, D. E.: Vol. 73, p. 85
von Stockar, U., van der Wielen, L. A. M.: Back to Basics: Thermodynamics in Biochemical
von Stockar, U. see Stark, D.: Vol. 80, p. 149
Stocum, D. L.: Stem Cells in CNS and Cardiac Regeneration. Vol. 93, p. 135
Straathof, A. J. J. see Bruggink, A.: Vol. 80, p. 69

Strancar, A., Podgornik, A., Barut, M., Necina, R.: Short Monolithic Columns as Stationary
Phases for Biochromatography. Vol. 76, p. 49
Suehara, K., Yano, T.: Bioprocess Monitoring Using Near-Infrared Spectroscopy. Vol. 90,
p. 173
Sun, C.-K.: Higher Harmonic Generation Microscopy. Vol. 95, p. 17
Suryanarayan, S. see Mazumdar-Shaw, K.: Vol. 85, p. 29
Suurnäkki, A., Tenkanen, M., Buchert, J., Viikari, L.: Hemicellulases in the Bleaching of
Chemical Pulp. Vol. 57, p. 261
Svec, F.: Capillary Electrochromatography: a Rapidly Emerging Separation Method. Vol. 76,
p. 1
Svec, F. see Xie, S.: Vol. 76, p. 87
Swanson, D. see Drmanac, R.: Vol. 77, p. 75
Swarup, R. see Sharma, M.: Vol. 84, p. 1
Tabata, H.: Paclitaxel Production by Plant-Cell-Culture Technology. Vol. 87, p. 1

Takeyama, H. see Matsunaga, T.: Vol. 96, p. 165
Takors, R. see Oldiges, M.: Vol. 92, p. 173
Tanaka, T. see Taniguchi, M.: Vol. 90, p. 35
Tang, C. Y. see Chu, K. H.: Vol. 97, p. 205
Tang, Y.-J. see Zhong, J.-J.: Vol. 87, p. 25
Taniguchi, M., Tanaka, T.: Clarification of Interactions Among Microorganisms and Devel-
opment of Co-culture System for Production of Useful Substances. Vol. 90, p. 35
Taya, M. see Kino-oka, M.: Vol. 72, p. 183
Taya, M. see Kino-oka, M.: Vol. 91, p. 135
Taylor, J. see Shaw, A. D.: Vol. 66, p. 83
Tenkanen, M. see Suurnäkki, A.: Vol. 57, p. 261
Tennikova, T. B. see Podgornik, A.: Vol. 76, p. 165
Thiericke, R. see Grabely, S.: Vol. 64, p. 101
Thomas, C. R. see Paul, G. C.: Vol. 60, p. 1
Thömmes, J.: Fluidized Bed Adsorption as a Primary Recovery Step in Protein Purification.
Vol. 58, p. 185
Thömmes, J. see Hubbuch, J.: Vol. 92, p. 101
Timmens, E. M. see Shaw, A. D.: Vol. 66, p. 83
Todd, P. see Raghavarao, K. S. M. S.: Vol. 68, p. 139
Tolan, J. S., Guenette, M.: Using Enzymes in Pulp Bleaching: Mill Applications. Vol. 57, p. 289
Tolan, J. S., Foody, B.: Cellulase from Submerged Fermentation. Vol. 65, p. 41
Tollnick, C. see Seidel, G.: Vol. 66, p. 115
Tollnick, C., Seidel, G., Beyer, M., Schügerl, K.: Investigations of the Production of Cephalosporin
C by Acremonium chrysogenum. Vol. 86, p. 1
Torget, R. W. see Lee, Y. Y.: Vol. 65, p. 93
Traganos, F. see Darzynkiewicz, Z.: Vol. 62, p. 33
Trip, H. see Evers, M. E.: Vol. 88, p. 111
Trojanowska, M. see Haralampidis, D.: Vol. 75, p. 31
Tsao, D. T.: Overview of Phytotechnologies. Vol. 78, p. 1
Tsao, G. T., Cao, N. J., Du, J., Gong, C. S.: Production of Multifunctional Organic Acids from
Renewable Resources. Vol. 65, p. 243
Tsao, G. T. see Gong, C. S.: Vol. 65, p. 207
Tsao, G. T. see Katzen, R.: Vol. 70, p. 77
Tscherrig, H. see Knoll, A.: Vol. 92, p. 77
Tsonis, P. A. see Call, M. K.: Vol. 93, p. 67

Tüncher, A. see Brakhage, A. A.: Vol. 88, p. 45
Tyagi, A. K., Dhar, N.: Recent Advances in Tuberculosis Research in India. Vol. 84, p. 211
Tyagi, A. K., Khurana, J. P.: Plant Molecular Biology and Biotechnology Research in the
Post-Recombinant DNA Era. Vol. 84, p. 91
Ueda, M. see Wazawa, T.: Vol. 95, p. 77

Ukrainczyk, T. see Drmanac, R.: Vol. 77, p. 75
Ulber R. see Muffler, K.: Vol. 97, p. 63
Ullán, R. V. see Martín, J. F.: Vol. 88, p. 91
Uozumi, N.: Large-Scale Production of Hairy Root. Vol. 91, p. 75
Uyama, H. see Kobayashi, S.: Vol. 71, p. 241
VanBogelen, R. A.: Probing the Molecular Physiology of the Microbial Organism, Escherichia
coli using Proteomics. Vol. 83, p. 27
Vandamme, E. see Sablon, E.: Vol. 68, p. 21
Vasic-Racki, D. see Wichmann, R.: Vol. 92, p. 225
Verma, P., Fawcett, J.: Spinal Cord Regeneration. Vol. 94, p. 43
Verpoorte, R. see Memelink, J.: Vol. 72, p. 103
Viikari, L. see Suurnäkki, A.: Vol. 57, p. 261
Vilo, J. see Brazma, A.: Vol. 77, p. 113
Vingron, M. see Brazma, A.: Vol. 77, p. 113
Virdi, J. S. see Johri, B. N: Vol. 84, p. 49
Vivier, H. see Pons, M.-N.: Vol. 60, p. 61
Vivier, H. see Pons, M.-N.: Vol. 66, p. 133
Vorgias, C. E. see Antranikian, G.: Vol. 96, p. 219
de Vos, W. M. see van der Oost, J.: Vol. 61, p. 87
Wahlbom, C. F. see Hahn-Hägerdal, B.: Vol. 73, p. 53

Wall, M. B. see Farrell, R. L.: Vol. 57, p. 197
van der Walle, G. A. M., de Koning, G. J. M., Weusthuis, R. A., Eggink, G.: Properties, Modifi-
cations and Applications of Biopolyester. Vol. 71, p. 263
Walsh, B. J. see Nouwens, A. S.: Vol. 83, p. 117
Walter, G. see Eickhoff, H.: Vol. 77, p. 103
Wang, B. see Rogers, P. L.: Vol. 56, p. 33
Wang, R. see Webb, C.: Vol. 87, p. 195
Wazawa, T., Ueda, M.: Total Internal Reflection Fluorescence Microscopy in Single Molecule
Nanobioscience. Vol. 95, p. 77
Webb, C., Koutinas, A. A., Wang, R.: Developing a Sustainable Bioprocessing Strategy Based
on a Generic Feedstock. Vol. 87, p. 195
Weichold, O. see Adam, W.: Vol. 63, p. 73
van der Werf, M. J., de Bont, J. A. M. Leak, D. J.: Opportunities in Microbial Biotransformation
of Monoterpenes. Vol. 55, p. 147
Westermann, P. see Hofman-Bang, J.: Vol. 81, p. 151
Westermann, P. see Stams, A. J. M.: Vol. 81, p. 31
Weuster-Botz, D., de Graaf, A. A.: Reaction Engineering Methods to Study Intracellular
Metabolite Concentrations. Vol. 54, p. 75
Weuster-Botz, D.: Parallel Reactor Systems for Bioprocess Development. Vol. 92, p. 125
Weusthuis, R. see Kessler, B.: Vol. 71, p. 159
Weusthuis, R. A. see van der Walle, G. J. M.: Vol. 71, p. 263
Wichmann, R., Vasic-Racki, D.: Cofactor Regeneration at the Lab Scale. Vol. 92, p. 225
Wick, L. M., Egli, T.: Molecular Components of Physiological Stress Responses in Escherichia
coli. Vol. 89, p. 1
Wiechert, W., de Graaf, A. A.: In Vivo Stationary Flux Analysis by 13C-Labeling Experiments.
Vol. 54, p. 109
Wiechert, W., Nöh, K.: From Stationary to Instationary Metabolic Flux Analysis. Vol. 92,
p. 145
van der Wielen, L. A. M. see Bruggink, A.: Vol. 80, p. 69
van der Wielen, L. A. M. see von Stockar, U.: Vol. 80, p. 1
Wiesmann, U.: Biological Nitrogen Removal from Wastewater. Vol. 51, p. 113
Williamson, N. M. see Allan, J. V.: Vol. 63, p. 125
Wilson, D. B., Irwin, D. C.: Genetics and Properties of Cellulases. Vol. 65, p. 1
Winson, M. K. see Shaw, A. D.: Vol. 66, p. 83
Winterhalter, P., Skouroumounis, G. K.: Glycoconjugated Aroma Compounds: Occurence,
Role and Biotechnological Transformation. Vol. 55, p. 73
Witholt, B. see Kessler, B.: Vol. 71, p. 159
Wolberg, M. see Müller, M.: Vol. 92, p. 261
Wolfgang, J., Prior, A.: Continuous Annular Chromatography. Vol. 76, p. 233
Wöltinger, J., Karau, A., Leuchtenberger, W., Drauz K.: Membrane Reactors at Degussa.
Vol. 92, p. 289
Woodley, J. M.: Advances in Enzyme Technology – UK Contributions. Vol. 70, p. 93
Woodward, A. M. see Shaw, A. D.: Vol. 66, p. 83
Wrigley, S. K. see Hill, D. C.: Vol. 59, p. 73
Wu, A. see Chu, K. H.: Vol. 97, p. 205
Xia, L. see Cen, P.: Vol. 65, p. 69

Xie, B., Ramanathan, K., Danielsson, B.: Principles of Enzyme Thermistor Systems: Appli-
cations to Biomedical and Other Measurements. Vol. 64, p. 1
Xie, S., Allington, R. W., Fréchet, J. M. J., Svec, F.: Porous Polymer Monoliths: An Alternative
to Classical Beads. Vol. 76, p. 87
Xu, C. see Drmanac, R.: Vol. 77, p. 75
Yamane, T. see Iwasaki, Y.: Vol. 90, p. 135

Yamane, T. see Nakano, H.: Vol. 90, p. 89
Yanagimachi, K. S. see Stafford, D. E.: Vol. 73, p. 85
Yang, S.-T., Luo, J., Chen, C.: A Fibrous-Bed Bioreactor for Continuous Production of Mon-
oclonal Antibody by Hybridoma. Vol. 87, p. 61
Yannas, I. V.: Facts and Theories of Induced Organ Regeneration. Vol. 93, p. 1
Yannas, I. V. see Zhang, M.: Vol. 94, p. 67
Yano, T. see Suehara, K.: Vol. 90, p. 173
Yim, S. S., Shamlou, P. A.: The Engineering Effects of Fluids Flow and Freely Suspended
Biological Macro-Materials and Macromolecules. Vol. 67, p. 83
Yokouchi, H. see Matsunaga, T.: Vol. 96, p. 165
Zhang, S., Chu, J., Zhuang, Y.: A Multi-Scale Study on Industrial Fermentation Processes and
Their Optimization. Vol. 87, p. 97
Zhang, M., Yannas, I. V.: Peripheral Nerve Regeneration. Vol. 94, p. 67
Zheng, D. see Hofman-Bang, J.: Vol. 81, p. 151
Zhong, J.-J.: Biochemical Engineering of the Production of Plant-Specific Secondary Metabo-
lites by Cell Suspension Cultures. Vol. 72, p. 1
Zhong, J.-J., Tang, Y.-J.: Submerged Cultivation of Medicinal Mushrooms for Production of
Valuable Bioactive Metabolites. Vol. 87, p. 25
Zhuang, Y. see Zhang, S.: Vol. 87, p. 97
Zhumabayeva, B., Chenchik, A., Siebert, P. D., Herrler, M.: Disease Profiling Arrays: Reverse
Format cDNA Arrays Complimentary to Microarrays. Vol. 86, p. 191
Zimmermann, T.: Spectral Imaging and Linear Unmixing in Light Microscopy. Vol. 95, p. 245
Zimmermann, T. see Gräf, R.: Vol. 95, p. 57
Zollinger, N. see Ferro, A.: Vol. 78, p. 125
van Zyl, W. H. see Hahn-Hägerdal, B.: Vol. 73, p. 53
Subject Index
Agarase 196 Ceramides, Coolia monolis 59

Alcohol dehydrogenases, extremophiles – sponges 67
244, 247 CGRP, waste hydrolysates 142
Algal taxonomy, FAs 57 CGTase 238
Alkaline phosphatase, fish 130 Chemical screening 28
Almelysin 196 Chitinases 189, 196, 206
Alteramide 32 Chitin-degrading enzymes 234
Amidases, thermoactive 248 Chlorella spp., anti-inflammatory 169
Amylases 210 Chloroperoxidase 197
Amylases, heat-stable 235 Chlorophytes 169
Anchovy, fish meal 111 Clams, lipids 76
Angiotensin-converting enzyme (ACE) Cloning, screening 19
141 Cnidaria, lipids 69
Antibacterial compounds 41 CO2 fixation, microalgae 182
Antibiotics 35 Coccolithophorids, CO2 fixation 182
Anticancer drugs 172 Coccoliths 172
Antifungal compounds 35 Coelenterates, lipids 69
Anti-inflammatory agents 38 Copepods, lipids 61
Antimicrobial drug screening 24 Crustaceans, lipids 78
Antioxidants, marine hydrolysates 143 Cryptophytes 170
Antitumor compounds, marine 32–34 CTAB detergent 150
Antiviral agents 37 Curacin A 34
Arachidonic acid 171 Cu-Zn superoxide dismutase 197
Attention-deficit disorder (ADHD), PUFA Cyanobacteria, fatty acids 54
81 – polysaccharides 167
Cytokines 38
Bacillariophytes 57 Cytotoxic agents, marine 32
Bacteria, fatty acids 54
– PUFA 91 DHA, fatty acids 79, 171
– cell factories 96 Diatoms 57, 170
Bacterial artificial chromosome 19 Dimethyl sulfide 198
Biological screening, marine 28 Dinoflagellates 57, 171
DMSP lyase 198
C-reactive protein 80 DNA ligase, thermostable 252
Calcitonin, waste hydrolysates 142 DNA microarrays, genomic 23
Catalases 197 DNA polymerases 207, 249
Cathepsins 210 DNA sequencing 251
Cellobiose phosphorylase 208 Docosahexaenoic acids (DHA) 49, 79, 171
Cellulases 227 – fatty acids 79, 171
286 Subject Index
Docosatetraenoic acids (DTA) 171 Haloperoxidases 201

Dolastatin-10 34 Halophiles 227
Drug development, genomics, marine 24 Halovir 37
Haptophytes 172
Echinoderms, lipids 72 Heart disease, PUFA 80
Eicosapentaenoic acid (EPA) 49, 170 Heterokontophytes 170
Endoglucanase 229 High-content screening (HCS) 30
Endothelin 39 High-throughput screening (HTS) 30
Enkephalins 140 Hormonal regulating-peptides, waste
Environmental genomics 18 hydrolysates 142
Enzymes, cloning 202, 208 Hydrolases 196, 206
– fish 130 Hydrolysates 128
– inhibitors 39 Hyperthermophilic archaea, proteases
EPA, fatty acids 79, 170 241
Epolactaene 39
Epoxy-pseudoisoeugenol Immunopeptides, fish hydrolysates 142
(2-methylbutyrate) (EPB) IPNV 208
146
Komodoquinone A 39
Esterases, extremophiles 194, 244, 247
Krill lipids 61
Ethylene 176
Euglenophytes 173 LC-PUFA, marine sources 90
Extremophiles 192, 219 LDH, deep-sea fish 130
Leukotriene 83
Fatty acids 49 Ligase chain reaction 252
– acetylenic, sponges 66 Ligases 198
– biosynthesis, marine algae 55 Lipases 194
– non-methylene-interrupted 53 – thermotolerant 244
– polyunsaturated 78 Lipids 49
– ∆5,9- 62 Lyases 198
FISH 18, 23, 26 Lycopene k-cyclase 198
Fish, genetic traceability 146
Fish oil, PUFA 90, 106, 111 Macroalgae, FAs 59
Fish protein hydrolysates 131 Macrolactins, HIV 37
Fish silage 131 Malingamide G 56
Fosmids 19 Maltotriose 237
Mannanase 209
Galactose-1-phosphate uridylyltransferase Marine bioprocess engineering 210
210 Marine genomes, microbial 1, 3
Gastrin, waste hydrolysates 142 Marinone 35
Gene transfer, microalgae 173 Massetolides 35
Glucoamylases, heat-stable 235 Metabolome analysis 1, 31
Glucose dehydrogenase 197 Metalloproteinase 196
Glucose isomerases, extremophiles 244 Methanococcus jannaschii 3, 192, 210
β-Glucosidase 196 Methoxy FAs 60
Glucosidases, heat-stable 235 Microalgae, gene transfer 173
Glutamine synthetase 198 – mass cultivation 177
Glycosphingolipids 67 – metabolites 165
Gorgonians, lipids 69 Molluscs, lipids 73
Growth hormone releasing factors 142 Monooxygenases 197
Gymnodinium spp. 172 Mussels, PUFA 74
Subject Index 287
Neuroactive peptides 140 Repeat expansion detection 252

Nitrite reductase 204 Rhodophytes 168
Nitrogenase 205 Riftia pachyptila 17, 194
Nitrous oxide reductase 204 rRNA genes, cloning 204
RuBisCO 208
Obionin 39
Octacosapolyenoic FAs 58 Salinamides 38
One strain-many compounds 41 Salinosporamide A 32
Opioids 140 Scallops, lipids 76
Oxidoreductases 197, 204 Screening, high-throughput 1
Oysters, lipids 75 Scylla serrata 78
Semiplenamides 39
Patella spp. 75 Shellfish, genetic traceability 146
PCR 249 Shellfish protein hydrolysates 131
Pectin-degrading enzymes 232 Shewanella, PUFA phylogeny 93
Pepsins, cold-active fish 131 Silicatein, silica-synthesizing enzyme 203
Pernilase 192 Sponges 203, 207
Phomactin D 38 – lipids 62
Phospholipids 49 Squids, lipids 77
Photobioreactors, microalgae 180 Starch-hydrolyzing enzymes 236
Photoreactor 165 Sulfolobus spp. 226, 237
Phytanic acids 64 Superoxide dismutases 197, 201
Phytoplankton, fatty acids 56 Synechocystis spp. 3
Pirellula sp. 17
Plakosides 68 Taq polymerase 249
Polyketide synthase (PKS) 90 Thermophiles 219, 224, 242
Porphyra spp. 169 Thermus aquaticus, DNA polymerase 251
Porphyridium cruentum 57, 169 Thiotropocin 38
Prochlorococcus spp. 17 Thraustochytrids 97, 99, 171
Proteases 189, 241 Thromboxane 83
– gastric, fish 131 Thyrotropin-releasing hormone (TRH)
Proteolysis, quantification 137 140
Proteome analysis 1, 22 Topoisomerase 172
– drug action 41 Transcriptome 1
Proteorhodopsin, marine bacteria 20 Transferases 207
Psoriasis, PUFA 81 Triacylgycerols 51
Psychrophiles 207, 219, 224 – biosynthesis 83
PUFA 49, 79, 170 Trypsin, fish 130
– biosynthesis 83 Tubular reactors, microalgae 180
– fish 103 Tumor necrosis factor 83
– health benefits 79 Tunicates, lipids 73
– heart disease 80 VLC-PUFA 58
PUFA production, molecular
biotechnology 96 Xylanolytic enzymes 230
Pullulanase 238 Xylobiose 230
Xylose isomerase 244
Raphidophyceae, FA composition 57
RdRp 208 Zooplankton, lipids 60

Marine Biotechnology I (2005) PDF

Hochgeladen von

Dokumentinformationen

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Marine Biotechnology I (2005) PDF

Hochgeladen von

Copyright:

Verfügbare Formate

96

Biotechnology for the Future Recent Progress of Biochemical and Biomedical

Technology Transfer in Biotechnology Biomethanation II

Recent Progress of Biochemical and Biomedical Biomethanation I

Volume Editors: Yves Le Gal, Roland Ulber

Springer WWW home page: http://www.springeronline.com

Library of Congress Control Number: 2005926286

Prof. Dr. S.-O. Enfors Prof. Dr. I. Endo

Prof. Dr. A. Fiechter Prof. Dr. J.-J. Zhong

For all customers who have a standing order to Advances in Biochemical

You will ﬁnd information about the

Information on this handbook can be found on the internet at

A complete list of all enzyme entries either as an alphabetical Name Index or

Kaiserslautern and Concarneau, Roland Ulber and Yves Le Gal

Screening for New Metabolites from Marine Microorganisms

Fatty Acids from Lipids of Marine Organisms: Molecular Biodiversity,

Fish and Shellﬁsh Upgrading, Traceability

Extreme Environments as a Resource for Microorganisms

Author Index Volumes 51–97 . . . . . . . . . . . . . . . . . . . . . . . 263

Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285

Aquaculture of “Non-Food Organisms”

Bioprocess Engineering Data

Downstream Processing in Marine Biotechnology

Asymmetric Total Synthesis of Complex Marine Natural Products

Seafood Allergy: Lessons from Clinical Symptoms,

Screening for New Metabolites

2 Sequencing of the Genomes of Marine Microorganisms . . . . . . . . . . . 3

3 Screening for New Metabolites . . . . . . . . . . . . . . . . . . . . . . . . . 26

4 Application of Proteomics for Target Analyses of Antibacterial Compounds 41

5 Inﬂuence of Cultivation Conditions on Metabolite Production . . . . . . . 41

Keywords Functional genomics · Proteome · Metabolome · Natural compounds ·

The tremendous biochemical diversity of marine microorganisms and their

A prerequisite for the sequencing of the whole genome of an organism is

Table 1 Selection of completed and ongoing marine genome sequencing projects

Complete genome sequences of marine microorganisms

Organism Properties Genome size (Mb) Institution Reference

Aquifex aeolicus VF5 Hyper-thermophilic marine 1.551 Diversa, [5]

Aeropyrum pernix Aerobic hyperthermophilic archaeon 1.669 National Institute of [6]

Alcanivorax borkumensis Oil-degrading (hydrocarbonoclastic), 3.12 Competence Network [7]

Carboxydothermus Thermophilic anaerobic bacterium 2.1 TIGR, Center of Marine [9]

Chlorobium tepidum TLS Photosynthetic, anaerobic, 2.155 TIGR, USA [10]

Organism Properties Size (Mb) Institution Reference

Colwellia psychroerythraea 34H Arctic bacterium 5.3 TIGR, USA [11]

Methanococcus jannaschii Methanogenic archeon 1.66 TIGR, USA [13]

Nanoarchaeum equitans Marine archaeon, living as an 0.491 Diversa Corporation, [15]

Organism Properties Size (Mb) Institution Reference

Organism Properties Size (Mb) Institution Reference

Pyrococcus horikoshii OT3 Hyperthermophilic archaebacterium 1.739 National Institute of [22]

Sulfolobus tokodaii 7 Aerobic thermoacidophilic 2.695 National Institute of [25]

Thermosynechococcus Thermophilic unicellular cyanobacterium 2.594 Kazusa DNA Research [28]

Organism Properties Size (Mb) Institution Reference

Genomes and chromosomes of marine microorganisms in progress

Aeromonas hydrophila Enterotoxic aeromonad, ﬁsh No data TIGR, University [32]

Bacteriovorax marinus SJ Marine predatory bacterium 3.431 Sanger Institute, [32]

Organism Properties Size (Mb) Institution Reference

Deinococcus geothermalis Extremely radiation-resistant No data Joint Genome Institute, [32]

Organism Properties Size (Mb) Institution Reference

Desulfotalea psychrophila LSv54 Psychrophilic sulfate-reducing 3.66 Epidauros Biotechnologie [32]

Desulfuromonas acetoxidans Anaerobic, sulfur-reducing, 4.1 Joint Genome Institute, [32]

Epulopiscium sp. Lives in the intestines No data TIGR [32]

Organism Properties Size (Mb) Institution Reference

solfataric habitats Denmark

Hyphomonas neptunium Primary colonizers of surfaces in 2.7 University of Georgia, [32]