Crop Protection 28 (2009) 236–242

Contents lists available at ScienceDirect

Crop Protection
journal homepage: www.elsevier.com/locate/cropro

Biocontrol activities of Bacillus amyloliquefaciens DGA14 isolated from banana fruit

surface against banana crown rot-causing pathogens
Dionisio G. Alvindia a, *, Keiko T. Natsuaki b
a
Bureau of Postharvest Research and Extension (BPRE), CLSU Compound 3120, Science City of Muñoz, Nueva Ecija, Philippines
b
Department of International Agricultural Development, Faculty of International Agricultural Studies, Tokyo University of Agriculture, 1-1-1 Sakuragaoka,
Setagaya-ku 156-8502, Tokyo, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Two bacteria, isolated from the surface of banana fruits, one forming a creamy white colony and the
Received 4 July 2008 other, dry yeast like colony were screened for in vitro antagonism toward Lasiodiplodia theobromae. Both
Received in revised form isolates, identified as Bacillus amyloliquefaciens, were further tested for antibiosis against other crown
23 October 2008
rot-causing pathogens (Thielaviopsis paradoxa, Colletotrichum musae, and Fusarium verticillioides). The
Accepted 23 October 2008
creamy white colony strain, coded as B. amyloliquefaciens DGA14, was subjected to laboratory and field
studies. B. amyloliquefaciens DGA14 produced a diffusible metabolite that inhibited all test pathogens in
Keywords:
culture. In addition, bacteria moved and attached to pathogens significantly affecting mycelial growth
Epiphytic bacteria
Antibiosis and conidial germination in liquid medium. Following inoculation, B. amyloliquefaciens DGA14 survived
Biocontrol agent and colonized banana fruits after 2 d. Interparasitic relationships were observed between the antagonist and
Postharvest pathogens pathogens on artificial media and the natural substrate. Postharvest application of B. amyloliquefaciens
DGA14 in the packing house reduced the incidence of crown rot to a level significantly lower than in
fungicide treated or control fruits.
Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction
The preference of consumers for safe agricultural products with
few or no chemical residues has influenced banana farming prac-
tices in the Philippines. Large plantations in Mindanao catering for
export markets have started to convert land to ‘‘organic’’ banana
production. Similarly, small-scale farmers grow bananas in back-
yards without agricultural pesticide application during production
and postharvest operations (hereafter referred to as ‘‘non-chemical
bananas’’). Some of the organic bananas from plantations and non-
chemical bananas are exported to Japan. Japanese consumers prefer
these bananas because of their taste and pesticide-free status. Due
to the absence of pesticide treatments and long interval (19–21 d)
from harvest to market, non-chemical bananas have been reaching
the Japanese market with impaired quality due to postharvest
diseases, particularly crown rot (Alvindia et al., 2000). Crown rot,
the most important postharvest disease of banana, is a syndrome
caused by several fungi including Lasiodiplodia theobromae (Ogawa,
1970; Johanson and Blazquez, 1992), Colletotrichum musae (Finlay
and Brown, 1993), Thielaviopsis paradoxa (Alvindia et al., 2002), and
a complex of Fusarium spp. (Alvindia et al., 2000; Hirata et al., 2001;
* Corresponding author.
E-mail address: dgalvindia@yahoo.com (D.G. Alvindia).
Jimenez et al., 1993; Knight et al., 1977). These fungi infect the
crown through fresh wounds created after trimming the crown of
the banana hand into a crescent shape. Crown rot is controlled
commercially by a postharvest treatment which involves
submerging hands or clusters of banana in fungicide solutions.
Prolonged use of fungicides can lead to a build-up of resistance in
pathogens. The adverse effects of pesticides on human health and
environment necessitate alternatives such as biological control.
Application of fungal biocontrol agents against postharvest
diseases of banana has been reported by various workers (Alvindia
and Natsuaki, 2008; Krauss et al., 1998; Mortuza and Ilag, 1999).
Biocontrol by antagonistic bacteria associated in the fructoplane
was also reported (De Costa and Erabadupitiya, 2005). The potential
for resident microorganisms to be an effective biological control
agent depends on their ability to colonize food sources in plants
without damaging the cells (Janisiewicz et al., 1994). The most
viable approach to utilize antagonistic microorganisms to control
postharvest diseases is the promotion and management of natural
antagonists that already exist on, and are well adapted to, plant
surfaces. In the present investigation, we isolated an unreported
bacterial epiphyte from the banana fructoplane, which is effective
against banana postharvest pathogens and crown rot disease.
Moreover, the interparasitic relationship of the antagonist with the
pathogen, mechanisms of combat, survival, and colonization of
natural habitats was elucidated.

0261-2194/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.cropro.2008.10.011
 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242
2. Materials and methods
2.1. Isolation of bacterial epiphytes
Bacterial antagonists were isolated from the surface of green
Cavendish banana fruit in the Laboratory of Tropical Plant Protec-
tion (LTPP), Tokyo University of Agriculture (TUA), Japan. The
samples were provided by Japan Fresh Fruits (JFF) Co., Ltd that
imports bananas into Japan from the Philippines. Banana fruits in
clusters (five fingers) and hands (13–15 fingers) were supplied by
the company from July–October 2007 for the experiment. From
each hand or cluster, 30 surface tissue squares (1 cm2) were taken
randomly using a sterile scalpel. The tissue pieces were enclosed in
meshed metal containers, washed in running water for 10 min and
blotted dry on sterilized filter paper. Five tissue pieces were plated
onto each potato dextrose agar (PDA) plate and incubated for 3–5 d
at 25  C. Various filamentous fungi, yeast, and bacteria developed
from the tissues. However, only those bacterial colonies with
pronounced growth inhibition towards fungi were isolated to
a fresh nutrient agar (NA) medium. The bacterial isolates with
pronounced growth inhibition to fungi formed a creamy white
colony (CWC) and dry yeast like colony (DYLC) respectively.
Bacteria were purified on NA plates by making streaks in four right
angle directions, flaming the loop after each directional streak.
After 24 h incubation at 25  C, a single colony, well separated from
other colonies was restreaked on a new NA plate to be sure the
bacterium was pure. A single colony was then isolated on a NA test
tube slant and stored in a low temperature freezer 4 (Sanyo, Tokyo,
Japan) at 32  C.
2.2. In vitro screening of bacterial epiphytes for antagonism
CWC and DYLC were evaluated for in vitro antagonism toward
L. theobromae, by the dual incubation method (Fokkema, 1978).
Bacteria with more than 25% growth inhibition (GI) toward L. the-
obromae were further tested for antibiosis to T. paradoxa, C. musae,
and Fusarium verticillioides, the most active crown rot pathogens of
non-chemical banana (Alvindia et al., 2002). A loopful of bacteria
grown in nutrient agar (NA) for 24 h was stab inoculated at three
equidistant points 1 cm from the plate periphery, while a mycelial
plug of the test pathogen was placed off-centre on PDA plates.
Mycelial plugs, 4 mm in diameter, were taken from the edge of 7-
d-old fungal colonies maintained on PDA þ 5% malt extract (ME).
Plates inoculated only with test pathogen served as controls. Plates
were incubated at 25  C. The experiment was repeated twice with
three replications of each treatment. Percent GI was determined
after 14 d using the formula described in Korsten et al. (1995):
Kr  r1/kr  100 ¼ GI, where Kr represents the distance (measured in
mm) from the point of inoculation to the colony margin on control
plates, r1 the distance of fungal growth from the point of inocula-
tion to the colony margin on treated plates in the direction of the
antagonist, and GI the percent growth inhibition. Percent GI was
categorized on a scale from 0 to 4, where 0 ¼ no GI, 1 ¼1–25% GI,
2 ¼ 26–50% GI, 3 ¼ 51–75% GI, and 4 ¼ 76–100% GI. Bacteria that
inhibited growth of four pathogens by more than 25% were selected
as candidate biocontrol agents for further evaluation and optimi-
zation studies. Molecular classification revealed that both CWC and
DYLC were B. amyloliquefaciens. We selected CWC (coded as
B. amyloliquefaciens DGA14) at random, for further laboratory and
field studies. Meanwhile, DYLC (coded as B. amyloliquefaciens
DGA15) was stored and further tests stopped.
2.3. In vitro spore germination evaluation
A loopful of B. amyloliquefaciens DGA14 grown in NA for 24 h
was cultured in 250 ml Erlenmeyer flasks containing 100 ml
237
nutrient broth (NB) þ 5% ME. After 48 h shake incubation (rotary
shaker, 70 rpm) at 28  C, cells were harvested by centrifugation for
25 min at 13,000 rpm. The resulting pellet was dissolved in 10 ml of
sterile ¼ concentration Ringer’s solution (Daigo, Tokyo, Japan). Cell
concentration was determined with a bacteria counter (SLGC, Sai-
tama, Japan), and a dilution was made to give cell concentrations of
108, 107, 106, and105 ml1. A sterile 96-well ELISA plate (Sigma,
Steinheim, Germany) was used as a checker board type assay
(Korsten et al., 1995). Thirty (30) ml of each bacterial concentration
solution was placed in each well in a vertical column, starting with
the highest concentration in the left column, and the lowest
concentration in the fourth column. Fungal pathogens were grown
on PDA þ 5% ME for 14 d at 25  C. Spores were harvested in Ring-
er’s, counted with a haemacytometer (Hausser, Horsham, PA, USA),
and a dilution was made to spore concentrations of 106, 105, 104,
and 103 ml1. Evaluation of in vitro spore germination of L. theo-
bromae was not done because the fungus did not sporulate well on
media. Each fungal spore suspension of 30 ml was placed in each
well in a horizontal row, starting with the highest concentration at
the top, and the lowest concentration in the fourth row. Three
replicates for each bacteria-pathogen combination were used and
the experiment was repeated twice. The ELISA plates were incu-
bated at 25  C. Fungal spore suspension that received only NB þ 5%
ME was used as control. Percentage spore germination was deter-
mined after 24 h by dividing the number of germinating spores by
the total number of spores counted as observed under the inverted
microscope (IM).
2.4. Detection and effect of diffusible metabolites on
growth of pathogens
An indirect agar plate method described by Korsten and De Jager
(1995) was used to detect the production of diffusible metabolites
by B. amyloliquefaciens DGA14. Bacteria were grown in 100 ml
Erlenmeyer flasks containing 20 ml NB þ 5% 4 ME for 24 h at 28  C
in a rotary shaker (70 rpm). Using a sterile cork borer, agar wells of
5 mm diameter extending to the bottom of the plate were made in
the centre of plates containing 20 ml NA. From the bacterial culture,
20 ml was pipetted into each agar well. After 24 h incubation at
28  C, the well was covered with a 2.5  2.5 cm sterile dialysis
membrane, size 20 (Wako, Osaka, Japan). A mycelial disc was
aseptically punched (cork borer #2) from the periphery of 7-d-old
fungal cultures grown on PDA þ 5% ME at 25  C and placed on top of
a membrane. Control plates received 20 ml of sterile NB þ 5% ME per
well instead of bacterial suspension. Plates were incubated at 28  C
and growth patterns (GP) were scored after 14 d as described in
Fig. 1. Three replicated plates were provided for each treatment and
the experiment was repeated twice. Percentage fungal growth (G)
was determined as described in Korsten and De Jager (1995): r1/
Kr  100 ¼ G, where Kr represents the fungal growth radius on
dialysis membrane on control plates, and r1 represents the fungal
growth radius on dialysis membrane on treated plates, as deter-
mined after 21 d of incubation.
2.5. Effect of culture filtrate on conidial germination and mycelial
growth of pathogens
B. amyloliquefaciens DGA14 was cultured in 250 ml Erlenmeyer
flasks containing 100 ml NB þ 5% ME. The culture was incubated for
48 h in a rotary shaker (70 rpm) at 28  C and centrifuged for 25 min
at 13,000 rpm (Tomy, California, USA). The supernatant was poured
gently into a sterile beaker, without disturbing the palletized
bacterial cells. The supernatant was purified by a sterile syringe
with a 0.20 mm 20 filter unit (Minisart, New York, USA). 10 ml of the
filtrate was transferred to a sterile test tube. With a sterile cork
borer #2, a mycelial disc was aseptically punched from the
238 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242
Fig. 1. Nine possible growth patterns (GP) of fungi on PDA exposed to metabolites of Bacillus amyloliquefaciens DGA14 using an indirect technique (Korsten and De Jager, 1995).
periphery of 7-d-old fungal pathogens grown on PDA þ 5% ME at
25  C. A mycelial disc of the pathogen was placed in the test tube
with the culture filtrate. Controls received 10 ml of sterile NB þ 5%
ME instead of culture filtrate. The test tubes were incubated for 14 d
at 28  C. Mycelial growth (MG) was categorized on a scale from 0 to
2, where 0 ¼ no mycelial growth, 1 ¼ growth limited around
mycelial disc, and 2 ¼ mycelia overgrows liquid medium (Alvindia
and Natsuaki, 2008). Three replicated test tubes were provided for
each treatment and the experiment was repeated twice.
For the spore germination test, 5 ml of the bacterial filtrate was
transferred to sterile 45 mm diameter glass plates. Then, 100 ml of
pathogen spore suspension (106 ml1) in Ringer’s was pipetted
onto the bacterial filtrate in a 45 mm plate and spread gently by
rotating the plate 3. Plates were sealed by vinyl tape and incu-
bated for 24 h at 28  C. Control plates received sterile NB þ 5% ME
instead of bacterial filtrate. Under an inverted microscope,
percentage germination was then calculated by dividing the
number of germinated conidia over the total number of conidia
counted. Three replicated plates were provided for each treatment
and the experiment was repeated twice.
2.6. Interaction of antagonist and pathogen on banana fruit surface
Matured banana fruit, yellow-green in color, were rinsed with
sterile water and blotted dry. One side of a fruit was marked with
three squares (1 1 cm), well spaced from each other, with a black
waterproof pen. The first square received a 200 ml suspension of
B. amyloliquefaciens DGA14 cells (108 ml1), the second a suspension
of the pathogen (106 ml1) and in the third, a suspension of
B. amyloliquefaciens DGA14 and pathogen mixture. The treatments
were replicated in three fruits. Fruits were kept in plastic boxes
sprayed with sterile water at 25  C. Fruit tissue (36 mm2) was taken
from the square after 2, 3, 4, and 7 d for scanning electron micro-
scope (SEM) observations. Samples were fixed for 24 h in 2%
glutaraldehyde, rinsed in phosphate buffer, post-fixed in 2% OsO4
for 5 h, and dehydrated for 15 min in a series of ethanol solutions:
50%, 70%, 80%, 90%, 95%, and 100%. Samples were immersed over-
night in methyl butyl acetate, dried in a Hitachi critical point dryer
with CO2 as the transitional fluid, and mounted on aluminum stubs.
Sample tissues were gold coated using a Hitachi E-102 ion sputter
and examined with a SEM Hitachi S-400.
 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242
2.7. Identification of antagonist
The antagonistic bacterial isolates were identified as Bacillus
spp. based on cultural and morphological characteristics. A
molecular technique was used to confirm identification. Bacteria
from pure culture were streaked on NA plates at four right angle
directions, flaming the loop after each directional streak. After
24 h incubation at 25  C, a single colony was picked up with
a sterile wire loop and resuspended in 1 ml sterile distilled water
in a microfuge tube. The tube was centrifuged for 1 min at
12,000 rpm and the supernatant removed. Then, 200 ml of 5%
InstageneÔ matrix was added to the pellet and incubated at 56  C
for 30 min. The tube was mixed in a high speed vortex for 10 s
and placed in 100  C heat block for 8 min. The tube was again
mixed in a high speed vortex for 10 s and spun at 12,000 rpm for
3 min. The 16S ribosomal DNA (rDNA) was amplified by a pair of
primers namely: L523SR-50 GCATATCGGTGTTAGTCCCGTCC and
L516SF-50 TCGCTAGTAATCGCGGATCAGC (Xu and Côté, 2003).
Polymerase chain reaction (PCR) amplification of 16S rDNA was
performed with 45 s at 95  C and then 30 cycles of 15 s at 94  C,
30 s at 53  C and 90 s at 72  C. Gene amplifications were per-
formed with the TaKaRa ExTaq system (TaKaRa, Shuzo, Otsu,
Japan). Sequencing was conducted with the ABI-Prism 377 DNA
sequencing system (Applied Biosystems, California, USA) and DNA
sequencing kit (Perkin-Elmer, Waltham, Massachusetts, USA)
following the ABI protocol.
2.8. Postharvest application of the antagonist in the packing house
Cavendish banana fruits (var. Buñgulan) with 80% maturity
were obtained from non-chemical banana farmers from Nueva
Viscaya in Northern Luzon Island, Philippines. The fruits were
dehanded and washed in water before the crown was trim-
med. Thereafter, five banana hands of uniform size were
selected and sprayed with a cell suspension (108 ml1 ) of
B. amyloliquefaciens DGA14. The fruits were air-dried, packed in
corrugated carton boxes, and stored at 25  C with 90–95% RH.
Crown rot index (CRI) was measured after 13 d and 20 d using
the index described by Alvindia and Natsuaki (2008). Fungicide
(Maneb 2 ml1) and water only sprays were included as controls.
The experiment was repeated twice with three replications.
2.9. Statistical analysis
All of the comparisons of means were subjected to analysis of
variance and the significant differences among treatments were
determined with a least significant difference separation test using
Microsoft Corp. STATISTICAs Ver. 6.
Table 1
Identity and effect of bacteria isolated from the surface of banana fruits on in vitro growth of four crown rot-causing pathogens of banana.
Bacterial taxon Isolate code/ Growth inhibition (GI) categorya
description
Lasiodiplodia Thielaviopsis
theobromae paradoxa
Bacillus DGA14 (CWC)b 3 3
amyloliquefaciens
Bacillus DGA15 (DYLC)c 3 3
amyloliquefaciens
Values were average of two experiments.
a
Percent growth inhibition was determined after 14 d by the formula described in Korsten et al. (1995). Percent GI was categorized on a scale from 0 to 4, where 0 ¼ no GI,
1 ¼1–25% GI, 2 ¼ 26–50% GI, 3 ¼ 51–75% GI, and 4 ¼ 76–100% GI. Values were categorized on a scale from 0 to 4, where 0 ¼ no growth inhibition, 1 ¼1 to 25%, 2 ¼ 26 to 50%,
3 ¼ 51 to 75%, and 4 ¼ 76 to 100%.
b
CWC – creamy white colony.
c
DYLC – dry yeast like colony.
239
3. Results
The identity and in vitro inhibitory effect of bacterial isolates
against banana crown rot-causing pathogens are presented in
Table 1. The antagonists were sorted into two groups based on
cultural characteristics, namely: creamy white colony (CWC) and
dry yeast like colony (DYLC). A total of 7 isolates of CWC and 8
isolates of DYLC were obtained. The mode of action of CWC and
DYLC were mediated at a distance which highly inhibited the
growth of all test pathogens with a mean GI category of 3.50. All
CWC and DYLC isolates were subjected to molecular identification.
Results indicated that all isolates of CWC and DYLC were B. amy-
loliquefaciens. We arbitrarily selected CWC for laboratory and field
studies and coded the isolate as B. amyloliquefaciens DGA14.
Meanwhile, isolates of DYLC (coded as B. amyloliquefaciens DGA15)
were stored and no further testing done.
Spore germination of C. musae and T. paradoxa was significantly
less than in the control when challenged with any of the antagonist
concentrations. Spore germination of F. verticillioides, however, was
comparable to the control when challenged with less than 108 ml1
of the antagonist (Table 2). Germination of T. paradoxa at all spore
concentrations was completely controlled by all antagonist
concentrations tested. Comparing the means of the various antag-
onist concentrations, 108 ml1 was the most effective concentration
for inhibiting spore germination of all pathogens tested. In the
presence of the antagonist, spores of C. musae, F. verticillioides, and
T. paradoxa swelled abnormally, with subsequent bulb-like forma-
tion. Bulb formation and bursting of the pathogen cell wall was also
observed in all pathogen-antagonist combinations evaluated. This
appeared to be associated with release of cell contents, as was the
case with T. paradoxa (Fig. 2a). Abnormal mycelial growth such as
shrivelling, swellings and bulb formation after germination
occurred in all test pathogens (Fig. 2b). Bacteria were often
observed moving rapidly towards germinating spores and attach-
ing polarly to the surface. On banana fruit, in the artificial co-
inoculation study the antagonist attached and produced dents on
the spores of C. musae (Fig. 3). Further, no spores of C. musae
germinated on banana fruit when co-inoculated with the antago-
nist. B. amyloliquefaciens DGA14 colonized banana fruit 2 d after
artificial inoculation. However, this study did not establish how
long B. amyloliquefaciens DGA14 able to colonize the banana fruit.
Diffusible metabolites from the bacterial antagonist resulted in
complete inhibition of mycelial growth of L. theobromae, T. para-
doxa, and C. musae and 91% reduction in growth of F. verticillioides
(Table 3). Although the mycelial growth of F. verticillioides was
restricted by diffusible metabolites of the antagonist on dialysis
membrane, sporulation was observed after 15 d. The mycelial
growth and spore germination of pathogens were greatly affected
by the culture filtrate of B. amyloliquefaciens DGA14. The culture
filtrate totally suppressed conidial germination and mycelial
Mean GI Pathogens
category inhibited
Colletotrichum Fusarium
musae verticillioides
4 4 3.50 4
4 4 3.50 4
240 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242

Table 2
Evaluation of various cell concentrations of Bacillus amylolifaciens DGA14 on spore germination of crown rot-causing fungal pathogens of banana.

Pathogen Pathogen concentration (spores ml1) Spore germination (%) with Bacillus amyloliquefaciens Control
(cells ml1)a

108 107 106 105

Thielaviopsis paradoxa 106 0 0 0 0 100
105 0 0 0 0 100
104 0 0 0 0 100
103 0 0 0 0 100
Colletotrichum musae 106 0 6 18 37 100
105 0 16 37 27 100
104 0 32 38 40 100
103 0 39 50 47 100
Fusarium verticillioides 106 0 95 90 100 100
105 0 96 90 100 100
104 0 82 80 93 100
103 0 83 85 88 100

Values were average of two experiments.

a
Spore germination (%) ¼ Germinated spores/Total spores counted  100.

growth of all test pathogens, except for limited mycelial growth of

F. verticillioides around the mycelial disc (Table 4). Postharvest
application in the packing house showed that the antagonist-
treated fruits was the best treatment after 13 d with a crown rot
index (CRI) of 1.0. The fungicide (Maneb)-treated banana fruits
were statistically similar when compared with the untreated
controls with a CRI of 3.0 and 2.4, respectively (Table 5). After 20 d,
CRI of antagonist-treated fruits was maintained at 1.2, whereas
those of fungicide treated and untreated control fruits were both
recorded as 4.4. B. amyloliquefaciens DGA14 reduced crown rot
incidence by 58% and 73% after 13 d and 20 d respectively.

4. Discussion

The advantages of using ‘native’ antagonists isolated from the

same habitat as that in which they are effective for biocontrol were
elucidated by Alvindia and Natsuaki (2008). Native fungal
epiphytes isolated from the surface of banana fruits significantly
control crown rot-causing pathogens and rot in the packing house
(Alvindia and Natsuaki, 2008). Knowledge of the mechanism of
antagonism may be used to improve biocontrol (Spurr, 1981). An
antagonist may have more than one mode of action. Exploiting all
modes of action will increase the efficacy of the biocontrol agent.
B. amyloliquefaciens DGA14 antagonized pathogens by production
of extracellular antibiotics and direct contact as observed in vitro
and on the natural substrate. In this study, we did not examine the
effect of B. amyloliquefaciens DGA14 plus the produced metabolites
against pathogens in the natural substrate. Taking into account the
important effects of metabolites on growth of pathogens and the
Fig. 3. Bacillus amyloliquefaciens DGA14 (Ba) and dents (arrows) on spore surface of
Colletotrichum musae (Cm) after artificial co-inoculation on banana fruit surface.
inflicted damage on pathogens when B. amyloliquefaciens DGA14
was in contact with them, these mechanisms seem to be comple-
mentary giving the antagonist a competitive edge in the natural
substrate.
Our study showed that antimicrobial substances can be
produced by B. amyloliquefaciens DGA14 in nutrient broth and
nutrient agar which is peptone based. These media can be easily
obtained, which is of advantage in mass production and commer-
cialization of the biocontrol agent. Peptone appears to be a key

Fig. 2. (a). Cell wall bursting and release of cell contents of spores of Thielaviopsis paradoxa (b). Formation of bulb-like swellings and mycelial shredding in Lasiodiplodia theobromae
when co-inoculated with Bacillus amyloliquefaciens DGA14 in liquid medium.
 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242
Table 3
Evaluation of the inhibitory effect of diffusable metabolites from Bacillus amyloli-
quefaciens DGA14 on the growth of crown rot-causing fungal pathogens of banana.
Growth pattern (GP)a and percentage pathogen growth (G)b
Lasiodiplodia Thielaviopsis Colletotrichum Fusarium
theobromae paradoxa musae verticillioides
GP G GP G GP G GP
0 0 0 0 0 0 1 18
Values were average of two experiments.
a Values with the same letter in a column are not significantly different according to
Growth pattern represent type of inhibition as indicated in Fig. 1 (Korsten and
De Jager, 1995).
b Crown rot reduction (%) ¼ CRI of untreated fruits  CRI of treated fruits/CRI of
Represents (%) pathogen growth calculated from the formula: r1/Kr  100, where
Kr represents the fungal growth radius on dialysis membrane on control plates, and
r1 represents the fungal growth radius on dialysis membrane on treated plates, as
determined after 21 d of incubation (Korsten and De Jager, 1995).
nutrient for the production of antifungal compounds by B. amylo-
liquefaciens RC-2 (Yoshida et al., 2001). B. amyloliquefaciens is
known to produce iturins, a family of cyclic lipopeptide antibiotics
(Hiradate et al., 2002). These molecules have seven a-amino acids
and one b-amino fatty acid, and iturin A is produced as a mixture of
up to eight isomers (Yu et al., 2002). B. amyloliquefaciens strains
producing iturin A have been used as biocontrol agents to suppress
fungal plant pathogens (Yoshida et al., 2001; Yu et al., 2002).
Adaptability of the antagonist to the natural substrate is equally
important. Artificial inoculation revealed that B. amyloliquefaciens
DGA14 can adapt easily to the natural habitat, i.e., banana fruits,
hence, survival and physiological activity required for biocontrol is
possible. B. amyloliquefaciens colonized the banana fruit surface 2 d
after artificial inoculation. An important attribute of a successful
biocontrol agent is the ability to efficiently control a range of
pathogens. Our isolates conformed to this prerequisite by being
generally effective against the various banana crown rot-causing
pathogens. Both the bacteria and/or its metabolites were effective
in controlling postharvest pathogens of banana. This study shown
that in vitro results were complementary to in vivo effects. The
efficacy of the antagonist on banana fruit was demonstrated when
applied as a postharvest biocontrol agent in the packing house.
Moreover, the capability of antagonist to control a range of path-
ogens at low concentrations is an advantage in biocontrol activities.
Epiphytic B. amyloliquefaciens controls banana crown rot at
108 ml1, the same concentration effective for epiphytic Bacillus
subtillis against avocado diseases (Korsten and De Jager, 1995;
Korsten et al., 1995, 1997) and lower than 1010 ml1 for Burkholderia
cepacia isolated from banana fructoplane to control postharvest
diseases of banana (De Costa and Erabadupitiya, 2005). F. verti-
cillioides was not totally controlled by vegetative cells or metabo-
lites of B. amyloliquefaciens as were the other pathogens. Other
studies have shown resistance of F. verticillioides to antagonsitic
Table 4
Conidial germination and mycelial growth of various pathogens in culture filtrate of
Bacillus amyloliquefaciens DGA14.
Lasiodiplodia Thielaviopsis Colletotrichum Fusarium
theobromae paradoxa musae verticillioides
%CGa MGb %CGa MGb %CGa MGb %CGa MGb
Nd 0 0 0 0 0 0 1 Alvindia, D.G., Kobayashi, T., Yaguchi, Y., Natsuaki, K.T., 2002. Pathogenicity of fungi
Nd – not determined due to poor sporulation of Lasiodiplodia theobromae in artificial
media.
Values were average of two experiments.
a from the Philippines. Jpn. J. Trop. Agric. 44, 87–93.
Percent conidial germination (%CG) was calculated under the microscope by
dividing the number of germinated conidia over the total number of conidia counted
after 24 h at 25  C.
b
Mycelial growth (MG) was categorized on a scale from 0 to 2, where 0 – no
mycelial growth, 1 – growth limited around mycelial disc, and 2 – mycelia overgrows
liquid medium after 15 d at 25  C (Alvindia and Natsuaki, 2008).
241
Table 5
Crown rot index and crown rot reduction (%) in treated and untreated bananas 13 d
and 20 d after treatment.
Treatment Crown rot index Crown rot
(CRI) reduction (%)
13 d 20 d 13 d 20 d
G Bacillus amyloliquefaciens DGA14 1.0a 1.2a 58 73
Maneb 3.0b 4.4c 0 0
Control (water only) 2.4b 4.4c
the LSD test (P > 0.01). Values were average of two experiments.
untreated fruits  100.
For visual determination of index see Alvindia and Natsuaki (2008).
native fungal epiphytes Trichoderma harzianum and Clonostachys
byssicola (Alvindia and Natsuaki, 2008) and high tolerance to
inorganic salts with or without surfactant (Alvindia et al., 2004;
Alvindia and Natsuaki, 2007). This has to be considered in the
development and application of non-chemical control alternatives
since F. verticillioides is a dominant and serious pathogen of banana
(Alvindia et al., 2000, 2002). Future experiments should investigate
the compatibility of a mixed inoculum combining all the assets of
the antagonists which includes epiphytic bacteria and fungi as
biocontrol agents. Other future activities include the application of
the antagonist in the field and further packing house evaluations.
Integration of antagonists with other non-chemical control alter-
natives such as hot water treatment and inorganic salts is also
considered to provide greater control of postharvest diseases than
using individual treatments alone. The ecological fate of the
antagonist on the fruit surface needs to be investigated before it is
recommended for biocontrol. Equally important is the formulation
and commercialization of the product and examination of whether
metabolites produced by the antagonists are safe for human
consumption or can be used for other beneficial purposes. A sound
formulation ensures the stability of the long-term storage of the
antagonist, enhances its ability to control disease and warrants the
commercial value of biocontrol agents (Droby et al., 1997).
Acknowledgment
The senior author gratefully acknowledges Japan Society for the
Promotion of Science (JSPS) for a postdoctoral fellowship and
granting research support to develop non-chemical alternatives on
postharvest disease management of banana. We thank Dr. Professor
Yukio Yaguchi and Mr. Chiki Ali (Ph.D. candidate), TUA for assis-
tance during electron microscopy and molecular identification of
bacteria, respectively.
Reference
Alvindia, D.G., Natsuaki, K.T., 2008. Evaluation of fungal epiphytes isolated from
banana fruit surfaces for biocontrol of banana crown rot disease. Crop Prot. 27,
1200–1207.
Alvindia, D.G., Natsuaki, K.T., 2007. Control of crown rot-causing fungal pathogens
of banana by inorganic salts and a surfactant. Crop Prot. 26, 1667–1673.
Alvindia, D.G., Kobayashi, T., Natsuaki, K.T., Tanda, S., 2004. Inhibitory influence of
inorganic salts on banana postharvest pathogens and preliminary application to
control crown rot. J. Gen. Plant Pathol. 70, 61–65.
isolated from non-chemical bananas. Jpn. J. Trop. Agric. 44, 215–223.
Alvindia, D.G., Kobayashi, T., Yaguchi, Y., Natsuaki, K.T., 2000. Symptoms and the
associated fungi of postharvest diseases on non-chemical bananas imported
De Costa, D.M., Erabadupitiya, H.R.U.T., 2005. An integrated method to control
postharvest diseases of banana using a member of the Burkholderia cepacia
complex. Postharvest Biol. Tech 36, 31–39.
Droby, S., Wisniewski, M.E., Cohen, L., Weiss, B., Touitou, D., Eilam, Y., Chalutz, E.,
1997. Influence of CaCl2 on Penicillium digitatum, grapefruit peel tissue, and
biocontrol activity of Pichia guilliermondii. Phytopathology 87, 310–315.
242 D.G. Alvindia, K.T. Natsuaki / Crop Protection 28 (2009) 236–242
Finlay, A.R., Brown, E.A., 1993. The relative importance of Colletotrichum musae
as a crown rot pathogen on Windward Island bananas. Plant Pathol. 40,
568–575.
Fokkema, N.J., 1978. Fungal antagonism in the phyllosphere. Ann. Appl. Biol. 89,
115–117.
Hiradate, S., Yoshida, S., Sugie, H., Yada, H., Fujii, Y., 2002. Mulberry anthracnose
antagonists (iturins) produced by Bacillus amyloliquefaciens RC-2. Phytochem-
istry 61, 693–698.
Hirata, T., Kimishima, E., Aoki, T., Nirenberg, H.I., O’Donnell, K., 2001. Morphological
and molecular characterization of Fusarium verticillioides from rotten banana
imported into Japan. Mycoscience 42, 155–166.
Janisiewicz, W.J., Peterson, D.L., Bors, R., 1994. Control of storage rots of apples with
Sporobolomyces roseus. Plant Dis. 78, 466–470.
Jimenez, M., Logrieco, A., Bottalico, A., 1993. Occurrence and pathogenicity of
Fusarium species in banana fruits. J. Phytopathol. 137, 214–220.
Johanson, A., Blazquez, B., 1992. Fungi associated with banana crown rot on
field packed fruit from the Windward Islands and assessment of their
sensitivity to fungicides thiabendazole, procloraz and imazalil. Crop Prot. 11,
79–83.
Knight, C., Cutts, D.F., Colhoun, J., 1977. The role of Fusarium semitectum in causing
crown rot of bananas. Phytopathol. Z. 89, 170–176.
Korsten, L., De Jager, E.E., 1995. Mode of Action of Bacillus subtilis for Control of
Avocado Postharvest Pathogens, 18. South African Avocado Growers’ Associa-
tion, pp. 124–130.
Korsten, L., De Jager, E.S., Villiers, E.E., Lourens, A.J., Kotzé, M., Wehner, F.C., 1995.
Evaluation of bacterial epiphytes from avocado leaf and fruit surfaces for
biocontrol of avocado postharvest diseases. Plant Dis. 79, 1149–11560.
Korsten, L., De Villiers, E.E., Wehner, F.C., Kotzé, J.M., 1997. Field sprays of Bacillus
subtilis and fungicides for control of preharvest fruit diseases of avocado in
South Africa. Plant Dis. 81, 455–459.
Krauss, U., Bidwell, R., Ince, J., 1998. Isolation and preliminary evaluation of myco-
parasites as biocontrol agents of crown rot of banana. Biol. Contr. 13, 111–119.
Mortuza, M.G., Ilag, L.L., 1999. Potential for biocontrol of Lasiodiplodia theobromae
(Pat.) Griff. & Maulb. in banana fruits by Trichoderma species. Biol. Contr. 15,
235–240.
Ogawa, J.M., 1970. Postharvest diseases of bananas in China (Taiwan). FAO Plant
Prot. Bull. 18, 31–42.
Spurr Jr., H.W., 1981. Formulation of bacterial antagonists alters efficacy of foliar
disease control. Phytopathology 71, 905.
Xu, D., Côté, J.C., 2003. Phylogenetic relationships between Bacillus species and
related genera inferred from comparison of 30 end 16S rDNA and 50 end 16S–
23S ITS nucleotide sequences. Int. J. Syst. Evol. Microbiol. 53, 695–704.
Yoshida, S., Hiradate, S., Tsukamoto, T., Hatakeda, K., Shirata, A., 2001. Antimicrobial
activity of culture filtrate of Bacillus amyloliquefaciens RC-2 isolated from
mulberry leaves. Phytopathology 91, 181–187.
Yu, G.Y., Sinclair, J.B., Hartman, G.L., Bertagnolli, B.L., 2002. Production of iturin A by
Bacillus amyloliquefaciens suppressing Rhizoctonia solani. Soil Biol. Biochem 34,
955–963.