1a A message was received from a group of researchers, who were looking for the 1

probability of existence of alien life forms on Mars. They found an unusual life
form and the cell membrane of that life form is depicted in the figure.
a. What conditions need to exist in Mars to make the illustrated life form possible?
Ans: This cell membrane shows hydrophobic groups are projected outward,
exactly opposite what we see on earth. Hence this alien form survives in
hydrophobic environment (1/2 mark)
b. A student requested to send this life form to earth, but the request was rejected
stating that this life form is not possible to survive on earth. Why have they told
like that? Ans: One earth, the life forms are equipped to survive on aqueous
(hydrophilic) environment. Hence this life form is not suitable here. (1/2 mark)

1b Label the interactions 1 and 1

2 between the active site
and substrate in the figure
shown here.
Ans:
1- Ionic bond (1/2
mark)
2- Hydrogen bond
(1/2 mark)

1c Lungs are involved in maintaining the blood pH by expelling CO 2 that hemoglobin carries to it. The 2
acid-base balance buffering activity in body allows blood pH to be in the normal range of 7.3 to 7.4.
How is this level disturbed when the acidity or alkalinity of blood gets disturbed out of the normal
range? Explain with suitable equations.
Ans: The basic reaction is as follows: H2 O + CO 2 ↔ H2 CO3 ↔ H+ + HCO3 - (1 mark)
When blood pH drops too low, the body compensates by increasing breathing thereby expelling CO2,
shifting the above reaction to the left such that less hydrogen ions are free; thus the pH will rise back
to normal. For high blood pH, the opposite occurs. (1 mark)

1d The ancient Roman civilization used lead piping to supply water. It is believed that the reason for the 2
downfall of this great civilization was due to lead poisoning. Lead is a neurotoxin. How does the
concentration of lead increase in the body? Ans: Sometimes, in the living systems, when the primary
element is not immediately available, a substitution can be made with an element present in the same
column of periodic table (1 mark) or (2 mark). Thus, an element from the same group in the periodic
table can sometimes be substituted for another element (1/2 mark). Therefore, lead can substitute for
carbon in various life processes and cause toxicity due to excessive deposition.(1/2 mark)

1e Glucose is the only ingredient in glycogen, starch and cellulose. Identify which of them is taken as the 1
energy storage compound in mammals and explain why? Ans: Glycogen is the energy storage
compound in mammals (1 mark) as it is more compact in form.
1f Glycolysis is the first energy providing cycle in all the organisms, in which glucose is converted to 1
pyruvic acid. The first step in glycolysis is
Glucose Glucose 6 phosphate ∆G= +4 kcal/mol
According to bioenergetics, this reaction should not happen. How it happens in any organism?
 Ans: Due to the positive free energy of the reaction, it requires energy input to move in forward
direction. Due to direct coupling with a spontaneous reaction (i.e. ATP), overall ∆G of the reaction
becomes negative and it proceeds in the forward direction. (1 mark) Consider if the student understands
that energy input is required.
ATP ADP + Pi (∆G=-7.3 kcal/mol)

1g Ribonuclease is an enzyme 2
involved in the cutting of RNA. The
figure shows action of the enzyme
on RNA as it breaks the bonds and
cuts the RNA strand. Answer the
following questions using the
information given about
ribonuclease enzyme:
a) Would the enzyme
function if water molecule is not
allowed in the active site? Explain
how? Ans: Water molecule is
required to hydrolyze the RNA
substrate by general acid-base
catalysis in which the P—0 bond
linking the ribose of one nucleotid e
with the ribose of a neighbor ing
nucleotide is broken. Enzyme will
not function in its absence. (1 mark)
b) If Lysine is substituted instead of arginine in position 2, explain the effect on the enzyme
activity. Ans: The positively charged arginine and lysine interact with the negative phosphate
group and allow it to orient within the enzyme. If arginine is replaced by lysine, which is similar
in structure to arginine, the length of the side chain is different and the reaction will proceed;
probably the enzyme activity may be changed moderately. (1/2 mark)
c) If aspartic acid is substituted instead of arginine in position 2, explain the effect on the enzyme
activity. (Note: Refer to chart of amino acids in question 3d) Ans: Aspartic acid is negative ly
charged and so will repel the negatively charged phosphate group and prevent the substrate
from orienting in the active site. (1/2 mark) If student understand the difference in the properties
of these amino acids is responsible for the enzyme activity change, kindly give marks.
2a In sheep, furred tail (F) results from an allele that is dominant over an allele for furless tail (f). A female 2
with furred tail is mated with furless tailed male. The female then gives birth to a single lamb with
furless tail. From this single offspring, is it possible to determine the genotypes of the two parents? If
so, what are their genotypes? If not, why?
Ans: Parents genotype: Mother- Ff and Father- ff (1 mark)
This can be determined because depending on the information given the mother can be Ff or ff and
father has recessive phenotype therefore he is ff. This mating gives rise to a furless progeny, therefore
the mother has to be heterozygous with the genotype Ff (1 mark). Ff×ff →ff
2b Answer the questions after studying the following pedigree chart: 4
a. What is the most probable mode of inheritance? Justify.
Ans: Inheritance is autosomal recessive. (1 mark) Unaffected
parents of generation one gives rise to affected progeny (II-2).
Therefore, not dominant trait. Trait passed from male II-2 to
daughter III-4, therefore not Y linked trait. Not X linked as the
trait doesn’t pass from III-5 to IV-5. Therefore, disease is
autosomal recessive.
b. What is the genotype of individual I-2, II-3, III-3, and
IV-4? Ans: I-2 is Aa; II-3 is A-; III-3 is aa and IV-4 is A- (2 mark)
c. What is the genotype of the individual shown as a question mark? Ans: aa or A- (1 mark)
Note: Use notation ‘A’ for dominant allele; ‘a’ for recessive allele. Also when a heterozygo us
genotype in the only possibility use symbol ‘Aa’ and when genotype can be heterozygous or
homozygous dominant use symbol ‘A-’
2c The alleles coding for eye color (B or b) - either black or blue and body shape (L or l) - either long or 2
short are present on the same chromosome but separated by 15cM. The traits for black eye color and
long body shape are dominant. What fraction of the progeny would be having the phenotype blue eyes
and long body, from the cross of a double recessive individual and a double heterozygous individual?
Ans: The cross is between BbLl and bbll. The progenies are (BbLl and bbll- Parental) and (Bbll and
bbLl- recombinants)
Distance between genes is 15cM.
%Recombination frequency=Map distance. Therefore recombination frequency is 15. (1 mark)
bbLl = 7.5% (or half of 15% recombinants) (1 mark)
2d The physical appearance of a trait is called as: 1
a) Morphology b) Phenotype c)Genotype d)Homology
2e What is the alternate form of a gene called? 1
a) Recessive gene b) Alternate gene c) Allele d) Chromosome
3a If the DNA of an organism has 20% of thymine, then calculate the percentage of guanine. 1
Ans: According to Chargaff’s rule: A=T and C=G. Therefore, Adenine is also 20%
Therefore, 100-20-20=60 is C+G in the DNA; 60/2=30% guanine. (1 mark) Give full marks if student
does not give the complete description but the answer is correct.
3b The cell does not expend energy on proofreading the transcription process. Why is it that the cell, which 1
carries out replication with great accuracy, not carry out RNA proofreading?
Ans: The process of DNA replication will cause the entire genome to be copied and eventually passed
on to the progeny. This process is highly monitored and errors are eliminated by proofreading, to a
certain margin. Transcription makes a single copy of RNA which codes for a single protein. The single
protein produced by an inaccurate RNA will give rise to only one damaged protein which can be
eliminated eventually. Thus multiple proofreading stages are not essential in transcription process. (1
mark if they get the general idea)
3c The energy for forming phosphodiester bonds is obtained by cleaving 1
phosphate groups from the incoming nucleotides. Consider a hypothetica l
situation, where the beta and gamma phosphates are labelled in an incoming
nucleotide. Will the resulting DNA chain show any radioactivity? Explain
with proper reasoning. Ans: No radioactivity will be seen in the resulting chain
(1/2 mark) as gamma and beta phosphates are cleaved for formation of the
phosphodiester bond and only the alpha phosphate is retained in the DNA
chain. (1/2 mark)
3d Given is a stretch of single stranded DNA sequence which encodes for a protein. Write sequence of the 4
amino acid chain encoded by the given DNA
sequence. The resulting protein works as a
transmembrane protein and a part of the protein
traverses the phospholipid bilayer as is illustrated in
the figure below. State which amino acids in this
protein will be present in area 1, 2 and 3? Use inputs
of amino acid structures illustrated below:

2 Transmembrane
protein

DNA sequence (shaded region is the promoter)

3’
TCTGACGAGGCGTACGCGCCGGGCTTTCACCCGCGCCACCACCGCGACGACAAATACATT 5’

Ans:
mRNA: AUGCGCGGCCCGAAAGUGGGCGCGGUGGUGGCGCUGCUGUUUAUGUAA (1 mark).
Consider for students if they even write some area of promoter.
Protein: MRGPKVGAVVALLFM. (2 mark for protein which starts from methionine and 1 mark if starts
from any other codon. Identifying the areas hydrophilic ½ mark and hydrophobic ½ mark. Consider and
give 1, if the students give only hydrophobic region.)
3e A novel drug has been introduced in the market that blocks RNA dependent DNA polymerase. This 1
drug has no effect on the negative and positive single stranded RNA viruses. Considering only this
activity of the drug, does it have any side effect on the human host? Answer with suitable explanatio n.
Ans: It doesn’t affect the host as there are no RNA dependent DNA polymerases (or Reverse
transcriptase) in humans. (1 mark)
3f In rats, a gene 1,440 base pairs (bp) long codes for an enzyme made up of 192 amino acids. Discuss 2
this apparent discrepancy. How long would the initial and final mRNA transcripts be?
Ans: The discrepancy is due to splicing (1 mark). Post processing mRNA length- 578 bases (1 /2 mark)
and preprocessing- 1440 bp long. (1 /2 mark)
4a The diagram below represents the bone arrangements in the front limbs of 2
three different species of mammals. These species have evolved from the
same ancestor. What can you comment about the habitat (type of
environment) in which these species developed?
Ans: During development, these bones assume different shapes and
dimensions to adapt the forelimbs to various functions: swimming, flying,
running and tool use. (2 mark) [Consider for answers given by the student
and give full marks if students just say that evolution is based on the
functions.]
4b Describe any two examples of bioinspiration that you can imbibe from nature. (Consider for Any 3
logical explaination)
4c Design a flowchart for the hierarchy followed in biology from the molecular level to the biosphere 3
level. Describe interactions at each level.
Ans: Biological molecules (DNA or RNA)→ Organelles (like nucleus or group of biomolecules) →
Cells (arrangement of organelles in bounded compartment)→ Tissues (groups of similar cells for
similar function)→ Organs (group of similar functioning tissues)→ Organ Systems (arrangement of
organs to carry out different life processes)→ Organism (Organs and organ systems work together for
existence of an organism as a complex, self-reproducing unit)→ Population (group of organisms of one
species)→ Community (interaction between organisms of different species)→ Ecosystem (interactio n
between biotic and abiotic elements)→ Biosphere(group of ecosystems) (1 mark for flowsheet)
(2 mark for description of each level) Consider the descriptions given by the students and if it is
reasonable give full 2 marks.
5a Transposons are also called as “jumping genes”. Does a transposition event cause increase in 2
transposon copies in the genome? What are the effects of transposition event on the organism?
Ans: Transposition can cause increase in transposon copies if it jumps using the copy paste
mechanism.(1 mark) Transposition can cause any mutations (1mark)
5b E.coli cells are growing in a medium containing lactose without glucose. Indicate how each of the 2
following changes or conditions would influence the expression of lac operon. Copy the table in your
answer sheet and use tick mark ( ) at appropriate place with valid justification (1/2 each). Consider
the reason given by student and give marks if it satisfies the condition.
Condition Expression of lac operon Reason
Increased Decreased No change in
expression expression the expression
A mutation completely inactivated
β- galactosidase gene
Inactivation of
gene will not stop
expression of
other genes in the
operon
Addition of high concentration of No requirement of
glucose proteins to
breakdown
lactose
A mutation that prevents the RNA polymerase
binding of activator protein to site will not be stably
near lac promoter bound
A mutation that prevents the No binding of
dissociation of the lac repressor RNA polymerase
from the operator so no expression
5c In the course of military recruitment, all subjects are tested for the sickle cell trait. 2
 a. Why were those individuals, who did not display any symptoms for the disease, get tested for the
appearance of the trait? Ans: They may be heterozygous and since, the symptoms for sickle cell
trait will be seen during the rigorous exercises, they should be tested. (1 mark)
b. Why sickle cell anemia is autosomal recessive? Explain at the molecular level. Ans: In
heterozygous individual, under normal oxygen conditions, beta fibers do not form. The normal
phenotype is dominant and masks the recessive sickle cell trait. Autosomal condition because the
trait is present on somatic chromosomes. (1 mark)
5d A researcher isolates a gene coding for protein X from human cell and using a vector inserts it into a 4
prokaryotic bacterial cell. Assuming that the experiment is carried out under conditions that positive ly
eliminate any possibility of mutation, explain the following observations:
a) The resulting amino acid chain from the prokaryotic cell does not function like protein X and is
longer in amino acid number than that observed in the protein X. Justify your reasoning. Ans: As
prokaryotes do not carry out splicing after transcription, the resulting amino acid strand is long. (2
mark for identifying the reason) Consider if the students say that no introns and exons exist for the
prokaryote.
b) Some bacterial cells do not produce the protein of interest, however they survive the screening stage
with an antibiotic. How? Ans: These bacterial cells carry the nonrecombinant plasmid. (2 mark for
identifying the nonrecombinant plasmid with explanation of what it means)
5e a) Deadly diseases like small pox have been completely eradicated in the human population using 2
vaccines. What is the basic principle by which vaccines produce an effective defensive response in
human beings? Ans: Adaptive immunity produces memory cells which recognize a second round
of infection by the same pathogen, against which the vaccine was developed. (1 mark)
b) Vibrio ordalii is a bacterium that causes vibriosis in fishes kept in aquarium. Can we develop an
effective vaccine against Vibrio ordalii in a jawless fish kept in an aquarium? Explain with suitable
reasoning. Ans: Due to lack of adaptive immunity jawless fish cannot be vaccinated or they do not
produce memory cells. (1 mark)