Electronic Supplementary Material (ESI) for Chemical Science.

This journal is © The Royal Society of Chemistry 2019

Chemically Modified Nanofoci Unifying Plasmonics and Catalysis

Yueliang Wang,† Lingling Fang,† Ming Gong,‡ and Zhaoxiang Deng*,†

†
CAS Key Laboratory of Soft Matter Chemistry, Hefei National Research Center for Physical Sciences at the
Microscale, Department of Chemistry, University of Science and Technology of China, Hefei, Anhui 230026,
China
‡
Engineering and Materials Science Experiment Center, University of Science and Technology of China, Hefei,
Anhui 230027, China
Email: zhxdeng@ustc.edu.cn

Experimental Details

Chemicals
Chloroauric acid tetrahydrate (HAuCl4∙4H2O), hexachloroplatinic acid hexahydrate (H2PtCl6·6H2O),
hydrogen peroxide, hydrochloric acid, Polyvinylpyrrolidone (K30), and sodium borohydride (NaBH4) were
obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Fish sperm DNA (FSDNA) and
sodium citrate tribasic dihydrate were bought from Sigma. Bis (p-sulfonatophenyl) phenylphosphine dihydrate
dipotassium salt (BSPP) and sodium tetrachloropalladate trihydrate (Na2PdCl4∙3H2O) were obtained from
Strem Chemicals (Newburyport, MA, USA). 4-nitrophenol (4-NTP) and 4-aminothiophenol (4-ATP) were
purchased from J&K Chemicals (Beijing, China). AgNO3 was a product from Bio Basic Inc. (BBI, Canada).
All reagents were used as received without further purifications.

DNA sequences
DNA oligonucleotides were custom-synthesized by Sangon Bioengineering Technology and
Services Co., Ltd. (Shanghai, China) and purified by PAGE (unmodified DNA) or HPLC (thiolated DNA). All
DNA oligos were subject to a molecular weight verification by MALDI-TOF mass spectroscopy. Following are
the sequences (5’-3’) of the DNA oligonucleotides used in this work (Note: underlined sequences in sDNA and
sDNAc are complementary to each other; sDNA and sDNAc were modified versions of a sequence used in:
Nano Letters 2001, 1, 32)):

sDNA (89 bases):

HS-5’GCAGTAACGCTATGTGACCGAGAAGGATTCGCATTTGTAGTCTTGAGCCCGCACGAAACCTG
GACACCCCTAAGCAACTCCGTATCAGA3’

sDNAc (89 bases):

HS-5’GCAGTAACGCTATGTGACCGAGAAGGATTCGCATTTGTATCTGATACGGAGTTGCTTAGGGGT
GTCCAGGTTTCGTGCGGGCTCAAGAC3’

AuNPs: AuNPs with different diameters of 23, 30, and 43 nm were synthesized through a seeded-growth
described in a previous publication. [N. G. Bastús, J. Comenge, V. Puntes, Langmuir 2011, 27,
11098-11105]. The as-obtained citrate-capped nanoparticles were incubated overnight with Bis
(p-sulfonatophenyl)phenylphosphine dihydrate dipotassium salt (BSPP) (0.5 mg/mL for 23 and 30 nm
AuNPs, 1 mg/mL for 43 nm AuNPs) at room temperature to accomplish a ligand exchange. The
BSPP-decorated AuNPs were collected by centrifugation and redispersed in 0.5 mL of deionized H2O.

AIS-assembled AuNP dimers: The BSPP-capped AuNPs were added to a 0.5TBE (pH 8.0; 44.5 mM Tris,
1 mM EDTA, 44.5 mM boric acid) buffer supplemented with 11 mM AgNO3 and 2 μg/μL FSDNA at room
temperature for 1 min. The resulting discrete AuNP clusters were further isolated by agarose gel electrophoresis
to obtain dimeric assemblies in purified form.

g-dimers and s-dimers: A 20 μL solution of 38.8 mM sodium citrate and different volumes of 1 mM HAuCl4
or AgNO3 were added to1 mL boiling water containing 0.1 nM AuNP dimers. The solution was kept boiling in
a 125oC oil bath, and maintained under this condition for 20 min to obtain gold and silver modified dimers with
different junction widths.

Pt-s-dimers: To 4 mL of boiling water containing 0.1 nM s-dimers (made from 35 nm AuNPs and
pre-incubated with 0.1% PVP) was added 20 L of a 20 mM H2PtCl6 solution. The resulting mixture was
stirred for 2 min in a 115oC oil bath, followed by an addition of 20 L of an aqueous PVP solution (20 %).
After a 20 min incubation with PVP, the solution was centrifuged at 2390 g to precipitate the Pt-s-dimers,
which were then redispersed in water for further use.

Pd-s-dimers: An 80 L solution containing 2.5 mM Na2PdCl4 was added to a 4mL solution containing 0.1 nM
s-dimers (made from 35 nm AuNPs and pre-incubated with 0.1% PVP). The solution was stirred for 10 min in 
an ice-water bath to obtain Pd-s-dimers. Afterwards, 20 L of a PVP aqueous solution (20 %) was introduced
for an extra protection of the products. After a 20 min incubation with PVP, the solution was subjected to a
centrifugation at 2390 g. The precipitated Pd-s-dimers were redispersed in water for further use.

DNA-monofunctionalized 5 nm AuNPs: BSPP-capped 5 nm AuNPs synthesized by a sodium citrate/tannic

acid method (Eur. J. Cell Biol. 1985, 38, 87-93) were combined with 5’-thiolated DNA stands at a molar ratio
of 1:0.6 (AuNP:DNA) in 0.5TBE (pH 8.0) supplemented with 100 mM NaCl. After a 2h incubation at 20oC,
the mixture was purified by 3% agarose gel electrophoresis to obtain monovalent DNA-AuNP conjugates.

DNA multifunctionalized g-dimers: G-dimers made from 23 nm AuNPs were combined with 5’-thiolated
DNA stands at a molar ratio of 1:500 in 250 μL of a 0.5TBE (pH 8.0) buffer. 3.75 μL of NaNO3 (1 M) was
added to this solution every 3 hours for 23 times. The final solution was centrifuged at 6120 g with the solid
pallet redispersed in the 0.5TBE buffer. This process was repeated 3 times to remove unbound DNA stands.

DNA-directed core-satellite assemblies between g-dimers and AuNPs: DNA-multifunctionalized g-dimers

and DNA-monofunctionalized 5 nm AuNPs bearing complementary DNA sequences were combined at a molar
ratio of 1:500 in 0.5TBE containing 150 mM NaNO3. The mixture was kept at 37oC for 24 h to form
core-satellite assemblies via DNA hybridization. 0.6% agarose gel electrophoresis was employed to isolate the
products.
H2O2 etching of s-dimers: Different amounts of H2O2 were added to a 30 L solution of 1 nM 30 nm s-dimer
buffered with 0.1TBE (pH 8.0) for a 20 s etching.

4-NTP decorated CMNFs: A 1 μL aqueous droplet containing appropriate amounts of 4-NTP was added
separately to 100 μL solutions of 0.2 nM AIS-assembled AuNP dimers (35 nm) and CMNF structures (s-dimers,
Pt-s-dimers, Pd-s-dimers) followed by a 30 min adsorption. Free unbound 4-NTP in excess was removed by
centrifugation at 2390 g with the precipitates being redispersed in deionized water.

Catalytic NaBH4 reduction of 4-NTP: 1 μL of 50 mM NaBH4 was combined with the 4-NTP-decorated Au
nanodimers and CMNFs (0.2 nM) to initiate a hydrogenation of 4-NTP to form 4-ATP.

TEM characterizations: TEM imaging was conducted on a Hitachi HT7700 transmission electron microscope
operated at an electron acceleration voltage of 100 kV. An aqueous sample droplet was pipetted on a
carbon-coated copper grid, followed by a removal of the liquid after a 10 min deposition.

Spectroscopic characterizations: UV-vis extinction spectra were recorded on a Hitachi U-2910

spectrophotometer. Raman spectra were measured for liquid samples in a low-volume quartz cuvette at room
temperature with a portable Raman spectrometer (Ocean Optics) equipped with a Maya 2000 CCD detector and
a 671 nm laser.

Energy dispersive X-ray spectroscopic (EDX) analysis: EDX element analysis of a sample was
conducted on a JEM-2100F field emission transmission electron microscope operated at an electron
acceleration voltage of 200 kV.
 Supporting figures

40 50 30
22.9±2.3 nm 42.8±3.1 nm
(a) (b) 30.2±2.2 nm
25
(c)
40
30
20
30
Count

Count

Count
20 15
20
10
10
10
5

0 0 0
16 18 20 22 24 26 28 30 32 22 24 26 28 30 32 34 36 38 40 36 40 44 48 52 56
Diameter / nm Diameter / nm Diameter / nm  
Figure S1. Statistical diameter distributions of as-synthesized 23, 30, and 43 nm AuNPs used throughout our
experiments.
 
 

Figure S2. Agarose gel electrophoretic purifications of Ag+-soldered Au nanoparticle dimers with different
diameters of 23 nm (a), 30 nm (b), and 43 nm (c). The bands marked by arrows are dimeric products which can
be eluted from the gels.
 1.0 (a) 23 nm AuNPS 1.0 (b) 30 nm AuNPs 1.0 (c) 43 nm AuNPs
Normalized Extinction

Normalized Extinction

Normalized Extinction
23 nm dimers 30 nm dimers 43 nm dimers
0.8 0.8 0.8

0.6 0.6 0.6

0.4 0.4 0.4

0.2 0.2 0.2

0.0 0.0 0.0

400 600 800 1000 400 600 800 1000 400 600 800 1000
Wavelength / nm Wavelength / nm Wavelength / nm  
 

1.0
Norm. extinction cross section

Gap size (diameter) (d)

0.65 nm (23 nm)
0.8 0.8 nm (30 nm)
0.9 nm (43 nm)
E

0.6

0.4

0.2

0.0
500 550 600 650 700 750
Wavelength /nm
Figure S3. Normalized extinction spectra of (a) 23, (b) 30 and (c) 43 nm gold nanoparticles along with their
dimers assembled by Ag+ soldering. (d) Simulations of the coupling-induced longitudinal plasmon (BDP)
resonances of the dimers indicated gap separations of (a) 0.65 nm, (b) 0.8 nm, and (c) 0.9 nm for the 23-43 nm
dimers, respectively. Light polarization was along the dimer axis. The simulations were carried out by a
MESME algorithm developed by Prof. García de Abajo (F. J. Garcia de Abajo, Phys. Rev. Lett. 1999, 82, 2776;
F. J. Garcia de Abajo, Phys. Rev. B 1999, 60, 6086).
Figure S4. TEM images of gel-isolated dimeric clusters of AuNPs with different diameters of 23 nm (a), 30 nm
(b), and 43 nm (c).

1.8
1.8
(a) (b) SC 85 oC
Normalized Extinction

Normalized Extinction
o
L-AA 25 C 1.6
1.6
SC 125 oC 1.4 SC 125 oC
1.4 Ag
1.2
1.2
1.0 1.0 Ag
0.8 0.8
0.6 0.6
0.4 0.4
0.2 0.2
0.0 0.0
400 500 600 700 800 900 1000 1100 400 500 600 700 800 900 1000 1100
Wavelength / nm Wavelength / nm  
FigureS5. Extinction spectral characterizations revealing the critical role of reaction temperature in the
formation of a silver conductive junction inside the nanogap of a strongly coupled gold nanodimer. Silver
reductions by (a) L-ascorbic acid (L-AA) at 25C and (b) sodium citrate (SC) at 85C resulted in plasmon
peaks around 400 nm (characteristic of silver nanophases) and weak, broadened CTP peaks around 650-700 nm
(related to silver junctions) due to an over-deposition of silver outside of the nanogaps. In contrast, the silver
deposition with SC as a reductant in a 125C oil bath produced a very sharp CTP peak at 650 nm with
unresolvable plasmon signal for the silver phase, indicating a highly preferential silver deposition in the
nanogap region. Dashed profiles show the extinction spectra of the AIS-assembled gold nanodimer with a
subnm interparticle gap, featuring a BDP resonance at the long wavelength side of the spectra. CTP positions
are marked with triangle symbols. Please see the following TEM images showing the typical sample
morphologies achieved in the 25C and 85C reactions.
FigureS6. TEM image showing typical Ag-deposited dimers at 25C with L-AA as the reducing agent. A large
portion of the structures were unsuccessful, mainly including (1) gap-retained dimers, (2) asymmetrically
deposited dimers, and (3) CTP dimers with very thick Ag layer around the individual particles (not
gap-preferred) (note that not all of them were marked). This result forms a sharp contrast to Figure 3 where
the reaction was conducted in a 125C oil bath with citrate as the reductant.
FigureS7. TEM image showing typical Ag-deposited dimers at 85C with SC as the reducing agent. A large
portion of the structures were unsuccessful, mainly including (1) gap-retained dimers, (2) asymmetrically
deposited dimers, (3) CTP dimers with very thick Ag layers around the individual particles (not gap-preferred),
and (4) dissociated dimer assemblies (note that not all of them were marked). This result forms a sharp
contrast to Figure 3 where the reaction was conducted in a 125C oil bath with citrate as the reductant.
 40 50 30
(a1) 7.5±2.3 nm (a2) 15.9±1.8 nm
25
(a3) 27.9±2.0 nm
30 10 μM 40 30 μM 80 μM
20

Count

Count

Count
30
20 15
20 10
10 10 5
0 0 0
0 2 4 6 8 10 12 14 16 18 6 9 12 15 18 21 24 20 22 24 26 28 30 32 34 36 38
CJ width CJ width CJ width

50 (b1) 12.0±2.8 nm 25 (b2) 22.5±2.9 nm

30
(b3) 32.9±3.0 nm
40 10 μM 20 60 μM 120 μM
Count

Count

Count
30 15 20
20 10
10
10 5
0 0 0
3 6 9 12 15 18 21 12 15 18 21 24 27 30 33 24 27 30 33 36 39 42 45 48
CJ width CJ width CJ width
40 25 40
35 (c1) 19.3±3.6 nm
20
(c2) 31.6±3.4 nm (c3) 46.2±4.8 nm
30 20 μM 60 μM 30 100 μM
25 15
Count

Count

Count
20 20
15 10
10 5 10
5
0 0 0
12 15 18 21 24 27 30 33 24 27 30 33 36 39 42 30 35 40 45 50 55 60 65
CJ width CJ width CJ width
Figure S8. Statistical charts showing as-measured CJ widths for g-dimers made of different AuNPs (a-c
corresponding to 23, 30, and 43 nm AuNPs, respectively; 1-3 correspond to different HAuCl4 concentrations as
marked on each panel). Multiple TEM images of the samples were used for the analyses.

40 40
(a1) 24.5±2.6 nm (a2) 27.0±2.6 nm
30 (a3) 30.7±3.9 nm
30 10 μM 30 30 μM 80 μM
Count

Count

Count

20
20 20

10 10 10

0 0 0
18 21 24 27 30 33 18 21 24 27 30 33 36 39 21 24 27 30 33 36 39 42
Diameter / nm Diameter / nm Diameter / nm
40
(b1) 33.3±3.2 nm 25 (b2) 35.0±2.8 nm 20 (b3) 39.9±4.1 nm
30 10 μM 20 60 μM 120 μM
15
Count

Count

Count

20 15
10
10
10 5
5
0 0 0
24 27 30 33 36 39 42 45 27 30 33 36 39 42 45 30 33 36 39 42 45 48 51
Diameter / nm Diameter / nm Diameter / nm

70 (c2)
60
(c1) 44.3±3.9 nm 30 48.8±5.4 nm 40 (c3) 54.2±5.2 nm
20 μM 25 60 μM 100 μM
50 20 30
Count

Count

Count

40
15 20
30
20 10
10
10 5
0 0 0
35 40 45 50 55 35 40 45 50 55 60 65 40 45 50 55 60 65 70
Diameter / nm Diameter / nm Diameter / nm

Figure S9. Statistical charts showing the diameters of the gold-deposited AuNPs in as-formed g-dimers. Panels
a-c correspond to 23, 30, and 43 nm diameters of original AuNPs. 1-3 correspond to different HAuCl4
concentrations as marked on each panel. Multiple TEM images of the samples were used for the analyses.
 30 18.1±2.0 nm
(a1) 10.3±1.6 nm
30 (a2) 13.2±2.5 nm 40 (a3) 40 μM
10 μM 20 μM
20 30

Count

Count

Count
20
20
10 10 10
0 0 0
3 6 9 12 15 18 21 3 6 9 12 15 18 21 24 9 12 15 18 21 24 27
CJ width CJ width CJ width
30
20 (b1) 11.7±2.7 nm
30
(b2) 19.6±4.7 nm (b3) 24.5±2.6 nm
10 μM 30 μM 25 50 μM
15 20
Count

Count

Count
20
10 15
10 10
5
5
0 0 0
6 9 12 15 18 21 5 10 15 20 25 30 35 15 18 21 24 27 30 33
CJ width CJ width CJ width
30 25
(c1) 12.5±2.1 nm 30 (c2) 24.6±2.7 nm
20
(c3) 41.7±5.5 nm
10 μM 25 μM 90 μM
20
15
Count

Count

Count
20
10
10 10
5
0 0 0
6 9 12 15 18 21 10 15 20 25 30 35 40 20 30 40 50 60
CJ width CJ width CJ width

Figure S10. Statistical charts showing as-measured CJ widths for s-dimers made of different AuNPs (a-c
corresponding to 23, 30, and 43 nm AuNPs, respectively; 1-3 correspond to different AgNO3 concentrations as
marked on each panel). Multiple TEM images of the samples were used for the analyses.

30 (a1) 24.7±3.5 nm 30 (a2) 25.6±2.7 nm 25 (a3) 26.1±1.2 nm

25 10 μM 25 20 μM 20 40 μM
20 20
Count

Count

Count

15
15 15
10
10 10
5 5 5
0 0 0
20 22 24 26 28 30 20 22 24 26 28 30 32 22 24 26 28 30 32
Diameter / nm Diameter / nm Diameter / nm
30
25 (b1) 31.9±2.9 nm 30 (b2) 34.2±3.1 nm
25 (b3) 35.3±3.2 nm
20 10 μM 22 μM 50 μM
25
20
Count

Count

Count

15 20
15
15
10 10
10
5 5 5
0 0 0
24 27 30 33 36 39 42 27 30 33 36 39 42 45 27 30 33 36 39 42
Diameter / nm Diameter / nm Diameter / nm
30
(c1) 44.4±4.5 nm
32 (c2) 46.4±4.8 nm 25 (c3) 49.1±4.8 nm
25 10 μM 25 μM 90 μM
20
20 24
Count

Count

Count

15 15
16
10 10
8 5
5
0 0 0
30 35 40 45 50 55 60 35 40 45 50 55 35 40 45 50 55 60 65
Diameter / nm Diameter / nm Diameter / nm
 
Figure S11. Statistical charts showing the diameters of the silver-deposited AuNPs in as-formed s-dimers.
Panels a-c correspond to 23, 30, and 43 nm diameters of original AuNPs. 1-3 correspond to different AgNO3
concentrations as marked on each panel. Multiple TEM images of the samples were used for the analyses.
Figure S12. EDX analysis showing the Au and Ag element profiles along the dimer axis of a 30 nm s-dimer,
indicating an enriched distribution of Ag in the gap region.

Figure S13. Photographs of as-formed g-dimers after reacting with different amounts of HAuCl4. The control
samples were original Ag+-soldered dimers. These pictures show a clear color transition and a good water
solubility of the products.

Figure S14. Photographs of as-formed s-dimers after reacting with different amounts of AgNO3. The control
samples were original Ag+-soldered dimers. These pictures show a clear color transition and a good water
solubility of the products.
Figure S15. Agarose gel electropherograms of as-formed g-dimers after reacting with different amounts of
HAuCl4. The control samples were original Ag+-soldered dimers. These data show a good purity and colloidal
stability of the samples.

Figure S16. Agarose gel electropherograms of as-formed s-dimers after reacting with different amounts of
AgNO3. The control samples were original Ag+-soldered dimers. These data show a good purity and colloidal
stability of the samples.
 35.0k
Extinction cross section /nm2

Extinction cross section /nm2

25.0k (a1) 30.7 nm (27.9) (b1) 18.8 nm (18.1)
19.1 nm (15.9) 30.0k 15.4 nm (13.2)
12.5 nm (7.5) 13.0 nm (10.3)
20.0k 25.0k

20.0k
15.0k
15.0k
10.0k
10.0k

5.0k 5.0k

0.0 0.0

400 500 600 700 800 900 1000 1100 400 500 600 700 800 900 1000 1100

Wavelength /nm Wavelength /nm

70.0k
Extinction cross section /nm2

Extinction cross section /nm2

50.0k (a2) 39.9 nm (32.9)
24.7 nm (22.5)
(b2) 26.7 nm (24.5)
21.7 nm (19.3)
60.0k
14.2 nm (12.0) 14.8 nm (11.7)
40.0k 50.0k

40.0k
30.0k
30.0k
20.0k
20.0k
10.0k
10.0k

0.0 0.0

400 500 600 700 800 900 1000 1100 400 500 600 700 800 900 1000 1100

Wavelength /nm Wavelength /nm

100.0k
Extinction cross section /nm2

Extinction cross section /nm2

(a3) 54.2 nm (46.2)

100.0k (b3) 47.1 nm (41.7)
29.9 nm (24.6)
37.6 nm (31.6)
80.0k 17.6 nm (19.3) 17.5 nm (12.5)
80.0k

60.0k
60.0k

40.0k
40.0k

20.0k 20.0k

0.0 0.0

400 500 600 700 800 900 1000 1100 400 500 600 700 800 900 1000 1100

Wavelength /nm Wavelength /nm  

Figure S17. BEM calculated theoretical CTP profiles of different g-dimers (a) and s-dimers (b) based on two
simplified models shown above. Light polarizations were along the dimer axes. Different CJ widths were
adopted during the calculations to fit experimentally observed CTP positions (see Figure 4). The values in
brackets are measured CJ widths based on TEM data, which show a good consistency with simulated ones.
 140000

Extinction cross section /nm2

Au Ag
120000
42.5 nm
100000
40.0 nm
80000
19.3 nm

60000
42.5 nm

40000 85.0 nm

20000

300 400 500 600 700 800 900 1000 1100

Wavelength /nm  
Figure S18. BEM calculated theoretical extinction profiles of different CTP dimers. Light polarizations were
along the dimer axes. From the bottom up in the schematic drawings are: a 40 nm g-dimer bearing a 1.25 nm
thick gold coating and a 19.3 nm wide Au CJ (blue curve), a 42.5 nm AuNP dimer connected by a 19.3 nm
thick Ag CJ (green curve), a 40 nm s-dimer bearing a 1.25 nm thick Ag coating and a 19.3 nm wide Ag CJ (red
curve), and a 42.5 nm AgNP dimer connected by a 19.3 nm wide Ag CJ (black curve).
 
1.6
[H2O2] / 102 μM:
Normalized Extinction

1.4
1.2 0
1.7
1.0 2.7
0.8 3.3
6.7
0.6 50
0.4 100
0.2
0.0
400 500 600 700 800 900 1000 1100
 
Wavelength / nm
Figure S19. Normalized extinction spectra of s-dimers prepared from 40 nm AuNP dimers after an etching by
different concentrations of H2O2. 
Figure S20. (a) Photographs of H2O2-etched s-dimers synthesized from 40 nm AuNP dimers. (b) Agarose gel
electrophoretic data showing a good purity and colloidal stability the H2O2-etched s-dimers shown in (a). The
samples from left to right correspond to increased H2O2 concentrations.

Figure S21. TEM images of s-dimers prepared 40 nm AuNP dimers after an etching by different concentrations
of H2O2.

1.8 1.8 1.8

1.6 (a) s-dimers
s-dimers + H2O2 1.6 (b) s-dimers
Pt-s-dimers 1.6 (c) s-dimers
Pd-s-dimers
Normalized Extinction

Normalized Extinction

Normalized Extinction

Pt-s-dimers + H2O2 Pd-s-dimers + H2O2

1.4 1.4 1.4
1.2 1.2 1.2
1.0 1.0 1.0
0.8 0.8 0.8
0.6 0.6 0.6
0.4 0.4 0.4
0.2 0.2 0.2
0.0 0.0 0.0
400 600 800 1000 1200 400 600 800 1000 1200 400 600 800 1000 1200
Wavelength / nm Wavelength / nm Wavelength / nm

Figure S22. UV-visible extinction spectra of 30 nm s-dimers (a), Pt-s-dimers (b), and Pd-s-dimers (c) before
and after a silver etching by H2O2. The negligible spectral changes for the Pt-s-dimers and Pd-s-dimers after the
H2O2 etching indicate minimal silver residuals after the Pt and Pd displacements. CTP positions are marked
with triangle symbols.
Figure S23. Pt-s-dimers (a) and Pd-s-dimers prepared by Galvanic displacements of s-dimers with minimum
Ag deposition.

1.2 1.2
(a) dimers (b) dimers
Normalized Extinction

Normalized Extinction

1.0 s-dimers 1.0 s-dimers

Pt-s-dimers Pd-s-dimers
0.8 0.8
0.6 0.6
0.4 0.4
0.2 0.2
0.0 0.0
400 600 800 1000 400 600 800 1000
Wavelength / nm Wavelength / nm  
Figure S24. Normalized extinction spectra of Pt-s-dimers (a) and Pd-s-dimers (b) prepared by Galvanic
displacements of 35 nm s-dimers with minimum Ag depositions. The weakened and redshifted CTP peaks for
the Pt-s-dimers and Pd-s-dimers compared to corresponding s-dimers were a result of silver replacement.
 
 (a) C4-NTP= 250 μM
(b) C4-NTP= 100 μM
24
(c)
26
Intensity / a.u.
20
24 18
22

Reaction time / 10s

Reaction time / min
16
20
18 14
14 10
10
6
6
2 2
0 0
1000 1200 1400 1600 1800 1000 1200 1400 1600 1800 1520 1600
Raman Shift / cm-1  
Figure S25. Time-course SERS spectra measured on 35 nm Pd-s-dimers showing the catalytic conversion from
4-NTP to 4-ATP after being reduced by NaBH4. The 4-NTP-decorated Pd-s-dimers were prepared in the
presence of 250 μM (a) and 100 μM (b) 4-NTP molecules. The catalytic conversion was obvious at a low
4-NTP coverage (panels b and c in contrasting to panel a). Panel c is a zoom-in view of the marked part in
panel b.

4k

×5
3k 4-ATP
Intensity

2k

1k

4-NTP
0
1000 1200 1400 1600 1800
-1
Raman Shift / cm
 
Figure S26. SERS spectra of chemically pure 4-NTP and 4-ATP molecules adsorbed on strongly coupled
AuNP (30 nm in diameter) dimers obtained by AIS. The concentrations of 4-NTP and 4-ATP were 10-5 M.
 dimers s-dimers Pt-s-dimers Pd-s-dimers
1.2 10 μM 500 μM 250 μM
(a1) 10 μM
Original
(b1) Original
(c1) Original
(d1) Original
1.0 4-NTP adsorbed 4-NTP adsorbed 4-NTP adsorbed 4-NTP adsorbed
After reaction After reaction
Normalized Extinction

After reaction After reaction

0.8
0.6
0.4
0.2
0.0
1.2 250 μM 100 μM
(a2) Original
2 μM
(b2) Original
2 μM (c2) Original
(d2) Original
1.0 4-NTP adsorbed 4-NTP adsorbed 4-NTP adsorbed 4-NTP adsorbed
After reaction After reaction After reaction After reaction
0.8
0.6
0.4
0.2
0.0
400 600 800 1000 400 600 800 1000 400 600 800 1000 400 600 800 1000
Wavelength / nm  
Figure S27. Normalized extinction spectra of AuNP dimers and different CMNFs before and after the SERS
measurements. The slight changes to the BDP peaks were a result of 4-NTP and NaBH4 treatments that slightly
altered the dielectric environments and gap separations of the nanofoci. 
Figure S28. TEM images of AuNP dimers (a), s-dimers (b), Pt-s-dimers (c), and Pd-s-dimers (d) after
interacting with 4-NTP and NaBH4. These samples corresponded to the data in Figure 6.
 (a) (b1) Original
1 min

20

Intensity / a.u.
Intensity / a.u.
18
Original
16 (b2) 6 min

Illumination Time / min

14 ×5
12
10
8
6 (b3) Original
8 min
4 ×5
2
0
1000 1200 1400 1600 1800 1000 1200 1400 1600
Raman Shift / cm-1 Raman Shift / cm-1
 

Figure S29. Evidences in support of the fact that only chemical catalysis was responsible for the conversion
from 4-NTP to 4-ATP in the plasmonic hotspot of CMNFs. (a) Unvaried SERS signals of 4-NTP molecules
adsorbed on Pt-s-dimers for different irradiation times of the 671 nm excitation laser in the absence of the
chemical reductant NaBH4. (b) Under a constant laser illumination for relatively short time of 10 s during each
measurement, a prolonged incubation with NaBH4 increased the yield of 4-ATP. Shadowed peaks correspond to
characteristic vibrations of 4-NTP (grey and cyan) and 4-ATP (red). A complete conversion of 4-NTP into
4-ATP happened after an 8-min reaction as judged by the disappearance of 4-NTP signals. Because
homogeneous solution-based samples were employed for the SERS measurements, any light-induced processes
would be invisible due to a rapid diffusion of the CMNFs carrying the product molecules out of the laser
focusing point. These results clearly indicate that the conversion from 4-NTP to 4-ATP was due to chemical
catalysis, not related to the laser irradiation during SERS measurements.
  

dimers s-dimers Pt-s-dimers

(a) 532 nm (b) 532 nm (c) 532 nm

Illumination Time / min

Illumination Time / min

Illumination Time / min

60 60 60
40 40 40
20 20 20
0 0 0
Intensity / a.u.

(d) 671 nm (e) 671 nm (f) 671 nm

Illumination Time / min

Illumination Time / min

Illumination Time / min

60 60 60
50 50 50
40 40 40
30 30 30
20 20 20
10 10 10
0 0 0

(g) 671 nm (h) 671 nm (i) 671 nm

Illumination Time / min

Illumination Time / min

Illumination Time / min

60 60 60
50 50 50
40 40 40
30 30 30
20 20 20
10 10 10
0 0 0
1000 1200 1400 1600 1800 1000 1200 1400 1600 1800 1000 1200 1400 1600 1800

Raman Shift / cm-1  

 
Figure S30. SERS spectra showing plasmon-driven dimerizations of 4-NTP into DMAB
(4,4'-dimercaptoazobenzene) in the hotspots of gold nanodimers, s-dimers, and Pt-s-dimers. (a-c) Irradiation by
a 532 nm laser (unmatched with the hotspot resonance) did not generate a DMAB product, as evidenced by
SERS measurements with a 671 nm laser at a lowered (10%) intensity and shortened (40 s) overall illumination
time to alleviate its plasmon effect. (d-i) Irradiation by a 671 nm laser at 45% (d-f) and 100% (g-i) of its full
power led to clearly observable Raman signals (marked with green shadowed areas) of DMAB. The yield of
DMAB was explicitly related to the laser intensity. The effectiveness of the 671 nm laser for the
plasmon-driven reaction is well-understood considering the significantly red-shifted hotspot LSPR. Note that
the CMNFs were deposited on a quartz substrate for the SERS measurements in order to avoid a quick
diffusion of the DMAB products out of the laser focus points.
Figure S31. TEM images of DNA-linked 23 nm AuNP dimers before (a) and after (d) an AIS treatment, and
the corresponding gold (b, e) and silver (c, f) modified nanodimers (i.e. g-dimers and s-dimers) prepared from
(a) and (b) in the absence (b, c) and presence (e, f) of the AIS treatment. Insets show photographs of
corresponding solutions.

1.2 (a) DNA-linked dimers 1.2 (b) DNA-linked dimers

Normalized Extinction

Normalized Extinction

DNA-linked dimers@Au DNA-linked dimers@Ag

1.0 Soldered dimers 1.0 Soldered dimers
Soldered dimers@Au Soldered dimers@Ag
0.8 0.8

0.6 0.6

0.4 0.4

0.2 0.2

0.0 0.0
400 600 800 1000 1200 400 600 800 1000 1200
Wavelength / nm   Wavelength / nm
Figure S32. UV-visible extinction profiles of DNA-linked 23nm AuNP nanodimers, their AIS-treated structures,
along with the gold (a) and silver (b) modified samples (i.e. g-dimers and s-dimers) based on the DNA-linked
dimers with or without the AIS treatment. The AIS-treated dimers show a new resonance peak corresponding to
the BDP mode. CTP peaks generated after a metal filling of the interparticle gaps are marked with triangle
symbols.
Figure S33. (a) Gel electrophoretic data showing a successful high density DNA functionalization of g-dimers,
and their assembly with 5 nm AuNPs to form core-satellite structures. Lanes 1-5 correspond to 5 nm AuNPs
(lane 1), ssDNAc mono-conjugated 5 nm AuNPs (lane 2), g-dimers (lane 3), ssDNA multi-functionalized
g-dimers (lane 4), and DNA-directed core-satellite assemblies (lane 5). (b) TEM images showing the as-formed
core-satellite structures with g-dimers cores (prepared from 23 nm AuNPs) and 5 nm AuNP satellites.