Sie sind auf Seite 1von 127

Cloning Vectors

Cloning Vectors >> Plasmid Vectors


DATA SHEET

Reagent: Cloning Vector (pLG339/SPORT)

Catalog Number: 3924

Lot Number: 1

Release Category: D

Provided: 1 vial kanamycin-resistant, transformed DH5α (glycerol stock). Culture at 37°C.

Description: Contains the 5.5 kb HincII-EcoRI fragment from pLG339, which in turn contains the
pSC101 ori and a kanamycin resistance gene. Also contains a 245 bp FspI-EcoRI
fragment with the pSPORT multiple cloning site.

Plasmid Map

Special Low copy number, 5820 bp plasmid vector useful in stabilizing lentivirus sequences
Characteristics: such as SIV, EIAV, Visna maedi, etc. for subcloning, propagation, and manipulation in
E. coli. Reduces the level of toxic gene expression from cryptic promoter sequences.

Recommended -70°C
Storage:

Contributor: Dr. Ronald C. Montelaro.

References: Cunningham TP, Montelaro RC, Rushlow KE. Lentivirus envelope sequences and
proviral genes are stabilized in Escherichia coli when cloned in low copy number
plasmid vectors. Gene 124:93-98, 1993.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: Cloning Vector
(pLG339/SPORT) from Dr. Ronald C. Montelaro (cat# 3924)." Also include the
reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: Cloning Vector (pLG338/30)

Catalog Number: 3923

Lot Number: 1

Release Category: D

Provided: 1 vial ampicillin-resistant, transformed DH5a (glycerol stock). Culture at 37°C.

Description: Contains the 3.05 kb PvuII-HincII fragment from pLG338, which in turn contains the
pSC101 ori. Also contains a 1.65 bp EcoRI-HaeII fragment with the pBR322 ampicillin
resistance gene, and the multiple cloning site (FspI-EcoRI) from pIBI30.

Plasmid Map

Special Low copy number, 5215 bp plasmid vector useful in stabilizing lentivirus sequences
Characteristics: such as SIV, EIAV, Visna maedi, etc. for subcloning, propagation, and manipulation in
E. coli. Reduces the level of toxic gene expression from cryptic promoter sequences.
GenBank Accession no. AF035682.

Recommended -70°C
Storage:

Contributor: Dr. Ronald C. Montelaro.

References: Cunningham TP, Montelaro RC, Rushlow KE. Lentivirus envelope sequences and
proviral genes are stabilized in Escherichia coli when cloned in low copy number
plasmid vectors. Gene 124:93?98, 1993.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: Cloning Vector
(pLG338/30) from Dr. Ronald C. Montelaro (cat# 3923)." Also include the reference
cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: Expression Vector (pJW4304)

Catalog Number: 7622

Lot Number: 020880

Release Category: B

Provided: 1 ml transformed DH5α (glycerol stocks). The plasmid carries a ColE1 origin, and a
ß-lactamase cassette. Growth in luria broth + 50 µg/ml ampicillin is recommended.

Description: This is an empty vector which has been utilized in DNA vaccines. Expression is driven by
the CMV IE promoter (Towne isolate). The sequence has been mapped and is provided.

Click here to see the sequence file.

Cloning Vector: The cloning vector is pJW4304. The size of the cloning vector is 5132 bp.

Special This clone is unique due to the high level of expression upon transfection into
Characteristics: mammalian cells in vivo.

Recommended -70°C.
Storage:

Contributor: Drs. James Arthos, Laura Heath and James Mullins

References: Mossman SP, Bex F, Berglund P, Arthos J, O'Neil SP, Riley D, Maul DH, Bruck C, Momin
P, Burny A, Fultz PN, Mullins JI, Liljestrom P, Hoover EA. Protection against lethal simian
immunodeficiency virus SIVsmmPBj14 disease by a recombinant Semliki Forest virus
gp160 vaccine and by a gp120 subunit vaccine. J Virol 70:1953-1960, 1996.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Yasutomi Y, Robinson HL, Lu S, Mustafa F, Lekutis C, Arthos J, Mullins JI, Voss G,
Manson K, Wyand M, Letvin NL. Simian immunodeficiency virus-specific cytotoxic
T-lymphocyte induction through DNA vaccination of rhesus monkeys. J Virol
70:678-681, 1996.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pJW4304 from
Drs. James Arthos, Laura Heath and James Mullins (cat# 7622)." Also include the
references cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact the Office of Technology Licensing at the following email
address: brenda.martino@stanford.edu, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HTLV-II Cloning Vector (pGEMT-HTLV-2)

Catalog Number: 12496

Lot Number: 160169

Release Category: E

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: A HTLV-II cloning vector

Cloning Vector: pGEMT-Easy

Ampicillin resistant

Cloning Site: TOPO TA cloned

The size of the insert is 801 bp.

Special This construct is 3818 bp including the insert.


Characteristics:
The HTLV-II PCR amplified sequence was TOPO TA cloned between the EcoRI and SpeI
sites of the pGEMT-Easy (Promega) vector.

The sequence maps to partial LTR and gag sequences of the HTLV-II virus (isolate
G12) between nucleotides 39 and 840 corresponding to partial LTR and gag sequences
of the virus.

This sequence can serve as a positive control in population screenings using the
following primers:
Forward: 5'-CGAGTCATCGACCCAAAAGGTC-3'
Reverse: 5'-GGAGTTGGGGAAAGCCCGTGG-3'

This construct is not for protein expression.

GenBank Accession Number: L11456

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Plasmid map and sequence file lot 160169

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may
benefit from growth at 30°C. This construct may also be grown in other competent
cells.

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Elisa Oltra

References: Oltra, E., Garcia-Escudero, M., Mena-Duran, A. V., Monsalve, V., & Cerda-Olmedo, G.
(2013). Lack of evidence for retroviral infections formerly related to chronic fatigue in
Spanish fibromyalgia patients. Virol J, 10, 332. doi: 10.1186/1743-422X-10-332
PUBMED

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HTLV-II Cloning
Vector (pGEMT-HTLV-2) from Dr. Elisa Oltra." Also include the references cited above
in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Lentivirus Cloning System >> EGFP Reporter
DATA SHEET

Reagent: pTY-EFeGFP

Catalog Number: 4828

Lot Number: 041225

Release Category: C

Provided: 0.5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Lentiviral transducing vector containing the EF1a promoter-driven eGFP gene.

Special Self-inactivated lentiviral vector (pTY) expressing the eGFP reporter gene. Reporter
Characteristics: gene expression can be detected directly by flow cytometry.

The plasmid is ampicillan Resistant.

Protocol: DNA Transfection for production of recombinant lentiviruses


Plasmid Map
Sequence

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
Storage: barrier bag.

Contributor: Dr. Lung-Ji Chang

References: Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J. Efficacy and safety analyses of a
recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther
6:715–728, 1999.

Iwakuma T, Cui Y, Chang L-J. Self-inactivating lentiviral vectors with U3 and U5


mutations. Virology 261:120–132, 1999.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Cui Y, Iwakuma T, Chang L-J. Contributions of viral splice sites and cis-regulatory
elements to lentivirus vector function. J Virol 73:6171–6176, 1999.

Zolotukhin S, Potter M, Hauswirth WW, Guy J, Muzyczka N. A “humanized” green


fluorescent protein cDNA adapted for high-level expression in mammalian cells. J
Virol 70:4646-4654, 1996.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH:pTY-EFeGFP
from Dr. Lung-Ji Chang." Also include the references cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact UF Innovate at the following email address:
mta@research.ufl.edu, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Lentivirus Cloning System >> Helper Construct
DATA SHEET

Reagent: pHP-dl-N/A

Catalog Number: 4692

Lot Number: 041252

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Derived from the lentiviral packaging vector pHP-1dl.28 (see attached figure) with an
additional 695 bp env deletion (NdeI-AseI).

Cloning Vector: Ampicillin resistant

Special This construct is 11,729 bp including the insert.


Characteristics:
Lentiviral helper construct for packaging pTY vectors. Generates HIV-1 Gag-Pol, Tat,
Rev, Vpr, Vif, and Vpu. Derived from pUC18-based pNL4-3 with deletions of 5', U3,
5'UTR, part of env, nef, and the 3' LTR. Bacteria transformed with this construct is prone
to deletions when grown at 37°C with vigorous shaking. Cultures should be grown at
32°C with gentle overnight shaking.

Protocol:DNA Transfection for production of recombinant lentiviruses

Contributor Provided Plasmid Map

From Chang L-J, et al. Gene Ther 6:715, 1999 (Figure 1a).

Plasmid map and sequence file lot 041252

Propagate in DH5a, Top-10, HB101, or STBL2.

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Lung-Ji Chang.

References: Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J. Efficacy and safety analysis of a
recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther
6:715-728, 1999.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pHP-dl-N/A from
Dr. Lung-Ji Chang." Also include the reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact UF Innovate at the following email address:
mta@research.ufl.edu, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Lentivirus Cloning System >> NLACZ Reporter
DATA SHEET

Reagent: pTY-EFnlacZ

Catalog Number: 4694

Lot Number: 051159

Release Category: C

Provided: 2 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Lentiviral transducing vector containing the EF1a promoter-driven nuclear localized lacZ
gene.

Plasmid Map

Protocol:DNA Transfection for production of recombinant lentiviruses

Special Self-inactivated lentiviral vector (pTY) expressing the nlacZ reporter gene.
Characteristics:
Sequence file lot 051159

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Lung-Ji Chang

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J. Efficacy and safety analyses of a
recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther
6:715-728, 1999. Iwakuma I, Cui Y, Chang L-J. Self-inactivating lentiviral vectors with
U3 and U5 mutations. Virology 261:120-132, 1999. Cui Y, Iwakuma T, Chang L-J.
Contributions of Viral splice sites and cis-regulatory elements to lentivirus vector
function. J Virol 73:6171-6176, 1999.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pTY-EFnlacZ from
Dr. Lung-Ji Chang (cat# 4694)." Also include the references cited above in any
publications.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact UF Innovate at the following email address:
mta@research.ufl.edu, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Lentivirus Cloning System >> TAT Expression Vector
DATA SHEET

Reagent: pCEP4-Tat

Catalog Number: 4691

Lot Number: 041224

Release Category: C

Provided: 0.5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: This is a HIV-1 SF-2 Tat eukaryotic expression plasmid with the preferred eukaryotic
translational initiation codon (-CCACC-ATG).

Special This construct is 9922 bp including the insert and contains the HIV-1 SF2 Tat gene
Characteristics: from pSP72-tat ligated to pCEP4 (XhoI-BglII site). It contains a selectable hygromycin
resistance marker. Efficiently transactivates HIV-1 LTR.

Propagate in DH5a, Top-10, HB101, or STBL2.

Plasmid map and sequence file lot 041224

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
Storage: barrier bag.

Contributor: Dr. Lung-Ji Chang.

References: Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J. Efficacy and safety analyses of a
recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther
6:715?728, 1999.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pCEP4-Tat
from Dr. Lung-Ji Chang." Also include the reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact UF Innovate at the following email address:
mta@research.ufl.edu, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Lentivirus Cloning System >> Transducing Vector
DATA SHEET

Reagent: pTY-Linker

Catalog Number: 4690

Lot Number: 051157

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Generated by combining the lentiviral transducing vector pTV, self-inactivating lentiviral
vector pTYΔCT-CMVnlacZdl3'U3#1U5pA (see attached figure) and 5' splice site and env
deletion env.dl.6 (see attached figure) with a NotI-EcoRI linker. Unique cloning sites on
the linker that can be used for foreign gene insertion are: NotI, NheI, SalI, SmaI, BamHI,
SacII, SpeI, EcoRI, and KpnI.

Special Universal lentiviral self-inactivated transducing vector. Contains a chimeric 5' CMV-TATA
Characteristics: enhancer/promoter site and a 3' bovine growth hormone polyA signal. The backbone is
derived from pUC18 (of pNL4-3). This HIV-1 derived transducing vector contains the
following HIV sequences; RU5, UTR without the major splice site, 720 bp gag, 927 bp env
including the RRE, the two integration att sites and the 3'R.

Protocol:DNA Transfection for production of recombinant lentiviruses.

Plasmid Map and Sequence.

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may
benefit from growth at 30°C. This construct may also be grown in other competent cells.

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Lung-Ji Chang.

References: Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J. Efficacy and safety analyses of a
recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther
6:715-728, 1999. Iwakuma T, Cui Y, Chang L-J. Self-inactivating lentiviral vectors with
U3 and U5 mutations. Virology 261:120-132, 1999. Cui Y, Iwakuma T, Chang L-J.
Contributions of viral splice sites and cis-regulatory elements to lentivirus vector function.
J Virol 73:6171-6176, 1999.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pTY-Linker from
Dr. Lung-Ji Chang." Also include the references cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact UF Innovate at the following email address: mta@research.ufl.edu,
before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Packaging and Helper Constructs >> GPT-Based
DATA SHEET

Reagent: HIV-gpt

Catalog 1067
Number:

Lot Number: 100009

Release A
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: An XbaI-HpaI pHXB2gpt fragment (Drs. A. Fisher and F. Wong-Staal) containing proviral
and flanking cellular sequences was cloned into the HincII-XbaI site of pBS KS (+/-). A 1.2
KB NdeI-BglII fragment (nt 6402-7620) was deleted from env gene, and the 1.1 kb
PvuII-DraI SV2gpt fragment (Dr. M. Mulligan) was inserted at the env deletion site.
Contains intact HXB2 rev and tat genes. Replication-defective.

Image of vector from reference cited on this page.

Cloning Vector: Bluescript pBS KS +/-.

Description of Contains intact HIV-1 HXB2 rev and tat genes. Deletion of sequences encoding gp160 has
Clone: rendered HIV-gpt replication-defective. The PvuII - DraI SV2gpt fragment contains the
SV40 origin of replication and coding sequences for the gpt gene.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Special This construct is 14,294 bp.
Characteristics:
By itself, HIV-gpt produces non-infectious HIV-1 particles. Co-transfection of HIV-gpt with
an envelope expression vector into COS cells results in the packaging of the
replication-defective genome into infectious virions (virus is transiently produced). HIV or
other retroviral env genes can be used to complement HIV-gpt to yield virus with the host
range of the complementing gene. The gpt gene provides a convenient selection marker,
since each successful infection leads to the growth of a drug-resistant (mycophenolic acid)
colony.

Bacterial Host: HB101. Other bacterial strains should also be successful.

Cloning Strategy: An XbaI - HpaI fragment from pHXB2gpt containing HIV-1 proviral and
flanking cellular sequences was cloned into the HincII - XbaI site of pBS. A 1.2 kb NdeI -
BglII fragment (nt 6402-7620) was deleted from env gene, and the 1.1 kb PvuII - DraI
SV2gpt fragment was inserted at the env deletion site.

Source Of Pro Virus: HIV-1 plasmid pHXB2gpt (Dr. A. Fisher and Dr. F. Wong-Staal) and
pSV2gpt (Dr. M. Mulligan).

Plasmid map and sequence file lot 100009

This reagent is currently being provided as dried purified DNA stabilized in DNAstable PLUS.
Please see the notice for additional information and the protocol for reconstitution of dried
DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier bag.
Storage:

Contributor: Dr. Kathleen Page and Dr. Dan Littman.

References: Page KA, Landau NR, Littman DR. Construction and use of a Human immunodeficiency virus
vector for analysis of virus infectivity. J Virol 64:5270-5276, 1990.

NOTE: Acknowledgment for publications should read "The following reagent was obtained through
the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-gpt from Dr. Kathleen
Page and Dr. Dan Littman." Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Packaging and Helper Constructs >> MLV-Based
DATA SHEET

Reagent: pSV-Ψ-MLV-env-

Catalog Number: 3422

Lot Number: 050814

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Ψ-Moloney Murine Leukemia virus DNA (from Richard Mann) was cloned into the SV40
expression vector pSV7d at the EcoRI site. Restriction sites in the MLV sequence can be
found in the Appendix to Volume 2 of the Cold Spring Harbor Tumor Virus Book. The
mouse flanking sequences present on either side of the provirus have not been
sequenced.

Cloning Vector: pSV7d

Ampicillin resistant

Cloning Site: EcoRI cloning site

The size of the insert is 11,606 bp

Special This construct is 13,966 bp including the insert.


Characteristics:
This plasmid is used to produce MLV retroviral vectors using the method of Landau and
Littman. In the original method, COS cells were transfected with this plasmid and an
amphotropic MLV env vector. Higher virus titers can be obtained by transfecting 293
cells instead of COS cells, and with the VSV-G expression vector instead of A-MLV.

Contributor Provided Plasmid Map

Plasmid map and sequence file lot 050814

Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may
benefit from growth at 30°C. This construct may also be grown in other competent
cells.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Nathaniel Landau, Aaron Diamond AIDS Research Center, the Rockefeller University.

References: Landau NR, Littman DR. packaging system for rapid production of murine leukemia virus
vectors with variable tropism. J Virol 66:5110-5113, 1992.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pSV-Ψ-MLV-env-
from Dr. Nathaniel Landau (cat# 3422)." Also include the reference cited above in any
publications. Patent pending.

Requests from commercial organizations must be directed to the New York


University Office of Industrial Liaison at the following email address:
sadhana.chitale@nyumc.org.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pSV-A-MLV-env

Catalog Number:   1065

Lot Number:   110151

Release Category:   A

Provided:   10 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Contains the amphotropic murine leukemia virus env gene linked to the MLV LTR, and
 
an SV40 origin. The cloning vector is pSV7d.

Cloning Vector:   pSV7d

Description of Contains the amphotropic murine leukemia virus env gene linked to the MLV LTR. The
 
Clone: plasmid also contains the SV40 origin. Ampicillin resistant.

Cloning Site:   EcoRI/SalI

Special This construct is 5734 bp including the insert. 
Characteristics:
Co-transfection of COS cells with SV-A-MLV-env and HIV-gpt (catalog #1067) yields
an HIV/MLV (amphotropic) pseudotype virus.

Contributor provided plasmid map 
 
Plasmid map and sequence file lot 110151  

This reagent is currently being provided as dried purified DNA stabilized in DNAstable 
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
 
Storage: barrier bag.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 1 of 2
Contributor:   Dr. Nathaniel Landau and Dr. Dan Littman

References: Landau NR, Page KA, Littman DR. Pseudotyping with human T-cell leukemia virus type
 
I broadens the human immunodeficiency virus host range.  J Virol  65:162-169, 1991.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: SV-A-MLV-env
 
from Dr. Nathaniel Landau and Dr. Dan Littman." Also include the reference cited
above in any publications. 

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 2 of 2
Packaging and Helper Constructs >> Other
DATA SHEET

Reagent: HIV-1 Packaging Construct (psPAX2)

Catalog Number: 11348

Lot Number: 080142

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: The plasmid encodes for the Gag/Pro/Pol genes derived from HIV-1. The promoter is
the chicken beta actin promoter and polyAdenylation signal is the rabbit beta globin
polyA. Resistance to Ampicillin.

Cloning Vector: The size of the cloning vector including the insert is 10703 bp.

Cloning Site: The size of the insert is 8100 bp from the CMV enhancer to the polyA signal.

Special Vector is a second generation packaging plasmid used to produce HIV-1 derived
Characteristics: lentivectors. Replaces plasmids pCMVdeltaR8.91 and pCMVdeltaR8.74.

Plasmid Map

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Alternate names include: psPAX2 (equivalent to pCMVdeltaR8.91)

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
Storage: barrier bag.

Contributor: Dr. Didier Trono

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read “The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: psPAX2 (Cat#
11348) from Dr. Didier Trono.” Also include the reference cited above in any
publications.

Commercial organizations that are interested in this reagent should contact


Dr. Didier Trono, EPFL, SV-LVG, Laboratory of Virology and Genetics, Station
15, CH-1015 Lausanne, email: didier.trono@epfl.ch

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> CAT
DATA SHEET

Reagent: HIV-1 LTR Scanning Mutants (CAT)

Catalog Number: 4147

Lot Number: 2

Release Category: A

Provided: The plasmids are supplied as a complete collection of transformed bacterial stocks in a
single 96-well plate.

Description: Two sets of 26 substitution mutants extending from the 5' LTR (-453 bp from the
transcription start site) to base +15. Each mutant replaces 18 bp of the wild type HXB2
sequence with an NdeI-XhoI-SalI (NXS) polylinker (CATATGCTCGAGGTCGAC).

Click here to see the Plate A Well Assignment for this reagent.

Special The 96 well plates used for expansion have a 1.5ml capacity. Each of the wells to be
Characteristics: inoculated were filled with 1ml of LB+ ampicillin at 100µg/ml.

The plates were inoculated by using a pin inoculator configured for 96 well plates. The
inoculator was dipped in ethanol and flamed before and after each use. The expansion
plates were place in a 37°C incubator overnight. The following morning growth was
observed in all wells. Sterile glycerol (110µl) was added to each well and mixed
thoroughly.

A mixture of broth culture and glycerol was aliquoted into U bottom 96 well plates.
Plates were aliquoted at 100µl per well, covered with sterile sealing material and
labeled on top cover. All plates stored at -80°C.

Contributor: Dr. Steve Zeichner

References: Zeichner S, Kim JYH, Alwine JC. J Virol 65:2436, 1991.

Zeichner S, et al. J Virol 66:2268, 1992.

Kim JYH, et al. J Virol 67:1658, 1993.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pΔκB-HIV-CAT

Catalog Number: 2618

Lot Number: 120126

Release Category: A

Provided: 7 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Contains a 727 bp HindIII-XhoI insert encoding the HIV-1 LTR with mutated kB
sequences linked to the CAT gene.

Special This construct is 5223 bp including the insert.


Characteristics:
The clone is useful for the examination of inducible HIV transcription in response to
cytokines. A control clone containing normal NF-kB sequences is also available
(Catalog #2619).

Sequence file lot 120126

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
Storage: barrier bag.

Contributor: Dr. Gary Nabel and Dr. Neil Perkins.

References: Nabel G, Baltimore D. An inducible transcription factor activates expression of human


immunodeficiency virus in T cells. Nature 326:711-713, 1987.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pΔκB-HIV-CAT
from Dr. Gary Nabel and Dr. Neil Perkins." Also include the reference cited above in
any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD54E8)

Catalog 1520
Number:

Lot Number: 96111

Release C
Category:

Provided: 1 vial of ampicillin-resistant transformed bacteria DH5-a. Also grows in HB101.

Description: The 5' end of the LTR to position -48 from the transcriptional start site is deleted, but the
presence of the NF-kB enhancer sequence (reverse) resulted in restored transcriptional
activity (CAT assay).

Clone pC15CAT was cleaved with KpnI, treated with Bal31 exonuclease, blunted and the
XbaI linkers ligated. The resultant deletion mutant, pCD54E8, contains HIV-1 IIIB LTR
sequences from -48 to +80 located in front of the CAT gene. The NFκB sequence has been
cloned into the XbaI site at -48 in the reversed orientation. The NFκB insert sequence is:
XbaI XbaI -48 5'cgcagcgagtcact/ctagatggaaagtccccagcggaaagtccct/ctagag*gcgag3'

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The 5' end of the LTR to position -48 from the transcriptional start site is deleted, but the
Characteristics: presence of the NFκB enhancer sequence resulted in restored transcriptional activity as
determined by CAT assay. The LTR sequences are cloned upstream to the CAT gene.

Recommended -70degreeC
Storage:

Contributor: Dr. Steven F. Josephs.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express chloramphenicol
acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, and Wong-Staal F. Trans-activator gene of human
T-lymphotropic virus type III (HTLV-III). Science 9:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal F.
Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a viral
sequence encoding 58 amino acids and lacks tissue specificity. Virology 148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained through
the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT Reporter
Vector (pCD54E8)from Dr. Steven Josephs (cat# 1520)." Also include the references cited
above in any publications.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact the NCI Technology Transfer Center at the following email address:
lauren.nguyen-antczak@nih.gov, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD38)

Catalog Number: 1519

Lot Number: 96108

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed bacteria.

Description: The 5' end of the LTR to position -103 from the transcriptional start site is deleted.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII

Special Clone pC15CAT was cleaved with KpnI, treated with Bal31 exonuclease, blunted and the
Characteristics: XbaI linkers ligated. The resultant deletion mutant, pCD38, contains HIV-1IIIB LTR
sequences from -103 to +80 located in front of the CAT gene. The 5' end of the LTR to
position -103 from the transcriptional start site is deleted.
Bacterial Host: E. coli DH5-a. Also grows in HB101.

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD38) from Dr. Steven Josephs (cat# 1519)."Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1519) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD54E9)

Catalog Number: 1521

Lot Number: 96112

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a . Also grows in HB101.

Description: The 5' end of the LTR to position -48 from the transcriptional start site is deleted, but
the presence of the NF-kB enhancer sequence (forward) resulted in restored
transcriptional activity as determined by CAT assay. The LTR sequences are cloned
upstream to the CAT gene.
,br /> Clone pC15CAT was cleaved with KpnI, treated with Bal31 exonuclease, blunted
and the XbaI linkers ligated. The resultant deletion mutant, pCD54E9, contains
HIV-1IIIB LTR sequences from -48 to +80 located in front of the CAT gene. The NFκB
sequence has been cloned into the XbaI site at -48 in the forward orientation.

The NFκB insert sequence

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The 5' end of the LTR to position -48 from the transcriptional start site is deleted, but
Characteristics: the presence of the NFκB enhancer sequence resulted in restored transcriptional activity
as determined by CAT assay. The LTR sequences are cloned upstream to the CAT gene.

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD54E9) from Dr. Steven Josephs (cat# 1521)." Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1521) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD23)

Catalog Number: 1522

Lot Number: 96107

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: The nef region is deleted from the HIV LTR at -117. NF-kB and Sp-1 nuclear factor
binding sites and the TAR region are retained.

Clone pC15CAT was cleaved with KpnI, then treated with Bal31 exonuclease, blunted
and the XbaI linkers ligated. The resultant deletion mutant, pCD23, contains HIV-1IIIB
LTR sequences from -117 to +80 located in front of the CAT gene.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The nef region is deleted from the HIV LTR. The clone retains NFκB and Sp-1 nuclear
Characteristics: factor binding sites and the TAR region.

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of
the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pCD23 from Dr.
Steven Josephs." Also include the reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1522) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD16)

Catalog Number: 1523

Lot Number: 96106

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: The 5' end of the HIV LTR to position -176 from the transcriptional start site is deleted.

Clone pC15CAT was cleaved with KpnI, then treated with Bal31 exonuclease, blunted
and the XbaI linkers ligated. The resultant deletion mutant, pCD16, contains HIV-1IIIB
LTR sequences from -176 to +80 located in front of the CAT gene.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The 5' end of the HIV LTR to position -176 from the transcriptional start site is deleted.
Characteristics:

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD16) from Dr. Steven Josephs (cat# 1523)." Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat#1523) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD12)

Catalog Number: 1524

Lot Number: 96104

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: Deletion at -670D (CAT gene KpnI site). LTR-directed gene expression is enhanced
compared to that of the full-length LTR.

Clone pC15CAT was cleaved with KpnI, treated with Bal31 exonuclease, blunted and the
XbaI linkers ligated. Clone pCD12 contains a small deletion in the CAT gene KpnI site.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special LTR-directed gene expression is enhanced compared to that of the full-length LTR.
Characteristics:

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD12) from Dr. Steven Josephs (cat# 1524)." Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1524) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD54)

Catalog Number: 1525

Lot Number: 96110

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: The nef region, NF-kB and Sp-1 nuclear factor binding sites are deleted at -48.

Clone pC15CAT was cleaved with KpnI, then treated with Bal31 exonuclease, blunted
and the XbaI linkers ligated. The resultant deletion mutant, pCD54 contains HIV-1 IIIB
LTR sequences from -48 to +80 located in front of the CAT gene.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The nef region is deleted from the HIV LTR. The NFκB and Sp-1 nuclear factor binding
Characteristics: sites are also deleted.

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD54) from Dr. Steven Josephs (cat# 1525)." Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1525) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD7)

Catalog Number: 1526

Lot Number: 96105

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: The 5' end of the LTR to position -278 from the transcriptional start site is deleted.

Clone pC15CAT was cleaved with KpnI, treated with Bal31 exonuclease, blunted and the
XbaI linkers ligated. The resultant deletion mutant, pCD7, contains HIV-1IIIB LTR
sequences from -278 to +80 located in front of the CAT gene.

Cloning Vector: pC15CAT (Catalog 1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The 5' end of the LTR to position -278 from the transcriptional start site is deleted.
Characteristics:

Recommended -70°C
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program,Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD7) from Dr. Steven Josephs (cat# 1526)." Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat#1526) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pC15CAT)

Catalog Number: 1527

Lot Number: 110076

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Parent LTR-CAT clone. Deletion at -670D.

Clone pC15CAT contains the HIV-1 LTR cloned into the HindIII site of plasmid pSV0CAT.

Cloning Vector: pSV0CAT

Ampicillin resistant

Cloning Site: HindIII cloning site

Special This construct is 5353 bp including the insert.


Characteristics:
LTR-directed gene expression can be quantitated by CAT assay.
Source of Pro Virus: LTR sequences derived from HIV-1IIIB .

Sequence file lot 110076

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Steven F. Josephs

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051, 1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation of


the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ, Wong-Staal
F. Transactivation induced by human T-lymphotropic virus type III (HTLV III) maps to a
viral sequence encoding 58 amino acids and lacks tissue specificity. Virology
148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pC15CAT) from Dr. Steven Josephs (cat# 1527)."Also include the
reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C Reagents (Cat# 1527) must contact Dr. Brian W. Bailey, NIAID
Office of Technology Development, 6610 Rockledge Drive, Room 4036, MSC
6606, Bethesda, MD 20892-6606, Email: bbailey@mail.nih.gov, Tel:
301-594-1697, Fax: 301-402-7123, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pCD52)

Catalog Number: 1528

Lot Number: 96109

Release Category: C

Provided: 1 vial of ampicillin-resistant transformed DH5-a. Also grows in HB101.

Description: The nef region and NF-kB binding site are deleted at -65, but the two Sp-1 nuclear
factor binding sites remain.

Clone pC15CAT was cleaved with KpnI, then treated with Bal31 exonuclease, blunted
and the XbaI linkers ligated. The resultant deletion mutant, pCD52 contains HIV-1 IIIB
LTR sequences from -65 to +80 located in front of the CAT gene.

Cloning Vector: pC15CAT (Catalog #1527), a derivative of pSV0CAT.

Cloning Site: HindIII.

Special The nef region is deleted from the HIV LTR. The NFκB binding site is also deleted, but
Characteristics: the clone retains two Sp-1 nuclear factor binding sites.

Recommended -70degreeC.
Storage:

Contributor: Dr. Steven F. Josephs.

References: Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express
chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051,
1982.

Arya SK, Guo C, Josephs SF, Wong-Staal F. Trans-activator gene of human


T-lymphotropic virus type III (HTLV-III). Science 229:69-73, 1985.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Seikevitz M, Josephs, SF, Dukovich M, Peffer N, Wong-Staal F, Greene WC. Activation
of the HIV-1 LTR by T cell mitogens and the trans-activator protein of HTLV-I. Science
238:1575-1578, 1987.

Chang KS, Liu WT, Josephs SF. Regulation of cellular trans-activating activities in two
different promonocytic leukemia cell lines. Cancer Lett 60:75-83, 1991.

Seigel LJ, Ratner L, Josephs SF, Derse D, Feinberg M, Reyes G, O'Brien SJ,
Wong-Staal F. Transactivation induced by human T-lymphotropic virus type III (HTLV
III) maps to a viral sequence encoding 58 amino acids and lacks tissue specificity.
Virology 148:226-231.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pCD52) from Dr. Steven Josephs (cat# 1528)."

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pHIV-CAT)

Catalog Number: 2619

Lot Number: 01979

Release Category: A

Provided: 1 vial ampicillin-resistant transformed XL-1 Blue bacteria.

Description: Contains a 727 bp dIII-XhoI insert encoding the HIV-1 LTR with normal NF-κB
sequences linked to the CAT gene.

Plasmid Map

Special This clone serves as a positive control for pΔκB-HIV-CAT (Catalog #2618). Mutant κB
Characteristics: HIV VAT contours alterations in both κB sites (GGGACTTTCC->TCTACTTTCC).

Recommended -70°C
Storage:

Contributor: Dr. Gary Nabel and Dr. Neil Perkins.

References: Nabel G, Baltimore D. An inducible transcription factor activates expression of human


immunodeficiency virus in T cells. Nature 326:711-713, 1987.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pHIV-CAT) from Dr. Gary Nabel and Dr. Neil Perkins (cat# 2619)."
Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 1


DATA SHEET

Reagent: HIV-1 LTR CAT Reporter Vector (pU3R-III CAT)

Catalog Number: 330

Lot Number: 1947

Release Category: D

Provided: 1 ml (3.8 x 109 ampicillin-resistant transformed HB101 bacteria).

Description: An XhoI-HindIII fragment (approximately 720 base pairs) of HIV-1 cDNA clone C15
containing the U3 and R regions of the 3' LTR was cloned 5' to the CAT gene of pSV2CAT.

Cloning Vector: pSV2CAT (Gorman, C.M., et al. Mol. Cell. Biol. 2:1044, 1982).

Description of XhoI-HindIII fragment (~720 base pairs) of HIV-1 cDNA clone C15 containing the U3
Clone: and R regions of the 3' LTR was cloned 5' to the chloramphenicol acetyltransferase (CAT)
gene.

Cloning Site: XhoI-HindIII.

Special This plasmid will direct the expression of CAT under control of the HIV-1 LTR sequences
Characteristics: that are responsive to Tat.

Plasmid Map

Recommended -70°C.
Storage:

Contributor: Dr. Joseph Sodroski.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Rosen CA, Sodroski JG, Campbell K, Haseltine WA. Construction of recombinant murine
retroviruses that express the human T-cell leukemia virus type II and human T cell
lymphotropic virus type III trans-activator genes. J Virol 57:379-384, 1986. Sodroski J,
Rosen C, Wong-Staal F, Salahuddin SZ, Popovic M, Arya S, Gallo RC, Haseltine WA.
Trans-acting transcriptional regulation of human T-cell leukemia virus type III long
terminal repeat. Science 227:171-173, 1985.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR CAT
Reporter Vector (pU3R-III CAT) from Dr. Joseph Sodroski (cat# 330)." Also include the
references cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: CAT Reporter Vector (pIL2Rmut1)

Catalog 2135
Number:

Lot Number: 10/7/93

Release C
Category:

Provided: 1 ml transformed DH5a bacteria.

Description: A synthetic 26 bp oligonucleotide containing the a subunit of the IL-2 receptor (IL-2Ra)
NFκB binding site (region -268 through -243) with a 3 bp mutation was cloned into the
SalI site of plasmid Δ56.

Cloning Vector: Δ56, a minimal c-fos promoter/CAT reporter plasmid.

Special The synthetic κB oligonucleotide sequence is:


Characteristics: (-268)GCTCAATCTCCCTCTCCTTTTATGGG(-243). Nucleotides -267 through -269 were
altered to CTC, causing a loss in enhancer activity of the construct. Double digestion of
the plasmid with EcoRI and HindIII produces a 500 kb fragment containing the insert, a
2650 kb fragment, and a 2130 kb fragment. Digestion with HincII produces a 1750 kb
fragment containing the insert, and 2900, 370, and 240 kb fragments.

Recommended -70°C.
Storage:

Contributor: Dr. Michael J. Lenardo.

References: Pierce JW, Lenardo M, Baltimore D. Oligonucleotide that binds nuclear factor NF-κB acts as
a lymphoid-specific and inducible enhancer element. Proc Natl Acad Sci USA
85:1482-1486, 1988. Gilman MZ, Wilson RN, Weinberg RA. Multiple protein-binding sites
in the 5'-flanking region regulate c-fos expression. Mol Cell Biol 6:4305-4316, 1986.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: CAT Reporter
Vector (pIL2Rmut1) from Dr. Michael Lenardo (cat# 2135)." Also include the reference
cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact the NIH Office of Technology Transfer,
Email: NIAIDAIDSReagent@niaid.nih.gov, before the reagent can be released.
Please specify the name and a description of the intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: CAT Reporter Vector (pIL-2r)

Catalog 2134
Number:

Lot Number: 10/5/93

Release C
Category:

Provided: 1 ml transformed DH5α bacteria.

Description: A synthetic 26 bp oligonucleotide containing the alpha subunit of the IL-2 receptor (IL-2Ra)
NF-kB binding site (-268 through -243) was cloned into the SalI site of plasmid delta56.

Cloning Vector: Δ56, a minimal c-fos promoter/CAT reporter plasmid.

Cloning Site: SalI.

Special The synthetic κB oligonucleotide sequence is:


Characteristics: (-268)GGGGAATCTCCCTCTCCTTTTATGGG(-243). The κB enhancer drives increased CAT
expression in transfected S194 myeloma and 3T3 cells. This activity is further increased by
LPS stimulation of these B-cell lines. CAT expression in Jurkat T cells occurs after PMA
stimulation, but does not occur in the absence of mitogen induction. Double digestion of
the plasmid with EcoRI and HindIII produces a 500 kb fragment containing the insert, a
2650 kb fragment, and a 2130 kb fragment. Digestion with HincII produces a 1750 kb
fragment containing the insert, and 2900, 370, and 240 kb fragments.

Recommended -70°C
Storage:

Contributor: Dr. Michael J. Lenardo.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Pierce JW, Lenardo M, Baltimore D. Oligonucleotide that binds nuclear factor NF-κB acts as
a lymphoid-specific and inducible enhancer element. Proc Natl Acad Sci USA
85:1482-1486, 1988. Gilman MZ, Wilson RN, Weinberg RA. Multiple protein-binding sites
in the 5'-flanking region regulate c-fos expression. Mol Cell Biol 6:4305-4316, 1986.

NOTE: Acknowledgment for publications should read "The following reagent was obtained through
the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: CAT Reporter Vector
(pIL-2r) from Dr. Michael Lenardo (cat# 2134)." Also include the references cited above in
any publications.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact the NIH Office of Technology Transfer,
Email: NIAIDAIDSReagent@niaid.nih.gov, before the reagent can be released.
Please specify the name and a description of the intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: CAT Reporter Vector (pJ16)

Catalog Number: 2136

Lot Number: 10/29/93

Release Category: C

Provided: 1 vial transformed DH5α bacteria.

Description: Two synthetic 26 bp oligonucleotides (TCGACAGAGGGGACTTTCCGAGAGGC) containing


region 3937-3958 of the κ light chain enhancer NF-κB binding site (B orientation) were
cloned into the SalI site of D56, a truncated c-fos promoter/CAT reporter plasmid as a
direct repeat.

Cloning Vector: Δ56, a minimal c-fos promoter/CAT reporter plasmid.

Description of Contains two copies of the κ light chain enhancer NF-κB site (B orientation) cloned into
Clone: the SalI site of Δ56.

Special Double digestion of the plasmid with EcoRI and HindIII produces a 500 kb fragment
Characteristics: containing the insert, a 2650 kb fragment, and a 2130 kb fragment. Digestion with
HincII produces a 1750 kb fragment containing the insert, and 2900, 370, and 240 kb
fragments.
Bacterial Host: DH5α.

Recommended -70°C.
Storage:

Contributor: Dr. Jacqueline Pierce and Dr. Michael Lenardo.

References: Gilman MZ, Wilson RN, Weinberg RA. Multiple protein-binding sites in the 5'-flanking
region regulate c-fos expression. Mol Cell Biol 6:4305-4316, 1986.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: CAT Reporter
Vector (pJ16) from Dr. Jacqueline Pierce and Dr. Michael Lenardo (cat# 2136)." Also
include the reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact the NIH Office of Technology Transfer,
Email: NIAIDAIDSReagent@niaid.nih.gov, before the reagent can be released.
Please specify the name and a description of the intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: CAT Reporter Vector (pJ32)

Catalog Number: 2137

Lot Number: 10/29/93

Release Category: C

Provided: 1 vial transformed DHα bacteria.

Description: Two synthetic 26 bp oligonucleotides (TCGACAGAATTCACTTTCCGAGAGGC) containing a


mutated form of region 3937-3958 of the κ light chain enhancer NF-kB binding site (B
orientation) were cloned into the SalI site of D56, a truncated c-fos promoter/CAT
reporter plasmid.

Contains two mutated copies (3937-3958 GGGG-→ATTC) of the κ light chain enhancer NF--κB site
(B orientation) cloned into the SalI site of -κ56.

Cloning Vector: κ56, a minimal c-fos promoter/CAT reporter plasmid.

Cloning Site: SalI.

Special Double digestion of the plasmid with EcoRI and HindIII produces a 500 kb fragment
Characteristics: containing the insert, a 2650 kb fragment, and a 2130 -κb fragment. Digestion with
HincII produces a 1750 -κb fragment containing the insert, and 2900, 370, and 240 -κb
fragments. CAT activity is substantially reduced in comparison to pJ16 (Cat. #2136).
Bacterial Host: DH5-α.

Recommended -70°C.
Storage:

Contributor: Dr. Jacqueline Pierce and Dr. Michael Lenardo.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Pierce JW, Lenardo M, Baltimore D. Oligonucleotide that binds nuclear factor NF-κB acts
as a lymphoid-specific and inducible enhancer element. Proc Natl Acad Sci USA
85:1482-1486, 1988.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: CAT Reporter
Vector (pJ32) from Dr. Jacqueline Pierce and Dr. Michael Lenardo (cat# 2137)." Also
include the reference cited above in any publications.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact the NIH Office of Technology Transfer,
Email: NIAIDAIDSReagent@niaid.nih.gov, before the reagent can be released.
Please specify the name and a description of the intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> EGFP
DATA SHEET

Reagent: HIV-1 NL4-3 ΔEnv EGFP Reporter Vector

Catalog Number: 11100

Lot Number: 170352

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable Plus

Description: A HIV-1 NL4-3 ΔEnv EGFP reporter vector.

Cloning Vector: pNL4-3 (Cat# 114)

Ampicillin resistant

Cloning Site: KpnI/NheI cloning site

The size of the insert is 745 bp.

Special This construct is 14,664 bp including the insert.


Characteristics:
This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP
fusion protein. EGFP (enhanced green fluorescent protein) was amplified from the
pEGFP-N1 plasmid and include endonuclease sites, a KDEL ER-retention signal, and a
stop codon. The PCR product was inserted in frame into the pNL4-3 backbone in the env
gene, rendering Env non-functional.

This construct can be used for measuring viral replication in pseudotyped single-round
infection assays using GFP as the output reading. It can also be used to quantitatively
measure HIV-1 drug resistance by replacing the gag-pol region of the construct with a
desired sequence at the ApaI/AgeI site.

A restriction digest with ApaI and AgeI produces fragments of approximately 13200 bp
and 1500 bp.

Contributor provided plasmid map and sequence information

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Sequence file lot 170352

Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may
benefit from growth at 30°C.

Alternate names include: pNL4-3-deltaE-EGFP

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
Plus. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Drs. Haili Zhang, Yan Zhou, and Robert Siliciano

References: H. Zhang, Y. Zhou, C. Alcock, T. Kiefer, D. Monie, J. Siliciano, Q. Li, P. Pham, J.


Cofrancesco, D. Persaud and R. F. Siliciano. (2004). Novel single-cell-level phenotypic
assay for residual drug susceptibility and reduced replication capacity of drug-resistant
human immunodeficiency virus type 1. J Virol, 78(4), 1718-29. PUBMED

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 NL4-3
ΔEnv EGFP Reporter Vector from Drs. Haili Zhang, Yan Zhou, and Robert Siliciano (cat#
11100)." Also include the reference cited above in any publications.

Patent Pending.

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact Dr. Robert Siliciano, Email: rsiliciano@jhmi.edu, before
the reagent can be released. Please specify the name and a description of the
intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pLTR.D24-SEAP-IRES-EGFP

Catalog 11788
Number:

Lot Number: 130274

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: A set of mammalian reporter vectors of HIV-1 subtype C-LTR (pLTRD24-SEAP-IRES-EGFP,


pLTRSB253-SEAP-IRES-EGFP, pLTRA5/2000-SEAP-IRES-EGFP). The full-length HIV-1 LTR
up to the splice donor was amplified from genomic DNA isolated from three different
Indian clinical samples using the nested PCR approach. The restriction sites MluI and NheI
were engineered into the primers. The PCR amplified fragments were directionally cloned
upstream of two different reporter genes, secreted alkaline phosphatase which is directly
under the LTR control and enhanced green fluorescent protein under the control of an
internal ribosome entry site.

Cloning Vector: pcDNA3.1+ (Invitrogen)

Cloning Site: The full-length LTRs were cloned directionally between MluI and NheI sites.

Special Two independent reporter genes secreted alkaline phosphatase and green fluorescent
Characteristics: protein are simultaneously expressed from these vectors in Tat-responsive manner. The
LTRs have important differences in their transcription factor binding sites and will be
useful in viral transactivation studies, and in the screening of viral inhibitors. The
expression of both of the reporter genes could be monitored without terminating the assay.

GenBank Accession No. EF178613

Contributor provided plasmid map

Plasmid map and sequence file lot 130274

This reagent is currently being provided as dried purified DNA stabilized in DNAstable

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Udaykumar Ranga

References: Siddappa NB et al., AIDS Research and Human Retroviruses, 23(10), 1268-1278, 2007.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH:
pLTRD24-SEAP-IRES-EGFP from Dr. Udaykumar Ranga.”Also include the reference cited
above in any publications. Contact the contributor for more details.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact Dr. Udaykumar Ranga, Jawaharlal Nehru Centre for Advanced
Scientific Research, Jakkur Post, Bangalore, 560064, India. Tel: (080) 228-2831
Email: udaykumar@jncasr.ac.in, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pLTR.A5/2000-SEAP-IRES-EGFP

Catalog 11789
Number:

Lot Number: 130275

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: A set of mammalian reporter vectors of HIV-1 subtype C-LTR (pLTRD24-SEAP-IRES-EGFP,


pLTRSB253-SEAP-IRES-EGFP, pLTRA5/2000-SEAP-IRES-EGFP). The full-length HIV-1 LTR
up to the splice donor was amplified from genomic DNA isolated from three different
Indian clinical samples using the nested PCR approach. The restriction sites MluI and NheI
were engineered into the primers. The PCR amplified fragments were directionally cloned
upstream of two different reporter genes, secreted alkaline phosphatase which is directly
under the LTR control and enhanced green fluorescent protein under the control of an
internal ribosome entry site.

Cloning Vector: pcDNA3.1+ (Invitrogen)

Cloning Site: The full-length LTRs were cloned directionally between MluI and NheI sites.

Special Two independent reporter genes secreted alkaline phosphatase and green fluorescent
Characteristics: protein are simultaneously expressed from these vectors in Tat-responsive manner. The
LTRs have important differences in their transcription factor binding sites and will be
useful in viral transactivation studies, and in the screening of viral inhibitors. The
expression of both of the reporter genes could be monitored without terminating the assay.

GenBank Accession No. AY567474

Contributor provided plasmid map

Plasmid map and sequence file lot 130275

This reagent is currently being provided as dried purified DNA stabilized in DNAstable

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Udaykumar Ranga

References: Siddappa NB et al., AIDS Research and Human Retroviruses, 23(10), 1268-1278, 2007.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH:
pLTR.A5/2000-SEAP-IRES-EGFP from Dr. Udaykumar Ranga.”Also include the reference
cited above in any publications. Contact the contributor for more details.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact Dr. Udaykumar Ranga, Jawaharlal Nehru Centre for Advanced
Scientific Research, Jakkur Post, Bangalore, 560064, India. Tel: (080) 228-2831
Email:udaykumar@jncasr.ac.in, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pLTR.SB253-SEAP-IRES-EGFP

Catalog 11790
Number:

Lot Number: 130276

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: A set of mammalian reporter vectors of HIV-1 subtype C-LTR (pLTRD24-SEAP-IRES-EGFP,


pLTRSB253-SEAP-IRES-EGFP, pLTRA5/2000-SEAP-IRES-EGFP). The full-length HIV-1 LTR
up to the splice donor was amplified from genomic DNA isolated from three different
Indian clinical samples using the nested PCR approach. The restriction sites MluI and NheI
were engineered into the primers. The PCR amplified fragments were directionally cloned
upstream of two different reporter genes, secreted alkaline phosphatase which is directly
under the LTR control and enhanced green fluorescent protein under the control of an
internal ribosome entry site.

Cloning Vector: pcDNA3.1+ (Invitrogen)

Cloning Site: The full-length LTRs were cloned directionally between MluI and NheI sites.

Special Two independent reporter genes secreted alkaline phosphatase and green fluorescent
Characteristics: protein are simultaneously expressed from these vectors in Tat-responsive manner. The
LTRs have important differences in their transcription factor binding sites and will be
useful in viral transactivation studies, and in the screening of viral inhibitors. The
expression of both of the reporter genes could be monitored without terminating the assay.

GenBank Accession No. EF178612

Contributor provided plasmid map

Plasmid map and sequence file lot 130276

This reagent is currently being provided as dried purified DNA stabilized in DNAstable

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Udaykumar Ranga

References: Siddappa NB et al., AIDS Research and Human Retroviruses, 23(10), 1268-1278, 2007.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH:
pLTR.SB253-SEAP-IRES-EGFP from Dr. Udaykumar Ranga.”Also include the reference
cited above in any publications. Contact the contributor for more details.

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact Dr. Udaykumar Ranga, Jawaharlal Nehru Centre for Advanced
Scientific Research, Jakkur Post, Bangalore, 560064, India. Tel: (080) 228-2831
Email: udaykumar@jncasr.ac.in, before the reagent can be released.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: DuoFluo (R7GEmC)

Catalog Number: 12595

Lot Number: 140325

Release Category: D

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: This HIV-1 construct contains two distinct fluorescent proteins under control of
independent promotors. EGFP has been inserted in place of nef and is expressed through
LTR activation. An EF1a-mCherry transcriptional unit was inserted between EGFP and
the 3'LTR.

This construct can be used to study latent infection. The env is non-functional and nef
as been replaced with EGFP, so the construct can be used to produce single-cycle
infectious pseudotyped virions when combined with a suitable envelope expression
vector.

Cloning Vector: R7/3/GFP

Special This construct is 18165 bp including the insert.


Characteristics:
The construct was generated by using the R7/3/GFP plasmid and cat# 3418,
pNL4-3.Luc.R-.E-. Please see the reference for more details.

Donor Sequence file

Sequence file lot 140325

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Drs. Vincenzo Calvanez and Eric Verdin

References: Calvanese V, Chavez L, Laurent T, Ding S, Verdin E. Dual-color HIV reporters trace a
population of latently infected cells and enable their purification. Virology. 2013
Nov;446(1-2):283-92. ABSTRACT

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: Cat# 12595
DuoFluo (R7GEmC) from Drs. Vincenzo Calvanez and Eric Verdin."

Scientists at for-profit institutions or who intend commercial use of this


reagent must contact the J. David Gladstone Institutes, Email:
veronica.viray@gladstone.ucsf.edu, before the reagent can be released. Please
specify the name and a description of the intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> GFP
DATA SHEET

Reagent: pNL-GFP-RRE(SA)

Catalog 11466
Number:

Lot Number: 140245

Release C
Category:

Provided: 5 μg of purified DNA stabilized in DNAstable PLUS and dried

Description: pNL-GFP-RRE-(SA) is designed to express GFP in cells that express Rev and Tat. Thus, if
introduced into target cells through pseudotyping, it can detect HIV infected cells.

Cloning Vector: PUC18; The size of the insert is 7307bp. Size of vector and insert is 9669bp.

Special pNL-GFP-RRE was first constructed by complete deletion of all HIV ORFs of pNL4-3 by
Characteristics: replacing the 8.1 kb BssHII-BlpI fragment of the HIV-1 genomes with an insert containing
the GFP ORF and the HIV-1 RRE including the first 336 nucleotides of the gag ORF (the
gag reading frame was disrupted by a frame shift mutation at the ClaI site by blunt end
ligation). pNL-GFP-RRE-(SA) was constructed by insertion of a PCR fragment into the
NotI-SmaI site of pNL-GFP-RRE, in front of the GFP ORF. The insert carries the HIV-1 A5
splicing acceptor and D4 donor. GFP is expressed from the HIV-1 LTR promoter in HIV
infected cells when Tat and Rev are present.

GenBank EF408805

Plasmid map and sequence file lot 140245

Contributor provided sequence information

This reagent is currently being provided as purified DNA stabilized in DNAstable PLUS and
dried. Please see the notice for additional information and the protocol for reconstitution of
dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Yuntao Wu and Dr. Jon W. Marsh

References: Wu, Y. , Beddall, M.H. and Marsh, J.W. Rev-dependent lentiviral expression vector.
Retrovirology 4: 12 (2007). Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained through
the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pNL-GFP-RRE(SA)(Cat#
11466) from Dr. Jon Marsh and Dr. Yuntao Wu." Also include the reference cited above in
any publications.

Scientists at for-profit institutions or who intend commercial use of Release


Category C reagent (Cat# 11446) must contact NIH Office of Technology
Transfer, Email: NIAIDAIDSReagent@niaid.nih.gov. Please cite reference number
E-276-2003.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pR7-GFP

Catalog Number: 3622

Lot Number: 150188

Release D
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: pR7-GFP expresses a modified green fluorescent protein (GFP), with the GFP coding
sequences substituted for HIV-1 Nef coding sequences.

Cloning Vector: SP65 modified to include an SV-gpt gene within the vector and an SV40 origin of
replication for amplification in T antigen-containing cells. Vector has an
ampicillin-resistance gene.

Special Alanine was substituted for serine at aa 65 in the modified jellyfish (Aequorea victoria)
Characteristics: GFP, resulting in markedly increased fluorescence as compared to wild type GFP. This
modification is similar to the traditional S65T modification used for EGFP.

Since there is a gpt gene in the plasmid but not in the provirus, infected cells cannot be
selected with any drug. Transfected cells can be selected with mycophenolic
acid/hypoxanthine/xanthine. The amount to use depends on the cell type. Selection
would ensure isolation of cells that have integrated the part of the construct that includes
the SV-gpt gene (in the vector), but does not ensure that an intact provirus is integrated.
One can easily screen selected clones for those that secrete virus by doing p24 assays on
the culture supernatant.

Propagate in STBL2 grown at 30°C. May also be grown in HB101.

Contributor provided sequence information

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Drs. Kathleen Page, Teri Liegler, and Mark Feinberg.

References: Page KA, Liegler T, and Feinberg MA. Use of a green fluorescent protein as a marker for
human immunodeficiency virus type I infection. AIDS Res Hum Retroviruses
13:1077-1081, 1997.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pR7-GFP from
Drs. Kathleen Page, Teri Liegler, and Mark Feinberg". Also include the reference cited
above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> HSA
DATA SHEET

Reagent: pNL-r-HSAS

Catalog Number: 4101

Lot Number: 040927

Release E
Category:

Provided: 2.45 μg of dried purified DNA stabilized in DNAstable PLUS

Description: pNL-r-HSAS is a HIV-1-based reporter virus that is both replication-competent and


pathogenic in vivo. Virus produced from pNL-r-HSAS infects cells expressing both CD4
and CXCR4. Infected cells express surface HSA which is detectable by flow cytometry.

Cloning Vector: pNL4-3

Special A 267 bp fragment from the ORF of HSA was inserted into an introduced XbaI site (nt
Characteristics: 5625) and an existing EcoRI site (nt 5743) of pNL4-3. This site is within the NL4-3 vpr
gene, which was paritally deleted during the digests. In addition, the start of vpr and two
potential start sites in the 3' end of vif are silenced by site-specific mutagenesis. The
insert was cloned in the 5'-3' orientation. The murine HSA insert was derived from the
plasmid pSL87c4-1. The insert contains the HSA ORF and 36 extraneous bases from the
original plasmid. HSA expression is driven by the HIV-1 LTR.

Plasmid map and sequence file lot 040927

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Drs. Beth Jamieson and Jerome Zack.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Jamieson BD, Zack JA. In vivo pathogenesis of a human immunodeficiency virus type 1
reporter virus. J Virol 72:6520-6526, 1998.

Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Martin MA. Production of
acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells
transfected with an infectious molecular clone. J Virol 59:284-291, 1986.

Kay R, Takei F, Humphries RK. Expression cloning of a cDNA encoding MI/J11D


heat-stable antigens. J Immunol 145:1952-1959, 1990.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pNL-r-HSAS from
Drs. Beth Jamieson and Jerome Zack." Also include the references cited above in any
publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> VPR and ENV Mutants
DATA SHEET

Reagent: HIV-1 pNL4-3.HSA.R- E-

Catalog 3417
Number:

Lot Number: 150362

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable Plus

Description: Two frameshifts render this NL4-3 clone Env- and Vpr-. When cotransfected with an Env
expression vector it will produce infectious virus that is competent for a single round of
infection.

Cloning Vector: pUC-19. Amp resistant.

Special The murine heat stable antigen CD24 (HSA) gene was inserted into the pNL4-3 nef gene
Characteristics: to produce this clone. Virus can be produced by transfecting 2 X 10 6 293 or 293T cells
with 10 μg NL4-3 DNA and 10 μg env expression vector DNA. Transfections can be
performed in a 10 cm 2 tissue culture dish using standard calcium phosphate protocols.
Virus is typically harvested 48 hours post-transfection. Infections should be performed in
a total volume of 0.5 ml. The amphotropic pseudotypes generally have much higher
infectivity than those bearing HIV-1 env. Cultures infected with HSA viruses can be
assayed by FACS analysis with a commercial CD24 antibody (Pharmingen) 2-5 days
post-infection.

Contributor provided sequence information

This reagent is currently being provided as dried purified DNA stabilized in DNAstable Plus.
Please see the notice for additional information and the protocol for reconstitution of dried
DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Nathaniel Landau.

References: He J, Choe S, Walker R, Di Marzio P, Morgan DO, Landau NR. Human immunodeficiency
virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting
p34cdc2 activity. J Virol 69:6705-6711, 1995. Connor RI, Chen BK, Choe S, Landau NR.
Vpr is required for efficient replication of human immunodeficiency virus type-1 in
mononuclear phagocytes. Virology 206:935-944, 1995.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1
pNL4-3.HSA.R - .E- from Dr. Nathaniel Landau." Also include the references cited above in
any publications. Patent pending.

Requests from commercial organizations must be directed to the New York


University Office of Industrial Liaison at the following email address:
sadhana.chitale@nyumc.org.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: pNL4-3.HSA.R +

Catalog 3419
 
Number:

Lot Number:   150187

Release C
 
Category:

Provided:   5 μg of dried purified DNA stabilized in DNAstable PLUS

Description:   Encodes replication competent NL4-3 proviral DNA.

Cloning Vector: pNL4-3 (cat# 114) 


 
Ampicillin resistant

Cloning Site: NotI/XhoI cloning site 


 
The size of the insert is 236 bp.

Special This construct is 14,971 bp including the insert. 
Characteristics:
Murine heat stable antigen CD24 (HSA) gene was inserted into the pNL4-3 (cat# 114) nef
gene to produce this clone. Virus can be produced by transfecting 2 X 10 6 293 or 293T
cells with 20 μg NL4-3 DNA. Transfections can be performed in a 10 cm2 tissue culture
dish using standard calcium phosphate protocols. Virus is typically harvested 48 hours
post-transfection. Infections should be performed in a total volume of 0.5 ml. The
amphotropic pseudotypes generally have much higher infectivity than those bearing HIV-1
env. Cultures infected with HSA viruses can be assayed by FACS analysis with a
commercial CD24 antibody (Pharmingen) 2-5 days post-infection. 
 
GenBank Accession Number: pNL4-3: M19921 

Contributor provided plasmid map information 

Plasmid map and sequence file lot 150187  

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 1 of 2
This reagent is currently being provided as dried purified DNA stabilized in DNAstable 
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
 
Storage: bag.

Contributor:   Dr. Nathaniel Landau, Aaron Diamond AIDS Research Center, The Rockefeller University.

References: He J, Choe S, Walker R, Di Marzio P, Morgan DO, Landau NR. Human immunodeficiency
virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting
p34cdc2 activity. J Virol  69:6705-6711, 1995. 
 
Connor RI, Chen BK, Choe S, Landau NR. Vpr is required for efficient replication of human
immunodeficiency virus type-1 in mononuclear phagocytes. Virology  206:935-944, 1995.

NOTE: Acknowledgment for publications should read “The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pNL4-3.HSA.R+
(cat# 3419) from Dr. Nathaniel Landau.” Also include the references cited above in any
publications.
 
Patent pending. Requests from commercial organizations must be directed to the
New York University Office of Industrial Liaison at the following email address:
sadhana.chitale@nyumc.org. 

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 2 of 2
DATA SHEET

Reagent: pNL4-3.HSA.R -

Catalog 3421
 
Number:

Lot Number:   110077

Release C
 
Category:

Provided:   5 μg of dried purified DNA stabilized in DNAstable PLUS

Description:   Replication competent proviral DNA. Vpr- due to a frameshift at Vpr aa 26.

Cloning Vector: pUC-19 


 
Ampicillin resistant

Special This construct is 14,975 bp including the insert. 
Characteristics:
Murine heat stable antigen CD24 (HSA) gene was inserted into the pNL4-3 nef gene to
produce this clone. Virus can be produced by transfecting 2 X 10 6 293 or 293T cells with
20 μg NL4-3 DNA. Transfections can be performed in a 10 cm2 tissue culture dish using
standard calcium phosphate protocols. Virus is typically harvested 48 hours
post-transfection. Infections should be performed in a total volume of 0.5 ml. The
amphotropic pseudotypes generally have much higher infectivity than those bearing HIV-1
env. Cultures infected with HSA viruses can be assayed by FACS analysis with a
 
commercial CD24 antibody (Pharmingen) 2-5 days post-infection. 

Contributor provided plasmid map 

Plasmid map and sequence file lot 110077  

This reagent is currently being provided as dried purified DNA stabilized in DNAstable 
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 1 of 2
Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
 
Storage: bag.

Contributor:   Dr. Nathaniel Landau, Aaron Diamond AIDS Research Center, The Rockefeller University.

References: He J, Choe S, Walker R, Di Marzio P, Morgan DO, Landau NR. Human immunodeficiency
virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting
p34cdc2 activity. J Virol  69:6705-6711, 1995.
 
Connor RI, Chen BK, Choe S, Landau NR. Vpr is required for efficient replication of human
immunodeficiency virus type-1 in mononuclear phagocytes. Virology  206:935-944, 1995.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pNL4-3.HSA.R-
from Dr. Nathaniel Landau." Also include the references cited above in any publications. 
 
Patent pending. Requests from commercial organizations must be directed to the
New York University Office of Industrial Liaison at the following email address:
sadhana.chitale@nyumc.org.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS. 

REV: 10/20/2019  Page 2 of 2
DATA SHEET

Reagent: HIV-1 pNL4-3.HSA.R+ E-

Catalog Number: 3420

Lot Number: 110146

Release Category: C

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: Env- due to a 5′ frameshift. Murine heat stable antigen CD24 (HSA) gene was inserted
into the pNL4-3 nef gene.

Cloning Vector: pUC-19

Ampicillin resistant

Special This construct is 14,973 bp including the insert.


Characteristics:
Competent for a single round of replication. Requires cotransfection with env
expression vector to produce infectious virus.

Contributor provided protocol and sequence information

Plasmid map and sequence file lot 110146

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture
Storage: barrier bag.

Contributor: Dr. Nathaniel Landau, Aaron Diamond AIDS Research Center, The Rockefeller
University.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: He J, Choe S, Walker R, Di Marzio P, Morgan DO, Landau NR. Human
immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the
cell cycle by inhibiting p34cdc2 activity. J Virol 69: 6705–6711, 1995.Abstract

Connor RI, Chen BK, Choe S, Landau NR. Vpr is required for efficient replication of
human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:
935–944, 1995.Abstract

NOTE: Acknowledgment for publications should read “The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH:
pNL4-3.HSA.R+E-from Dr. Nathaniel Landau.” Also include the references cited above
in any publications.

Patent pending. Requests from commercial organizations must be directed to


the New York University Office of Industrial Liaison at the following email
address: sadhana.chitale@nyumc.org.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-)

Catalog Number: 3418

Lot Number: 160163

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: A HIV-1 NL4-3 luciferase reporter vector that contains defective Nef, Env and Vpr.

Cloning Vector: pUC18

Ampicillin resistant

Special This construct is 16,396 bp including the insert.


Characteristics:
In this reporter vector, a firefly luciferase gene was inserted into the pNL4-3 nef gene
while frameshifts in env and vpr render this clone Env and Vpr deficient.

To generate this plasmid, a frameshift near the 5'-end of env was introduced by using T4
DNA polymerase to fill in the NdeI site (nt 5950) of pNL4-3. This renders the clone Env
deficient. A firefly luciferase gene was then inserted into the nef gene by removing the
BamHI (nt 8021) to XhoI (nt 8443) fragment of pHXB-Luc (Chen et al. 1994) and
ligating it to the same sites in env deficient pNL4-3. A frameshift was introduced in vpr
by filling in the AflII site (nt 5180) corresponding to amino acid 26.

This construct is competent for a single round of replication and requires co-transfection
with an Env expression vector to produce infectious virus.

Contributor provided protocol and sequence information

Plasmid map and sequence file lot 160163

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for reconstitution
of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may
benefit from growth at 30°C. This construct may also be grown in other competent cells.

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Nathaniel Landau

References: Connor, R. I., Chen, B. K., Choe, S., & Landau, N. R. (1995). Vpr is required for efficient
replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology,
206(2), 935-944. doi: 10.1006/viro.1995.1016 PUBMED

He, J., Choe, S., Walker, R., Di Marzio, P., Morgan, D. O., & Landau, N. R. (1995).
Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase
of the cell cycle by inhibiting p34cdc2 activity. J Virol, 69(11), 6705-6711. PUBMED

Chen, B. K., Saksela, K., Andino, R., & Baltimore, D. (1994). Distinct modes of human
immunodeficiency virus type 1 proviral latency revealed by superinfection of
nonproductively infected cell lines with recombinant luciferase-encoding viruses. J Virol,
68(2), 654-660. PUBMED

NOTE: Acknowledgment for publications should read “The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 pNL4-3
ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-) from Dr. Nathaniel Landau.” Also
include the references cited above in any publications.

Patent pending. Requests from commercial organizations must be directed to


the New York University Office of Industrial Liaison at the following email
address: sadhana.chitale@nyumc.org.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> LACZ
DATA SHEET

Reagent: HIV-1 LTR lacZ Reporter Vector (pHIVlacZ)

Catalog Number: 151

Lot Number: 060489

Release Category: A

Provided: 1 ml (1.6 x 109 ampicillin-resistant transformed bacteria).

Description: Plasmid Map

Cloning Vector: pU3RIII-CAT (catalog #330).

Description of The plasmid contains all of the U3 region and approximately 75 bp of the R region,
Clone: including the TAR region the HIV-1 3' LTR driving the E. coli lacZ gene.

Cloning Site: HindIII-BamHI

Special Standard β-galactosidase assays show quite high levels of expression in human
Characteristics: embryonic teratocarcinoma cells or activated monocyte-macrophage lines. Contains no
BamHI site. Digestion of this plasmid with KpnI can produce unusual cleavage patterns
(star activity) if buffer conditions are not correct, enzyme concentration is too high, or
the digest is done on a miniprep. When performing a mini-prep, use Asp718
(Boehringer-Mannheim Biochemicals) instead of KpnI.
Bacterial Host: HB101
Cloning Strategy: 3.2 kb lacZ gene from pCH110 was removed by digestion with
HindIII-BamHI and inserted in place of the pUR3III-CAT CAT gene.

Recommended -70°C.
Storage:

Contributor: Dr. Joseph J. Maio.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


References: Maio JJ, Brown FL. Regulation of expression driven by human immunodeficiency virus
type 1 and human T-cell leukemia virus type I long terminal repeats in pluripotential
human embryonic cells. J Virol 62:1398-1407, 1988.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LTR lacZ
Reporter Vector (pHIVlacZ) from Dr. Joseph Maio (cat# 151)." Also include the reference
cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> Luciferase
DATA SHEET

Reagent: HIV-1 93UG66 LTR Luciferase Reporter Vector

Catalog Number: 4787

Lot Number: 150274

Release Category: B

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: This construct bears the 3' LTR region from an HIV-1 subtype A patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5721 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: A patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TATA box, and the TAR TNA hairpin motif.

Sequence file lot 150274

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-A

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


reconstitution of dried DNA reagents. Dried DNA Notice

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000. Abstract

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994. Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 93UG66
LTR Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat#
4787)." Also include the references cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 93ZM74 LTR Luciferase Reporter Vector

Catalog Number: 4789

Lot Number: 011631

Release Category: B

Provided: 1 vial of transformed DH5a bacteria in LB broth containing 20% glycerol.

Description: This construct bears the 3' LTR region from an HIV-1 subtype C patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5720 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: C patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TATA box, and the TAR TNA hairpin motif.

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-C

Recommended -70ºC.
Storage:

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000.

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 93ZM74
LTR Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat#
4789)." Also include the references cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 94ZR80 LTR Luciferase Reporter Vector

Catalog Number: 4790

Lot Number: 011632

Release Category: B

Provided: 1 vial of transformed DH5α bacteria in LB broth containing 20% glycerol.

Description: This construct bears the 3' LTR region from an HIV-1 subtype D patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5720 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: D patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TATA box, and the TAR TNA hairpin motif.

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-D

Recommended -70°C
Storage:

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000. Abstract

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994. Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 94ZR80
LTR Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat#
4790)." Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 97TH87 LTR Luciferase Reporter Vector

Catalog Number: 4791

Lot Number: 011633

Release Category: B

Provided: 1 vial of transformed DH5α in LB broth containing 20% glycerol.

Description: This construct bears the 3' LTR region from an HIV-1 subtype E patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5720 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: E patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TAAA box, and the TAR TNA hairpin motif.

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-E

Recommended -70°C
Storage:

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000. Abstract

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994. Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 97TH87
LTR Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat#
4791)." Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 94BR77 LTR Luciferase Reporter Vector

Catalog Number: 4792

Lot Number: 011634

Release Category: B

Provided: 1 vial of transformed DH5α bacteria in LB broth containing 20% glycerol.

Description: This construct bears the 3' LTR region from an HIV-1 subtype F patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5720 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: F patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TATA box, and the TAR TNA hairpin motif.

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-F

Recommended -70°C
Storage:

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000. Abstract

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994. Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 94BR77
LTR Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat#
4792)." Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 CB76 LTR Luciferase Reporter Vector

Catalog Number: 4793

Lot Number: 011635

Release Category: B

Provided: 1 vial of transformed DH5α bacteria in LB broth containing 20% glycerol.

Description: This construct bears the 3' LTR region from an HIV-1 subtype G patient isolate
upstream of the luciferase gene. The LTR was shown to be functional using the subtype
B LAI tat protein.

Cloning Vector: pBluescript KS(+). Ampicillin resistant. The construct size is 5720 bp.

Special The LTR region (nt -147 to +63 relative to the transcription start site) from a subtype
Characteristics: G patient isolate was PCR-amplified and exchanged into pBlue3'LTR-luc-B (Catalog
#4788) in place of the LAI LTR. It contains two NF-kB enhancers, three Sp1 binding
sites, the TATA box, and the TAR TNA hairpin motif.

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-G

Recommended -70°C
Storage:

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000. Abstract

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994. Abstract

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 CB76 LTR
Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat# 4793)."
Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 YU2 NanoLuc Reporter Vector (prRosa26 CMV-IE NLuc Env)

Catalog Number: 13119

Lot Number: 170215

Release C
Category:

Provided: 5 μg of dried purified DNA stabilized in DNAstable Plus

Description: A HIV-1 YU2 subtype B CMV-IE Nanoluciferase reporter vector

Cloning Vector: pRRosa26v2

Ampicillin resistant

Cloning Site: Unknown

Special This construct is 11529 bp including the insert.


Characteristics:
This construct contains a rat Rosa26 targeted HIV-1 YU2 provirus driven by the CMV-IE
promoter. The Gag-Pol region in the provirus has been replaced with Nanoluciferase,
rendering this clone replication-defective. The coding regions for Vif, Vpr, Vpu, Env, Rev,
Tat, and Nef are present.

The final 1500 nucleotides of gag and the leading 2306 nucleotides of the pol region of
YU2 were replaced with a loxP site and the coding region for Nanoluciferase. The entire
proviral sequence was then transferred into a backbone containing sequences
homologous to 1021 nucleotides upstream and 998 nucleotides downstream of the
Rosa26-targeted CRISPR-induced breakpoint. The provirus was then modified further by
replacing the LTR with the CMV-IE promoter via ligation independent cloning.

Contributor provided plasmid map and sequence information

Sequence file lot 170215

Plasmids can be propagated in STBL2 cells and grown at 37°C. Larger plasmids may

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


benefit from growth at 30°C. This construct may also be grown in other competent cells.

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
Plus. Please see the notice for additional information and the protocol for reconstitution of
dried DNA reagents. Dried DNA Notice

Alternate names include: pOTTC1166 - pZDrRosa26v2 - CMV-IE NLuc HIV

Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Brandon Harvey

References: L. A. Campbell, C. T. Richie, Y. Zhang, E. J. Heathward, L. M. Coke, E. Y. Park and B. K.


Harvey. (2017). In vitro modeling of HIV proviral activity in microglia. FEBS J.
doi:10.1111/febs.14293 PUBMED

NOTE: Acknowledgement for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 YU2
NanoLuc Reporter Vector (prRosa26 CMV-IE NLuc Env) from Dr. Brandon Harvey (cat#
13119)."

Scientists at for-profit institutions or who intend commercial use of this reagent


must contact the Tech Transfer office, Email: mleff@intra.nida.nih.gov, before
the reagent can be released. Please specify the name and a description of the
intended use of the reagent.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 LAI LTR Luciferase Reporter Vector

Catalog Number: 4788

Lot Number: 140231

Release Category: B

Provided: 5 μg of dried purified DNA stabilized in DNAstable PLUS

Description: This construct bears the LAI 3' LTR upstream of the luciferase gene. The LTR was shown
to be functional using the subtype B LAI tat protein.

Cloning Vector: pBluescript KS(+)

Special Contains a 1426 bp BglI-XhoI fragment from pBluescript KS(+) with the ColE1 origin, a
Characteristics: 719 bp XhoI-HindIII LAI 3' LTR fragment, a 1951 bp HindIII-BamHI pGL3 luciferase
gene, and a 1625 bp BamHI-BglI fragment derived from pSV2CAT, which encompasses
an SV40 polyA site and a pBluescript KS(+) fragment. The construct size is 5720 bp.

Plasmid Map and sequence file lot 140231

The accession numbers for these related reagents are:


Cat# 4787-AF127566 (subtype A)
Cat# 4788-K02013.1 (subtype B)
Cat# 4789-AF127567 (subtype C)
Not offered -AF127568 (subtype C)
Cat# 4790-AF127569 (subtype D)
Cat# 4791-AF127570 (subtype E)
Cat# 4792-AF127571 (subtype F)
Cat# 4793-AF127572 (subtype G)

Alternate names include: pBlue3'LTR-luc-B

This reagent is currently being provided as dried purified DNA stabilized in DNAstable
PLUS. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Reink Jeeninga and Dr. Ben Berkhout.

References: Jeeninga RE, Hoogenkamp M, Armand-Ugon M, Baar MD, Verhoef K, Berkhout B.


Functional differences between the long terminal repeat transcriptional promoters of
human immunodeficiency virus type 1 subtypes A through G. J Virol 74:3740-3751,
2000.

Klave B, Berkhout B. Comparison of the 5' and 3' LTR promoter function in the human
immunodeficiency virus. J Virol 68:3830-3840, 1994.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 LAI LTR
Luciferase Reporter Vector from Dr. Reink Jeeninga and Dr. Ben Berkhout (cat# 4788)."
Also include the references cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


Reporter Constructs >> ALPP
DATA SHEET

Reagent: HIV-1 HXB2 ALPP Reporter Vector (pHXBnPLAP-IRES-N-)

Catalog Number: 3611

Lot Number: 98090

Release C
Category:

Provided: 1 ml ampicillin-resistant, transformed HB101 glycerol stock. Propagate in HB101 or


MC1061.

Description: Infectious molecular clone of HIV-1HXB2. The human placental alkaline phosphatase
(PLAP) gene has been inserted into the nef open reading frame. The nef open reading
frame has been disrupted by the introduction of a frame shift mutation at a unique XhoI
site in the nef coding region.

Special Produces high titer infectious HIV-1 when transfected into 293T cells. Virus carries the
Characteristics: PLAP reporter gene into target cells. Quantitative analysis of infection on a single cell level
can be done by histochemical staining for phosphatase activity or by flow cytometry with
anti-PLAP antibodies. Serves as a nef-deficient control for pHXBnPLAP-IRES-N+ (Catalog
#3610). When both clones are used in parallel experiments, the effects of Nef on
expression of cell surface molecules such as CD4 may be directly examined during acute
infection.

Recommended -70°C.
Storage:

Contributor: Dr. Benjamin K. Chen and Dr. David Baltimore.

References: Chen BK, Gandhi R, Baltimore D. CD4 down-modulation during infection of human T cells
with human immunodeficiency virus type 1 involves independent activities of vpu, env,
and nef. J Virol 70:6044-6053, 1996.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 HXB2 ALPP
Reporter Vector (pHXBnPLAP-IRES-N-) from Dr. Benjamin K. Chen and Dr. David
Baltimore (cat# 3611)." Also include the reference cited above in any publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2


DATA SHEET

Reagent: HIV-1 HXB2 ALPP Reporter Vector (pHXBnPLAP-IRES-N+U+)

Catalog Number: 12750

Lot Number: 150202

Release Category: C

Provided: 5 μg of purified DNA stabilized in DNAstable PLUS and dried

Description: Infectious molecular clone of HIV-1 HXB2 with the human placental alkaline
phosphatase (PLAP) gene inserted into the nef open reading frame. This plasmid
expresses functional HXB2 nef and vpu.

Special This construct is 18574 bp including the insert.


Characteristics:
Produces high titer infectious HIV-1 when transfected into 293T cells. Virus carries the
PLAP reporter gene into target cells. Quantitative analysis of infection on a single cell
level can be done by histochemical staining for phosphatase activity or by flow
cytometry with anti-PLAP antibodies.

Expression of a functional HXB2 nef allele has been restored by insertion of an internal
ribosomal entry site from the encephalomyocarditis (ECMV) and repairing the nef open
reading frame.

Expression of a functional HXB2 vpu allele has been restored by repairing a premature
stop codon present in the HXB2 parent clone used to construct Cat# 3610
pHXBnPLAP-IRES-N+U-.

Donor Plasmid Map

Sequence file lot 150202

This reagent is currently being provided as purified DNA stabilized in DNAstable PLUS
and dried. Please see the notice for additional information and the protocol for
reconstitution of dried DNA reagents. Dried DNA Notice

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 1 of 2


Recommended Keep the reagent at room temperature in a dry storage cabinet or in a moisture barrier
Storage: bag.

Contributor: Dr. Benjamin K. Chen and Dr. David Baltimore.

References: Chen BK, Gandhi R, Baltimore D. CD4 down-modulation during infection of human T
cells with human immunodeficiency virus type 1 involves independent activities of vpu,
env, and nef. J Virol 70:6044–6053, 1996.

NOTE: Acknowledgment for publications should read "The following reagent was obtained
through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 HXB2
ALPP Reporter Vector (pHXBnPLAP-IRES-N+U+) from Dr. Benjamin K. Chen and Dr.
David Baltimore (cat# 12750)." Also include the reference cited above in any
publications.

ALL RECIPIENTS OF THIS MATERIAL MUST COMPLY WITH ALL APPLICABLE BIOLOGICAL, CHEMICAL,
AND/OR RADIOCHEMICAL SAFETY STANDARDS INCLUDING SPECIAL PRACTICES, EQUIPMENT,
FACILITIES, AND REGULATIONS. NOT FOR USE IN HUMANS.

REV: 10/20/2019 Page 2 of 2