ID#:_________________________
BIOL 0470 GENETICS
Final Exam
December 20, 2014
Question
1) (40 pts) ________________
2) (40 pts) ________________
3) (40 pts) ________________
4) (40 pts) ________________
5) (40 pts) ________________
TOTAL (200) ____________________
Adjusted Score ___________________
This is the final exam for BIOL 0470
Genetics.
Please put your ID# on each page of
this exam.
By turning in this exam you indicate
your adherence to the Brown code
of ethics, agree that all work is your
own, and vouch that you have not
knowingly aided another student.
The exam consists of 5 questions for
a total of 200 points. You may use
the front and back of each page.
Make sure your answers, as
opposed to your scratch work, are
clearly labeled. If important
material is on the back of a page,
please note this on the front of the
relevant page. For problems
involving numerical calculations you
will help yourself and your TAs by
showing the numbers you use in
your calculation as well as the final
answer.
If you have questions about the test
items, please ask one of the
instructors. Do not consult with
other test takers.
Good Luck!
1
ID#:_________________________

Question 1 (40 pts) Mutagenesis and reversion: the Ames test

Ten-fold serial dilutions of a saturated Salmonella culture were prepared using sterile water.
The number of colonies resulting from each 5µl “spot” of diluted culture is shown below.

# of colonies on plate
Dilution
containing histidine
10-1 Too many to count
10-2 Too many to count
10-3 Too many to count
10-4 Too many to count
10-5 22
10-6 3
10-7 0
10-8 0

(A, 6 Points) Using these results, calculate the concentration of live cells (CFUs) in the original
Salmonella culture. Show all work and express your answer in CFUs/mL.

2
ID#:_________________________

Use the information in the graph to

answer the following questions (B and
C).

(B, 4 points) Of the two Salmonella

strains, which has a higher rate of
spontaneous mutation?

Give the approximate rate of

spontaneous reversion in that strain.

(C, 4 points) Does 4NOP cause reversion mutations in TA1535? Explain your answer.

The query sequence shown below is a portion of the wild type hisD gene from Salmonella
enterica. The subject is the corresponding sequence from a loss of function mutant. The
horizontal line above the wild type sequence identifies the alanine codon GCC.

(D, 4 points) What is the nature of the hisD loss of function mutation?

(E, 6 points) Based only on the sequence shown,

describe the consequence of this mutation at the
protein level.

3
ID#:_________________________

Two examples (Example 1, Example 2) of HisD revertant sequences obtained in lab are given
below. In each case, the revertant sequence is aligned with the original sequence.

The alignment of wild type and original mutant sequence presented earlier in this problem is
included here for reference.

Reference alignment (Wild Type and original HisD mutation):

Example 1:

(F, 8 points)
• Label the revertant sequence (R)
• Indicate whether the reversion restores the wild type sequence (true revertant)
• In any case where wild type sequence is not restored, explain how reversion was
accomplished. Identify any differences between the wild type and the revertant amino
acid sequences.

Example 2:

(G, 8 points)
• Label the revertant sequence (R)
• Indicate whether the reversion restores the wild type sequence (true revertant)
• In any case where wild type sequence is not restored, explain how reversion was
accomplished. Identify any differences between the wild type and the revertant amino
acid sequences.

4
ID#:_________________________

Question 2 (40 pts)

A haploid yeast can produce a particular compound (ShirazinTM) which gives a particularly
coveted and lucrative flavor to a kind of wine fermented in the McLaren Vale, Australia. The
company you work for has been contracted by the vintner to determine the pathway to
producing this compound. Your team has isolated haploid mutants that no longer synthesize
the compound. In addition, they have identified the intermediates in the pathway, and provide
you as the team leader (and expert geneticist) with the following data sets to figure out the
pathway. (Fact: diploids can also synthesize ShirazinTM).

TABLE 1- Complementation Test

(+ = produce ShirazinTM, - = do not produce Shirazin TM
).
Mutants
1 2 3 4 5 6 7 8 9 10 11 12
1 - + + - + + + + + + + +
2 + - + + + + + - + + + +
Muts 3 + + - + + + + + + + + +
4 - + + - - + + - - + - +
5 + + + - - + + - - + + +
6 + + + + + - + - + + + -
7 + + + + + + - + + + + +
8 + - + - - - + - - + + -
9 + + + - - + + - - + + +
10 + + + + + + + + + - + +
11 + + + - + + + + + + - +
12 + + + + + - + - + + + -

(A) (16 pts) Based on this data, how many genes (complementation groups) are involved in synthesis
of ShirazinTM. Some of the mutants may be deletions. If so, generate a map of the relative locations of
the genes in this pathway with respect to each other.

Your team demonstrates that certain ShirazinTM mutants can be rescued for its production by supplying
certain intermediates in the media, one of which is ShirazinTM itself. They present you with this data in
Table 2. Also, they tell you that they discovered that mutant 2 accumulates two intermediates, B & D.

5
ID#:_________________________

Table 2: Intermediates that restore ShirazinTM production when supplied

(A-H are intermediates or product in the pathway).

INTERMEDIATES ADDED
A B C D E F G H
1 - - - + + + - -
2 - - - - + + - -
Mut 3 - + + - + + + -
4 - - - - + + - -
5 - + - - + + - -
6 - - - - + - - -
7 + - - + + + - -
8 - - - - + - - -
9 - + - - + + - -
10 - + + - + + + +
11 - - - - + + - -
12 - - - - + - - -

(B) (16 pts) Based on this data, which compound is ShirazinTM? Draw its synthetic pathway.
Indicate where the various mutations act in the pathway. (If there are deletion mutations, you
needn’t include them in the pathway as they likely disrupt multiple steps).

(C) (4 pts) Give a brief explanation for mutations that identify genes (complementation groups)
that can not be ordered in the pathway?

(D) (4 pts) For intermediates that can not be ordered, what experiment could you perform to
resolve the dilemma?

6
ID#:_________________________

Question 3 (40 pts)

You are studying the genetics of a particular eye color pathway in a diploid species of small
furry mammal with unusually large adorable eyes (species X). The wild type eye color is a
dreamy almost mesmerizing purple. This is a very important character in this mammal, as it
appears to be its only defense against predation. When cornered by a predator, one look at
those adorable purple eyes, and the predator finds another dinner. You find that animals
released into the wild with brown tinted contact lenses are immediately gobbled up. Tasty! So,
the color is important! However, no matter how hard you mutagenize these little guys, you can’t
get eye color mutants. A biochemist colleague informs you that he has identified the enzyme
that produces purple, and that based on protein sequence, he has determined that there are two
VERY similar genes encoding the same activity. He contracts a genetics company (he’s a
biochemist after all) to make mutants of these two nearly identical genes, he calls A and B. His
two mutant stocks aaBB and AAbb, have the normal wild type eye color. He sends the mutants
to you, begging you to combine the mutations together. Since he is a biochemist, he is ignorant
of how to perform a cross. You ask him, “are the A and B loci linked?” He replies, “what’s
linked?”

(A) (4 pts) You cross the mutant stocks to each other. What is the phenotype of the F1
individuals?

(B) (8 pts) You interbreed the F1 animals to each other. Assuming the A and B loci are
unlinked, what are the phenotypic ratios in the F2 (assume the absence of purple is white)?

(C) (8 pts) You become embroiled with a fellow geneticist “colleague” who is working on a
closely related species (species Y). He’s goads you, “it’s easy, in fact REALLY easy, to get
eye color mutants in my species”. Steaming, you contract a molecular genetics company
(you are a geneticist after all) to sequence the wild type genomes of the small furry
mammals. You are most interested in the A and B loci and the company analyzes the data
and reports that the gene’s organization looks like this in the two species:

The data reveals that in species Y, there is only one gene with homology to the highly similar A
and B genes of species X. The data also reveal the presence and orientation of repetitive non-
active transposon elements in the neighborhood of these genes (boxes with arrows indicating
sequence orientation). You contact a evolutionary biologist who tells you, that, “of course,
species Y is the ancestor of species X, everybody knows that!” How could recombination have
led to the gene organization of species X starting from species Y? Show this in a simple sketch
based on the above figure, indicating where recombination must occur (Hint, you know

7
ID#:_________________________

recombination should be occurring at Meiosis, that is not what we are getting at. We mean,
precisely where do crossovers occur physically).

(D) (4 pts) Your data also indicate how recombination could lead to a high rate of gene
mutation in species Y, providing a mechanism to shove in your colleague’s snooty face.
Describe how recombination could lead to a high mutation rate to loss of the single A/B
gene in species Y. There are two possible ways that it can occur, you only need show one.

(E) (4 pts) In species X, why are the genes only “nearly” identical?

(F) (8 pts) Reflecting back to part B, you DO the cross of those F1 individuals to each other,
and generate F2 animals… and generate F2 animals… and generate F2 animals. You
finally generate enough animals to find that you get white-eyed mutants (no Purple!) at a
rate of 1/10,000! You sequence the white-eyed individuals, and they in fact have normal
organization of the A and B loci, just both copies are mutant! You generated bona fide
recombinants. What is the genetic map distance between the A and B loci?

(G) (4 pts) Briefly, what environmental factors may have led to the gene organization
differences in these two species and why might the organization be advantageous?

8
ID#:_________________________

Question 4 (40 pts) Use of CRISPR-CAS to make a novel transcriptional regulator

Upon graduation you are offered a lucrative job at REGULOMIX, a brand new biotech company.
Your first project is to make an RNA-Programmed Transcriptional Activator. The goal is to be
able to specifically activate transcription of any gene in any genome. You look at your boss and
say, "No problem, we learned about CAS9 and GAL4 in Genetics; I got this". You figure you'll be
able to take advantage of the precise genome targeting capability of RNA-guided CAS9.

The first step is to create an RNA-Programmable Transcriptional Activator protein using the
Streptococcus pyogenes CAS9 and the yeast GAL4 transcription factor.

(A, 4 points) What enzymatic activity of the wild-type CAS9 protein would you need to eliminate
as a first step in your engineering approach?

(B, 10 points) Briefly describe the concept behind how you will use this modified CAS9 protein
and a specific domain from the yeast GAL4 transcription factor to create a fusion protein with
the desired characteristics. Name/describe the domain from GAL4 you will use and describe
with 2-4 bullet points how this novel fusion protein will achieve your goal.

(C, 8 points) Now you need to establish that your novel protein is RNA-programmable. The
following is a schematic of a typical Eukaryotic gene. Circle the region you would like to direct
your novel protein to and explain how doing this would activate transcription of this generic
gene.

1 2 3

Explanation (1-3 bullet points):

9
ID#:_________________________

Now, you design a guide RNA sequence that will be loaded into your novel protein and will
direct it to a specific locus in the genome the way CAS9 is normally directed to a specific locus.
Remember the Streptococcus pyogenes CAS9 Protospacer Adjacent Motif (PAM) is NGG.

Your guide RNA:

5- CUUGUCACUACUUUCGGUUA -3'

Your boss is happy with your progress, but she has a meeting with some venture capitalists
next week and she needs some quick data to get them to invest. You say, "No problem, we
learned about reporter constructs in Genetics; I got this".

You construct plasmids with the following sequences (only the top strand [5'-3'] of double-
stranded DNA is shown). Each plasmid contains a different fluorescent protein that will be
expressed only if your RNA-Programmed Transcriptional Activator is able to recognize this
sequence.

Plasmid 1: Green Fluorescent Protein

GATTATGTACAGTAAAGAACTATATTTTTCAAAGATGACGTGAAC

Plasmid 2: Red Fluorescent Protein

TACATCATGGCATAACCGTAAGTAGTGACTTGGACAAACAAGAAC

Plasmid 3: Cyan Fluorescent Protein:

TCCATCGCTAACACTTGTCACTACTTTCGGTTATGGTGTTCAATG

Plasmid 4: Blue Fluorescent Protein:

ATTCTTGTACACAAATTGGAATACAACTATAACTCACACAATGTA

Plasmid 5: Yellow Fluorescent Protein:

TAACACTTGTCACTACTTTCGCTTATGGTGTTCAATGTCCATCGC

Next, you set up a series of 50 injection experiments in frog oocytes to test your system. In each
oocyte you inject:
• your novel CAS9
• your guide RNA
• one of your five plasmids (each plasmid was injected into 10 oocytes)

10
ID#:_________________________

(D, 10 points) Your experiment is a massive success. It shows the approach works and
suggests your novel protein-guide RNA complex is very specific. 10 hours after injection, you
noticed that 10 oocytes expressed a fluorescent protein – they were all the same color.

What color were these oocytes?

Give two characteristics of the sequence from the plasmid encoding this fluorescent protein that
suggest it will be a target of your novel transactional activator.

(E, 8 points) You were particularly gratified to see an absence of one of the five colors because
this experiment suggested your system was highly specific.

Which color would you have expected to observe if a single mismatch between guide RNA and
target was still resulted in binding of your novel protein to the target.

11
ID#:_________________________

Question 5 (40 pts) Transposons and epigenetic regulation of gene expression

Arabidopsis fwa mutants are dominant and flower late compared to wild type. The FWA gene
was identified by map-based cloning, but when the gene was sequenced in the mutant, it had
no mutations – the DNA sequence in the fwa mutant was identical to the wild-type sequence.
Sequencing of FWA also revealed that there was a repetitive sequence derived from an inactive
transposon in the FWA promoter (Soppe et al., Mol. Cell, 2000).
SOUTHERN BLOT
Southern Blot analysis of genomic DNA following digestion with

wil ype
fwa ype
a
/fw
either the MspI restriction enzyme or the HpaII restriction

dt
dt
Genotype:

wil
enzyme is shown (at right). MspI and HpaII cut the same DNA
sequence (CCGG). HpaII does not digest DNA when the middle
C is methylated, MspI cuts regardless of methylation status.
3.8

Size of Band
(kilobases, kb)

2.0
1.8
1.6

Restriction Enzyme: MspI HpaII

Use the Southern blot to complete the following map of the FWA gene. One MspI/HpaII (M/H)
recognition site is given. The DNA used to produce a probe for the Southern Blot is also
indicated below the map. Boxes 1-3 represent the FWA exons.

(A, 10 points) Place the remaining M/H sites on the map and indicate the distance between all
of the M/H sites. Arrows indicate the position of the repetitive transposon-derived sequence in
the FWA promoter.

M/H$
1 2 3

Probe&=&4&kb&

(B, 8 points) Provide an explanation for the different pattern of bands observed for fwa mutants
and wild type following digestion by HpaII. Your explanation should explain the different size
bands observed and should provide a hypothesis explaining the fwa mutant phenotype (2-4
bullet points).

12
ID#:_________________________

ddm1 (decreased dna methylation1) loss-of-function mutants have reduced DNA methylation
across the genome. The mutation disrupts an important DNA methyltransferase. After self-
fertilization of ddm1/ddm1 for 8 generations, genomic DNA methylation is nearly absent and
mutant plants are late flowering.
SOUTHERN BLOT

m 1
wil ype
fwa ype

/dd
a
/fw

m1
dt
dt
Genotype:

wil

dd
(C, 4 points) Draw the expected HpaII band pattern at the FWA
gene in ddm1 mutants that have been self-fertilized for 8
generations. Fill in the box with expected bands in the Southern
3.8
blot to the right. The probe is the same as above (part A).
Size of Band
(kilobases, kb)

2.0
1.8
1.6

Restriction Enzyme: MspI HpaII

Size Standard

ddm1/ddm1
(D. 10 points) The full-length FWA transcript is 2.5 kb and only a

wild type
single band is detectable by RNA gel blot (Northern blot) when

fwa/fwa

fwa/+
DNA corresponding to FWA exon 2 is used as a probe. Draw the
bands you'd expect to observe when RNA is analyzed from each
of the indicated genotypes. Note: RNA was extracted from
8 kb
plants at the developmental stage when fwa affects flowering
time and equal amounts of this RNA was loaded on the gel. 4 kb

2 kb

1 kb

500 bp
(E. 4 points) Explain why fwa is dominant (1-2 bullet points)

50 bp

Probe = FWA Exon 2

(F. 4 points) Explain why ddm1 is recessive (1-2 bullet points)

13