Sie sind auf Seite 1von 11

L1 HPV

SECUENCIA
>KU684312.1:6083-7156 Human papillomavirus type 16 isolate IND-JNM434,
complete genome
ATGGATTACAAACAAACACAATTGTGTTTAATTGGTTGCAAACCACCTATAGGGGAACACTGGGGCAAAG
GATCCCCATGTACCAATGTTGCAGTAAATCCAGGTGATTGTCCACCATTAGAGTTAATAAACACAGTTAT
TCAGGATGGTGATATGGTTGATACTGGCTTTGGTGCTATGGACTTTACTACATTACAGGCTAACAAAAGT
GAAGTTCCACTGGATATTTGTACATCTATTTGCAAATATCCAGATTATATTAAAATGGTGTCAGAACCAT
ATGGCGACAGCTTATTTTTTTATTTACGAAGGGAACAAATGTTTGTTAGACATTTATTTAATAGGGCTGG
TGCTGTTGGTGAAAATGTACCAGACGATTTATACATTAAAGGCTCTGGGTCTACTGCAAATTTAGCCAGT
TCAAATTATTTTCCTACACCTAGTGGTTCTATGGTTACCTCTGATGCCCAAATATTCAATAAACCTTATT
GGTTACAACGAGCACAGGGCCACAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTGTTGTTGA
TACTACACGCAGTACAAATATGTCCTTATGTGCTGCCATATCTACTTCAGAAACTACATATAAAAATACT
AACTTTAAGGAGTACCTACGACATGGGGAGGAATATGATTTACAGTTTATTTTTCAACTGTGCAAAATAA
CCTTAACTGCAGACGTTATGACATACATACATTCTATGAATTCCACTATTTTGGAGGACTGGAATTTTGG
TCTACAACCTCCCCCAGGAGGCACACTAGAAGATACTTATAGGTTTGTAACATCCCAGGCAATTGCTTGT
CAAAAACATACACCTCCAGCACCTAAAGAAGATCCCCTTAAAAAATACACTTTTTGGGAAGTAAATTTAA
AGGAAAAGTTTTCTGCAGACCTAGATCAGTTTCCTTTAGGACGCAAATTTTTACTACAAGCAGGATTGAA
GGCCAAACCAAAATTTACATTAGGAAAACGAAAAGCTACACCCACCACCTCATCTACCTCTACAACTGCT
AAACGCAAAAAACGTAAGCTGTAA
INTTRRODUCCION
Proteína: Principal proteína de la cápside L1
Gen: L1
Organismo: Virus del papiloma humano tipo 16
Función: Forma una cápside icosaédrica con una simetría T = 7 y un diámetro de 50 nm. La cápside
está compuesta por 72 pentámeros unidos entre sí por enlaces disulfuro y asociados con proteínas
L2. Se une a los proteoglicanos de heparán sulfato en la superficie celular de los queratinocitos de la
capa basal para proporcionar la unión inicial del virión. Esta unión media un cambio conformacional
en la cápside del virus que facilita una infección eficiente. El virión ingresa a la célula huésped a través
de la endocitosis. Durante el tráfico de virus, la proteína L1 se disocia del ADN viral y el ADN genómico
se libera al núcleo del huésped. El ensamblaje del virión se lleva a cabo dentro del núcleo celular.
Encapsula el ADN genómico junto con la proteína L2
Ubicación subcelular: Virion; Núcleo del huésped
PTM: Disulfide bond
Sistema para la expresión de proteínas: Elegimos la Pichia pastoris debido a las técnicas genéticas
disponibles, altos niveles de expresión, tasa de crecimiento rápido en medios relativamente simples
y tecnología de fermentación bien establecida, junto con su economía de uso.
Vector plasmídico: pPICZB
Enzimas de restricción: Sitio 1: EcoRI; Sitio 2: XhoI;

EcoRI XhoI
CUTSITE CUTSITE
G/A A T T C C/T C G A G
C T T A A/G G A G C T/C

OVERHANG OVERHANG
5′ AATT 5′ TCGA
DISEÑO DE PRIMERS
Secuencia: FWD GGC GCG CGA ATT CAT GGA TTA CAA AC
Tm: 61 ºC
Estructuras secundrias:

Secuencia: REV CGC GAT CTC GAG TAG TTA CAG CTT ACG
Tm: 60.1 ºC
Estructuras secundrias:

PCR
vector plasmídico pPICZB / L1 usando ADN polimerasa Pfu.
Configuración de la reacción:Recomendamos ensamblar todos los componentes de la reacción
en hielo y transferir rápidamente las reacciones a un termociclador precalentado a la temperatura
de desnaturalización (98 ° C). Todos los componentes deben mezclarse y centrifugarse antes de
su uso. Es importante agregar Phusion DNA Polymerase al final para evitar cualquier degradación
del cebador causada por la actividad exonucleasa 3´ → 5´. Phusion DNA Polymerase puede
diluirse en 1X HF o GC Buffer justo antes de su uso para reducir los errores de pipeteo. Tenga en
cuenta que los protocolos con Phusion DNA Polymerase pueden diferir de los protocolos con otras
polimerasas estándar. Como tal, las condiciones recomendadas a continuación deben usarse para
un rendimiento óptimo.
Mezcla de reacción
Componente 20 µl de 50 µl de Concentración final
reacción reacción

Agua libre de hasta 20 µl hasta 50 µl


nucleasas
Tampón 5X Phusion 4 µl 10 µl 1X

DNTP 10 mM 0.4 µl 1 µl 200 µM

Cebador directo 10 1 µl 2.5 µl 0.5 µM


µM

Cebador inverso 10 1 µl 2.5 µl 0.5 µM


µM

ADN de plantilla variable variable <250 ng

DMSO (opcional) (0.6 µl) (1,5 µl) 3%

Phusion DNA 0.2 µl 0,5 µl 1.0 unidades / 50 µl de


Polymerase PCR

Notas: Mezcle suavemente la reacción. Recoja todo el líquido en el fondo del tubo mediante un giro
rápido si es necesario. Superponga la muestra con aceite mineral si usa una máquina de PCR sin
una tapa calentada.
Transfiera los tubos de PCR del hielo a una máquina de PCR con el bloque precalentado a 98 ° C
y comience el termociclado:
Condiciones de termociclado para una PCR de rutina:
PASO TEMPERATURA HORA

Desnaturalización inicial 98 ° C 30 segundos

25-35 ciclos 98 ° C 5-10 segundos


45-72 ° C 10-30 segundos
72 ° C 15-30 segundos por kb

Extensión final 72 ° C 5-10 minutos

Sostener 4-10 ° C

ADN CANTIDAD

ADN genómico 1 ng – 1 µg

Plásmido o viral 1 pg – 10 ng

El fragmento resultante debera incubarse con ADN polimerasa Taq


Protocolo
Configuración de la reacción:
Recomendamos ensamblar todos los componentes de la reacción en hielo y transferir rápidamente
las reacciones a un termociclador precalentado a la temperatura de desnaturalización (95 ° C).
Componente Reacción de Reacción de Concentración final
25 μl 50 μl

Tampón de reacción 2.5 µl 5 μl 1X


ThermoPol 10X

DNTP 10 mM 0,5 µl 1 μl 200 µM

Cebador directo 10 µM 0,5 µl 1 μl 0.2 µM (0.05–1 µM)

Cebador inverso 10 µM 0,5 µl 1 μl 0.2 µM (0.05–1 µM)

ADN de plantilla variable variable <1,000 ng

Taq DNA Polymerase 0,125 µl 0.25 µl 1,25 unidades / 50 µl


de PCR

Agua libre de nucleasas hasta 25 µl hasta 50 µl

Notas: Mezcle suavemente la reacción. Recoja todo el líquido en el fondo del tubo mediante un
giro rápido si es necesario. Superponga la muestra con aceite mineral si usa una máquina de PCR
sin una tapa calentada.
Transfiera los tubos de PCR del hielo a una máquina de PCR con el bloque precalentado a 95 ° C y
comience el termociclado.
Condiciones de termociclado para una PCR de rutina:
PASO TEMPERATURA HORA

Desnaturalización inicial 95 ° C 30 segundos

30 ciclos 95 ° C 15-30 segundos


45-68 ° C 15-60 segundos
68 ° C 1 minuto / kb

Extensión final 68 ° C 5 minutos

Sostener 4-10 ° C

ADN Cantidad
genómico 1 ng – 1 μg

plásmido o viral 1 pg – 10 ng

DIGESTIÓN
Enzimas
EcoRI; XhoI
Mezcla

polimerasa Klenow (Invitrogen)

Componentes:

18012-021 Large Fragment of DNA Polymerase I

Y92500 REact® 2 Buffer

51669 Klenow Dilution Buffer


Tampón de dilución Klenow: 10X REact® 2 Buffer:

Fosfato de potasio 50 mM (pH 7.0) Tris-HCl 500 mM (pH 8.0)

100 mM KCl 100 mM MgCl2

Ditiotreitol 1 mM NaCl 500 mM

50% (v / v) de glicerol

Condiciones de reacción

1. Diluya el fragmento grande de ADN polimerasa I a 0.5 U / µl con Klenow Tampón de dilución.

2. A un tubo de microcentrífuga de 1,5 ml en hielo, agregue:

10X REact® 2 Buffer.........................................................................3 µl

0.5 mM dATP ...................................................................................1 µl

0.5 mM dCTP ...................................................................................1 µl

0.5 mM dGTP ...................................................................................1 µl

0.5 mM dTTP....................................................................................1 µl

DNA...........................................................................................0.5-1 µg

Large fragment of DNA Polmerase I.................................................1 µl

Autoclaved distilled water...........................................................to 30 µl

3. Mezcle suavemente y centrifugue brevemente para llevar el contenido al fondo del el tubo.
4. Incubar a temperatura ambiente durante 10-15 minutos o 20 minutos en hielo.

5. Termine la reacción de llenado mediante extracción con fenol.

LIGACIÓN
El gen L1 se ligó al vector de expresión pPICHOLI (Mobitech) después de la digestión
con SalI, rellenando los extremos de cadena sencilla usando polimerasa Klenow
(Invitrogen) y dNTP, y digestión por EcoRI. El vector de expresión resultante se
denominó pPICHOLI / L1.
Enzimas

SalI EcoRI.

Mezcla

Condiciones de reacción

TRANSFORMACIÓN
Introducción:
El kit Pichia EasyComp ™ produce células Pichia químicamente competentes y es
incluido para proporcionar una alternativa a la electroporación y un rápido y conveniente
método para la transformación. Sin embargo, debido a la baja eficienicia de transformación
(3 μg de ADN plasmídico produce alrededor de 50 colonias), es muy difícil
aislar integrantes de copias mútliples. En casos donde los integrantes de copias múltiples
son deseados, se utiliza la electroporación para obtener mejores resultados.
Tenga en cuenta que las celdas son preparadas de manera diferente para la
electroporación.
No utilice celdas preparadas utilizando el Protocolo EasyComp ™ para electroporación.

Se requiere:
Reactivos y Equipo
• Incubadora rotatoria de 30 ° C
• Medio YPD (extracto de levadura peptona dextrosa) (ver Recetas, página 55)
• 50 ml, tubos cónicos estériles
• Centrífuga adecuada para tubos cónicos de 50 ml (piso o sobremesa)
• Tubos de microcentrífuga estéril de rosca de 1,5 ml.
• –80 ° C congelador
• Caja de espuma de poliestireno o toallas de papel.

Antes de comenzar:
• Colocar una placa de YPD con su cepa de Pichia de forma aislada.
Las colonias crecerán. Incubar la placa a 28-30 ° C durante 2 días.
• Equilibre la solución I a la temperatura ambiente.
Preparado:
 Células competentes
1. Inocular 10 ml de YPD con una sola colonia de su cepa Pichia. Dejar crecer
durante la noche a 28–30 ° C en una incubadora con agitación (250–300 rpm).
2. Diluya las células del cultivo nocturno a un OD600 de 0.1–0.2 en 10 ml de YPD.
Crecer las células a 28-30 ° C en una incubadora de agitación hasta que el OD600 es 0.6-1.0.
Esto tomará aproximadamente 4 a 6 horas.
3. Formar Pellet de las células por centrifugación a 500 × g durante 5 minutos a temperatura
ambiente.
Desechar el sobrenadante.
4. Resuspender el sedimento celular en 10 ml de Solución I. No se requiere tiempo de
incubación.
5.Formar Pellet de las células por centrifugación a 500 × g durante 5 minutos a temperatura
ambiente.
Desechar el sobrenadante.
6. Resuspender el sedimento celular en 1 ml de Solución I. Las células ahora son
competentes.
7. Alícuota de 50 a 200 μl de células competentes en tubos con tapones roscados estériles
de 1,5 ml etiquetados de microcentrífuga.
Nota: Usar 50 μl de celdas para cada transformación. Puedes descongelar las células y volver
a congelar varias veces sin pérdida significativa en la eficiencia de transformación.
8. En este punto, las células pueden mantenerse a temperatura ambiente y usarse
directamente para la transformación o congelado para uso futuro. Para congelar las células,
coloque los tubos en una Caja o envoltura de espuma de poliestireno en varias capas de
toallas de papel y colóquela a –80 ° C en congelador. Es importante que congele las células
lentamente. No congelar las células en nitrógeno líquido.
9. Continúe con el procedimiento de transformación.

Hemos observado que a menudo se obtienen mayores eficiencias de transformación con


células congeladas en comparación con células recién preparadas. Puedes elegir usar
algunas de las celdas inmediatamente después de la preparación y congelar las células
restantes en pequeñas alícuotas. Puede usar el siguiente protocolo para transformar
productos recién preparados o congelados de Células Pichia competentes. La eficiencia de
transformación puede variar con cada cepa y vector utilizado.

Necesario:
Reactivos y Equipo
• incubadora a 30 ° C
• Baños de agua o bloques de calor a 30 ° C y 42 ° C.
• Microcentrífuga a temperatura ambiente.
• YPDS con placas Zeocin ™ de 100 μg / ml (consulte Recetas, página 56)

Antes de comenzar:
• El PEG en la Solución II puede precipitar a temperaturas inferiores a 27 ° C. En caso de
observar un precipitado, calentar la solución a 37 ° C, girando ocasionalmente, hasta que
el precipitado se disuelva. Para evitar la formación de un precipitado, almacene la Solución
II a temperatura ambiente.
• Equilibre la Solución III a la temperatura ambiente.
• Equilibre el número y tipo de placas apropiados a la temperatura ambiente.
Necesitará una placa para cada transformación.
• Es posible que desee incluir controles para verificar la contaminación.
Se recomienda un control sin ADN y solo con plásmido.

Protocolo:
1. Para cada transformación, descongelar un tubo de células competentes en la sala a
temperatura ambiente y alícuotar 50 μl en un tubo de microcentrífuga estéril. Si se busca
transformar células nuevas, use 50 μl de células competentes,
Paso 7, página 29.
2. Agregue 3 μg de ADN de vector de expresión de Pichia linealizado a las células
competentes.
Nota: El uso de más de 3 μg de ADN puede aumentar la eficiencia de transformación en
algunos casos. El volumen de ADN no debe exceder los 5 μl. Se puede usar ADN linealizado
directamente de una reacción de digestión de restricción sin afectar la eficiencia de la
transformación.
La extracción con cloroformo de fenol y la precipitación con etanol no son necesarias.
3. Agregue 1 ml de Solución II a la mezcla de ADN / célula y mezcle sacudiendo el tubo.
4. Incubar las reacciones de transformación durante 1 hora a 30 ° C en un baño de agua o
incubadora. Mezcle la reacción de transformación cada 15 minutos mediante agitación
vorticial o sacudiendo el tubo. No mezclar la reacción de transformación cada 15 minutos.
Pues dará como resultado una disminución de la eficiencia de transformación.
5. Chocar con calor las células en un bloque de calor de 42 ° C o baño de agua durante 10
minutos.
6. Divida las células en 2 tubos de microcentrífuga (aproximadamente 525 μl por tubo)
y agregue 1 ml de medio YPD a cada tubo.
7. Incubar las células a 30 ° C durante 1 hora para permitir la expresión de la resistencia
Zeocin ™.
8. Formar Pellet de las células por centrifugación a 3.000 × g durante 5 minutos a
temperatura ambiente.
Desechar el sobrenadante.
9. Resuspenda cada tubo de células en 500 μl de Solución III y combine las células
en un tubo.
10. Formar Pellet de las células por centrifugación a 3.000 × g durante 5 minutos a
temperatura ambiente.
Desechar el sobrenadante.
11. Resuspender el sedimento celular en 100 a 150 μl de Solución III.
12. Platee toda la transformación en placas de selección apropiadas usando un
esparcidor estéril. Incubar las placas durante 3 a 10 días a 30 ° C. Cada transformación
debería producir aproximadamente 50 colonias.
 Analizando transformaciones en Pichia
Seleccione 6–10 de sus transformantes de Pichia resistentes a Zeocin ™ y confirme el Mut
fenotipo. También es posible que desee analizar la presencia de inserto mediante PCR
Nota: Al seleccionar transformantes de Pichia resistentes a Zeocin ™, es normal observar
una baja cantidad de fondo (~ 10-30%).
SCREENING
X-GAL

PCR

Seuenciación

PURIFICACIÓN
En esta sección, crecerá e inducirá un cultivo de 10–200 ml de su transformante Pichia para la
purificación de prueba en una resina quelante de metales como ProBond ™.

Puede recolectar las células y almacenarlas a –80 ° C hasta que esté listo para purificar su proteína
de fusión, o puede proceder directamente con la purificación de proteínas.

Recomendamos que utilice el Sistema de purificación ProBond ™ (Cat. No. K850-01) para purificar
proteínas de fusión expresadas. Tenga en cuenta que las instrucciones para el equilibrio y la
cromatografía en resina ProBond ™ son contenido en el sistema de purificación ProBond ™.

Si está utilizando una resina quelante de metales que no sea ProBond ™, siga las recomendaciones
del fabricante para las proteínas de fusión expresadas en bacterias o levaduras.

Un mililitro de resina ProBond ™ se une al menos a 1 mg de proteína recombinante.


Preparacion de celdas.
Exprese su proteína usando un cultivo a pequeña escala (10–20 ml para MutSson;
100-200 ml para Mut +) y las condiciones óptimas para la expresión (si se determina).
Consulte el manual del kit de expresión Pichia para obtener más información. Una vez que tu
proteína es expresado, siga el protocolo a continuación para preparar un lisado celular para
cromatografía en ProBond ™.
Prepare Breaking Buffer (BB)
1. Lave las células una vez en BB resuspendiéndolas y centrifugándolas de 5 a 10 minutos a 3.000 ×
g a 4 ° C.
2. Resuspenda las celdas a un OD600 de 50–100 en BB.
3. Agregue un volumen igual de perlas de vidrio lavadas con ácido (0.5 mm). Volumen estimado
por desplazamiento.
4. Agite la mezcla en vórtex durante 30 segundos, luego incube en hielo durante 30 segundos.
Repite 7 veces más. La alternancia de vórtice con enfriamiento mantiene la célula
extrae frío y reduce la desnaturalización de tu proteína.
5. Centrifugue la muestra a 4 ° C durante 5–10 minutos a 12,000 × g.
6. Transfiera el sobrenadante transparente a un recipiente nuevo y analice su proteína. La
concentración total de proteínas debe ser de alrededor de 2-3 mg / ml.
7. Guarde el sedimento y extraiga con urea 6 M o Triton® X-100 al 1% para verificar Proteína
insoluble.
Aplicaion de muestra.
Para la aplicación de muestra en ProBond ™, necesitará Native Binding Buffer,pH 7.8 y una columna
ProBond ™ de 2 ml, preequilibrada usando condiciones nativas.
1. Combine 1 ml (2–3 mg / ml de proteína total) de lisado de Pichia con 7 ml de tampón de unión
nativo.
2. Tome una columna ProBond ™ pre-equilibrada y resuspenda la resina en 4 ml de el lisado diluido
del Paso 1.
3. Selle la columna y aglutine por lotes meciéndola suavemente a temperatura ambiente durante
10 minutos.
4. Deje que la resina se asiente por gravedad o centrifugación a baja velocidad (800 × g) y Retire con
cuidado el sobrenadante. Guarde el sobrenadante para verificarproteína no unida
5. Repita los pasos 2 a 4 con los 4 ml restantes de lisado diluido. Continúe con el lavado y la elución
de columnas en condiciones nativas en ProBond ™
Desnaturalización Condiciones
Use el protocolo anterior, excepto el pre-equilibrio de la columna ProBond ™ usando el tampón de
unión desnaturalizante y combine 1 ml del lisado de células Pichia con 7 ml de el tampón de unión
desnaturalizante.
Análisis de purificación
Asegúrese de guardar todas las fracciones, lavados y flujos para el análisis por SDS-PAGE.
Es posible que deba usar el análisis de Western para detectar su proteína si la expresión es baja o si
no se cargó suficiente proteína en la columna. Consulte el ProBond ™
Manual del sistema de purificación para una guía para solucionar problemas de cromatografía

REFERENCIAS
https://www.neb.com/protocols/0001/01/01/pcr-protocol-m0530

http://tools.thermofisher.com/content/sfs/manuals/MAN0012033_Pfu_DNAPolymerase_UG.pdf

https://www.neb.com/protocols/0001/01/01/taq-dna-polymerase-with-thermopol-buffer-m0267

https://assets.thermofisher.com/TFS-
Assets/LSG/manuals/MAN0012026_TaqDNAPolymerase_recombinant_5_UuL_100U_UG.pdfhttp://tools.the
rmofisher.com/content/sfs/manuals/MAN0012033_Pfu_DNAPolymerase_UG.pdf

https://www.neb.com/protocols/0001/01/01/taq-dna-polymerase-with-thermopol-buffer-m0267

https://assets.thermofisher.com/TFS-
Assets/LSG/manuals/MAN0012026_TaqDNAPolymerase_recombinant_5_UuL_100U_UG.pdf

https://enzymefinder.neb.com/#!/name/XhoI

https://enzymefinder.neb.com/#!/name/EcoRI

http://tools.thermofisher.com/content/sfs/manuals/easyselect_man.pdf

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3507537/
GGG CGG TCG GAA TTC ATG GAT TAC AAA C

CCG AGG GAA TTC ATG GAT TAC AAA C

CGG CCG AGG GAA TTC ATG GAT TAC AAA C


GGCTCGGAATTCATGGATTACAAA

CCG GCC GGA ATT CAT GGA TTA CAA AC

GGC GCG CGA ATT CAT GGA TTA CAA AC


GCC TGG ATC TCG AGT AGT TAC AGC TTA CG
CGC GAT CTC GAG TAG TTA CAG CTT ACG
CGC GAT CTC GAG TAG TTA CAG CTT ACG

CCG CCA TCT CGA GTA GTT ACA GCT TAC G


CCG CCA TCT CGA GTA GTT ACA GCT TAC G