EFFECT OF ADDING DIFFERENT CAROTENOID-RICH DIET

IN THE CD36 GENE EXPRESSION OF RED TILAPIA

AIMEE CAROL R. TANGONAN

A Special Problem Submitted to the Dr. Khristina J. Cruz of the Department of

Biological Sciences, College of Arts and Sciences, Central Luzon State
University, Science City of Muñoz, Nueva Ecija, Philippines
as a Requirement for the Subject BIO 738
- Molecular Genetics

January 2020
 Table of Contents

LIST OF TABLES iv

LIST OF FIGURES v

LIST OF APPENDICES vi

LIST OF APPENDIX TABLES vii

LIST OF APPENDIX FIGURES viii

INTRODUCTION 8

Background of the Study 2

Objectives of the Study 4
Significance of the Study 4
Scope and Limitations of the Study 6
Time and Place of the Study 7

REVIEW OF RELATED LITERATURE 7

Tilapia Industry 7
Tilapia in the Philippines 9
Red Tilapia 10
Use of Natural Carotenoids for Pigmentation in Fishes 12
Cluster Determinant 36 (CD36) 13

METHODOLOGY 16

Experimental Treatments 16
Gene Expression Analysis of CD36 17
Data Gathered 18
Statistical Analysis 18

RESULTS AND DISCUSSION 19

Descriptive Statistics of CD36 Gene 19

Expression of CD36 gene as Affected by the Different Treatments 22

SUMMARY, CONCLUSION AND RECOMMENDATION 25

Summary 25
Conclusion 26

ii
 Recommendation 27

LITERATURE CITED 28

APPENDICES 33

iii
 LIST OF TABLES

TABLE PAGE

1 Experimental Treatments using commercial feeds 16

supplemented with the experimental plants Daucus carota,
Ipomoea aquatica and Moringa oleifera.
20
2 Mean CT value of the Red Nile Tilapia intestinal samples.

iv
 LIST OF FIGURES

FIGURE PAGE

1 Mean CT value for the CD36 gene expression of the 19

intestinal samples of red Nile tilapia subjected to the
different treatments.

2 Expression of CD36 in red tilapia intestines. 22

v
 LIST OF APPENDICES

APPENDIX PAGE

I Appendix Tables 34

II Appendix Figures 35

vi
 LIST OF APPENDIX TABLES

TABLE PAGE

1 Analysis of Variance on the Mean CT value of the Red Nile 34

Tilapia intestinal samples

vii
 LIST OF APPENDIX FIGURES

FIGURE PAGE

1 Preparation of qRT-PCR mix. 35

2 Loading of qRT-PCR mix and RNA samples in the well. 35

3 Running of qRT-PCR. 36

INTRODUCTION

viii
 2

Background of the Study

Aquaculture remains one of the fastest-growing food-producing sectors nowadays;

and as believed by many, it will continue in playing a key role in meeting the rising demand

for fishery products. No wonder why fish production by aquaculture has become a major

industry ventured upon by many Asian countries including the Philippines (Camacho &

Lagua, 2015). And in 2012, the country ranked among the major fish producing countries

in the world with aquaculture contributing 790, 900 tons, or 25.4 percent to the total fish

production (FAO, 2019).

In the Philippines, tilapia is the second most important farmed fish next to milkfish

(PSA, 2018). While the milkfish is an indigenous fish, the Mozambique tilapia

(Oreochromis mossambicus) was first introduced in the country in 1950 from Thailand

followed by the Nile tilapia (O. niloticus) in 1972 and so with the other species like the O.

aureus and O. hornorum. It is generally held that it was only with the introduction of the

faster growing Nile tilapia in the early 1970s that freshwater aquaculture progressed

beyond the intermittent backyard scale or seasonal operations in the past (Guerrero, 2019).

And from then on up to the present year, fishery technologists and various experts in the

field of aquaculture have been working in intense search with regards to factors that could

induce growth of the said farm fed fish and all the more make ways to increase its value

and acceptability in the market.

Normal skin color of tilapia is dark, with melanin being the predominant pigment.

This coloration does not come accord with the color preference of consumers for brightly
 3

colored fish and thus, greatly affects marketability of tilapia in either whole or as skin-on

fillets (Tave et al., 1990). But the discovery of mutant, light-colored tilapia in 1970’s

presented a conceivable solution to produce light-colored tilapia that happens to be more

desirable and are expected to command higher price compared to the normally pigmented

black tilapia (Tave, 1991). In addition, with regards to color preferences of food consumers,

various studies showed that red is considered as a chief food color, evoking the taste buds

and stimulating the appetite (Connolly, 2013). Red coloration has been observed to

effectively grab attention making fishes like the red sea bream, red snapper, and red grouper

to all command good market and high price (DOST-PCAARRD, 2013). So, to keep in

touch with such demands for red color and with the advancement in selective breeding and

biotechnology, the red tilapia (Oreochromis niloticus X O. mossambicus) came into being.

At present, not only because of its attractive color and increased marketability that red

tilapia are gaining popularity among producers, but also because of high salinity tolerance

and high temperature tolerance of some strains. Red tilapia is a delight for the consumers

in many countries for its good flesh quality and market potential (Arous et al., 2014).

The enhancement and enrichment of red tilapia is a continuous process, the fish

breeders and researchers still seek ways for the possibilities of producing this fish with

more appealing color. There had already been numerous studies conducted exploring the

use of carotenoids to enhance pigmentation in the skin and flesh of the fish. But since

animals lack the capability to synthesize carotenoids, adding it to the animal diet had been

the key to increase carotenoid level in the animal body. So far, adding natural sources of

carotenoids like annatto seeds, tomato, carrots, and yellow corn to formulated tilapia diet
 4

shows promising results in improving the color of the Red Nile Tilapia. (BWO, 2013;

DOST-PCAARRD, 2013)

With the innovative methods and the current tools of molecular biology, further

opportunities for the scientific community will open up to expand our knowledge on

correlating gene expression measurements with phenotypic data. This study tried to

determine the effect of carotenoid-rich diet in red tilapia in the expression of CD36 gene –

a gene related to carotenoid-uptake and production of carotenoid coloration in different

tissues of animals.

Objectives of the Study

The study was conducted to determine the effect of carotenoid-rich diet in the CD36

gene expression of Red Nile Tilapia.

Specifically, this study aimed to:

1. measure the level of gene expression of CD36 gene in the intestinal tissues of the

test organism as affected by the different carotenoid-rich diet; and

2. identify which among the selected carotenoid rich plants utilized as feed diet greatly

affects expression of CD36 gene in the intestinal tissues of the test organism.

Significance of the Study

 5

All over the world, Nile tilapia (Oreochromis niloticus) is the main cultivated

species in aquaculture due to the high growth rate and adaptability to different raising

systems, in addition to the good acceptance of the consumer market (Kubitza 2000; FAO

2014). On the other hand, the red tilapia, Oreochromis sp., is increasing in popularity

among producers due to its appealing color, increased marketability and high salinity

tolerance in some strains (Lovshin, 2019).

The color, nutritional value and appearance of food are intuitive features being

considered by consumers when given a set of options for a food item. (Diler & Dilek 2002).

The reddish hue of some fish is a distinguishing characteristic that adds value to the derived

products rendering them a higher status in the market (Takahashi et al. 2008). Thus, the

use of carotenoids in the diets of fish with economic importance like cichlids and

ornamentals is a matter of interest in aquaculture (Sefc et al., 2014). Carotenoids are

lipophilic substances widely used in food industry due to its pigmenting properties (Stahl

& Sies 2003). Apart from rendering bright colors, these pigments also have antioxidant,

antimicrobial and photoprotective function. In aquaculture, since fish cannot synthesize

these pigments (Patil & Thakare, 2017) and the relationship of using carotenoids in fish

diets as an exogenous source of bringing color to flesh was already established (Baker et

al., 2002), the present study evaluated the capability of fish feed diet amended with selected

locally available plants that are recognized to contain carotenoid to improve coloration in

red tilapia.
 6

This paper gives information about ability of D. carota, I. aquatica and M. oleifera

to improve red coloration in the experimental animal. Moreover, since gene expression

measurements were correlated with phenotypic data, results that were gathered from the

gene expression analysis of CD36 will be used to demonstrate ability of the different

carotenoid rich plants to improve red coloration of red tilapia. Also, since the gene of

interests that was analyzed in the present study encodes for a transporter protein, the results

will be used to verify presence of carotenoid compounds in the test plants that can be

transported via the CD36 transporter protein. Alternatively, data gathered can be used as a

basis to verify whether CD36 is involved or not in the carotenoid uptake of red tilapia.

Scope and Limitations of the Study

This study utilized RNA samples extracted from red tilapia that were fed with

commercial feeds amended with plant extracts of Daucus carota, Ipomea aquatic and

Moringa oleifera. In the conduct of the present study, RNA products that were used came

from a previously conducted study by Gajeton et al. (2019). Through qRT-PCR, the effect

of three carotenoid-rich plants were evaluated for their effect in the expression of the gene

CD36, a transporter protein. Since primer used encodes for a transporter protein, RNA

extracted from the intestines of the experimental animal were used. RNA extracted from

the other parts of the treated red tilapia were not utilized.
 7

Time and Place of the Study

This study was conducted in the Genetic Resources Division, Philippine Rice

Research Institute from August to December 2019.

 REVIEW OF RELATED LITERATURE

Tilapia Industry

Tilapia belongs to the family Cichlidae and is largely freshwater fish which dwells

in shallow streams, ponds, rivers and lakes. Historically, this versatile fish was of great

importance in mainly African and the Middle Eastern regions. But now, it is consumed

across the globe and gaining popularity in Asian and American countries. This fish is now

the second-most significant farmed species after carps in the world, making it one of

aquaculture’s greatest success stories. The annual tilapia harvest is currently estimated at

around six million metric tons, with a value in excess of USD 9.8 billion (EUR 8 billion),

which is considerably more than the annual production of salmonids and shrimp

(Holmyard, 2018).

The rapid expansion of aquaculture has catalyzed the growth of the tilapia industry

globally. It is now widely farmed around the world with production being carried out in

over 135 countries (Josupeit, 2004; Fitzsimmons, 2017). The fish is well-regarded because

of it is inexpensive and mild in taste which makes it a good substitute for expensive

alternatives such as salmon. It also contains various essential nutrients such as vitamin B12,

niacin, phosphorous, potassium, iron, vitamin D, selenium and omega-3 fatty acids

(Pearson, 2017). Tilapia is also an ideal choice for fish farming because of its rapid growth,

resistance to various environmental hazards, late age of sexual maturity and planktivorous

feeding habits, putting also into great consideration that they are affordable and easy even

for small farmers to grow. Moreover, the improvements in genetic technology, selective
 8

breeding and increasing government initiatives to support aquaculture business are also

stimulating the growth of the tilapia market. Looking forward, the market is expected to

reach a volume of 7.9 Million Tons by 2024, exhibiting a Compound Annual Growth

Rate (CAGR) of 3.7% during 2019-2024 (Wood, 2019).

In the Philippines, in terms of annual production, this fish is second to milkfish in

importance. Various farming techniques are applied by the industry for commercial tilapia

production in fresh and brackish water ponds, and cages and pens in lakes. In 2001,

freshwater fishponds and cages accounted for 91.2% of the total tilapia aquaculture

production of 106,618 tons. The total farm gate value of all Philippine tilapia production

in 2001 was P5.13 billion (Olalo, 2001). Moreover, several factors including the energy

crisis which favored aquaculture over capture fishing, improved technology made available

by researchers and the resourcefulness of Filipino fish farmers – contributed to the

successful development of the tilapia industry. With this, assessment on farmed tilapia

production in the year 2001 to 2017 showed an increase by 240% (Guerrero, 2019). With

the presence of vibrant market for tilapia and with the increasing demand for it in major

markets of the country and population centers worldwide, freshwater production of Nile

tilapia in ponds and cages will be expected to further expand. Culture of salt-tolerant

tilapias in brackish water ponds and sea cages will spread (Eguia & Eguia, 2016). Globally,

interest in farming tilapia will continuously grow. Without further processing, the fish are

sold whole, round, either fresh or chilled on ice in wholesale or in provincial markets. In

Japan, the trade of live fish includes tilapia that are used for making sashimi (Josupeit,

2004). On the other hand, employing appropriate processing technology and developing

value-added products from tilapia like fillets, nuggets, rolls, tocino, longganisa had
 9

increased economic returns from tilapia production (Rivera, 2016). In addition, the culture

of the red tilapia has also become an attractive investment in several countries because red

tilapia is said to have the potential qualities to satisfy the increasingly selective taste of

consumers (Samson, 2016; Samson, 2018). There is indeed a conceivable future for the

tilapia harvest in the Philippines.

Tilapia in the Philippines

Nile tilapia is a freshwater cichlid native to the Nile River basin; the south-western

Middle East; the Niger, Benue, Volta and Senegal rivers, and the lakes Chad, Tanganyika,

Albert, Edward, and. It has been introduced – mostly for farming purposes – into more than

50 countries on all the continents except Antarctica, and is now found in virtually every

country within the tropics (Daget et al., 1991; Fitzsimmons, 2019). Primarily, Oreochromis

mossambicus, occurred during the 1940s and 1950s while the distribution of the more

desirable Nile tilapia (Oreochromis niloticus), occurred during the 1960s up to the 1980s.

Nile tilapia from Japan were introduced to Thailand in 1965, and from Thailand they were

sent to the Philippines (FAO, 2019).

In the late 1970s and early 1980s, commercial tilapia production was advanced by

the development of technologies for the breeding of Nile tilapia in floating net enclosures

and the production of Nile tilapia in floating cages with feeding. The new technologies

were transferred to the private sector for evaluation. 1988 was a landmark year (Yapp,

2000) during which the International Center for Living Aquatic Resources Management

(ICLARM), began a programme to develop an improved strain of tilapia for low-cost

 10

sustainable aquaculture with funding from the Asian Development Bank (ADB) and the

United Nations Development Programme (UNDP) and resulted in the production of

Genetically Improved Farmed Tilapias (GIFT). The other collaborators in the GIFT Project

were the Bureau of Fisheries and Aquatic Resources (BFAR), Central Luzon State

University (CLSU) and Norway’s Institute for Aquaculture Research (AKVAFORSK).

During the same year, the British Overseas Development Agency (ODA) also funded the

Genetic Manipulation for Improved Tilapia (GMIT) project. Both projects were conducted

at the CLSU campus (FAO, 2019).

The continues improvement in tilapia breeding and production techniques propels

tilapia to continue its march towards eventually overtaking carp as the most important

farmed fish crop. With a much wider distribution of production and consumption and a

huge base of value-added product forms, it is almost certain that tilapia production will

someday eclipse that of carp. As tilapia production and consumption grows globally, it is

likely to become the foundation product for all farmed fishes, just as chicken is the base

for the poultry industry (Fitzsimmons, et al., 2011).

Red Tilapia

In the early 1970s the introduction of Nile tilapia (O. niloticus) – a species light in

color compared to that of the Mozambique tilapia (O. mossambicus) that was earlier

introduced in the Philippines, enhanced the image of tilapia and boosted commercial

production (FAO, 2019). Such incident, shows consumers preference for lighter food

coloration. And people’s associations with certain food colors have undoubtedly changed
 11

through time. That is why the red tilapia, Oreochromis sp., increased in popularity among

producers due to its appealing color, increased marketability and high salinity tolerance in

some strains (Lovshin, 2019). In certain Asian communities the fish fetch a premium as it

is the color of “good luck”. In other communities, red tilapia resemblance to red snapper

or red sea bream gains a premium price (Fitzsimmons, et al., 2011). In the 1990’s, it was

even recorded that red tilapia has replaced the Nile tilapia as the tilapia of choice among

producers in Colombia and Jamaica because of demand by domestic consumers. And in

the Philippines, there was even an instance that market price per kilogram of red tilapia is

twice that of the more widely cultured Nile tilapia (Romana – Eguia and Eguia 1999;

Vadhel et al., 2016).

Red tilapia is a not a species of tilapia, it is instead a name used for several different

manmade tilapia variants that sport and attractive red coloration. Unlike wild tilapia

species, which tend to be black or greyish – these fishes have showy red and pink

colors. These variants are the result of continuous selective breeding. There have been

several strains of red tilapia developed. These include populations from Florida, Hawaii,

Taiwan and Israel. Several have arisen from random mutations in O. mossambicus and

another one in O. niloticus (Aquatic Community, 2008).

In the Philippines, the red tilapia was first introduced from Singapore in 1978. To

date, at least three variant strains of red tilapia are grown commercially in the country,

namely: Taiwanese red, Florida red, and Israeli red. At present, to stimulate the culture of,

and market demand for, red tilapia, initiatives on developing a bigger and more appealing

breed of red tilapia have been undertaken by the Freshwater Aquaculture Center in Central
 12

Luzon State University (CLSU) in Muñoz, Nueva Ecija (DOST-PCAARRD, 2013) The

ability to breed bigger and more attractive tilapia adds value to the fish not only in the

Philippines but also in Malaysia, Indonesia, Thailand, and China. Among the different

farmed tilapia, red tilapia has the potential qualities to satisfy the increasingly selective

taste of consumers (Samson, 2016).

Use of Natural Carotenoids for Pigmentation in Fishes

There had already been numerous studies conducted exploring the use of

carotenoids to enhance pigmentation in the skin and flesh of the fish. But since animals

lack the capability to synthesize carotenoids, adding it to the animal diet had been the key

to increase carotenoid level in the animal body.

A variety of carotenoids, both synthetic and naturally occurring products, are

available or are being developed for use in aquaculture to enhance skin and fillet coloration.

Included are synthetically produced astaxanthin (3,3’-dihydroxy-P, Pcarotene-4,4’-dione)

and canthaxanthin (p, p-carotene-4,4’- dione). However, synthetic carotenoids are

expensive that it comprises 10-15% of the total feed cost. Aside from that, they were

observed of having deteriorating effects in the environment. In contrast, natural carotenoids

could serve as cheaper and much safer alternatives (Buttle et al., 2001). With this, natural

materials such as krill, spirulina, crustacean-meals, marigold, capsicum, and other

xanthophyll-containing vegetable meals are being used (Gupta et al., 2007). Added to this

list are commercially available products of the astaxanthin-rich yeast Phafia rhodozyma

and fermentation product of Xanthophyllomyces dendrrhous (Johnson, 1989; Meyers &

 13

Sandersson, 1992). Other microbial source being considered were the microalgae

Haemafococcus pluvialis, Chlorella vulgaris, Dunaliella salina and Arthospira maxima

(Johnson, 1989; Gupta et al., 2007).

So far, adding natural sources of carotenoids like capsicum, paprika, annatto seeds,

tomato, carrots and yellow corn to formulated tilapia diet shows promising results in

improving the color of the red Nile tilapia. Feeding of red tilapia with paprika also resulted

to enhancement of final weight, weight gain and specific growth rate (Yilmaz et al., 2012;

BWO, 2013; DOST-PCAARRD, 2013).

Cluster Determinant 36 (CD36)

Carotenoids are tetraterpene pigments that are distributed in photosynthetic

bacteria, some species of archaea and fungi, algae, plants, and animals. About 850 naturally

occurring carotenoids had been reported up until 2018. Photosynthetic bacteria, fungi,

algae, and plants can synthesize carotenoids de novo. Carotenoids are essential pigments

in photosynthetic organs along with chlorophylls. Carotenoids also act as photo-protectors,

antioxidants, color attractants, and precursors of plant hormones in non-photosynthetic

organs of plants (Maoka, 2020).

Carotenoids in animals play important roles such precursors of vitamin A, photo-

protectors, antioxidants, enhancers of immunity, and contributors to reproduction but

animals cannot synthesize carotenoids de novo. Therefore, those found in animals are either

directly accumulated from food or partly modified through metabolic reactions. So, animal

carotenoids show structural diversity. (Takashi, 2019).

 14

Despite the importance of carotenoid metabolism, understanding the mechanisms

of carotenoid absorption remains in progress and its molecular details have remained

elusive for long time. Nonetheless, there are already available reviews and completed

studies stating presence of putative or identified proteins that participates in the intestinal

membrane and cellular transport of vitamin A and carotenoids across the enterocyte (i.e.,

Scavenger Receptors or Cellular Retinol Binding Proteins, among others), among which is

the ubiquitous scavenger protein cluster determinant 36 also known as CD36 (Mousa et

al., 2010; Reboul, 2013).

CD36 is a 90 kDa single chain-membrane glycoprotein that is expressed at the

brush border mebrane (BBM) level of the duodenum and the jejunum (Terpstra et al., 2000)

and displays a broad substrate specificity (Reboul, 2013). It is assumed to play a key role

in fatty acid uptake in the intestine (Goudriaan et., 2002). It was shown that lipid secretion

in the lymph was decreased in CD36-deficient mice (Drover et al., 2005) as CD36 probably

allows the routing of the long-chain fatty acids to the endoplasmic reticulum for

chylomicron assembly in the enterocyte. Although the underlying mechanism is unknown,

it may be linked to the intracellular traffic of the protein between the plasma membrane

and the organelles. CD36 was involved in β-carotene uptake using transfected COS cells

and mouse BBM vesicles (Van Bennekum et al., 2005) in agreement with the finding that

a CD36-related protein is involved in selective carotenoid transport in Bombyx

mori (Sakudoh et al., 2010). In addition, CD36 has been shown to be involved in both

lycopene and lutein uptake in mouse 3T3-L1 adipocytes and in mouse adipose tissue

cultures (Moussa et al., 2010). It is noteworthy that CD36 colocalizes with other proteins
 15

such as caveolin-1 in lipid rafts (Ring et al., 2006). It is therefore possible that a cooperation

occurs between these proteins for lipid micronutrient uptake.

 METHODOLOGY

Experimental Treatments

The RNA samples that were used for the conduct of the present study were acquired

as an output or sample material from a recently conducted study on gene expression

analysis of selected genes associated to carotenoid uptake of red Nile tilapia as affected by

different carotenoid rich-diet (Gajeton, 2020). The treatments used from the

aforementioned study were prepared as follows:

Table 1. Experimental Treatments using commercial feeds supplemented with the

experimental plants Daucus carota, Ipomoea aquatica and Moringa oleifera.
Treatment Feed Diets
1 D. carota peel + commercial feeds

2 I. aquatica leaves + commercial feeds

3 M.oleifera leaves + commercial feeds

4 (Control) Pure commercial feeds

The red Nile tilapia was used as an experimental animal in the previous study. The

fishes were fed with the different treatment of feed formula that contains the selected

carotenoid-rich plant. Five representative red tilapias fed distinctly of each of the different

treatments were utilized for the study. After the allotted time and feeding schedule,

different parts of interest from the test animal were collected and extracted accordingly for

RNA sample. For the present study, intestinal samples were utilized as source of RNA.

Since there are four treatments applied in the study, in general, a total of 20 RNA samples

were used to carry out the CD36 gene expression analysis.

 17

Gene Expression Analysis of CD36

For the gene expression analysis, RNA extracted from the intestinal samples of red

tilapia which were drawn from different treatments were used. Intestinal RNA samples

were selected as material for the qRT-PCR analysis because the CD36 glycoprotein (gene

of interest), involved in β-carotene uptake, is being expressed at the brush border

membrane (BBM) level of the duodenum and the jejunum (Reboul, 2013). CD36 primers

used in the present study was lifted from a research conducted by Zhou and his colleagues

(2018) on nonadditive expression of lipid metabolism pathway-related genes in intestine

of Tilapia hybrids.

The CD36 gene expression assay was evaluated through qRT-PCR analysis and

was carried out in a reaction with a final volume of 10 μL containing 0.5 µl (10 µM) of the

CD36F primer (5 CCCAAAGCGAACGTCACATT 3), 0.5 µl (10 µM) of the CD36R

primer (5 ATGTGATGCTGGAGGAAGCAA 3), 5 μL of 2x KAPA FAST SYBR Kit

(KAPA Biosystems, USA), 0.2 μL RT mix, 2.8 μL RNAse free water and 1 μL RNA

sample. An internal standard of β-actin gene was used in the study. The qRT-PCR reaction

conditions were set as follows: initial hold at 42°C for 5 minutes, hold at 95°C for 2

minutes, followed by 40 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C

for 20 seconds and extension at 72°C for 20 seconds, before a final extension 72˚C for 5

minutes (Zhou et al., 2018).

 18

Data Gathered

To calculate the relative fold gene expression in the samples, resulting Critical

threshold (CT) values of CD36 gene in the samples measured through the utilization of the

qRT-PCR were gathered.

Statistical Analysis

The CT values of CD36 gene in the samples were used for the computation in Delta-

delta Ct method, also known as the 2-∆∆CT method. Likewise, data were also analyzed using

one-way Analysis of Variance (ANOVA) in a completely randomized design (CRD).

Comparison among means was conducted using the Tukey’s Honest Significant Difference

test (HSD) and all tests of significance were compared at 5% probability level.
 RESULTS AND DISCUSSION

Descriptive Statistics of CD36 Gene

The CT values can be used to determine the amount of target nucleic acid in a given

sample. In the present study, the CT values of the samples identified through the utilization

of the qRT-PCR were analyzed to determine the amount of CD36 present on the samples

that were subjected to the different treatments.

Figure 1 shows the mean CT value for the CD36 gene expression of the intestinal

samples of Red Nile Tilapia subjected to the different treatments.

28.00

27.00

26.00

25.00
CT Value

24.00

23.00

22.00

21.00

20.00
D. carota I. aquatica M. oleifera
Control
+ Feeds + Feeds + Feeds
Treatment

Figure 1. Mean CT value for the CD36 gene expression of the intestinal samples
of red Nile tilapia subjected to the different treatments.

Results of the study shows that there is a mean CT value of 24.81 for samples of

Red Nile Tilapia subjected in Treatment 1 (D. carota + feeds), a mean CT value of 26.72
 20

for samples subjected in Treatment 2 (I. aquatica + feeds), a mean CT value of 23.30 for

those subjected in Treatment 3 (M. oleifera + feeds), and a mean CT value of 22.60 for

those samples subjected in Treatment 4 (control). The mean CT value of all the samples

subjected in the different treatments were all less than 29. Therefore, there is a strong

positive reaction among samples indicating abundance of target nucleic acid which is the

CD36 in case of the present study. Among the treatments, Treatment 4 (control) yielded

the lowest mean CT value demonstrating the strongest positive reaction, followed by

Treatment 3 (M. oleifera + feeds), Treatment 1 (D. carota + feeds) and Treatment 2 (I.

aquatica + feeds) having the highest CT value.

Table 2 shows the mean CT value of the Red Nile Tilapia intestinal samples

subjected on the different treatments. All of the treatments caused an abundant

amplification of the CD36 gene. Analysis of Variance (Appendix Table 1) showed that

there is significant difference among treatments. Among the different plants that had been

evaluated, the lowest mean CT value of 22.60 was observed in the Treatment 4 (control).

Table 2. Mean CT value of the Red Nile Tilapia intestinal samples.

Treatments Mean Descriptive Amount of CD36
1 D. carota peel + commercial feeds 24.81bc abundant

2 I. aquatica leaves + commercial feeds 26.72c abundant

3 M.oleifera leaves + commercial feeds 23.30ab abundant

4 (Control) Pure commercial feeds 22.60a abundant

Means with the same letter superscript are not significantly different at the 5% level of significance by DMRT
 21

It is said that CT levels are inversely proportional to the amount of target nucleic

acid in the sample. That the lower the CT level, the greater the amount of target nucleic

acid in a given sample. With this, it only means that the control (Pure commercial feeds)

group contains the highest CD36 content among the samples which is comparable to

Treatment 3 (M. oleifera + feeds). Treatment 3 (M. oleifera + feeds) is also comparable

with Treatment 1 (D. carota + feeds) and that Treatment 1 being comparable with

Treatment 2 (I. aquatica + feeds), respectively.

The result of the study showing abundant expression of CD36 caused by the

different treatments can be attributed to the bioactive compounds present in the test plants,

specially carotenoids. The foliage, flowers, and immature pods of several M. oleifera

cultivars evaluated for bioactive compounds showed appreciable amount of carotenoid.

The highest content of total carotenoids is recorded in leaves, followed by immature pods

and flowers (Saini, 2016). On the other hand, a study conducted by Zaini and his

coresearchers (2012) in search of a potential treatment for leukemia, used D. carota to

prepare treatments that were applied for the study. D. carota was selected because of

having sufficient amount of important bioactive compounds among which includes Beta-

Carotene. Moreover, Ahmad and his colleagues (2019) who made a review on the

phytochemicals present in carrots also cited that carotenoids are found abundant in the

vegetable which contributes significantly to its dietary value. And as for I. aquatica,

which is a commonly grown green leafy vegetable, it was also reported as a rich

source of carotenes with many health benefits (Nagendra Prasad et al, 2008).
 22

Expression of CD36 gene as Affected by the Different Treatments

The ability of the selected carotenoid-rich diet to affect expression of CD36 gene

was also evaluated in the study. The red tilapia which served as test animal were fed with

particular plants having varied amount of carotenoid content and expected to contain

different types of carotenoid. With this, CD36 being identified as a transporter protein

which plays a crucial role in the absorption of vitamin A and carotenoids by the enterocytes

was assessed for different gene expression level as affected by the different prepared

treatments.

Figure 2 shows the expression of CD36 in the intestine of red tilapia as affected by

the different carotenoid-rich diet. Based on the results of the computed CD36 gene

expression in the intestinal samples using the 2-∆∆CT method, a down regulation is observed

among the treatments amended with carotenoid rich plants compared to the control.

0.12

0.10
Gene Expression

0.08

0.06

0.04

0.02

0.00
D. carota I. aquatica M. oleifera Control
+ Feeds + Feeds + Feeds
Treatment

Figure 2. Expression of CD36 in red tilapia intestines.

 23

CD36 is an ubiquitous scavenger receptor of 90 kDa single chain-membrane

glycoprotein It is considered among the genes that has potential roles in carotenoid

coloration in vertebrates via carotenoid uptake (Walsh et al., 2011). They are expressed at

the BBM level of the small intestine of animals.

Among the three test plants used in the study, D. carota is the most familiar source

and has long been known for its rich β-carotene content (Ahmad et al., 2019). And

associating such high β-carotene content of the plant with the functionality of the CD36

gene being involved in the uptake of β-carotene of brush border membrane vesicles (van

Bennekum et al., 2005) and in cellular uptake of lutein and lycopene (Moussa, 2010), one

would actually hypothesized that CD36 expression should be expected higher in amount

or expression on the red tilapia fed with D. carota compared to the other carotenoid rich

treatments. But the result of the present study turned out to be the other way around.

Moreover, though descriptive statistics of CD36 gene showed abundant amount of the

target gene in all the treatments, evaluation on the expression of CD36 gene in the intestine

of Red Nile Tilapia subjected in the different carotenoid rich diets were found lower

compared to the control (pure commercial feeds). Thus, they were down regulated.

Result of the study conducted by Kiefer et al (2002) showed that CD36 facilitates

cellular uptake of carotenoids in Drosophila. Moreover, CD36 was also reported being

involved in β-carotene uptake using transfected COS cells and mouse BBM vesicles (Van

Bennekum et al., 2005), in agreement with the finding that a CD36-related protein is

involved in selective carotenoid transport in Bombyx mori (Sakudoh et al., 2010).

 24

Though aforementioned results of different studies demonstrate involvement of

CD36 in carotenoid uptake, in contrast, there are also studies showing that this transporter

protein has little to no involvement in carotenoid uptake. During et al. (2005) reported that

addition of ezetimibe (an anti-CD36) in cell culture did not affect β-carotene transport

compared to application of an anti-SRBI (another scavenger protein) wherein SR-BI

inhibition resulted to reduced amount of β-carotene by 50% and lycopene by 20%. This

result shows that presence or absence of CD36 does not affect β-carotene transport. In line

with such findings, Werder et al. (2001) suggested that CD36 could play a role in the

selective uptake of sterols and thus, even selective uptake of carotenoid in the small

intestine. Moreover, the cellular uptake and efflux of carotenoids, like that of cholesterol,

likely involve not just CD36 but more other transporters. The selective mechanism of

CD36 and presence of other transporter that may facilitate transport of carotenoid from the

test plants to the red tilapia cells via the BBM instead of CD36 can be the underlying reason

on the results of the present study.

 SUMMARY, CONCLUSION AND RECOMMENDATION

Summary

Selected carotenoid rich plants - carrot (Daucus carota), water spinach (Ipomoea

aquatica) and horseradish (Moringa oleifera) were used for the preparation of experimental

treatments that were added on the feed diets of the red tilapia. The red tilapia that were

subjected on the aforementioned experimental diets for a period of time served as source

of intestinal samples and extracted RNA, respectively. The expression of the transporter

protein gene-CD36 in the intestine was analyzed through gene expression analysis using

qRT-PCR.

After conducting qRT-PCR, results showing descriptive statistics of CD36 gene in

the intestinal sample subjected to the different treatments revealed abundant level of the

target gene along all the treatments. Lowest CT value was observed in the control (22.60),

followed by Treatment 3 (M. oleifera + feeds), Treatment 1 (D. carota + feeds) and

Treatment 2 (I. aquatica + feeds) having the CT value of 22.30, 24.81 and 26.72,

respectively. It is said that CT levels are inversely proportional to the amount of target

nucleic acid in the sample. That the lower the CT level, the greater the amount of target

nucleic acid in a given sample. Statistical analysis on the CT value of the different

treatments also showed significantly different results. The control (Pure commercial feeds)

group contains the highest CD36 content among the samples which is comparable to

Treatment 3 (M. oleifera + feeds). Treatment 3 (M. oleifera + feeds) is also comparable

with Treatment 1 (D. carota + feeds) and that Treatment 1 being comparable with

Treatment 2 (I. aquatica + feeds), respectively.

 26

On the other hand, evaluation on the ability of the selected carotenoid-rich diet to

affect expression of CD36 gene showed that the control yields the highest expression of

the target gene (0.11), followed by Treatment 3 (0.09), Treatment 1 (0.03) and Treatment

2 (0.02), respectively. Feeding the red tilapia with the commercial feeds amended with

different carotenoid rich diets (Moringa oleifera, Daucus carota, Ipomea aquatica) caused

down-regulation of the target gene in the experimental animal compared to the control.

The selective mechanism of CD36 and presence of other transporter that may facilitate

transport of carotenoid from the test plants to the red tilapia cells via the BBM instead of

CD36 can be the underlying reason on the results of the present study.

Conclusion

Assessment of the resulting CT value after rt-QRT-PCR showed that target gene –

CD36 was found abundant in number in all of the intestinal samples subjected to the

different treatments. Though, feeding the red tilapia with the commercial feeds amended

with different carotenoid rich diets (Moringa oleifera, Daucus carota, Ipomea aquatica)

caused down-regulation of the target gene in the experimental animal compared to the

control.
 27

Recommendation

Based on the findings of this study, further study on the following are recommended:

1. evaluate other locally available carotenoid-rich plants for their ability to enhanced

pigmentation of red tilapia;

2. determine the expression of other genes linked to carotenoid uptake and

pigmentation of red tilapia;

3. and use other tissue samples like skin and muscle of the experimental animal for

evaluation of color enhancement;

 LITERATURE CITED

Ahmad, T., Cawood, M., Iqbal, Q., Ariño, A., Batool, A., Muhammad, R., . . . Akhtar, S.
(2019). Phytochemicals in Daucus carota and Their Health Benefits—Review
Article. Foods, 1-22.
Aquatic Community. (2008). Tilapia: Red Tilapia. Aquatic community.com.
Arous, W. H., El-Bermawi, N. M., Shaltout, O. E., & Essa, M. A. (2014). Effect of Adding
Carotenoid Sources on Growth Performance, Pigmentation, Stres Response and
Quality in Red Tilapia (Oreochromis Spp.). Middle East Journal of Applied
Sciences, 988-999.
Buttle, L. G., Crampton, V. O., & Williams, P. D. (2001). The effect of feed pigment type
on flesh pigment diposition and color in farmed atlantic salmon, Salmo salar L.
Aquaculture Research, 103-111.
BWO. (2013). Red nile tilapia propagation pushed. Manila, Philippines: Business World
Online.
Camacho, A. S., & Lagua, N. M. (2015). The Philippine Aquaculture Industry. Southeast
Asian Fisheries Development Center (SEAFDEC), 91-116.
Cedraz de Oliveira, H., Pinto Garcia , A., Gonzaga Gromboni, J., Vasconcelos Faris Filho,
R., Souza de Nascimento, C., & Arias Wenceslau, A. (2017). Influence of heat
stress, sex and genetic groups on reference genes stability in muscle tissue of
chicken. PLOS ONE, 1-15.
Connolly, J. (2013). Colors that influence food sales. California, United States of America.
Daget, J., Josse, J. P., Teugels, G., & Thys Audenaerde Evan den. (1991). Check-list of
freshwater fishes of Africa (CLOFFA). CLOFFA 4.
DOST-PCAARRD. (2013). Tilapia program bats for better look, bigger outlook for the red
nile tilapia. Los Baños City, Laguna.
Drover, V. A., Ajmal, M., Nassir, F., Davidson, N. O., Nauli, A. M., Sahoo, D., . . .
Abumrad, N. A. (2005). CD36 deficiency impairs intestinallipid secretion and
clearance chylomicrons from the blood. The Journal of Clinical Investigation,
1290-1297.
During, A., Dawson, H. D., & Harrison, E. H. (2005). Carotenoid transport is decreased
and expression of the lipid transporter SR-BI, NPC1L1 and ABCA1 is down
regulated in cac-2 cells treated with ezetimibe. The Journal of Nutrition, 2305-
2312.
 29

Eguia, R. V., & Eguia, M. R. (2016). Salt tolerant Nile tilapia production: Prospects in
aquaculture. Proceedings of the India Tilapia Summit, 263.
FAO. (2019). Cultured Aquatic Species Information Programme - Oreochromis niloticus
(Linnaeus, 1758). Fisheries and Aquaculture Department: Food and Agriculture
Organization of the United Nations.
FAO. (2019). Fishery and Aquaculture Country Profiles: The Republic of the Philippines.
Rome, Italy: Food and Agriculture Organization of the United Nations.
FAO. (2019). National Aquaculture Sector Overview - Philippines. Fisheries and
Aquaculture Department: Food and Agriculture Organization of the United
Nations.
Fitzsimmons, K. (2019). Invasive Species Compendium - Oreochromis niloticus Nile
Tilapia). University of Arizona, USA: CAB International.
Fitzsimmons, K. M. (2017). 2017 Supply and demand in tilapia markets and Vietnam's
role. Can Tho, Vietnam: Vietnam Aquaculture.
Fitzsimmons, K., Martinez-Garcia, R., & Gonzalez-Alanis, P. (2011). Why Tilapia is
becoming the most important food fish. Ninth International Symposium on Tilapia
in Aquaculture (pp. 8-16). Shanghai Ocean University, Shanghai, China: AquaFish
Collaborative Research Support Program.
Goudriaan, J. R., Dahlmans, V. E., Febbraio, M., Teusink , B., Romjin, J. A., Havekes, L.
M., & Voshol, P. J. (2002). Intestinal lipid absorption is not affected in CD36
deficient mice. Molecular and Cellular Biochemistry, 199-202.
Guerrero, R. D. (2019). Farmed tilapia production in the Philippines is declining: what has
happened and what can be done. Philippine Journal of Science, 11-15.
Gupta, S. K., Jha, A. K., Pal, A. K., & Venkateshwarlu, G. (2007). Use of natural
carotenoids for pigmentation in fishes. Naturall Product Radiance, 46-49.
Holmyard, N. (2018). Tilapia players debate industry future. Sea food source.
Johnson, E. A. (1989). A pigment source in salmonid feed. Feed Man, 18-21.
Josupeit, H. (2005). World market of tilapia. Rome, Italy: Globefish Research Programme,
FAO.
Kiefer, C., Sumser, E., Wernet, M. F., & Von Lintig, J. (2002). A class B scavenger
receptor mediates the cellular uptake of carotenoids in Drosophila. Proceedings of
the National Academy of Sciences, 10581-10586.
Lovshin, L. L. (2019). Criteria for Selecting Nile Tilapia. Department of Fisheries and
Allied Aquacultures, Auburn University, Alabama, USA.
 30

Maoka, T. (2020). Carotenoids as natural functional pigments. Journal of Natural

Medicine, Journal of Natural Medicine.
Meyers, S. P., & Sandersson, G. W. (1992). Natural pigment for salmon feeds. Feed Man,
12-20.
Moussa, M., Gouranton, E., Gleize, B., El Yazidi, C., Niot, I., Besnard, P., . . . Francois
Landrier, J. (2010). CD36 is involved in lycopene and lutein uptake of adipocytes
and adipose cultures. Molecular Nutrition: Food Research, 578-584.
Nagendra Prasad, K., Shivamurthy, G. R., & Aradhya, S. M. (2008). Ipomoea aquatica, An
Underutilized Green Leafy Vegetable:A Review. International Journal of Botany,
123-129.
Olalo, C. (2001). .Production, Accessibility and Consumption Patterns of Aquaculture
Products. In Production, Accessibility and Consumption Patterns of Aquaculture
Products in Asia: A CrossCountry Comparison. FAO Fisheries Circular 973. 275
p. Rome.
Pearson, K. (2017). Tilapia Fish: Benefits and Dangers. Healthline.
PSA. (2018). Philippine fisheries statistics. Quezon City, Philippines: Philippine Statistics
Authority.
Reboul, E. (2013). Absorption of Vitamin A and Carotenoids by the Enterocyte: Focus on
Transport Proteins . Nutrients, 3563-3581.
Ring , A., Le Lay, S., Pohl, J., Verkade, P., & Stremmel, W. (2006). Caveolin-1 is required
for fatty acid traslocase (FAT/CD36) localization and function at the plasma
membrane of mouse embryonic fibroblast. Biochimica et Biophysica Acta, 416-
423.
Rivera, R. (2016). Value-added products from Tilapia. Food Business Ideas,
Pinoybusiness.com.
Saini, R. K., Sivanesan, I., & Young-Soo, K. (2016). Phytochemicals of Moringa oleifera:
a review of their nutritional, therapeutic and industrial significance. Biotech, 1-14.
Sakudoh, T., Iizuka, T., Narukawa, J., Sezutsu, H., Kobayashi, I., Kuwasaki, S., . . . Takada,
N. (2010). A CD36-related transmembrane protein is coordinated with an
intracellular lipid-binding protein in selctive carotenoid transport fro cocoon
coloration. Journal of Biological Chemistry, 7739-7751.
Samson, N. P. (2016). Bigger and more appealing red tilapia developed. Retrieved from
Monthly Agriculture.
Samson, N. P. (2018). S&T Intervention: Develops bigger and more appealing red tilapia.
Business Diary Philippines, Aquabusiness.
 31

Takashi, M. (2019). Carotenoids as natural functional pigments. Journal of Natural

Medicines, 1-16.
Takashi, S., Tetsuya, I., Junko, N., Hideki, S., Isao, K., Seigo, K., . . . Kozo, T. (2013).
CD36 homolog divergence is responsible for the selectivity of carotenoid species
migration to the silk gland of the silkworm Bombyx mori. Journal of Lipid
Research, 482-495.
Tave, D. (1991). Genetics of body color in tilapia. Aquaculture Magazine, 76-79.
Tave, D., Lovell, R. T., Smitherman, R. O., & Rezk, M. (1990). Flesh and peritoneal lining
color of gold, bronze, and black Tilapia mossambica. Journal of Food Science, 255-
256.
Terpstra, V., van Amersfoort, E. S., van Velzen, A. G., Kuiper, J., & van Berkel, T. J.
(2000). Hepatic scavenger receptors: function in relation to disease.
Arteriosclerosis Thrombosis Vascular Biology, 1860-1872.
Vadhel, N. P., Pathan, J., Tandel, J. T., Lende, S., Alkolar, N., & Shrivastava, V. (2016).
Red Tilapia: A cnadidate Euryhaline Species for Aqua Farming in Gujarat. Journal
of Fisheries Sciences, 48-50.
van Bennekum, A., Werder, M., Thuahni, S. T., Chang-Hoon, H., Duong, P., Williams, D.,
. . . Helmut, H. (2005). Class B Scavenger Receptor-Mediated Intestinal Absorption
of Dietary β-Carotene and Cholesterol. Biochemistry, 4517-4525.
Walsh, N., Dale, J., McGraw, K. J., & Pointe, M. A. (2011). Candidate genes for carotenoid
coloration in vertebrates and their expression profiles in the carotenoid-containing
plumage and bill of a wild bird. Proceedings of the Royal Society, 58-66.
Werder, M., Han, C. H., Wehrli, E., Bimmler, D., Schultheless, G., & Hausser, H. (2001).
Role of scavenger SR-BI and CD#^ in selective sterol uptake in the small intestine.
. Biocehmistry, 11643-11650.
Wood, L. (2019). Global Tilapia Market Report 2019. Business Wire: A berkshire
Hathaway Company.
Yap, W. G. (2000). Rural Aquaculture in the Philippines. Bangkok: Regional Office for
Asia and the Pacific, Food and Agriculture Organization of the United Nations.
Yilmaz, S., Ergun, S., & Soytas, N. (2012). Enhancement of growth performance and
pigmentation in red Oreochromis mossambicus associated with dietary intake of
astaxanthin, paprika or capsicum. The Israeli Journal of Aquaculture, 1-7.
Zaini, R. G., Brandt, K., Clench, M. R., & Le Maitre, C. L. ( 2012). Effects of Bioactive
Compounds from Carrots (Daucus carota L.), Polyacetylenes,Beta-Carotene and
 32

Lutein on Human Lymphoid Leukaemia Cells. Anti-Cancer Agents in Medicinal

Chemistry, 640-652.
Zhou, Y., Zhang, X., Xu, Q., Yan, J., Yu, F., Xiao, J., . . . Zhong, H. (2018). Nonadditive
expression of lipid metabolism pathway-related genes in intestine of hybrids of Nile
tilapia females (Oreochromis niloticus) and blue tilapia males (Oreochromis
aureus). Molecular Biology Reports, 1-8.
APPENDICES
 34

APPENDIX I

Appendix Tables

Appendix Table 1. Analysis of Variance on the Mean CT value of the Red Nile Tilapia
intestinal samples
Sources of
Variation Sum of Squares df Mean Square F Sig.
Between Groups 49.846 3 16.615 12.282 .000
Within Groups 21.644 16 1.353
Total 71.490 19
 35

APPENDIX II

Appendix Figures

Appendix Figure 1. Preparation of qRT-PCR mix.

Appendix Figure 2. Loading of qRT-PCR mix and RNA

samples in the well.
 36

Appendix Figure 3. Running of qRT-PCR.