Hum Genet (1990) 84:228-232
9 Springer-Verlag 1990
Rapid detection of deletions in the Duchenne muscular dystrophy gene
by PCR amplification of deletion-prone exon sequences
M. Hentemann 1, J. Reiss t , M. Wagner l, and D. N. Cooper 2
11nstitut for Humangenetik der Universit~it,Gosslerstrasse 12d, D-3400 G6ttingen, Federal Republic of Germany
2Molecular Genetics Section, Thrombosis Research Unit, University of London, King's College Hospital School of Medicine, Denmark Hill,
London SE58RX, UK
Summary. Using the polymerase chain reaction (PCR) tech-
nique, we have screened the DNA of 42 patients with
Duchenne or Becker muscular dystrophy for deletions within
the DMD gene. Two regions within putative deletion "hot
spots" of this gene were tested, and deletions were found in
16.6% of patients. The oligonucleotide primers employed in
this study initiate the amplification of exon sequences and
were used to test the suitability and reliability of PCR in dele-
tion screening and prenatal diagnosis using various numbers
of cycles and artificial contamination ratios. We compared our
approach with both "multiplex DNA amplification" and
Southern blot analysis. A comparative evaluation of currently
available techniques is presented.
Introduction
Duchenne muscular dystrophy (DMD) is a recessive X-linked
degenerative disorder of muscle, affecting about 1 in 4000
live-born males (Moser 1984). Affected males are usually con-
fined to a wheelchair by the age of 12 and do not survive
beyond their late teens. The clinically milder and less frequent
Becker muscular dystrophy (BMD) is now known to be allelic
with DMD. The DMD/BMD gene has been mapped to Xp21
by RFLP linkage analysis (Davies et al. 1983) and by studies
of cytogenetically detectable deletions and various X/autoso-
mal translocations (Boyd and Buckle 1986). The full-length
DMD cDNA is 14 kb in length, and the gene comprises a total
of at least 75 exons spanning approximately 2300 kb of geno-
mic DNA (Mandel 1989). The availability of cloned intragenic
sequences as hybridization probes has provided us with pow-
erful tools for the detection of heterozygous carriers and for
the prenatal diagnosis of both DMD and BMD (Malhotra et
al. 1988; Darras et al. 1988; Darras and Francke 1988; Koenig
et al. 1988). With cDNA clones as probes, DMD gene dele-
tions have been shown to be the cause of the muscle dystrophy
in 50%-70% of DMD/BMD patients (Den Dunnen et al.
1987; Wapenaar et al. 1988;Koenig et al. 1987; Forrest et al.
1988; Liechti-Gallati et al. 1989; Hart et al. 1989).
The direct detection of deletions within the DMD gene
offers two great diagnostic advantages. Firstly, rapid and reli-
able prenatal diagnosis is readily accomplished, and secondly,
the risk of recombination events between linked RFLP mark-
Offprint requests to." J. Reiss
ers and the site of mutation, associated with indirect "gene
tracking", can be neglected. This risk is not negligible even
when intragenic RFLPs are employed, since recombination
occurs at high frequency due both to the large size of the
DMD gene and to the presence of intragenic recombination
hot spots (Forrest et al. 1987; Den Dunnen et al. 1987;
Wapenaar et al. 1988; Chen et al. 1989). Direct detection of
deletions ensures that diagnosis in sporadic cases is simplified
and that false prediction in prenatal diagnosis due to germ-line
mosaicism (Bakker et al. 1987; Wood and McGillivray 1988)
can be excluded.
Usually, RFLP linkage analysis and deletion screening is
carried out by Southern blot analysis, a time-consuming and
expensive procedure. One alternative to hybridization proce-
dures is the polymerase chain reaction (PCR) (Saiki et al.
1985), which has been applied to the detection of deletions
within the DMD gene by Chamberlain et al. (1988). Their ap-
porach involved the simultaneous amplification of six dele-
tion-prone exons within the DMD gene and was reportedly
capable of detecting the majority of DMD gene deletions.
However, intronic DNA sequence is required and this is not
always available.
In contrast to the above "multiplex" strategy, we have
selected only two sequences for amplification, representing
exon 8 and a region that, prior to confirmation by Chamber-
lain et al. (1988), was presumed to be an exon by repeat con-
figuration definition analysis (Koenig et al. 1988) and by refer-
ence to the splice-site consensus sequences in the cDNA
(Mount 1982). Our principal aim was to establish appropriate
reaction conditions for reliable diagnosis. To this end we have
tested various parameters, including the number of amplifica-
tion cycles and contamination ratios, and have employed an
optimized method for use in routine diagnosis.
Materials and methods
DNA was prepared from lymphocytes or chorionic villi by
standard phenol/chloroform extraction methods. Synthetic
oligonucleotide primers were prepared by the phosphoramidite
method on an automated DNA synthesizer (Applied Biosys-
terns, USA). Purification procedures included high-pressure
liquid chromatography (HPLC), detritylation, and repeated
co-evaporation with double-distilled water.
The polymerase chain reaction was essentially carried out
according to Kogan et al. (1987). The reaction volume was

Table 1. Description of oligonucleotides and summary of amplification results
Primer sequences
Pair1
5' G A T G T T G A T A C C A C C T A T C C A G 3'
5' TCTTTAGTCACTTTAGGTGGCC 3'
Pair 2
5' GCGGCAAACTGTTGTCAGAACA 3'
5' GGCATCTGTITTGAGGATTGC 3'
a Numbers follow scheme of Koenig et al. (1988) for full-length cDNA sequence
bDetected in Southern blots with probe ib as 7.5-kb HindlII fragment
cDetected in Southern blots with probe 7 as 0.5-kb HindIII fragment
50 ~tl with 1.5 mM of each dNTP and 25 pmol of each primer.
(1 • buffer was 16.6mM ammonium sulfate; 67mM TRIS-
HC1, pH 8.8 at 25~ 6.7mM magnesium chloride; 10mM [3-
mercaptoethanol; 6.7gM E D T A ; 170gg BSA/ml; and 10%
DMSO.) Annealing was conducted at 50~ for 40s; exten-
sion, at 63~ for 90 s; and denaturation, at 92~ for 40 s, using
water baths and a programmable robot arm (ROB 3, P & P
Elektronik, Ntirnberg, F R G ) to process the probes. We used
1.5 units Taq D N A polymerase (New England Biolabs, USA)
and 500 ng genomic D N A as a template.
Amplification was carried out for 20-30 cycles, using par-
affin to prevent evaporation. The final extensions were per-
formed for 10-15 min. Amplification products were analysed
on 10% polyacrylamide or 1.8% agarose gels. Usually one-
fifth of the amplified sample was enough to produce satisfac-
tory bands after electrophoresis.
Multiplex D N A amplification was carried out according to
Chamberlain et al. (1988). The reaction volume again was
501al, but 100 pmol of each primer for the 506-bp fragment
(corresponding to probe 8) and 50 pmol of each primer for the
other fragments were used. Southern blot analysis followed
standard protocols. The c D N A probes used in this study have
been described previously (Koenig et al. 1987). The plasmids
(ATCC, depositor L. Kunkel) were subcloned and labelled
with 32p-dATP for nick translation and with 32P-dCTP for ran-
dom-primed labelling after linearization. Purified inserts were
found to produce better signal/background ratios than com-
plete plasmids.
Of the 42 patients screened, 33 suffered from Duchenne
muscular dystrophy, 6 presented with a milder form, typical
for BMD, and 3 had a muscular disease of unknown aetiology.
Results
The sequences of the oligonucleotide primers used in this
study, the size of the amplification products, and the number
of deletions detected in our study are shown in Table 1. The
results of the PCR analysis of D N A from male patients and
corresponding controls are presented in Fig. 1. The amplifica-
tion of the 73-bp fragment (position 6670-6742 of the D M D
cDNA; Koenig et al. 1988) demonstrated that our original as-
sumption that the primer pair 2 encompassed an uninter-
rupted exon was correct. This assumption was based upon the
229
Amplification product Patients analysed Deletions detected (%)
42 1 (2.3%)
140 bp
Nucleotides
857-996 ~
(exon 8)b
42 6 (14.3%)
73 bp
Nucleotides
6670-6742 a
(repeat 19)c
I 2 3 4 5 6 7 8 9 10 11 12 13 14
Fig. 1. Amplification of the two deletion hot spots in the DMD gene.
Lanes 1, 7 positive controls (healthy male); lanes 5, 13 negative con-
trols (no DNA); lanes 2 - 4 male patients' DNA amplified with primer
pair 1; lanes 8-12 male patients' DNA amplified with primer pair 2;
lanes 6, 14 molecular weight standard (kb ladder, Bethesda Research
Laboratories, USA). Ten microliters of the amplified samples (25 cy-
cles) were separated on 10% acrylamide. Lanes 3, 8 and IO exhibit a
deletion
reported correspondence between sequence repeats and
exons (Koenig et al. 1988) whose boundaries are demarcated
by the exon consensus sequences C / A - A - G (donor site) and G
(acceptor site) (Mount 1982). In the meantime, confirmatory
sequence data have been reported (Chamberlain et al. 1988).
The two fragments described in Table 1 were co-amplified
in the same reaction by using twice the normal amount of Taq
D N A polymerase and a twofold higher concentration of
primer pair 1. Using these primers, we detected a deletion in
7 of 42 (17%) analysed patients (Table 1). The results were
confirmed by Southern blot analysis with the corresponding
c D N A probes. Using the multiplex D N A amplification meth-
od (Chamberlain et al. 1988) with six pairs of primers, we ad-
ditionally detected deletions in the D M D genes of eight other
patients (a total of 36%). One of these deletions was located
in the region detected by c D N A probe 7, which is not identical
to the region specified in Table 1; six occurred in the region
detected by c D N A probe 8; and one was located in the region
of probe 3 (Koenig et al. 1988) (Fig. 2).
Three patients in whom deletions were not apparent with
PCR analysis were shown to possess D M D gene deletions
230

1 2 3 t, 5 6 7 8 9 10 11 Table 3. Section of the DMD gene showing the deletions found and
the regions where the amplified fragments are localized (modified
according to Darras et al. 1988). The order of the fragments within
brackets has not been established
cDNA Exons b HindIII Multiplex Other No. of
probes a fragments ampli- fragments deletions
(kb) fication amplified detected
products in this
(bp) c study (bp)

1-2a 1 3.2
2 3.25
3 4.2
4 8.5
5 3.1
6 8.0
7 4.6
Fig. 2. Multiplex DNA amplification (Chamberlain et al. 1988). Lane 8/9 7.5 - - 3 6 0 140 1
1 positive control (healthy male); lane 10 negative control (no DNA),
lane 11 molecular weight standard (kb ladder, BRL), other lanes am- 10 10.5 d
plified DNA of DMD patients. Lanes 3, 4, and 6 exhibit deletions, 2b-3 11 10.5 d
which can be detected with primer pair 2 (Table 1); lanes 2 and 8 show 12 4.0
other deletions
13 6.6
14/15 2.7
16 6.0
Table 2. A comparison of methods for deletion screening in 42 unre-
17 1.7 - - ,416
lated DMD/BMD males
18 12.0 t

Method No. of (%) 19 3.0 - - ,159

deletions

PCR with primer pairs I and 2 a

found

7 (16.6)
5b-7
F,sl
18.0

0.45
+ Multiplex DNA amplification (6 pairs) b 15 (35.7)
ll.3.1
+ Southern blot analysis with cDNA probes
covering amplified regions ~ 19 (45.2) t.5
+ Southern blot analysis with other cDNA probes ~ 22 (52.4) 6.0
6.2
a This study
b Chamberlain et al. 1988
c Koenig et al. 1987
d Deletion screening as yet not complete 4.1 - - 268 l
0.5 - - 547 73, 3
10.0 d
w h e n c D N A p r o b e s were used t h a t e n c o m p a s s e s larger re- 8 10.0~
gions t h a n those amplified in the P C R reactions. O n e of these
deletions was d e t e c t e d by c D N A p r o b e l b , a n d t h r e e , by
3.8 _l 506 6
p r o b e 8 ( d a t a n o t shown). T h e deletions f o u n d using the dif-
1.6
f e r e n t d e t e c t i o n t e c h n i q u e s are s u m m a r i z e d in T a b l e 2.
3.7
T h e D N A of two of the t h r e e p a t i e n t s with an u n c h a r a c -
terized muscle disease exhibited a d e l e t i o n within the D M D / 3.1
B M D g e n e , w h e r e a s we were only able to d e m o n s t r a t e a dele- 7.0
tion in the D N A of two of the six B M D patients. O n e of the a Map according to Koenig et al. (1987)
l a t t e r deletions was f o u n d in the region of c D N A p r o b e 8 by b Distribution of exons with respect to HindIII fragments according to
multiplex D N A amplification, a n d one, only by hybridization, Koenig et al. (1988)
with c D N A p r o b e 8. Relative positions of amplified f r a g m e n t s c According to Chamberlain et al. (1988)
a n d c D N A p r o b e s can b e t a k e n from T a b l e 3. D e l e t i o n d Fragments hybridizing to both probes
s c r e e n i n g with the c o m p l e t e c D N A has not yet b e e n com-
pleted.
D e l e t i o n s c r e e n i n g via P C R is often h a m p e r e d by contami- chorionic villi samples ( R o b e r t s et al. 1988). W i t h 25 cycles,
n a t i o n with foreign D N A (e.g. Lo et al. 1988). In p r e n a t a l up to 2 % m a t e r n a l D N A c o n t a m i n a t i o n was f o u n d to be ac-
diagnosis, m a t e r n a l cell c o n t a m i n a t i o n is likely to cause the ceptable in so far as the diagnoses were u n a m b i g u o u s . How-
m o s t serious p r o b l e m s in this r e g a r d ( C h a m b e r l a i n et al. ever, after m o r e t h a n 30 cycles, e v e n a " c o n t a m i n a t i o n ratio"
1988). U s i n g 2 0 - 3 0 cycles a n d a d o p t i n g the conditions of 0.2% yielded a visible amplification product.
specified a b o v e , we s i m u l a t e d varying a m o u n t s of m a t e r n a l So far, one p r e n a t a l diagnosis has b e e n p e r f o r m e d with
cell c o n t a m i n a t i o n ( M C C ) (Fig. 3) as it could occur in s i m u l t a n e o u s use of multiplex D N A amplification a n d South-

Fig. 3a-c. Effect of cycle number and contaminationon PCR deletion
screening. Fragments were separated on 1.8% agarose. For simulated
contamination, DNA from the patient's mother was used in all cases:
a 20 cycles; b 25 cycles; c 30 cycles. Lane 1 mother of patient 1; lane 2
patient 1 (deletion detected with primer pair 1); lane 3 patient 1, 0.2%
contamination; lane 4 patient 1, 2.0% contamination; lane 5 patient 1,
20% contamination; lane 6 mother of patient 2; lane 7 patient 2 (dele-
tion detected with primer pair 2); lane 8 patient 2, 0.2% contamina-
tion; lane 9 patient 2, 2.0% contamination; lane 10 patient 2, 20%
contamination; lane 1I negative control (no DNA); lane 12 molecular
weight standard (kb ladder, BRL)
ern blot analysis. The fetal D N A did not exhibit a deletion in
the region detected by cDNA probe 8 as was found in the
D N A of the affected male relative (data not shown).
Discussion
We have demonstrated that the polymerase chain reaction is a
rapid, non-isotopic method of screening for DMD gene dele-
tions that requires only minimal amounts of patient DNA. Re-
gions of the DMD gene that are frequently deleted can easily
be amplified simultaneously. The PCR analysis is more rapid
and cost-effective than Southern blotting. In addition, specific
amplification of defined gene fragments of known length
avoids the common problem of co-migrating fragments on
Southern blots. The larger the gene, the more acute this prob-
lem is likely to become. However, some deletions may go un-
noticed if they lie beyond the limits of electrophoretic resolu-
tion. This notwithstanding, hybridization analysis must still be
carried out if no deletion is detected by PCR, since traditional
Southern blot analysis is capable of picking up additional dele-
tions.
In prenatal diagnosis, maternal cell contamination poses
an additional problem. Owing to the extreme sensitivity of the
PCR technique, its diagnostic application requires the com-
pletely reliable establishment of the procedure with multiple
controls. These controls should be performed side by side with
every diagnostic sample using pooled reaction mixtures. If suf-
ficient copies of the genomic target D N A are used, the
231
amplification reaction itself is unlikely to generate spurious re-
sults (Krawczak et al. 1989). We have established reliable pro-
cedures for the investigation of two portions of the DMD
gene, which together are the most promising targets for dele-
tion screening in Europeans.
Due to the extraordinarily large size of the DMD/BMD
gene, deletions detected in intronic regions cannot automati-
cally be regarded as the cause of the disease. Thus for diagnos-
tic purposes, screening must be confined to coding regions
(Bartlett et al. 1989). Further methodological improvements
are to be anticipated; indeed, only very recently the PCR
screening of another exon of the DMD/BMD gene has been
reported (Speer et al. 1989). We propose that the simultane-
ous amplification of exon sequences can form the basis of a
first rapid screen for mutation in the DMD gene. However,
for diagnostic purposes, Southern blot analysis still appears to
be the more reliable technique for diagnosis and must still be
employed as a second screen, where necessary.
Deletion screening is of great diagnostic value not only in
DMD/BMD patients but also in other muscular disorders. In
males presenting with "atypical" spinal muscular atrophy
(SMA), chronic limb-girdle syndrome, or other as yet un-
characterized muscle diseases, D N A studies should be in-
cluded in routine investigations since deletions within the
DMD/BMD gene in such cases (Clarke et al. 1989; Lunt et al.
1989; Norman et al. 1989) are being increasingly reported.
The search for exon splice junction sequences in cDNA se-
quence data and/or the use of repetitive sequence motifs of
presumably functional importance for the identification of
amplifiable regions could be extended to other regions of the
vast DMD gene worthy of investigation and might find appli-
cations elsewhere.
Acknowledgements. We thank U. Franke, M. Kulle, and U. Lenz for
excellent technical assistance and D. Immke for preparing the manu-
script.
References
Bakker E, Van Broeckhoven C, Bonten EJ, Van de Vooren MJ, Vee-
nema H, Van Hul W, Van Ommen GJB, Berghe A van den, Pear-
son PL (1987) Germline mosaicism and Duchenne muscular dys-
trophy mutations. Nature 329: 554-556
Bartlett RJ, Walker AP, Laing NG, Secore SL, Speer MC, Pericak-
Vance, Hung W-Y, Yamaoka LH, Siddique T, Kandt R, Roses
AD (1989) Inherited deletion at Duchenne dystrophy locus in nor-
mal male. Lancet I : 496-497
Boyd Y, Buckle V (1986) Cytogenetic heterogeneity of translocations
associated with Duchenne muscular dystrophy. Clin Genet
29: 108-115
Chamberlain JS, Gibbs RA, Ranier JE, Nguyen PN, Caskey CT
(1988) Deletion screening of the Duchenne muscular dystrophy
locus via multiplex DNA amplification. Nucleic Acids Res
23 : 11141-11156
Chen JD, Hejtmancik JF, Romeo G, Lindolf M, Boehm C, Caskey
CT, Kress W, Fischbeck KH, Dreier M, Serravalle S, Grimm T,
Kaariainen H, Ferrari M, Pfender E, Meng G, Chapelle A de la,
Melis MA, Muller B, MacKinley AG, Muller CR, Denton MJ
(1989) A genetic linkage map of five marker loci in and around the
Duchenne muscular dystrophy locus. Genomics 4 : 105-109
Clarke A, Davies KE, Gardner-Medwin D, Burn J, Hudgson P
(1989) Xp21 DNA probe in diagnosis of muscular dystrophy and
spinal muscular atrophy. Lancet I : 443
Darras BT, Francke U (1988) Normal human genomic restriction-
fragment patterns and the polymorphisms revealed by hybridiza-
tion with the entire dystrophin cDNA. Am J Hum Genet 43 : 612-
619
232
Darras BT, Blattner P, Harper JF, Spiro AJ, Alter S, Francke U
(1988) Intragenic deletions in 21 Duchenne muscular dystrophy
(DMD)/Becker muscular dystrophy (BMD) families with the dys-
trophin cDNA: location of breakpoints on HindIII and BgIII
exon-containing fragment maps, meiotic and mitotic origin of the
mutations. Am J Hum Genet 43 : 620-629
Davies KE, Pearson PL, Harper PS, Murray JM, O'Brien T, Safarazi
M, Williamson R (1983) Linkage analysis of two cloned DNA se-
quences flanking the Duchenne muscular dystrophy locus on the
short arm of the human X chromosome. Nucleic Acids Res 11 :
2303-2312
Den Dunnan JT, Bakker E, Klein Breteler EG, Pearsson PL, Van
Ommen GJB (1987) Direct detection of more than 50% of the
Duchenne muscular dystrophy mutations by field inversion gels.
Nature 329 : 640-642
Forrest SM, Cross GS, Speer A, Gardner-Medwin D, Burn J, Davies
KE (1987) Preferential deletion of exons in Duchenne and Becker
muscular dystrophies. Nature 329 : 638-640
Forrest SM, Cross GS, Flint T, Speer A, Robson KJH, Davies KE
(1988) Further studies of gene deletions that cause Duchenne and
Becket muscular dystrophies. Genomics 2:109-114
Hart KA, Abbs S, Wapenaar MC, Cole CG, Hodgson SV, Bobrow M
(1989) Molecular deletions in the Duchenne/Becker muscular dys-
trophy gene. Clin Genet 35:251-260
Koenig M, Hoffman EP, Bertelson C J, Monaco AP, Feener C, Kun-
kel LM (1987) Complete cloning of the Duchenne muscular dys-
trophy (DMD) cDNA and preliminary genomic organization of
the DMD gene in normal and affected individuals. Cell 50:509-
517
Koenig M, Monaco AP, Kunkel LM (1988) The complete sequence of
dystrophin predicts a rod-shaped cytoskeletal protein. Cell 53:
219-228
Kogan SC, Doherty M, Gitschier J (1987) An improved method for
prenatal diagnosis of genetic diseases by analysis of amplified
DNA sequences: application to hemophilia A. N Engl J Med 317:
985 -990
Krawczak M, Reiss J, Schmidtke J, Roessler U (1989) Polymerase
chain reaction: replication errors and reliability of gene diagnosis.
Nucleic Acids Res 17 : 2197-2201
Liechti-Gallati S, Koenig M, Kunkel LM, Frey D, Boltshauser E,
Schneider V, Braga S, Moser H (1989) Molecular deletion pat-
terns in Duchenne and Becker type muscular dystrophy. Hum
Genet 81 : 343-348
Lo YMD, Mehal WZ, Fleming KA (1988) False-positive results and
the polymerase chain reaction. Lancet II : 679
Lunt PW, Clumming WJK, Kingston H, Read AP, Mountford RC,
Mahon M, Harris R (1989) DNA probes in differential diagnosis
of Becker muscular dystrophy and spinal muscular atrophy. Lan-
cet I : 46-47
Malhotra SB, Hart KA, Klamut HJ, Thomas NST, Bodbrug SE,
Burghes HM, Bobrow M, Harper PS, Thompson MW, Ray PN,
Worton RG (1988) Frame-shift deletions in patients with
Duchenne and Becker muscular dystrophy. Science 242 : 755-759
Mandel JL (1989) The gene and its product. Nature 339:584-586
Moser H (1984) Duchenne muscular dystrophy: pathogenetic aspects
and genetic prevention. Hum Genet 66: 17-40
Mount SM (1982) A catalogue of splice junction sequences. Nucleic
Acids Res 10 : 459-472
Norman A, Coakley J, Thomas N, Harper P (1989) Distinction of
Becker from limb-girdle muscular dystrophy by means of dys-
trophin cDNA probes. Lancet I : 466-468
Roberts E, Duckett DP, Lang GD (1988) Maternal cell contamina-
tion in chorionic villus samples assessed by direct preparations and
three different culture methods. Prenat Diagn 8 : 635-640
Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA,
Arnheim N (1985) Enzymatic amplification of ct-globin genomic
sequences and restriction site analysis for diagnosis of sickle cell
anemia. Science 230 : 1350-1354
Speer A, Rosenthal A, Billwitz H, Hanke R, Forrest SM, Love D,
Davies KE, Coutelle C (1989) DNA amplification of a further
exon of Duchenne muscular dystrophy locus increases possibilities
for deletion screening. Nucleic Acids Res 17 : 4892
Wapenaar MC, Kievits T, Hart KA, Abbs S, Blonden LAJ, Den
Dunnen JT, Grootscholten PM, Bakker E, Verellen-Dumoulin C,
Bobrow M, Van Ommen GJB, Pearson PL (1988) A deletion
hotspot in the Duchenne muscular dystrophy gene. Genomics
2 : 101-108
Wood S, McGillivray BC (1988) Germinal mosaicism in Duchenne
muscular dystrophy. Hum Genet 78 : 282-284
Received May 23, 1989 / Revised August 22, 1989