JOURNAL OF BACTERIOLOGY, Nov. 1997, p. 6595–6601 Vol. 179, No.

21
0021-9193/97/$04.0010
Copyright © 1997, American Society for Microbiology

CelG from Clostridium cellulolyticum: a Multidomain Endoglucanase

Acting Efficiently on Crystalline Cellulose
LAURENT GAL,1 CHRISTIAN GAUDIN,1* ANNE BELAICH,1 SANDRINE PAGES,1
CHANTAL TARDIF,1,2 AND JEAN-PIERRE BELAICH1,2
Laboratoire de Bioénergétique et Ingénierie des Protéines, IBSM, Centre National de
la Recherche Scientifique,1 and Université de Provence,2 Marseille, France
Received 9 June 1997/Accepted 15 August 1997

The gene coding for CelG, a family 9 cellulase from Clostridium cellulolyticum, was cloned and overexpressed
in Escherichia coli. Four different forms of the protein were genetically engineered, purified, and studied: CelGL
(the entire form of CelG), CelGcat1 (the catalytic domain of CelG alone), CelGcat2 (CelGcat1 plus 91 amino
acids at the beginning of the cellulose binding domain [CBD]), and GST-CBDCelG (the CBD of CelG fused to
glutathione S-transferase). The biochemical properties of CelG were compared with those of CelA, an endo-
glucanase from C. cellulolyticum which was previously studied. CelG, like CelA, was found to have an endo
cutting mode of activity on carboxymethyl cellulose (CMC) but exhibited greater activity on crystalline
substrates (bacterial microcrystalline cellulose and Avicel) than CelA. As observed with CelA, the presence of
the nonhydrolytic miniscaffolding protein (miniCipC1) enhanced the activity of CelG on phosphoric acid
swollen cellulose (PASC), but to a lesser extent. The absence of the CBD led to the complete inactivation of the
enzyme. The abilities of CelG and GST-CBDCelG to bind various substrates were also studied. Although the
entire enzyme is able to bind to crystalline cellulose at a limited number of sites, the chimeric protein
GST-CBDCelG does not bind to either of the tested substrates (Avicel and PASC). The lack of independence
between the two domains and the weak binding to cellulose suggest that this CBD-like domain may play a
special role and be either directly or indirectly involved in the catalytic reaction.

Clostridium cellulolyticum is a mesophilic anaerobic bacte-
rium which is able to grow on cellulose as the sole carbon
source. The bacterium degrades this substrate by secreting
several enzymes. Five cellulase-encoding genes (celA, celC,
celD, celF, and celG) have been entirely sequenced, and an-
other (celE) has been partially sequenced (1, 4, 9, 27, 30). Four
of them, celA, celC, celD, and celF, have been overexpressed in
Escherichia coli, and the biochemical properties of the recom-
binant proteins have been completely characterized (10, 11, 28,
31). CelA, CelC, CelD, and CelF contain a catalytic core be-
longing to glycosyl hydrolase families 5, 8, 5, and 48, respec-
tively (15), and a dockerin domain which is involved in the
binding to the scaffolding protein CipC (24, 28). These en-
zymes are actually subunits of the cellulosome complex (12).
celG, a gene located downstream of celC in the large cel gene
cluster (1, 3, 4), codes for a 76-kDa protein harboring a cata-
lytic domain belonging to glycosyl hydrolase family 9, which is
followed by a putative cellulose binding domain (CBD) show-
ing similarities with family III CBDs (7). The CBD is in turn
followed by a dockerin domain specific to cellulosomal hydro-
lases (2).
In the present study, genetic engineering was carried with
a view to producing in E. coli (i) the mature form of CelG,
called CelGL (catalytic domain, putative CBD, and dockerin
domain); (ii) the catalytic domain alone, called CelGcat; and
(iii) a chimeric protein composed of glutathione S-transfer-
ase (GST) fused to the putative CBD of CelG, called GST-
CBDCelG. These proteins were purified to homogeneity, and
their biochemical properties were investigated. The degrada-
tion patterns of various substrates observed for CelG at various
* Corresponding author. Mailing address: Laboratoire de Bioéner-
gétique et Ingénierie des Protéines, CNRS, 31, Chemin Joseph
Aiguier, 13402 Marseille Cedex 20, France. Phone: (33) (0) 4 91 16 42
99. Fax: (33) (0) 4 91 71 33 21. E-mail: gaudin@ibsm.cnrs-mrs.fr.
concentrations were compared with those of CelA. The differ-
ent genetically engineered forms of CelG were tested to de-
termine whether they bind to substrates such as phosphoric
acid swollen cellulose (PASC), Avicel, and bacterial micro-
crystalline cellulose (BMCC). The synergistic action between a
truncated form of CipC (miniCipC1) and CelGL or CelA2
(entire CelA [11] and [24]) was also monitored.
MATERIALS AND METHODS
Bacterial strains and plasmids. C. cellulolyticum ATCC 35319 was used as the
source of genomic DNA. E. coli DH5a (Bethesda Research Laboratories) was
used as the host for pGEX-5X-2 (Pharmacia) derivatives and pET-22b(1) (No-
vagen) derivatives. E. coli BL21(DE3) (Novagen) was used as the host for the
pET-22b(1) derivative expression vector. C. cellulolyticum was grown anaerobi-
cally at 32°C on basal medium supplemented with cellobiose as the carbon and
energy source, and chromosomal DNA was obtained as previously described
(25). E. coli was grown at 37°C in Luria-Bertani (LB) medium supplemented with
ampicillin (100 mg/ml) when required.
Production of wild-type and various forms of CelG in E. coli. The various
genetic constructions which lead to the production of CelG and to various forms
of the protein are summarized in Fig. 1. The region of the celG gene between
nucleotides 109 and 1441 that encodes the mature catalytic domain of CelG
(defined by performing sequence comparison with other family 9 cellulases) was
amplified by PCR with primers containing restriction site (NdeI at the start of the
gene and XhoI at the end) to facilitate the in-frame cloning into the expression
vector. The oligonucleotide primer sequences were 59 CATCATATGGGAACA
TATAACTATGGAGAA 39 (primer 1, upstream) and 59 CCGCTCGAGAATC
GGATCTCCGCCAGA 39 (primer 2, downstream). The region of the celG gene
between nucleotides 109 and 2175, which encodes the entire mature CelG, was
amplified by PCR with primer 1 (upstream) and primer 3 (downstream; 59 GG
ACTCGAGGCCTTGAGGTAATTGGGT 39), which contains a XhoI site at the
end of the sequence. These two PCR products were cloned into pMOSBlue
vector (Amersham). Two recombinant plasmids, pLA1 and pLA2, corresponding
to PCR experiments 1 and 2, respectively, were selected, and the inserts were
sequenced to check that no mutations occurred during the PCR amplification.
After digestion of pLA1 with NdeI and XhoI, the DNA fragment encoding the
protein was cloned in frame into NdeI/XhoI-digested pET-22b(1), in which
unique BglII restriction site was previously deleted. The coding sequence of the
catalytic domain of CelG was fused in frame with a downstream sequence
encoding six histidine residues (His tag). The recombinant plasmid obtained was
named pLB1. The encoded part of CelG (CelGcat1) ended (C terminus) at I480

6595
 6596
GAL ET AL.

FIG. 1. Construction of the plasmids used to express CelG and various derivative recombinant proteins. SS, signal sequence; CD, catalytic domain; D, dockerin domain.
J. BACTERIOL.
VOL. 179, 1997
followed by the His tag. Since an NdeI site was located on the 39 end of celG (Fig.
1), the DNA insert of pLA2 was digested with restriction enzymes BglII and XhoI
and cloned in frame into BglII/XhoI-digested pLB1, yielding the recombinant
plasmid pLC1. The coding sequence of celG was fused in frame as for pLB1 with
a downstream sequence encoding the His tag. Plasmid pLC1 was digested by
restriction enzymes NcoI and XhoI, leading to the deletion of a 475-bp DNA
fragment coding for the last 155 amino acids (aa) of CelGL, corresponding to
half of the CBD and the entire dockerin domain. The linker 59 CATGGGA
TGTTC 39/59 TCGAGAACATCC 39 was inserted to replace the His tag of the
vector in frame. The plasmid obtained was named pLC1-T. The protein thus
obtained (CelGcat2) is 91 aa longer than CelGcat1, which contains only the
catalytic domain (Fig. 1). pLB1, pLC1, and pLC1-T were routinely kept in E. coli
DH5a. E. coli BL21(DE3) was used only for production of the recombinant
proteins.
The soluble proteins were produced as follows. Cells were grown at 37°C with
shaking in LB medium (2 liters) supplemented with glycerol (12 g/liter) and
ampicillin (100 mg/ml) until the optical density at 600 nm (OD600) reached 2.
They were stored on ice for 3.5 h and then at 15°C for a further 30 min without
shaking. Isopropyl-b-D-thiogalactopyranoside (IPTG) was added to a final con-
centration of 10 mM, and the cell culture was kept at 15°C with shaking for 17 h.
At this stage, the OD600 was about 6. The cells were harvested by centrifugation
(5,000 3 g, 15 min), resuspended in 80 ml of ice-cold 30 mM Tris-HCl buffer, pH
8 (THB), and broken twice in a French press. The crude extract was centrifuged
at 10,000 3 g for 15 min, and the supernatant was loaded onto a 30-ml Ni-
nitrilotriacetic acid column (Novagen) previously equilibrated with THB. The
column was washed with the same buffer and then with THB supplemented with
10 mM imidazole. His-tagged CelG was eluted with a 50 mM imidazole solution
in THB. The eluate was dialyzed and concentrated by ultrafiltration to 20 ml in
an Amicon concentrator with a 30K PTTK Millipore membrane and then loaded
onto a Q-Sepharose fast-flow column (30-ml bed volume; 18 by 2.5 cm; Phar-
macia). The active fraction was eluted with THB–200 mM NaCl at a flow rate of
3 ml/min and dialyzed as described above. The entire purification procedure was
carried out at 4°C.
Genetic construction encoding the chimeric protein GST-CBDCelG and pro-
duction in E. coli. The region of the celG gene between nucleotides 1444 and
1947, which encodes the putative CBD of CelG, was amplified by PCR with
primers containing BamHI and XhoI restriction sites. The primer sequences used
were 59 CGTGGGATCCCCAACTTCAAGGCTATCGAA 39 (upstream; prim-
er 4) and 59 CCCGCTCGAGTTAGGGTTCGTTACCGAATACTT 39 (down-
stream; primer 5). The latter primer introduces a stop codon before the XhoI
site. The PCR product was digested with BamHI and XhoI and cloned into the
corresponding sites of the pGEX-5X-2 vector, yielding plasmid pLD1. E. coli
DH5a was used as the recipient strain for the recombinant plasmid. The PCR
product and the junction with the GST gene were sequenced. The strain was
grown in LB medium supplemented with ampicillin (100 mg/ml) and glycerol
(12 g/liter) and incubated at 37°C until the OD600 reached 1.5. IPTG was then
added to a final concentration of 0.1 mM, and incubation continued at 25°C for
a further 12 h. The cells were harvested, suspended in phosphate-buffered saline
(PBS; 10.1 mM Na2HPO4, 1.8 mM KH2PO4, 0.14 M NaCl, 2.7 mM KCl buffer
[pH 7.3]), and broken in a French press. The crude extract was harvested at
10,000 3 g, and the supernatant was loaded on a glutathione-Sepharose 4B
column (Pharmacia). After two washes with PBS, the protein of interest was
eluted with reduced glutathione. Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis was performed to check the homogeneity of GST-CBDCelG, and
the enzymatic activity of the GST moiety was monitored.
Other recombinant proteins used. MiniCipC1 was produced and purified as
described by Pagès et al. (24). CelA2 (entire CelA) and CelA3 (CelA without the
dockerin domain) were produced and purified as previously described (11, 29).
Protein quantification. The protein concentrations were determined as de-
scribed by Lowry et al. (18), with fraction V bovine serum albumin (BSA; Merck)
as the standard.
Substrates used. Carboxymethyl cellulose, medium viscosity (CMC; Sigma),
barley glucan (Megazyme), laminarin (Sigma), xylan (Sigma), and lichenan (Sig-
ma) were prepared as 1% (wt/vol) solutions in 25 mM potassium phosphate
buffer, pH 7.0 (PPB). Avicel (Merck) was used at various concentrations from
1 to 10% (wt/vol) in PPB. PASC was prepared from Avicel as described by
Walseth (36); its concentration was estimated by performing dry weight mea-
surements and suitably adjusted to obtain a final concentration of 1% (wt/vol) in
PPB. BMCC was a generous gift from C. Boisset and B. Henrissat (CERMAV,
Grenoble, France); its concentration was adjusted to 0.2% (wt/vol) in PPB.
p-Nitrophenol (pNP)-glucose (pNPG) and pNP-cellobiose (pNPC) were pur-
chased from Sigma, and cellodextrins were purchased from Merck.
Enzyme assays. Carboxymethyl cellulase activity was assayed by mixing 1 ml of
enzyme solution at appropriate concentration with 4 ml of CMC solution at 37°C
(final concentration of CMC, 0.8%). Aliquots of 1 ml were collected at specific
intervals and stored on ice, and the reducing sugar contents were determined by
the ferricyanide method of Park and Johnson (26). One international unit (IU)
corresponds to 1 mmol of D-glucose equivalent released per minute. Since barley
glucan and laminarin solutions strongly react with the Park-Johnson ferricyanide
reagents, the enzymatic activities on these two substrates were therefore moni-
tored by using 50-ml (barley glucan) or 10-ml (laminarin) aliquots made up to
1 ml with PPB before measurement of the reducing sugars.
CelG FROM C. CELLULOLYTICUM 6597
Insoluble sugars such as xylan, Avicel, and lichenan were used at a final
concentration of 0.8% (wt/vol) (BMCC was used at 0.16%) in PPB. Aliquots of
1.5 ml were collected at specific intervals and centrifuged at 5,000 3 g for 5 min
at 4°C. The reducing sugar content of 1 ml of supernatant was determined as
described above.
Chromogenic substrates such as pNPG and pNPC were used at 0.1% (wt/vol)
in PPB. The enzymatic activities were determined at 37°C by monitoring the pNP
released at 400 nm.
To determine the degradation patterns of natural cellodextrins ranging from
degree of polymerization (DP) 6 to DP 2, 200-ml aliquots of a cellodextrin
solution (from 0.1 to 2.5 g/l in PPB diluted five times) were mixed at 37°C with
enzyme (from 16 to 200 mg/ml, final concentration). Aliquots of 75 ml were
collected at various times, heated at 90°C for 5 min, and filtered, and 50 ml was
loaded onto a Resex-oligosaccharide column (20 by 1 cm; Interchim) heated at
50°C for high-pressure liquid chromatography analysis (Varian). The mobile
phase was water, and the flow rate was 0.25 ml/min. The sugars were detected
with an R.I.4 refractive index detector (Varian), and the collected data were
analyzed by means of an LC Star workstation from Varian. The retention times
of the cellodextrins were determined by loading onto the column a mix contain-
ing 5 mg of DP 1 to DP 6 cellodextrins in the same buffer as described above. The
same method was also used to identify the sugars released by CelG (from 25 to
400 mg/ml, final concentration) on Avicel, PASC, and laminarin (0.8% [final
concentration] in each case); 50-ml aliquots of the reaction mixture were loaded
onto the column.
Binding assays. The experiments were performed as described previously (12).
Various quantities of protein were incubated with various quantities of Avicel for
30 min in PPB, under slow shaking at 4°C in 1-ml final volume, and then
centrifuged at 5,000 3 g for 15 min. In the case of CelGL and GST-CBDCelG
binding assays, the free protein fraction was estimated from the residual enzy-
matic activity in the supernatant, and BSA (1 mg/ml) was added to the reaction
tube to prevent any nonspecific interactions from occurring. In the case of
CelGcat, the protein concentration in the supernatant was determined by the
Lowry method, and therefore no BSA was added. In all experiments, the bound
fraction was estimated by subtracting the protein concentration of the free
fraction in the supernatant from the initial protein concentration.
Viscosimetric assays. Viscosimetric assays were performed by monitoring the
flow time of the 0.8% CMC solution incubated with various quantities of enzyme
at different times. The relative fluidity DF was determined by using the formula
DF 5 [T0/(T09 2 T0)] 2 [T0/(T 2 T0)], where T0 is the flow time measured for
the buffer, T09 is the flow time of the CMC solution without enzyme, and T is the
flow time of the CMC solution with enzyme. The relative fluidity was plotted
versus the reducing sugar content released.
Synergistic assays. In all the assays, a final PASC concentration of 0.8% was
used. In the assays with the miniCipC1-CelGL or miniCipC1-CelA2 complex, the
proteins were mixed together in equimolar (0.02 mM miniCipC1 and 0.02 mM
CelGL or CelA2) amounts or with a 500-fold excess of miniCipC1 (10 mM
miniCipC1 and 0.02 mM CelGL or CelA2) at 4°C for 5 min prior to incubation
with the substrate. In the assay with the cellulose pretreated with miniCipC1, the
substrate was incubated with 0.46 nmol of miniCipC1 per mg of substrate for
30 min at room temperature. The substrate was then extensively washed with
water in order to remove miniCipC1, equilibrated with buffer, and then used to
test the activity of CelGL or CelA2. Aliquots were pipetted at specific intervals,
and the reducing sugar contents were determined as described above.
RESULTS
Production of the entire and various forms of CelG. To
prevent the formation of inclusion bodies which commonly
occurred when the large form of CelG was produced from
pLC1 at 37°C with 1 mM IPTG, wide ranges of growth and
induction conditions were tested. Inductions were performed
at an OD600 of 1 or 2 for various times ranging from 2 to 17 h
and at various temperatures ranging from 15 to 37°C. IPTG
concentrations ranging from 1 mM to 1 mM were also tested.
The optimum conditions for the production of soluble recom-
binant proteins were obtained by inducing the culture at an
OD600 of 2 with 10 mM IPTG and incubating the cells at 15°C
for 17 h. The same conditions were subsequently used to pro-
duce the various forms of CelG (CelGL, CelGcat1, and Cel-
Gcat2) in E. coli.
Purification of CelGL. Samples of 30 g (wet weight) of cells
were used for purification as described in Materials and Meth-
ods. The purification pathway is summarized in Table 1. This
purification was performed as fast as possible in order to pre-
vent the C-terminal degradation which usually occurs with C.
cellulolyticum cellulases (10, 11, 28). From 2 liters of culture, 29
6598 GAL ET AL. J. BACTERIOL.

TABLE 1. Purification of CelGL from E. coli extract

CMCasea CMCase Purifi-
Protein Yield
Fraction activity sp act cation
(mg) (%)
(IU) (IU/mg) (fold)

Crude extract 1,045 3,038 0.34 100 1

Ni-nitrilotriacetic acid 344 75 4.6 33 13.5
Q-Sepharose 309 29 10.6 29.5 31.2
a
CMCase, carboxymethyl cellulase.

mg of active CelGL protein purified to homogeneity was ob-

tained. The results of N-terminal microsequencing of this frac-
tion (i.e., GTYNY) matches the sequence deduced from the
nucleotide sequence. The recombinant protein has an appar-
ent mass of 76 kDa on sodium dodecyl sulfate-polyacrylamide
gel electrophoresis, which is in good agreement with its theo- FIG. 2. Degradation pattern of cellodextrins by CelGL. Products of degra-
retical mass (76.109 kDa). The apparent pI of CelGL is 4.6. dation of cellodextrins ranging from cellotriose (G3) to cellohexaose (G6) were
This protein is inactivated by storage at 270 or 220°C and identified and quantified by high-pressure liquid chromatography. From their
therefore must be stored at 4°C with 0.3% NaN3. Under these compositions, the cleavage sites were deduced. The bold, thin, and dashed
arrows correspond to the main, second, and third sites of cleavage, respectively.
conditions, in 1 to 2 weeks, and as previously observed for
CelA (11), CelC (10), and CelF (28), a partial hydrolysis oc-
curs, yielding a mixture of the entire protein and a shortened
protein which lacks the dockerin domain. Using the properties cellulases of C. cellulolyticum characterized thus far (10, 11, 28,
of the His tag present in the entire CelG, we separated the two 31).
forms on a nickel column. The shortened protein was therefore The pattern of cellodextrin degradation by CelGL is sum-
named CelGS. Contrary to what was observed with CelA (11), marized in Fig. 2. The final products of degradation are cello-
CelC (10), and CelF (28), the loss of the dockerin domain had biose and glucose. Since the activity of CelGL toward cello-
no effect on the activity of CelG on the various tested sub- dextrins depends on the DP, the best substrate is cellohexaose.
strates. Since no subsequent proteolysis was observed, CelGS The degradation of G4 and G3 was relatively slight compared
was further used to make comparisons with CelA3, a previously to that of G6 or G5.
engineered dockerinless form of CelA (29). The sugars released upon incubation of CelGL with PASC
Catalytic properties of CelGL. The specific activities of or Avicel PH101 were identical; i.e., G5 and G4 were released
CelGL toward various substrates were tested. The results are in an initial phase (0 to 30 min), and then G3, G2, and G1
summarized in Table 2. The highest specific activities were accumulated in a subsequent phase (after 2 to 3 h of incuba-
obtained with barley glucan and CMC. CelGL showed no ac- tion).
tivity toward laminarin, xylan, and chromogenic substrates Catalytic properties of CelGcat. The catalytic domain of
such as pNPG or pNPC but was able to degrade lichenan, CelG (CelGcat1) was produced and purified to estimate its
Avicel, PASC, BMCC, and natural cellodextrins with DP rang- degree of dependence on other domains. Various concentra-
ing from 6 to 3. tions of this protein were used to test CMC, Avicel, and PASC
The apparent Km and Vmax of CelGL toward CMC medium degradation. In any case, the fact that no reducing sugars were
viscosity and Avicel were found to be 8.7 g/liter and 2,000 released indicates that this polypeptide was inactive on these
IU/mmol and 17.8 g/liter and 5 IU/mmol, respectively. The Km substrates. The catalytic domain, however, appeared to be cor-
and Vmax of CelGL toward cellopentaose (DP 5) are 1.7 g/liter rectly marked out in view of the only family 9 crystal structure
and 670 IU/mmol. published so far (three-dimensional structure of CelD from C.
The optimum pH and temperature are pH 7.0 and 50°C. thermocellum, [17]). In the case of CelD, the catalytic residue
These values are similar to those obtained with the other E555 was followed by the last a helix (I558 to A569). In CelG,
E455 corresponds to E555 of CelD, and the sequence between
C458 and A469 may correspond to the last a helix of the cata-
TABLE 2. Specific activities of CelGL toward various substrates lytic domain. The celG gene was truncated to code for a pro-
tein containing the first 479 residues, being therefore 10 resi-
% Activity dues longer than the catalytic domain expected to lie from
Sp act
Substratea Bond type of the best
(IU/mmol) residues G1 to A469, as suggested by the crystal structure of
substrate
CelD (17). A longer peptide, containing in addition the first 91
Barley glucan b-1,4, b-1,3 1,350 100.0 aa of the putative CBD, CelGcat2, was produced and purified
CMC medium viscosity b-1,4 1,170 86.7 in the same way. It was slightly active on CMC (0.5 IU/mmol of
Lichenan b-1,4, b-1,3 140 10.4 protein, corresponding to about 1/2,000 of the activity of
PASC b-1,4 38 2.8
Avicel b-1,4 5 0.4
CelGL). It emerged clearly that the catalytic domain cannot
BMCC b-1,4 9 0.7 efficiently hydrolyze CMC and that more than half of the
Laminarin b-1,3 NDb ND second domain of the protein is required to obtain a fully
Xylan b-1,4 ND ND active enzyme.
pNPG b-1,4 ND ND Binding assays. We tested the binding of CelGL, CelGcat1,
pNPC b-1,4 ND ND and GST-CBDCelG to PASC, Avicel, and BMCC. Neither
a
Concentrations used were 0.8% except for BMCC (0.16%) and pNPG and
GST-CBDCelG nor CelGcat1 was able to bind to these sub-
pNPC (0.1%). strates, even over a wide range of substrate and protein con-
b
ND, no detectable activity. centrations. The entire protein, CelGL, was able to bind to
VOL. 179, 1997
FIG. 3. Changes in relative fluidity of the CMC solution (8 g/liter) versus
reducing sugars released during CMC hydrolysis by CelGS at 0.018 (F) and 0.036
nmol/ml (E) and by CelA3 at 0.015 (■) and 0.030 nmol/ml (h).
Avicel. A reciprocal plot using a 5% (final concentration) so-
lution of Avicel (data not shown) indicated the existence of two
classes of sites, characterized by the following parameters: Kd
of 0.12 mM and 4 nmol of sites/g of Avicel; and Kd of 7.4 mM
and 95 nmol of sites/g. These properties seem to reflect a
binding weaker than that of the CBD of miniCipC1, which was
found (on 0.5% Avicel solution) to have a number of sites as
high as 280 nmol/g and a Kd of 0.13 mM (25).
Comparison between the catalytic properties of CelGS and
CelA3. The activities of CelGS and CelA3 were compared on
CMC, PASC, Avicel, and BMCC. In each assay, various quan-
tities of proteins were incubated with the substrate and the
activities were calculated as described in Materials and Meth-
ods. The specific activity of CelA3 on CMC (11) was higher
FIG. 4. Comparison between cellulase activities of CelGS (■) and CelA3 (h) on PASC (8 g/liter; A), Avicel (8 g/liter; B), and BMCC (1.6 g/liter; C). RS, reducing
sugars.
CelG FROM C. CELLULOLYTICUM 6599
than that of CelGS. Viscosimetric assays on CMC incubated
for various times with high concentrations of CelGS or CelA3
yielded similar profiles (Fig. 3). It is clear that both enzymes
have the same endo mode of action. Nevertheless, CelGS and
CelA3 exhibited quite different insoluble cellulose degradation
activities, as shown in Fig. 4. On PASC, which is cellulose with
a low degree of crystallinity, CelA3 exhibited greater activity
than CelGS. The activities on Avicel and BMCC, which are
more crystalline than PASC, were also monitored. On Avicel,
CelGS and CelA3 had similar initial degradation rates (Fig. 4B
and 5); but the degradation process of CelGS continued longer
than that of CelA3. A study using a wide range of concentra-
tions of the two enzymes and long incubation times confirmed
this observation (Fig. 5). With CelGS, there seemed to be
more sites on Avicel that were accessible for hydrolysis than in
the case of CelA3. When Avicel was incubated with both
CelGS and CelA3, no synergism was observed. Therefore nei-
ther enzyme seems to generate additional hydrolyzable sites
for the other. On BMCC, which is one of the most crystalline
substrates available, the activity of CelGS was 20-fold higher
than that of CelA3. The sites present on BMCC were appar-
ently not accessible or not easily accessible by CelA3, whereas
CelGS degraded this substrate efficiently and extensively (Fig.
4C). Moreover, the rate of BMCC hydrolysis by CelG was
faster than that of Avicel (Table 2 and Fig. 4).
Effects of miniCipC1 on CelGL activity. Evidence was re-
cently obtained (25) that the presence of the nonhydrolytic
miniscaffolding protein (miniCipC1) enhances the activity of
CelA (both CelA2 and CelA3) on insoluble celluloses. To com-
pare the activities of CelGL and CelA2 on PASC in presence
of miniCipC1, two sets of experiments were carried out. First,
the specific activity of both enzymes bound to miniCipC1 was
monitored and compared with that of each of the enzymes
alone. Incubation with 0.02 mM miniCipC1 yielded a 1.3-fold
enhancement of the specific activity of CelA2 but had no effect
on the specific activity of CelGL. When a 500:1 ratio of
miniCipC1 to enzyme was used, the specific activity of CelA2
was markedly (6.7-fold) enhanced, whereas with CelGL, only a
1.7-fold increase was observed. The action of miniCipC1 on
substrate (25) was therefore not as beneficial to CelGL as to
CelA2. To check this assumption, the substrate was incubated
with miniCipC1 before addition of CelA2 or CelGL. A 2.7-fold
increase in the specific activity of CelA2, similar to that previ-
ously observed by Pagès et al. (25), was recorded; the increase
6600 GAL ET AL.
FIG. 5. Comparison between the Avicel degradation observed at various concentrations of CelGS (F) and CelA3 (■). RS, reducing sugars released after 6 and 24 h
of incubation of enzymes with the substrate.
was 1.5-fold in the case of CelGL. These results suggest that
complex formation has various effects on cellulase activity,
probably due to differences in the mode of action of the en-
zymes, and that the new sites exposed on the substrate by the
action of miniCipC1 do not enhance the activity of CelGL as
much as for CelA2.
DISCUSSION
The catalytic properties of CelG were tested on various
substrates and compared with those of the other C. cellulolyti-
cum cellulases characterized so far (10, 11, 28). Like CelA and
CelC, CelG can be considered an endoglucanase, since the
enzyme hydrolyzes CMC, its preferential substrate, with a lin-
ear correlation between the reducing sugars released and the
increase in the relative fluidity of the CMC solution similar to
that observed with CelA (Fig. 3). CelG differs from CelA and
CelC, however, in that it shows significantly greater activity
toward crystalline cellulose, especially BMCC. The level of
degradation of BMCC by CelA was very low, and the reaction
stopped after 1 h, whereas CelG efficiently hydrolyzed this
substrate and continued to do so at the same rate for at least
6 h. The activity on crystalline substrates was similar to that
observed with CelF. CelG is slightly more active, however, than
the processive endocellulase CelF on BMCC (28). The effi-
ciency of CelG on both soluble and crystalline cellulose might
reflect an important role for this protein in cellulolytic pro-
cesses. This double efficiency was previously found for two
closely related cellulases, CelZ (Avicelase I) from C. sterco-
rarium (6) and CenB from Cellulomonas fimi (34). In the case
of C. stercorarium, it seems that the synergism between only
two components (CelZ and CelY) can explain the complete
solubilization of crystalline cellulose by this organism (5, 8).
Comparisons between the sequence of CelG and those of
other cellulases showed that this enzyme is a multidomain
protein composed of a family 9 catalytic domain followed by a
putative family III CBD and a dockerin domain. Only the
entire form (CelGL) and the form which has lost its dockerin
domain (CelGS) were able to hydrolyze cellulosic substrates
and to bind to Avicel. The binding to Avicel occurred at only
a relatively small number of sites however, and CelG cannot be
purified by means of the cellulose affinity chromatography pro-
cess commonly used in the case of enzymes harboring the
J. BACTERIOL.
CBD. Although it appeared to be trimmed correctly, the cat-
alytic domain alone was unable to hydrolyze CMC, Avicel, or
PASC and to bind cellulose. A very weak hydrolytic activity
was measured on CMC when the first 91 aa of the putative
CBD were conserved. On the other hand, the chimeric protein
GST-CBDCelG was unable to bind to either Avicel or PASC
under conditions where the CBDs of the scaffolding proteins
CipA and CipC, which are also family III CBDs, showed a
strong affinity for these substrates (22, 25). It therefore appears
likely that the catalytic domain and the putative CBD of CelG
may not be independent and that both may be required to
maintain the catalytic activity and the binding properties.
Structural studies will be necessary to fully understand the
interactions between the two domains.
The putative CBD of CelG (CBDCelG) exhibits strong ho-
mologies with family III CBDs. In the study by Tormo et al.
(35), sequence comparisons on family III CBDs showed that
this family could be subdivided into three subfamilies. Subfam-
ilies IIIa and IIIb are relatively closely related compared to
subfamily IIIc in which CBDCelG can be classified. Scaffolding
proteins CipA from C. thermocellum (13), CbpA from C. cel-
lulovorans (32), and CipC from C. cellulolyticum (24) possess a
subfamily IIIa CBD which binds very efficiently to cellulose. It
has been established (25) that the CBD of CipC plays a double
role: it anchors CipC to the substrate and has disrupting effects
on the cellulose, leading to the exposure of new sites that can
be hydrolyzed by the cellulolytic enzymes. The C-terminal
CBDs of CelZ from C. stercorarium, which was demonstrated
to bind very efficiently to cellulose (16), CelI from C. thermo-
cellum (14), and both CBDs of CelA from Caldocellum sac-
charolyticum (33) belong to subfamily IIIb. The exact function
of the subfamily IIIc CBDs is not clear, however. In the case of
the family 9 cellulases harboring subfamily IIIc CBD, only the
cellulosomal enzyme CelF from C. thermocellum (23) possesses
a single CBD as does CelG from C. cellulolyticum. The other
cellulases such as CenB from C. fimi (19), CelZ from C. ster-
corarium (16), and CelI from C. thermocellum (14) contain
another CBD belonging to subfamily IIIb (CelZ and CelI) or
to family II (CenB). Although subfamily IIIc CBD of CenB
alone was reported to be able to bind to cellulose (20), it seems
that the role of this domain cannot be restricted to this binding
property; previous studies mentioned that it is “required for
full activity” (20) and that it constitutes with the catalytic core
VOL. 179, 1997
“a compact protease-resistant module” (21). One hypothesis is
that the subfamily IIIc CBDs may have diverged from subfam-
ilies IIIa and IIIb and that the main role of this domain is not
that of anchoring the enzyme to the substrate. This evolution-
ary divergence may have affected the three-dimensional struc-
ture of the domain, since polyclonal antibodies raised against
CBDCelG failed to cross-react with CBDCipC (12). The two
cellulosomal enzymes, CelF from C. thermocellum and CelG,
which contain a subfamily IIIc CBD, bind to cellulose via the
subfamily IIIa CBD of the scaffolding protein, whereas in non-
cellulosomal enzymes, the subfamily IIIc CBD is accompanied
by other CBDs which were shown to efficiently bind to cellu-
lose. In the case of CelG, the presence of this domain might
confer on the protein the ability to degrade crystalline sub-
strates.
As previously described (12), CelG is a component of the
cellulosome of C. cellulolyticum. Two other genes, celH and
celJ, have been recently sequenced in our laboratory (3), and
the corresponding proteins CelH and CelJ exhibit a pattern of
organization similar to that of CelG, i.e., a family 9 catalytic
domain followed by a subfamily IIIc CBD and a dockerin
domain. This redundancy among enzymes of the same type
could be of importance for the complete solubilization of the
crystalline cellulose. We now plan to carry out further studies
on the latter proteins and their interactions with the other
components of cellulosomes.
ACKNOWLEDGMENTS
We are grateful to E. A. Bayer for providing information about the
structure of family III CBDs and for helpful discussions. We are
indebted to J. Blanc and H.-P. Fierobe for critical reading of the
English manuscript.
This research was supported by grants from the Centre National de
la Recherche Scientifique, the Université de Provence, the EEC (BIO-
TECH contract BIO-CT-94-3018), and the Région Provence-Alpes-
Côte d’Azur.
REFERENCES
1. Bagnara-Tardif, C., C. Gaudin, A. Bélaich, P. Hoest, T. Citard, and J.-P.
Bélaich. 1992. Sequence analysis of a gene cluster encoding cellulases from
Clostridium cellulolyticum. Gene 119:17–28.
2. Béguin, P., J. Millet, and J.-P. Aubert. 1992. Cellulose degradation by Clos-
tridium thermocellum: from manure to molecular biology. FEMS Microbiol.
Lett. 79:523–528.
3. Bélaich, A., C. Gaudin, L. Gal, S. Pagès, C. Tardif, and J.-P. Bélaich. 1997.
Unpublished data.
4. Bélaich, J.-P., C. Tardif, A. Bélaich, and C. Gaudin. The cellulolytic system
of Clostridium cellulolyticum. J. Biotechnol., in press.
5. Bronnenmeier, K., H. Adelsberger, F. Lottspeich, and W. L. Staudenbauer.
1996. Affinity purification of cellulose-binding enzymes of Clostridium ster-
corarium. Bioseparation 6:41–45.
6. Bronnenmeier, K., and W. L. Staudenbauer. 1990. Cellulose hydrolysis by a
highly thermostable endo-1,4-b-glucanase (Avicelase I) from Clostridium
stercorarium. Enzyme Microb. Technol. 12:431–436.
7. Coutinho, J. B., N. R. Gilkes, R. A. J. Warren, D. G. Kilburn, and R. C.
Miller, Jr. 1992. The binding of Cellulomonas fimi endoglucanase C (CenC)
to cellulose and Sephadex is mediated by the N-terminal repeats. Mol.
Microbiol. 6:1243–1252.
8. Creuzet, N., J.-F. Berenger, and C. Frixon. 1983. Characterization of exo-
glucanase and synergistic hydrolysis of cellulose in Clostridium stercorarium.
FEMS Microbiol. Lett. 20:347–350.
9. Faure, E., A. Bélaich, C. Bagnara, C. Gaudin, and J.-P. Bélaich. 1989.
Sequence analysis of the Clostridium cellulolyticum endoglucanase-A-encod-
ing gene, celCCA. Gene 84:39–46.
10. Fierobe, H.-P., C. Bagnara-Tardif, C. Gaudin, F. Guerlesquin, P. Sauve, A.
Bélaich, and J.-P. Bélaich. 1993. Purification and characterization of endo-
glucanase C from Clostridium cellulolyticum. Catalytic comparison with en-
doglucanase A. Eur. J. Biochem. 217:557–565.
11. Fierobe, H.-P., C. Gaudin, A. Bélaich, M. Loutfi, E. Faure, C. Bagnara, D.
Baty, and J.-P. Bélaich. 1991. Characterization of endoglucanase A from
Clostridium cellulolyticum. J. Bacteriol. 173:7956–7962.
12. Gal, L., S. Pagès, C. Gaudin, A. Bélaich, C. Reverbel-Leroy, C. Tardif, and
CelG FROM C. CELLULOLYTICUM 6601
J.-P. Bélaich. 1997. Characterization of the cellulolytic complex (cellulo-
some) produced by Clostridium cellulolyticum. Appl. Environ. Microbiol.
63:903–909.
13. Gerngross, U. T., M. P. Romaniec, T. Kobayashi, N. S. Huskisson, and A. L.
Demain. 1993. Sequencing of a Clostridium thermocellum gene (cipA) en-
coding the cellulosomal SL-protein reveals an unusual degree of internal
homology. Mol. Microbiol. 8:325–334.
14. Hazlewood, G. P., K. Davidson, J. I. Laurie, N. S. Huskisson, and H. J.
Gilbert. 1993. Gene sequence and properties of CelI, a family E endoglu-
canase from Clostridium thermocellum. J. Gen. Microbiol. 139:307–316.
15. Henrissat, B., and A. Bairoch. 1996. Updating the sequence-based classifi-
cation of glycosyl hydrolases. Biochem. J. 316:695–696.
16. Jauris, S., K. P. Rucknagel, W. H. Schwarz, P. Kratzsch, K. Bronnenmeier,
and W. L. Staudenbauer. 1990. Sequence analysis of the Clostridium sterco-
rarium celZ gene encoding a thermoactive cellulase (Avicelase I): identifi-
cation of catalytic and cellulose-binding domains. Mol. Gen. Genet. 223:258–
267.
17. Juy, M., A. G. Amit, P. M. Alzari, R. J. Poljak, M. Claeyssens, P. Béguin, and
J.-P. Aubert. 1992. Three-dimensional structure of a thermostable bacterial
cellulase. Nature 357:89–91.
18. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein
measurements with the Folin phenol reagent. J. Biol. Chem. 193:265–275.
19. Meinke, A., C. Braun, N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and R. A.
Warren. 1991. Unusual sequence organization in CenB, an inverting endo-
glucanase from Cellulomonas fimi. J. Bacteriol. 173:308–314.
20. Meinke, A., N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and R. A. Warren.
1991. Multiple domains in endoglucanase B (CenB) from Cellulomonas fimi:
functions and relatedness to domains in other polypeptides. J. Bacteriol.
173:7126–7135.
21. Meinke, A., M. Schmuck, N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and
R. A. Warren. 1992. The tertiary structure of endo-b-1,4-glucanase B
(CenB), a multidomain cellulase from the bacterium Cellulomonas fimi.
Glycobiology 2:321–326.
22. Morag, E., A. Lapidot, D. Govorko, R. Lamed, M. Wilchek, E. A. Bayer, and
Y. Shoham. 1995. Expression, purification, and characterization of the cel-
lulose-binding domain of the scaffolding subunit from the cellulosome of
Clostridium thermocellum. Appl. Environ. Microbiol. 61:1980–1986.
23. Navarro, A., M. C. Chebrou, P. Beguin, and J.-P. Aubert. 1991. Nucleotide
sequence of the cellulase gene celF of Clostridium thermocellum. Res. Mi-
crobiol. 142:927–936.
24. Pagès, S., A. Bélaich, C. Tardif, C. Reverbel-Leroy, C. Gaudin, and J.-P.
Bélaich. 1996. Interaction between the endoglucanase CelA and the scaf-
folding protein CipC of the Clostridium cellulolyticum cellulosome. J. Bac-
teriol. 178:2279–2286.
25. Pagès, S., L. Gal, A. Bélaich, C. Gaudin, C. Tardif, and J.-P. Bélaich. 1997.
Role of scaffolding protein CipC of Clostridium cellulolyticum in cellulose
degradation. J. Bacteriol. 179:2810–2816.
26. Park, J. T., and M. J. Johnson. 1949. A submicrodetermination of glucose.
J. Biol. Chem. 181:149–151.
27. Reverbel-Leroy, C., A. Bélaich, A. Bernadac, C. Gaudin, J.-P. Bélaich, and C.
Tardif. 1996. Molecular study and overexpression of the Clostridium cellu-
lolyticum celF cellulase gene in Escherichia coli. Microbiology 142:1013–1023.
28. Reverbel-Leroy, C., S. Pagès, A. Bélaich, J.-P. Bélaich, and C. Tardif. 1997.
The processive endocellulase CelF, a major component of the Clostridium
cellulolyticum cellulosome: purification and characterization of the recombi-
nant form. J. Bacteriol. 179:46–52.
29. Roig, V., H.-P. Fierobe, V. Ducros, M. Czjzek, A. Bélaich, C. Gaudin, J.-P.
Bélaich, and R. Haser. 1993. Crystallization and preliminary X-ray analysis
of the catalytic domain of endoglucanase A from Clostridium cellulolyticum.
J. Mol. Biol. 233:325–327.
30. Shima, S., Y. Igarashi, and T. Kodama. 1991. Nucleotide sequence analysis
of the endoglucanase-encoding gene, celCCD, of Clostridium cellulolyticum.
Gene 104:33–38.
31. Shima, S., Y. Igarashi, and T. Kodama. 1993. Purification and properties of
two truncated endoglucanases produced in Escherichia coli harbouring Clos-
tridium cellulolyticum endoglucanase gene celCCD. Appl. Microbiol. Bio-
technol. 38:750–754.
32. Shoseyov, O., M. Takagi, M. A. Goldstein, and R. H. Doi. 1992. Primary
sequence analysis of Clostridium cellulolyticum cellulose binding protein A.
Proc. Natl. Acad. Sci. USA 89:3483–3487.
33. Te’o, V. S., D. J. Saul, and P. L. Bergquist. 1995. celA, another gene coding
for a multidomain cellulase from the extreme thermophile Caldocellum
saccharolyticum. Appl. Microbiol. Biotechnol. 43:291–296.
34. Tomme, P., E. Kwan, N. R. Gilkes, D. G. Kilburn, and R. A. J. Warren. 1996.
Characterization of CenC, an enzyme from Cellulomonas fimi with both
endo- and exoglucanase activities. J. Bacteriol. 178:4216–4223.
35. Tormo, J., R. Lamed, A. J. Chirino, E. Morag, E. A. Bayer, Y. Shoham, and
T. A. Steitz. 1996. Crystal structure of a bacterial family-III cellulose-binding
domain: a general mechanism for attachment to cellulose. EMBO J. 15:
5739–5751.
36. Walseth, C. S. 1952. Occurrence of cellulase in enzyme preparations from
microorganisms. TAPPI 35:228–233.