Sie sind auf Seite 1von 8

NOMBRE: ALEXANDRA LIZET ELIAS AYLLON

SECUENCIAS DE ADN DE UN MISMO GEN MITOCONDRIAL

1)Cavia porcellus strain ATCC CRL-1405 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial

GenBank: HM102293.1

GenBank Graphics

>HM102293.1 Cavia porcellus strain ATCC CRL-1405 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial

GGTGCTTGAGCTGGTATAGTAGGTACTGCCCTAAGCTTGTTAATTCGAGCAGAACTGGGCCAGCCCGG
AA

CACTCTTAGGCGATGATCAAATTTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATTTTCTTCAT

GGTTATACCAATTATAATTGGAGGCTTCGGAAACTGGTTAGTGCCCTTAATAATTGGTGCTCCAGACAT
A

GCATTTCCGCGGATAAATAACATAAGCTTTTGACTCCTTCCCCCTTCATTTTTACTACTGTTATCCTCAT

CTATAGTCGAAGCTGGTGCTGGAACCGGGTGGACTGTTTACCCTCCTTTAGCAGGAAACCTGGCACATG
C

TGGGGCTTCCGTAGACCTAACTATTTTTTCACTTCACTTGGCAGGTGTCTCTTCAATCCTTGGAGCAATC

AACTTTATTACAACTATCATTAACATAAAACCACCTGCAATAACGCAATATCAAACACCATTATTTGTTT

GGTCGGTACTAATTACTGCCGTTCTCCTTCTTTTATCCTTACCAGTTCTAGCTGCAGGTATTACAATGCT

ATTAACAGATCGAAATTTGAATACAACCTTTTTCGATCCTGCTGGGGGAGGGGACCCTATTCTGTATCA
A

CACTTGTTC

2)Felis catus voucher Cat_KU cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
GenBank: MN124254.1

GenBank Graphics PopSet

>MN124254.1 Felis catus voucher Cat_KU cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial

TACTCTTTACCTTCTATTTGGTGCCTGAGCTGGCATGGTGGGGACTGCTCTTAGTCTCCTAATCCGGGCC

GAACTGGGTCACCCTGGCACACTGCTAGGAGACGATCAGATTTATAATGTGATCGTCACCGCTCATGCT
T

TTGTAATGATCTTCTTTATGGTGATGCCTATTATGATCGGAGGGTTCGGAAACTGATTGGTCCCATTACT

AATTGGTGCCCCTGACATAGCGTTTCCCCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCATCCTTT

CTACTCTTACTCGCCTCATCTATGGTAGCAGCCGGAGCAGGAACCGGATGGACAGTATACCCGCCCCTA
G

CCGGGAACCTGGCTCATGCGGGAGCATCCGTAGACCTAACTATTTTCTCACTACACCTGGCAGGTGTCT
C

CTCAATCTTGGGTGCTATTAATTTTATTACTACTATGATTAATATAAAACCTCCTGCCATGTCTCAATAT

CAAACACCCCTATTTGTTTGATCAGTCTTAATCACTGCTGTCCTGTTACTTCTATCACTCCCAGTTTTAG

CAGCGGGAATCACT

3)Loxodonta cyclotis voucher ELE-1 cytochrome oxidase subunit I (COI) gene, partial cds;
mitochondrial

GenBank: KF482457.1

GenBank Graphics PopSet

>KF482457.1 Loxodonta cyclotis voucher ELE-1 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial

ACTGCTTTTAGTATCCTAATTCGGGCAGAACTAGGTCAGCCAGGCTCTCTTCTTGGAGACGACCAAATCT

ATAATGTTGTTGTCACAGCACACGCCTTTGTAATAATCTTCTTTATAGTTATGCCAATTATAATTGGAGG

CTTTGGAAACTGGCTAATTCCACTTATAATCGGAGCACCTGATATAGCTTTTCCTCGAATAAACAATATG

AGTTTTTGACTACTGCCTCCATCTTTCCTACTACTTTTAGCATCCTCCATAGTAGAAGCTGGGGCAGGCA

CTGGTTGGACCGTATACCCTCCCCTGGCAGGAAACCTGGCCCATGCAGGAGCTTCTGTAGATTTAACTA
T

TTTTTCACTTCACCTTGCAGGAGTATCCTCTATTCTAAGTGCAATTAATTTTATCACTACCATTATCAAC
ATAAAACCTCCAGCTATGTCTCAATATCATATACCCTTATTTGTATGGTCCATTTTAATTACAGCCATCC

TTCTCCTTCTATCCCTCCCAGTTCTAGCAGCAGGTATTACAATATTATTAACGGATCGTAATCTCAATAC

TACTTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTATATCAACATCTATTCTGATTTTTTGGCCAC

CCAGAA

4)Panthera pardus voucher B42_LEO NNP cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial

GenBank: MN124276.1

GenBank Graphics PopSet

>MN124276.1 Panthera pardus voucher B42_LEO NNP cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial

AACTCTTTACCTTCTATTCGGTGCCTGGGCTGGCATGGTGGGGACTGCTCTCAGTCTCTTCATCCGAGCC

GAACTGGGTCAACCTGGCACGCTACTAGGGGACGACCAAATTTATAATGTAGTCGTCACCGCCCATGCC
T

TTGTAATAATCTTCTTTATAGTAATGCCTATTATGATTGGAGGATTCGGAAACTGATTGGTTCCACTAAT

AATTGGAGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTCTGACTCCTTCCCCCGTCTTTC

CTACTTTTGCTCGCATCATCGAGCGTAGAGGCTGGAGCAGGGACTGGATGGACAGTACACCCACCTCT
AG

CCGGCAACCTAGCTCATGCAGGAGCATCCGTAGATCTAACTATTTTTTCACTACACCTAGCAGGTGTCCC

CTCAATCTTAGGTGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCTGCTCTATCCCAATAT

CAAACACCCCTGTTTGTCTGATCGGTTTTAATCACTGCTGTATTGCTACTTCTATCACTACCAGTTTTAG

CAGCAGGCATCACTATACTACTGACAGATCGAAATCTGAACACCACATTTTTTGACCCCGCCGGAGGAG
G

GGATCCTATCTTATATCAGCACCTATTC

5)Ovis aries voucher Lamb_OD cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial

GenBank: MN124247.1

GenBank Graphics PopSet


>MN124247.1 Ovis aries voucher Lamb_OD cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial

CACCCTTTACCTTCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCCTTAAGCCTACTAATTCGCGCC

GAACTAGGCCAACCCGGAACTCTACTCGGAGATGACCAAATCTACAACGTAATTGTAACCGCACATGCA
T

TTGTAATAATTTTCTTTATAGTAATGCCTATTATAATCGGTGGATTCGGCAACTGACTAGTTCCTCTGAT

AATTGGAGCCCCTGATATAGCATTTCCTCGGATAAATAACATAAGCTTTTGACTTCTTCCCCCATCTTTC

CTGTTACTCCTAGCATCCTCTATGGTTGAGGCCGGAGCAGGAACAGGTTGAACCGTATACCCTCCTCTA
G

CAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTAACTATTTTCTCCCTACATCTGGCAGGTGTCTC

TTCAATTCTAGGAGCCATTAATTTTATTACAACTATTATTAATATAAAACCCCCTGCGATGTCACAGTAT

CAAACCCCCTTGTTTGTATGATCTGTACTAATTACTGCCGTACTTCTCCTTCTCTCACTTCCTGTATTAG

CAGCTGGTATCACAATACTACTAACGGACCGAAACCTGAATACAACCTTTTTTGACCCAGCAGGAGGAG
G

AGACCCTATCCTATATCAACACCTATTC

6)Columba livia breed Egyptian Baladi cytochrome oxidase subunit I (COI) gene, partial cds;
mitochondrial

GenBank: MG271864.1

GenBank Graphics

>MG271864.1 Columba livia breed Egyptian Baladi cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial

TTAGCCTCCTCATCCGAGCAGAACTGGGACAACCCGGTACCCTCCTAGGAGATGACCAGATCTATAATG
T

AATCGTCACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTTATACCAATCATAATTGGGGGCTTTGGA

AACTGATTAGTTCCCCTCATAATTGGTGCCCCCGACATAGCATTCCCCCGGATGAACAACATAAGCTTCT

GGCTCCTACCCCCATCCTTCCTTCTACTTCTAGCCTCCTCCACAGTCGAAGCTGGTGCAGGAACAGGATG

AACCGTCTACCCTCCCCTAGCTGGCAACCTAGCTCACGCCGGAGCCTCTGTAGACCTTGCCATCTTCTCC

CTTCACCTTGCTGGTATCTCCTCTATTCTAGGGGCCATCAACTTCATCACAACTGCCATTAACATAAAAC

CCCCAGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCAGTCCTCATCACTGCCGTCCTCCTTTT
ACTATCCCTCCCAGTACTTGCCGCCGGCATCACAATACTGCTCACAGACCGAAACCTAAACACTACCTTC

TTTGATCCTGCTGGTGGAGGGGACCCAGTACTATACCAACATCTCTTCTGATTCTTTGGTCACCCTGAAG

TCTATATCCTAATTTTACCAGGATTTGGAAT

7)Capra hircus voucher Goat_OD cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial

GenBank: MN124246.1

GenBank Graphics PopSet

>MN124246.1 Capra hircus voucher Goat_OD cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial

CACCCTCTACCTTCTGTTCGGTGCCTGAGCTGGCATAGTAGGGACCGCCTTGAGCTTACTAATTCGCGCC

GAACTAGGTCAACCCGGAACCCTACTTGGAGATGACCAGATCTACAATGTAATTGTAACTGCACACGCA
T

TCGTAATAATTTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGACTAGTCCCTCTAAT

AATTGGAGCCCCCGATATAGCATTTCCTCGGATAAATAATATAAGCTTTTGACTCCTTCCCCCCTCTTTC

CTATTACTTCTAGCATCCTCTATAGTTGAAGCCGGAGCAGGAACAGGTTGAACCGTATATCCTCCTCTAG

CAGGTAATCTAGCCCATGCAGGAGCCTCAGTAGACCTAACTATTTTTTCCCTACACCTAGCAGGCATCTC

TTCAATTCTAGGAGCCATTAATTTTATCACAACTATCATTAACATGAAACCACCCGCAATATCACAATAT

CAAACTCCCCTGTTTGTGTGATCTGTCTTAATTACTGCCGTACTACTCCTCCTTTCACTTCCTGTATTAG

CAGCTGGCATCACAATACTACTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAG
G

AGACCCTATTTTATATCAACACCTATTC

8)Equus caballus cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial

GenBank: EU834862.1

GenBank Graphics PopSet


>EU834862.1 Equus caballus cytochrome oxidase subunit I (COI) gene, partial cds;
mitochondrial

TAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCCTACTAGGAGATGATCAGATCTACAATG
T

TATTGTAACCGCCCATGCATTCGTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGA

AACTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAATAAACAACATAAGCTTCT

GATTACTTCCCCCATCATTCCTACTTCTTCTCGCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTG

AACCGTATATCCTCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCATTTTCTCT

CTCCACCTGGCTGGGGTGTCCTCGATTTTAGGTGCCATCAACTTTATTACCACAATCATTAACATAAAAC

CACCAGCTCTATCCCAATATCAAACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCT

CCTAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGTAACCTAAACACTACTTTC

TTCGACCCCGCAGGAGGAGGGGATCCAATCCTTTATCAACACCTATTC

9)Bovine mitochondrial cytochrome oxidase subunit II and Asp- and Lys-tRNA genes

GenBank: M10544.1

GenBank Graphics

>M10544.1 Bovine mitochondrial cytochrome oxidase subunit II and Asp- and Lys-tRNA genes

GAGGTGTTAGTAAAACATTATATAATTTTGTCAAAGTTAAGTTACAAGTGAAAGTCCTGTACACCTCATA

TGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCA

TGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACG

ACAAAGCTGACCCATACAAGCACGATAGATCCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGC
CA

TCATCTTAATTCTAATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATC

TCTTACAGTAAAAACCATAGGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAG
C

TTGGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAAT
C

GAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAG
C
TGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAACCAAACAACCCTTATATCGTC
C

CGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATACCCATTGTCC

TTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCAATATTATAAAATCACTAAGAAGCTAT

ATAGCACTAACCTTTTAAGTTAGAGATTGAGAGCCATATACTCTCCTTGGTGA

10)Sus scrofa domesticus cytochrome oxidase subunit I (COI) gene, complete cds;
mitochondrial

GenBank: KT372092.1

GenBank Graphics PopSet

>KT372092.1 Sus scrofa domesticus cytochrome oxidase subunit I (COI) gene, complete cds;
mitochondrial

ATGTTCGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATTTGGTG

CCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGGTCAGCCCGGAACC
CT

ACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGCCTTTGTAATAATCTTCTTTATAGTA

ATACCCATTATGATTGGGGGTTTTGGTAACTGACTCGTACCGCTAATAATCGGAGCTCCCGATATGGCC
T

TTCCACGTATAAACAACATAAGTTTCTGACTACTTCCACCATCCTTCCTATTACTACTGGCATCCTCAAT

AGTAGAAGCCGGGGCGGGTACTGGATGAACCGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAG
GA

GCTTCAGTTGATCTAACAATTTTCTCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGCTATTAATT

TCATTACCACAATTATTAACATAAAACCTCCCGCAATGTCTCAATACCAAACACCCCTGTTTGTCTGATC

AGTACTAATCACAGCCGTACTACTTCTACTATCCCTGCCAGTTCTAGCAGCTGGCATTACTATACTACTG

ACAGACCGCAACCTGAACACAACCTTTTTTGATCCAGCAGGTGGTGGAGACCCTATCCTTTATCAACACT

TGTTCTGATTTTTCGGACACCCAGAAGTATATATTCTCATCTTACCAGGGTTCGGAATAATCTCCCACAT
TGTAACCTACTATTCAGGTAAAAAAGAACCATTTGGATATATAGGCATAGTATGAGCCATAATGTCCAT
T

GGATTCTTAGGTTTTATCGTATGGGCTCACCACATATTCACCGTAGGAATAGACGTGGATACCCGAGCA
T

ACTTTACATCTGCCACAATAATCATTGCTATTCCCACTGGAGTAAAAGTATTTAGTTGATTAGCTACCCT

GCACGGCGGCAATATTAAATGATCACCCGCAATACTATGAGCTCTGGGCTTCATCTTCCTATTCACCGTA

GGAGGTCTAACGGGCATTGTACTAGCTAACTCCTCCCTAGACATTGTATTACATGATACATATTATGTAG

TCGCACACTTCCACTATGTCTTATCTATAGGAGCAGTGTTTGCCATTATAGGGGGCTTTGTTCACTGATT

CCCCGTATTCTCCGGGTACACACTCAACCAAGCATGAGCAAAAATTCACTTTGTAATTATATTCGTAGGA

GTAAATATAACATTCTTTCCACAACACTTTCTAGGACTATCCGGAATACCTCGACGATACTCCGATTATC

CTGACGCATACACAGCATGAAATACTATTTCCTCAATAGGCTCATTCATCTCACTAACAGCAGTGATATT

AATAATTTTCATTATCTGAGAAGCATTTGCATCAAAACGAGAAGTATCTGCAGTAGAACTGACAAGCAC
A

AACCTAGAATGACTACACGGATGTCCTCCTCCCTATCACACATTTGAAGAACCAACATATATCAACCTAA