Sie sind auf Seite 1von 10

Grundpraktikum in Biochemie

im Wintersemester 09/10

Rheinische Friedrich – Wilhelms – Universität Bonn

Protokoll zum

Versuch

PCR-Klonierung

eingereicht von

Durchführung:

Zunächst wird eine DNA-Klonierung mittels PCR durchgeführt, wobei im Anschluß daran
per Agarose-gel-elektrophorese eine Verlaufskontrolle zur Überprüfung des Erfolgs der PCR
und danach die Aufreinigung des PCR-Produktes mittels Qiagen PCR Purification Kit
durchgeführt wird.
Das aufgereinigte PCR-Produkt und ein Plasmid als Vektor werden nun einem
Restriktionsschnitt mit den Restriktionsendonucleasen HindIII und XbaI unterworfen, um den
Vektor an der Multicloning site zu öffnen und dazu das zugehörige Insert darzustellen. Im
Anschluß daran wird der geschnittene Vektor mit einer alkalischen 5`-Phosphatase bearbeitet,
um Recyclisierung zu verhindern. Nach Aufreinigung des Vektors und des Inserts über
Agarose-gel-elektrophorese und Extraktion dieser mit dem Qiagen Extraction Kit, werden
diese einer Ligation unterworfen mit einer T4-Ligase, die das Insert über den Nick-such
mechanismus in den Vektor einbaut. Anschließend wird das ligierte Plasmid in kompetente
E.coli Zellen transformiert und nach ausreichender Zeit eine analytische Kolonie-PCR
durchgeführt, um den Erfolg im Anschluß daran am einer Agarose-gel feststellen zu können.

Änderungen in der Durchführung:


PCR:

Komponente Menge
ddH2O 40 ul
Puffer mit MgCl2 5 ul
Template DNA 0,5 ul
5`-Primer 1 ul
3`-Primer 1 ul
dNTP-Mix 1,25 ul
Polymerase 1 ul

Tab. 1: PCR Pipettiermengen

Agarose-Gel-Elektrophorese der PCR:

Es werden 2 μl Loading Buffer (6x) und 1 μl SYBR-Green verwendet.


Es wird ein 0,8 % Agarose-Gel hergestellt
Es werden final 5 μl eines DNA-Markers in die Tasche geladen.

Restriktionsschnitt:

Komponente Menge Vektor Menge Insert


ddH2O 15 ul 4 ul
NEB2-Puffer BSA Mix 2 ul 4 ul
Vektor 2 ul
PCR-Produkt 30 ul
HindIII 0,5 ul 1 ul
XbaI 0,5 ul 1 ul

Tab. 2: Restriktionsschnitt Pipettiermengen

Zur Dephosphorylierung an den 5`-Enden des geschnittenen Vektors wird 1 μl Calf


Intestinal Alkaline Phosphatase verwendet.

Agarose-Gel-Aufreinigung des dephosphorylierten Vektors und des Inserts:

Es werden 5 μl Loading Buffer und 3 μl SYBR-Green zur Vektor Lösung und 10 μl


Loading Buffer und 5 μl SYBR-Green zur Insert Lösung gegeben.

Extraktion der Produkte mit dem Qiagen Extraction Kit:

Die Volumina der Gelstücke werden zu je 333 μl abgeschätzt, wozu 1 ml Puffer QG


gegeben wird.

Ligation:

Komponente Menge Kontrolle Menge Ligationsprodukt


ddH2O 10 ul
Quick-Ligase Puffer 1,5 ul 1,5 ul
Vektor 4 ul 4ul
PCR-Produkt 10 ul
T4-Ligase 1 ul 1 ul

Tab. 3: Ligation: fehlerhafte Pipettiermengen

Transformation des Liagtionsprodukt durch kompetenter E.coli Zellen:

Es werden 100 μl der Zellsuspension zum gesamten Ligationsansatz bzw. Kontrollansatz


gegeben.
Es wird im Anschluß nur 10 Minuten auf Eis inkubiert.
Nach Addition des LB-Mediums wird nur 20 Minuten bei 37 C inkubiert bevor der Überstand
zentrifugiert wird.

Analytische Kolonie-PCR:
Komponente Menge
ddH2O 515 ul
Puffer MgCl2 Mix 60 ul
5´-Primer 12 ul
3`-Primer 12 ul
dNTP-Mix 15 ul
Polymerase 6 ul

Tab. 4: Analytische Kolonie-PCR: Pipettiermengen

Es werden nur 20 Zyklen durchlaufen.

Gel-Analyse der Kolonie-PCR:

Es wird ein 0,8 % Agarose-Gel verwendet. Aus den PCR-tubes werden nur 5 μl entnommen,
die mit nur 2 μl Loading Buffer versetzt werden. Es wird 1 μl SYBR-Green zugefügt zu
jedem tube.

Diskussion der Ergebnisse:


In Abb.1 ist das Agarose-Gel zu sehen, das zur Verlaufskontrolle der ersten PCR gemacht
wurde. In lane 1 ist der DNA-Standard zu sehen und in lane 2 ist das PCR Produkt, das sich
wie erwartet ca. 1,45 kb befindet. In der Abbildung schwer zu erkennen sind schwächer
angefärbte PCR Nebenprodukte die durch nicht vollständig aufgefüllte Einzelstränge
enstanden sind, die sich dann über ungewollt entstandene sticky ends zusammengelagert
haben, bzw. nicht umgesetzes DNA-Templat und das zur Matrize dienende Ursprungs-DNA
Templat, die sich ohnehin bei höheren kilobasen befinden-. Diese PCR hat funktioniert.
Abb. 1: Agarose-Gel: Verlaufskontrolle PCR

In Abb.2 ist das Agarose-Gel zu sehen, das zur Verlaufskontrolle der Restriktionsschnitt
gemacht wurde. In lane 1 und 2 befindet sich der geschnittene, vermeintlich dephosphoryliete
Vektor bei ca. 5000 bp und das herausgeschnittene Stück bei um die 2000 bp .
In lane 3 bis 5 ist das PCR Produkt, das sich wie erwartet nur etwas unter ca. 1,45 kb befindet,
da die Palindromsequenzen nur wenige Basenpaare vom zu amplifiziernden Abschnitt durch
die Primer entfernt sind. Darüber sind Restriktionsschnitt Nebenprodukte, die sich über die
sticky ends bei Komplementarität zusammenlagern können und somit höhere
Basenpaaranzahlen besitzen. Und dieselben Nebenprodukte der PCR wie in Abb.1. Ganz
rechts wieder die DNA Marker Kontrolle.

Abb. 2: Agarose-Gel: Verlaufskontrolle Restriktionsschnitt

Im Anschluß daran wird eine Konzentrationsbestimmung des Vektors und des PCR Produkts
über nanodrop durchgeführt.
Diese Analyse war allerdings wenig aussagekräftig, weil die untersuchten Peaks von einem
immens großen Peak überschattet waren, der aus dem Extraction Kit stammt und somit die
Messung erschwerte. Es ergaben sich unvertrauenswürdige Werte bei einer Reinheit von 1,98
Zu 15,4 ng/ μl für die Vektorlösung und 27,3 ng/ μl für die PCR-Produktlösung. Falls diese
Werte stimmen, ist sehr wenig Vektor enthalten (evtl. fehlerhafte Pipettierung).
Die Transformation der Vektoren scheint funktioniert zu haben, da Zellen von E.coli
enstanden sind auf einer mit Ampicilin versetzten Agar-platte. Dieses Antibiotika können nur
E.coli Zellen überleben, in denen unser Vektor mit dem β-lactamase Gen enthalten ist,
wodurch dieses Enzym zur Antibiotika verdauung exprimiert wird. (Selektionsmarker).
Da jede Platte ca. 200 Klone enthielt, scheint aber kein Unterschied zwischen unseren
Kontrollklonen und den das Ligationsprodukt enthaltenen Klonen vorzuliegen. Ein erster
Hinweis darauf, dass das Insert nicht in den Vektor eingebaut wurde, sondern dieser
recyclisiert ist und ohne ein zusätzliches Gen in die kompetenten Zellen einging.
In Abbildung 4 sind die Kolonien der rekombinanten E.coli Bakterien (links Kontrolle und
rechts die Ligation) zu sehen. Möglicherweise sind die Klone auch einfach nur Background
der nichts mit dem Versuch zu tun hatte.

Abb. 3: Agarplatten der E.coli Klone

An der letzten Agarose-Gel-elektrophorese (Abb.4) muss man feststellen, dass die Ligation
nicht funktioniert hat. Unser erwartetes PCR Produkt müsste bei ca. 700 bp liegen. Hier ist
nur sehr schwach eine Bande bei 700 bp zu erkennen. Ausserdem wurden kaum Klone
gepickt, da diese sehr klein waren. Somit enthalten die lanes zwar genomische DNA, aber
nicht die DNA, die wir eingeführt haben. Hier nur in lane 4 und 7. Die positive Kontrolle ist
bei 700 bp. Somit ist das Gel ohnehin schlecht gelaufen und wenig aussagekräftig.

Abb. 4: Agarose-Gel: Verlaufskontrolle der Kolonie-PCR

Fazit:

An einigen Stellen sind Pipettierungsfehler unterlaufen. Vor allem bei der Ligation wurde nur
1,5 μl Quick-Ligase Puffer anstatt 15 μl zugegeben. Die T4-Ligase benötigt diesen aber
dringend, da sie darin enthaltenes ATP benötigt, um die Nicks zusammenzufügen.
Wahrscheinlich wurde aber der Vektor nicht ausreichend dephosphoryliert durch die
Phosphatase, da diese zu wenig (15 Minuten) einwirken gelassen wurde. Somit hat sich der
Vektor recyclisiert und gewünschtes Insert wurde nie eingebaut. Vielleicht wurde auch zu
schlecht gemischt bei diesem Schritt, da enthaltenes Glycerol diese zu schnell absinken ließ.
Die Kolonie-PCR wurde evtl. mit zu wenigen Zyklen durchgeführt (25), wodurch aufgrund
der ohnehin schon fast in keinem tube enthaltenen Klone, zu wenig DNA amplifiziert wurde.
Möglicherweise aber waren die 3 Minuten, die man die Zellen bei 95 C gehalten hat für den
Zellaufschluß zu wenig und die Zellen entließen kaum DNA zur Analyse.
Zusatzaufgabe:

Ausschnitt aus der Gesamtsequenz –hier die gesuchten 20 AS- also das Templat in Form von
cDNA:

5`-CCATGGGACAAGCACTATATGAATACGCAAGAAGGAGATTCACAGAGAGACGAGCCCAGGAGGCTGAC-3`

5`-Primer:

5`-CCATGGGACAAGCACTATATGAATACGCAAGAAGG-3`

Rot: NcoI palindromische Erkennungssequenz


Blau: taube Basen zur Zurechtrückung des Leserasters (sonst nonsense Auslesen)

Schmelztempetatur: 80 C

3`-Primer:

TCTAGACAGTCGGAGGACCCGAGC

Komplementäre Sequenz dazu:

3`-AGATCTGTCAGCCTCCTGGGCTCG-5`

Rot: BglII palindromische Erkennungssequenz

Schmelztempetatur: 67 C

Die 3´-Primer müssen für die gewünschte Basensequenz revers komplementiert werden, da
die Polymerase in 5`->3`Richtung auffüllt (revers) und die 3`-Primer unten anliegt am DNA-
Template (komplementär).

Zum schneiden des pQE-60 Vektors werden dieselben Restriktionsendonucleasen verwendet.


Zutaten und Vorgehen analog zum PCR-Klonierungsversuch.
cDNA ist komplementäre DNA, die aus prozessierter mRNA transkribiert wurde.
Das Enzym Reverse Transkriptase ist eine RNA-abhängige DNA-Polymerase, die diese
Transkription katalysiert. Das Produkt ist ein cDNA-Strang, der mit RNA-Templat
hybridisiert ist. Das Enzym RNase H katalysiert den Abbau des RNA-Templats.
Im Anschluß daran wird daraus mittels einer DNA-abhängigen DNA-Polymerase die
doppelsträngige cDNA synthetisiert. Auf der cDNA befinden sich somit im Gegensatz zur
genomischen DNA keine Introns. Demnach auch keine störenden Zwischensequenzen, die
beim Auslesen stören könnten. Auf diese Weise kann man die Primer an die cDNA andocken
lassen und weiß, dass genau die gewünschte Basensequenz ausgelesen wird. In genomischer
DNA müsste man eine Möglichkeit finden ungewollte Introns herauszusplicen.

Wichtig: Unterschied zwischen Klon und Zellen!!


Was ist genomische DNS

Literatur:
• BCG Skript
• Biochemie: Werner-Müller Esterl korrigierter Nachdruck 2009 der 1.Auflage 2004