Biomedicine & Pharmacotherapy 123 (2020) 109773

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

A new zinc chelator, IPZ-010 ameliorates postoperative ileus T

a,1 a,1 a a b
Hitomi Kimura , Yutaka Yoneya , Shoma Mikawa , Noriyuki Kaji , Hiroki Ito ,
Yasuaki Tsuchidac, Hirotsugu Komatsub, Takahisa Muratad, Hiroshi Ozakia, Ryota Uchidaf,
Keigo Nishidae,f, Masatoshi Horia,*
a
Department of Veterinary Pharmacology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan
b
Interprotein Corporation, 3-10-2 Toyosaki, Kita-ku, Osaka-city, Osaka 531-0072, Japan
c
Department of Surgical Pathology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya-city, Hyogo 663-8501, Japan
d
Department of Animal Radiology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan
e
Laboratory for Homeostatic Network, RCAI, RIKEN Research Center for Integrative Medical Sciences (IMS-RCAI), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama-city,
Kanagawa 230-0045, Japan
f
Laboratory of Immune Regulation, Graduate School of Pharmaceutical Sciences, Suzuka University of Medical Science, 3500-3 Minamitamagaki-cho, Suzuka-city, Mie
513-8607, Japan

A R T I C LE I N FO A B S T R A C T

Keywords: Zinc was discovered to be a novel second messenger in immunoreactive cells. We synthesized a novel free zinc
Zinc chelator, IPZ-010. Here, we investigated the effects of IPZ-010 in a mouse postoperative ileus model and de-
Mast cells termined the effects of zinc signal inhibition as a new therapeutic strategy against postoperative ileus. Zinc
Macrophages waves were measured in bone marrow-derived mast cells (BMMCs) loaded with a zinc indicator, Newport green.
Postoperative ileus
Degranulation and cytokine expression were measured in BMMCs and bone marrow-derived macrophages
Inflammation
(BMDMs). Postoperative ileus model mice were established with intestinal manipulation. Mice were treated with
IPZ-010 (30 mg/kg, s.c. or p.o.) 1 h before and 2 h and 4 h after intestinal manipulation. Gastrointestinal transit,
inflammatory cell infiltration, and expression of inflammatory mediators were measured. Free zinc waves oc-
curred following antigen stimulation in BMMCs and were blocked by IPZ-010. IPZ-010 inhibited interleukin-6
secretion and degranulation in BMMCs. IPZ-010 inhibited tumor necrosis factor-α mRNA expression in BMMCs
stimulated with lipopolysaccharide or adenosine triphosphate, whereas IPZ-010 had no effects on tumor necrosis
factor-α mRNA expression in BMDMs stimulated with lipopolysaccharide or adenosine triphosphate. In post-
operative ileus model mice, IPZ-010 inhibited leukocyte infiltration and cytokine expression, which ameliorated
gastrointestinal transit. Furthermore, ketotifen (1 mg/kg) induced similar effects as IPZ-010. These effects were
not amplified by co-administration of IPZ-010 and ketotifen. IPZ-010 inhibited zinc waves, resulting in inhibi-
tion of inflammatory responses in activated BMMCs in vitro. Targeting zinc waves in inflammatory cells may be a
novel therapeutic strategy for treating postoperative ileus.

1. Introduction Recent advances in our understanding of the underlying patho-

Postoperative ileus, which is transient hypomotility of the gastro-
intestinal tract, is a common problem after surgical trauma to the ab-
dominal cavity and other types of surgery [1,2]. Postoperative ileus
results in discomfort after surgery, increased medical costs due to
prolonged hospitalization, and an increased risk of secondary compli-
cations. Medical care costs in the United States due to postoperative
ileus are estimated at US$1.47 billion per year [3].
physiology of postoperative ileus have identified the main mechanism
as local intestinal inflammation triggered by manipulation of the in-
testine. Surgical tissue damage leads to the release of damage-asso-
ciated molecular patterns, such as adenosine triphosphate (ATP), which
in turn may activate resident muscularis macrophages [2,4]. These
activated macrophages are important in the development of intestinal
muscularis inflammation following intestinal manipulation [5,6]. Pro-
duction of inflammatory cytokines and chemokines enhances vascular

Abbreviations: BMMCs, bone marrow-derived mast cells; BMDMs, bone marrow-derived macrophages; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; LPS,
lipopolysaccharide; ATP, adenosine triphosphate
⁎
Corresponding author at: Department of Veterinary Pharmacology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, 1−1−1 Yayoi,
Bunkyo-ku, Tokyo 113-8657, Japan.
1
These authors have equal contribution.

https://doi.org/10.1016/j.biopha.2019.109773
Received 1 October 2019; Received in revised form 29 November 2019; Accepted 4 December 2019
0753-3322/ © 2019 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
H. Kimura, et al.
permeability, which in turn induces infiltration of monocytes and
neutrophils into the inflamed region [2,7]. Tumor necrosis factor-α
(TNF-α), Interleukin-1β (IL-1β), IL-6, Monocyte chemoattractant pro-
tein-1 (MCP-1), Macrophage inflammatory protein-1α (MIP-1α) and
Intercellular adhesion molecule-1 (ICAM-1) play important role to in-
itiate inflammation in postoperative ileus. Other inflammatory media-
tors such as cyclooxygenase-2 (COX-2)-induced prostaglandin E2 and
inducible nitric oxide synthase (iNOS)-produced nitric oxide (NO) are
also involved for pathogeny of postoperative ileus [8,9]. In addition,
recent work revealed that intestinal muscularis resident macrophages
may act as a key player of anti-inflammatory neural pathway via α7
nicotinic ACh receptor (α7nAChR) expressed on the macrophages in
mice [4]. On the other hand, infiltrated monocyte derived macrophages
rather than un-stimulated intestinal resident muscularis macrophages
expressed α7nAChR in postoperative ileus model [10] and gastric
mucosal ulcers [11] in rat.
Committed mast cell progenitors in peripheral blood develop to
mature mast cells after moving out into the peripheral tissues [12]. The
peripheral and peritoneal mast cells are considered important im-
munoreactive cells for the induction of postoperative ileus. The im-
portance of mast cells in the process of postoperative ileus induction
was demonstrated in experiments using mast cell stabilizers and W/Wv
mutant mice, which lack mast cells [2,13]. Ketotifen or doxantrazole,
mast cell stabilizers, ameliorate the inflammatory responses and im-
paired gastrointestinal transit in postoperative ileus model mice. In-
testinal manipulation triggers intestinal mast cell activation that in-
duces the inflammation associated with prolonged postoperative ileus
in patients [14] as well as the animal model. Taken together, macro-
phages residing in the muscularis externa and mast cells may be the key
players in this inflammatory cascade [2]. However, most recent work
argues against mast cells as a key player to induce postoperative ileus
by using CPa3cre/+ mast cell deficient mice [15].
Zinc is an essential nutrient and a structural constituent of many
proteins including enzymes and transcription factors [16]. Recent stu-
dies have shown that cytosolic free zinc ions (Zn2+) act as an in-
tracellular second messenger in many types of immunoreactive cells
[17–19,48]. Yamasaki and co-workers provided the first evidence that
cross-linking of the high-affinity immunoglobulin E receptor (FcεRI)
increases the release of intracellular cytoplasmic Zn2+, a phenomenon
called a “zinc wave”, from the endoplasmic reticulum in mast cells [17].
Treatment with the zinc chelator N,N,N',N'-tetrakis (2-pyridylmethyl)
ethylenediamine (TPEN) inhibits FcεRI-induced interleukin (IL)-6 and
tumor necrosis factor (TNF)-α mRNA expression in accordance with a
decrease in zinc waves. Zinc waves can also be induced by lipopoly-
saccharide (LPS) stimulation of human monocytes and RAW264.7
macrophages [18]. TPEN completely blocks activation of LPS-mediated
intracellular signal transduction involving mitogen-activated kinases
and nuclear factor-κB to inhibit cytokine production. These findings
provide new insight that regulation of zinc waves may be a new
strategy for treating inflammatory and autoimmune diseases.
TPEN is a membrane-permeable zinc chelator. In vitro analysis has
shown that TPEN is a useful chelator for determining the importance of
Zn2+ in cell signaling [17,20]. In some reports, TPEN also induces
therapeutic actions against allergic diseases. Intraperitoneal adminis-
tration of TPEN significantly inhibits antigen-stimulated passive cuta-
neous anaphylaxis and passive systemic anaphylaxis [20]. TPEN also
attenuates airway hyper-responsiveness and eosinophilic inflammation
in a mast cell-dependent mouse model of allergic asthma [21]. On the
other hand, TPEN has severe adverse effects. Administration of high
concentrations of TPEN (over 30 mg/kg) produces acute toxicity
leading to convulsion and death within several minutes [22]. Heavy
metal chelators such as TPEN also have neuronal cytotoxicity in the
hippocampus [23]. Thus, development of safer zinc chelators is needed
for clinical applications.
Pharmacological management of postoperative ileus has gradually
advanced. Although classical prokinetic agents such as metoclopramide
2
Biomedicine & Pharmacotherapy 123 (2020) 109773
were initially thought to be effective for treating postoperative ileus,
this has not been the case [1,24]. The μ-opioid receptor antagonist al-
vimopan has been reported to provide clinical improvement in bowel
function in patients who have undergone abdominal surgery [25–27].
The prokinetic agent mosapride citrate, which is a serotonin 4 receptor
agonist, ameliorates postoperative ileus in Japanese patients [28]. Re-
cent evidence using an experimental model animal for postoperative
ileus and gastric ulcers induced by non-steroidal anti-inflammatory
drugs revealed that stimulation of the serotonin 4 receptor has anti-
inflammatory action via activation of α7 nicotinic acetylcholine re-
ceptors on macrophages [10,11,29]. However, pharmacological man-
agement of postoperative ileus in patients remains unsatisfactory, and
new treatments are needed.
In the present study, we examined whether a new zinc chelator, IPZ-
010, may ameliorate the pathogenesis of postoperative ileus possibly by
preventing zinc waves. IPZ-010 significantly suppressed zinc waves in
activated mast cells in vitro, which in turn inhibited degranulation and
cytokine mRNA expression. Oral and subcutaneous administration of
IPZ-010 also ameliorated inflammation due to intestinal manipulation,
possibly by targeting inflammatory cells. Thus, targeting zinc signaling
could be a new therapeutic and/or prophylactic strategy for post-
operative ileus.
2. Materials and methods
2.1. Cell culture
Bone marrow-derived mast cells (BMMCs) were obtained as de-
scribed [30,31]. Briefly, bone marrow cells isolated from C57BL/6 J
mice (Charles River, Kanagawa, Japan) were cultured in RPMI 1640
medium (Sigma-Aldrich Japan, Tokyo, Japan) supplemented with
100 μM 2-mercaptoethanol, 10 % fetal bovine serum (FBS; Nichirei
Bioscience, Tokyo, Japan), 100 U/mL penicillin, 100 μg/mL strepto-
mycin (Life Technologies, Grand Island, NY, USA), and 10 μg/mL re-
combinant mouse IL-3 (Sigma). More than 90 % of the cells were
identified as immature mast cells 4 weeks after initiation of the culture.
BMMC cultures in which > 80 % of cells expressed the c-kit antigen
were used. In some experiments, the BMMCs were sensitized with
100 ng/mL anti-dinitrophenol (DNP) IgE mice antibody (SPE-7; Sigma)
before use for activation.
Bone marrow-derived macrophages (BMDMs) were obtained as
previously described [32]. Cultured bone marrow cell aggregates were
dispersed by passing through a 25-gauge needle. The suspended cells
were cultured in RPMI 1640 medium containing 10 % FBS, 100 U/mL
penicillin, 100 μg/mL streptomycin, and 10 % L929 cell-containing
medium as a source of macrophage colony-stimulating factor. BMDMs
were obtained as an adherent cell population following 7 days of cul-
ture, and BMDM cultures in which > 80 % of cells expressed the F4/80
antigen were used.
2.2. Mast cell degranulation
Mast cell degranulation was monitored by release of β-hex-
osaminidase [20,33]. In brief, sensitized BMMCs (2 × 105 cells per
tube) were washed with PIPES-buffered solution (40 mM NaCl, 5 mM
KCl, 5.5 mM glucose, 0.6 mM MgCl2, 1.5 mM CaCl2, 10 mM PIPES, and
0.1 % bovine serum albumin (BSA; Prospec-Tany Technogene LTD,
Rehovot, Israel), pH 7.4). BMMCs were stimulated by adding dini-
trophenylated human serum albumin (DNP-HSA; 5 ng/mL) at 37 °C
with gentle rotation. The supernatant was transferred to a 96-well plate,
and the remaining cell pellet after removal of the supernatant was
suspended in 0.5 % Triton X-100 solution. The cell suspension was
centrifuged by 10,000 xg, for 10 min at 4 °C, and the cell extract was
transferred to a 96-well plate. p-nitrophenyl-N-acetyl-p-D-glucosamide
(1.3 mg/mL; Sigma) in 0.04 M sodium citrate (pH 4.5) was added to
each well and incubated at 37 °C for 1 h. Then, glycine (0.2 M, pH 10.0)
H. Kimura, et al.
was added to each well, and the absorbance at 405 nm (optical density
(OD)) was measured with a multilabel counter (Perkin Elmer Japan,
Kanagawa, Japan). The percentage of degranulation was calculated
using the following formula:
% degranulation = ODsupernatant / (ODsupernatant + ODTriton X-100) ×100
2.3. IL-6 secretion by mast cells
BMMCs were activated as described above, and IL-6 in the cell
culture supernatant was measured with an ELISA kit (Cayman, Ann
Arbor, MI, USA).
2.4. Expression of TNF-α mRNA in BMMCs and BMDMs
BMMCs and BMDMs (2 × 106 cells per dish) were starved in phos-
phate-buffered saline at 37 °C for 10 h before the experiment. LPS
(300 ng/mL or 1 μg/mL in BMDMs or BMMCs, respectively) or ATP
(300 μM) was added, and the stimulated cells were incubated for 2 h at
37 °C. IPZ-010 (10 μM) was added 30 min before adding ATP or LPS.
Total RNA was extract 2 h after stimulation with LPS or ATP, and re-
verse-transcription polymerase chain reaction (RT-PCR) was performed
as described below.
2.5. Zinc wave measurement in BMMCs
Zinc wave measurement was performed as described [17]. Briefly,
IgE-sensitized BMMCs were suspended in HEPES buffer (10 mM HEPES
(pH 7.4), 130 mM NaCl, 5 mM KCl, 1.4 mM CaCl2, 1 mM MgCl2, and
5.6 mM glucose). BMMCs were allowed to adhere to a poly-L-lysine-
coated glass-bottom dish and incubated with 10 μM Newport green
(Invitrogen) for 30 min at 37 °C. Cells were stimulated with 100 ng/mL
DNP-HSA at 37 °C. The images of fluorescent signals were captured
every 30 s with an inverted microscope (Axiovert 200 MO; Carl Zeiss
3
Biomedicine & Pharmacotherapy 123 (2020) 109773
Fig. 1. Chemical structure of the newly syn-
thesized zinc chelator IPZ-010 and effects of
IPZ-010 on zinc waves, IL-6 secretion, and de-
granulation in BMMCs.
A: Chemical structure of IPZ-010 (IPZ). B:
Effect of IPZ-010 (10 μM) on antigen-induced
zinc waves in sensitized BMMCs. Calculated
values from 4 independent experiments are
shown. Each closed circle and bar showed
mean ± SEM. BMMCs were sensitized with
anti-DNP IgE and stimulated with 5 ng/mL
DNP-HSA as the antigen. Cytosolic Zn2+
movement, called zinc waves, were measured
using Newport green. C: The effect of IPZ-010
on secretion of IL-6 for 30 min in sensitized
BMMCs stimulated with DNP-HSA (5 ng/mL).
Typical results of 4 independent experiments
are shown. D: The effect of IPZ-010 and TPEN
on degranulation of sensitized BMMCs stimu-
lated with DNP-HSA. Each plot shows the
mean ± SEM (n = 4 each).
MicroImaging, Inc. Tokyo, Japan) with an oil plan Neofluar 100 × NA
1.3 objective (Carl Zeiss MicroImaging, Inc.), CCD camera (CoolSnap
HQ; Roper Scientific, Tokyo, Japan), and the system control application
SlideBook (Intelligent Imaging Innovation) at 25 °C.
2.6. Animals and the postoperative ileus model
The Institutional Review Board of the University of Tokyo approved
the animal care. All experimental protocols (approval code P13-815)
were performed in strict compliance with the Guide for Animal Use and
Care published by the University of Tokyo and in accordance with the
ARRIVE guidelines for reporting experiments involving animals. Balb/c
mice or C57BL/6 J mice (Charles River, Kanagawa, Japan) were housed
under controlled conditions (8–12 weeks of age, 12 h light/dark cycle).
A total of 135 animals were used in the experiments described here.
Balb/c mice and C57/BL/6 J mice were used in vitro and in vivo ex-
periments, respectively. Balb/c mice were anesthetized with pento-
barbital sodium (Kyoritsu Seiyaku, Tokyo, Japan) to create a mouse
model of postoperative ileus using intestinal manipulation as described
[6,9]. Briefly, the abdominal wall was opened with a midline lapar-
otomy. The distal ileum (about 10 cm) was carefully exteriorized and
manipulated three times with a sterile cotton stick moisturized with
sterile physiological saline. After intestinal manipulation, the ileum was
placed back into the abdominal cavity, and the abdominal wall was
closed with two layers of interrupted sutures. After the surgical pro-
cedure, mice were positioned on a heating pad at around 36 °C until
they recovered from the anesthesia. Pharmacological treatment such as
analgesic agents could not be used to avoid influencing the outcome of
the study. We confirmed that pathological profiles by surgical manip-
ulation were same with other postoperative ileus model previously re-
ported [7,13]
2.7. Experimental design and preparation of drugs
The mice were randomly assigned to the following groups: Control:
H. Kimura, et al.
Table 1
Primer sets and predicted sizes of RT-PCR products.
Gene Forward / Sequences (5′ to 3′) Expected size
name Revers (bp)
Mcp1 Forward TTTTGTCACCAAGCTCAAGA 381
Revers GGTTGTGGAAAAGGTAGTGG
Il1b Forward TGACGTTCCCATTAGACAGC 497
Revers TGGGGAAGGCATTAGAAACA
Il6 Forward TCTCTGGGAAATCGTGGAAA 397
Revers GATGGTCTTGGTCCTTAGCC
Tnf Forward AAATGGGCTCCCTCTCATCA 324
Revers AGCCTTGTCCCTTGAAGAGA
Gapdh Forward CAGGGCTGCTTTTAATTCTG 269
Revers AGCACCAGCATCACCCCACT
untreated and with fasting; intestinal manipulation: subcutaneously
injected with same volume of sterile solvent; intestinal
manipulation + IPZ-010 (30 mg/kg): IPZ-010 was subcutaneously (s.c.)
or orally (p.o.) administered to postoperative ileus mice 1 h before and
2 and 4 h after IM. Previously we used TPEN at concentration of 30 mg/
kg i.p. in in vivo experiments [20]. As shown in Fig. 1A, IPZ-010 con-
tains chemical structure of TPEN. In addition, half-life (t1/2) of IPZ-010
is so fast as shown in Supplementary Fig. 1. Based on the information,
we decided administration method of IPZ-010 as mentioned above. In
some experiments, ketotifen (1 mg/kg) was subcutaneously injected 1 h
before and 2 and 4 h after intestinal manipulation, as a tool for stabi-
lizer against mast cells. TPEN (1 mg/kg) was also subcutaneously in-
jected 1 h before intestinal manipulation. In this study, laparotomy and
intestinal manipulation were considered the postoperative ileus model,
because laparotomy alone transiently increases proinflammatory cyto-
kine expression [34].
The solvent for subcutaneous administration of IPZ-010 was ster-
ilized physiological salt solution containing 2 % ethanol and 0.01 %
Tween 20. The solvent for oral administration of IPZ-010 was the same
solvent plus 0.5 % carboxymethylcellulose. The solvent for TPEN was a
cocktail of ethanol, glyceline, and distilled water (1:3:6). The solvent
for ketotifen was physiological salt solution.
2.8. Whole-mount histochemistry and immunohistochemistry
The distal ileal part of the intestine was isolated from mice 24 h
after intestinal manipulation, cut open along the mesenteric attach-
ment, and then the mucosal and submucosal layers were gently re-
moved with microforceps under stereoscopic microscope. The muscu-
laris preparation was opened up on a silicon sheet, pinned, fixed in 10
% paraformaldehyde for 24 h at 4 °C, cut into 1 cm squares, and washed
with Tris-buffered saline (TBS) twice for 30 min at room temperature.
Myeloperoxidase (MPO) histochemical staining was performed as
described [6,15]. The preparations were stained with physiological salt
solution containing 0.1 % (w/v) Hanker-Yates reagent (Polyscience,
Warrington, PA, USA) and 0.03 % (v/v) hydrogen peroxide (Mitsubishi
Gas Chemical Company, Tokyo, Japan) for 5 min, washed for 10 min in
phosphate-buffered saline, and mounted on glass slides.
For immunohistochemistry, the fixed whole-mount preparations
were washed with TBS, permeabilized with 0.2 % Triton-X-100 and 2 %
BSA in TBS for 2 h, and rinsed with 2 % BSA in TBS for 30 min. The
permeabilized preparations were incubated with rat anti-mouse CD68
antibody (1:500; Serotec Ltd., Oxford, UK) in TBS with 2 % BSA at 4 °C
overnight and then washed for 2 h in TBS. The preparations were la-
beled with goat anti-rat IgG Alexa Flour 488 secondary antibody
(1:250; Life Technologies, Carlsbad, CA, USA) for 90 min at room
temperature.
The number of MPO-positive neutrophils and CD68-positive mac-
rophages were counted in four randomly selected areas of each pre-
paration under an ACT-1C for DXM1200C microscope (Nikon, Tokyo,
Japan), and the average number of infiltrating cells was calculated by
4
Biomedicine & Pharmacotherapy 123 (2020) 109773
two researchers independently.
2.9. Determination of intestinal transit
After fasting for 24 h, the mice were randomly assigned to one of
four groups (Control, IPZ-010, intestinal manipulation, and intestinal
manipulation + IPZ-010). IPZ-010 was subcutaneously administered as
described above. Twenty-three hours after intestinal manipulation in
mice, 100 μl of the non-absorbable marker 0.25 % (w/v) phenol red in 5
% (w/v) glucose was orally placed in their stomach with a gastric tube.
One hour after the treatment, the gastrointestinal region was isolated
from the abdominal cavity. The intestinal and colonic parts were di-
vided into 10 (SI1-SI10) and three (Co1-Co3) segments at equal inter-
vals. The stomach and cecum were each separated as a single segment
(Sto, Cec). Measurement of phenol red in each segment was performed
as previously described [35]. The solutions containing phenol red were
read using a spectrophotometer (560 nm wavelength) [35]. The volume
of phenol red in each segment and the geometric center of distribution
were calculated as described [9,36].
2.10. Semi-quantitative RT-PCR
Total RNA was extracted from muscularis preparations without the
mucosal layer using the acid guanidinium isothiocyanate-phenol
chloroform method with the TRIzol Reagent (Invitrogen Japan, Tokyo,
Japan), and concentrations of RNA were adjusted to 1 μg/μL with
RNase-free distilled water. Semi-quantitative RT-PCR was performed as
previously reported [10]. Gene-specific primers for IL-1β, IL-6, TNF-α,
macrophage chemoattractant protein-1 (MCP-1), and glyceraldehyde 3-
phosphate dehydrogenase (GAPDH) are listed in Table 1. The PCR
products from each cycle were electrophoresed on 2 % agarose gels
containing 0.1 % ethidium bromide, and the suitable PCR cycle was
chosen for quantitation. Possible DNA contamination was excluded by
performing PCR using total RNA without reverse transcription. Fluor-
escent bands were visualized using an ultraviolet trans-illuminator
using FAS-III (Toyobo Life Science, Osaka, Japan), and the density of
the bands was measured using NIH Image software (Image J, Ver.
1.38x).
2.11. Statistical analyses
Statistical data are expressed as the means ± SEM. Data were
analyzed using unpaired Student’s t tests for comparisons between two
groups and one-way analysis of variance (ANOVA) followed by
Dunnett’s test for comparisons among multiple groups. P values < 0.05
were considered statistically significant.
3. Results
3.1. Characteristics of new zinc chelator, IPZ-010, and effects of IPZ-010
on zinc waves and immunoreactivity in BMMCs
As shown in Fig. 1A, we synthesized a new membrane permeable
Zn2+ chelator, IPZ-010 [IPZ; 2-(3-trifluoromethyl phenylamino) ben-
zoic acid 2-[N, N-bis(2-pyridinemethyl) amino] ethyl ester, MW;
506.52]. In vitro analysis revealed a Ki value of 1 μM against Zn2+ and
no interaction with Ca2+ in cells. IPZ-010 contains chemical structure
of TPEN. In vivo pharmacokinetic analysis showed that administrated
IPZ-010 (10 mg/kg) by i.v. was quickly metabolized within 3−4 h
(Tmax; 5 min, t1/2; 0.35 h; Supplementary Fig. 1). IPZ-010 did not show
any toxicity until 100 mg/kg during 24 h after administration by i.v.. In
addition, IPZ-010 did not show any skin toxicity of mice ear when 1 %
IPZ-010 was administered once a day for 4 weeks to right ear of mice
(Supplementary Fig. 1D). In contrast, same concentration of TPEN lead
to thickening of ear of mice.
We next measured cytoplasmic zinc waves in BMMCs that were pre-
H. Kimura, et al.
activated with SPE-7 (1 μg/mL) for 12 h. DNP-HSA (5 ng/mL) increased
the fluorescent signal of Newport green, indicating increments of cy-
toplasmic Zn2+ levels following antigen stimulation (7.5 min after ad-
dition of antigen; 1.501 ± 0.068, n = 4). IPZ-010 (10 μM) significantly
suppressed the zinc waves (Fig. 1B; 5 min after addition of IPZ-010;
1.150 ± 0.053, P < 0.001 vs value before addition of IPZ-010,
n = 4). DNP-HSA also induced IL-6 protein and degranulation, which
were both inhibited by IPZ-010 (10 μM) in a concentration-dependent
manner (Fig. 1C and D). Taken together, IPZ-010 inhibited zinc waves
stimulated by antigen, which in turn inhibited degranulation and IL-6
secretion in mouse BMMCs.
We further tested effect of IPZ-010 on cytosolic Ca2+ movement in
living cells by using BMDMs loaded with Ca2+ indicator, fluo-3
(Supplementary Fig. 2). Application of α,β-methylene ATP, a selective
P2X receptor agonist (1 mM) induced transient Ca2+ increase followed
by small sustained one. IPZ-010 (10 μM) had no effect on the peak Ca2+
transient (Control; 1.35 ± 0.11, +IPZ-010; 1.46 ± 0.11, n = 4).
Results indicated that IPZ-010 does not affect cytosolic Ca2+ movement
in living cells.
3.2. Effects of IPZ-010 on infiltration of macrophages and neutrophils in
postoperative ileus
Pharmacokinetic character of IPZ-010 indicates that administrated
IPZ-010 may be quickly metabolized. On the other hand, postoperative
ileus model by surgical manipulation induced transient inflammatory
action, which is almost ameliorated within 48 h. Especially, in-
flammatory cytokines mRNA is increased within 3−6 h after intestinal
manipulation, then decreased control level within 24 h after intestinal
manipulation. So we performed repeated-high dose administration of
IPZ-010 before and after intestinal manipulation.
In the myenteric plexus region of control ileum, dendritic-formed
resident macrophages stained with the CD68 antibody were seen
(421.12 ± 40.44 cells/mm2), whereas in the intestinal manipulation-
induced inflamed ileum, many round monocyte-derived macrophages
had infiltrated (1072.54 ± 76.58 cells/mm2). Administration of IPZ-
010 significantly inhibited the macrophage infiltration. Oral adminis-
tration of IPZ-010 induced the same inhibition of macrophage in-
filtration as subcutaneous administration (787.41 ± 80.57 cells/mm2
with p.o. and 722.70 ± 146.93 cells/mm2 with s.c.). IPZ-010 alone
had no effect on the macrophage population in control mice
(440.04 ± 90.23 cells/mm2) (Fig. 2A and B).
Fig. 2C and D show MPO staining and quantification of neutrophil
infiltration in the myenteric plexus region of the ileum. In control
mouse intestine, neutrophils were not detected (0.52 ± 0.42 cells/
mm2). Twenty-four hours after intestinal manipulation, MPO-stained
neutrophils had infiltrated into the myenteric plexus region
(176.83 ± 32.69 cells/mm2). Both oral and subcutaneous administra-
tion of IPZ-010 significantly inhibited neutrophil infiltration
(91.33 ± 19.22 cells/mm2 with p.o. and 64.68 ± 17.29 cells/mm2
with s.c.). Taken together, both oral and subcutaneous administration
of IPZ-010 inhibited intestinal manipulation-induced leukocyte in-
filtration into the inflamed ileum. As shown in Supplementary Fig. 1,
metabolism of IPZ-010 is so fast, IPZ-010 was subcutaneously ad-
ministered in other experiments to eliminate effect of the first pass ef-
fect at intestine and liver as much as possible.
3.3. Effect of IPZ-010 on mRNA expression of inflammatory mediators in
postoperative ileus
In the ileal muscle layer of control mice, MCP-1, IL-1β, IL-6, and
TNF-α mRNAs were not detected. Messenger RNAs of all mediators
were significantly increased 3 h after intestinal manipulation. IPZ-010
treatment significantly inhibited mRNA expression of all inflammatory
mediators (Fig. 3).
5
Biomedicine & Pharmacotherapy 123 (2020) 109773
3.4. Effect of IPZ-010 on intestinal transit in postoperative ileus
Muscularis inflammation due to intestinal manipulation delays in-
testinal transit in postoperative ileus. Therefore, we examined the effect
of IPZ-010 on gastrointestinal dysmotility induced by intestinal ma-
nipulation (Fig. 4). In the intestine of control mice, less than 10 % of
orally administered phenol red remained in the stomach, whereas
10–25% of phenol red was transported down the intestine to the mid
and distal ileum (SI4 to SI9). The geometric center value was
8.30 ± 2.15. Intestinal transit tended to increase slightly following
administration of IPZ-010 in control mice, but the average calculated
geometric center value was not significantly different from the control
value (9.58 ± 2.12). In the intestine of postoperative ileus model mice,
about 40 % of phenol red remained in the stomach, and 10–15% of
phenol red was transported down the intestine to the upper small in-
testine (SI0 to SI4), indicating delayed gastrointestinal transit. The
calculated geometric center value was significantly lower than control
mice given IPZ-010 alone (intestinal manipulation; 2.91 ± 2.22). IPZ-
010 significantly improved the delayed intestinal transit caused by in-
testinal manipulation, in which 20 % of phenol red remained in the
stomach, and 60 % of the transported phenol red content was trans-
ported to between SI4 and SI8. The geometric center was also restored
to close to the control value (6.25 ± 3.48).
3.5. Effects of IPZ-010 on inflammatory action in BMMCs and BMDMs
As shown in Fig. 1, activated BMMCs induced zinc waves that were
inhibited by IPZ-010. A recent report showed that inflammatory signals
in macrophages and mast cells are also regulated by zinc waves [18,49].
Therefore, we examined the effect of IPZ-010 on TNF-α mRNA ex-
pression in BMDMs (Fig. 5A and B) and BMMCs (Fig. 5C and D) that
were stimulated with LPS or ATP. It was well recognized that LPS can
stimulate both cells to produce TNF-α [37,38]. In contrast, it has been
reported that ATP inhibited TNF-α production in peritoneal macro-
phages stimulated with LPS, indicating that further investigation will be
necessary to clarify the effects of ATP on cytokines secretion in BMDMs.
Based on these backgrounds, for both cell types, LPS (300 ng/mL or
1 μg/mL in BMDMs or BMMCs, respectively) or ATP (300 μM) sig-
nificantly upregulated expression of TNF-α mRNA. IPZ-010 selectively
inhibited TNF-α mRNA expression stimulated with LPS or ATP in
BMMCs but not in BMDMs.
3.6. Comparison of the anti-inflammatory effects of TPEN, IPZ-010,
ketotifen, and IPZ-010 plus ketotifen in postoperative ileus
We compared the anti-inflammatory effects of TPEN, IPZ-010, ke-
totifen, and combined treatment with both IPZ-010 and ketotifen in
postoperative ileus as assessed by infiltration of MPO-stained neu-
trophils into the ileal muscle layer. The number of MPO-stained neu-
trophils was increased 24 h after intestinal manipulation
(216.29 ± 21.39 cells/mm2). Administration of TPEN (10 mg/kg) or
ketotifen (1 mg/kg) significantly inhibited the neutrophil infiltration,
similar to IPZ-010 treatment (intestinal manipulation + TPEN;
95.47 ± 19.01 cells/mm2, intestinal manipulation + ketotifen;
77.89 ± 9.17 cells/mm2, intestinal manipulation + IPZ-010;
95.63 ± 10.45 cells/mm2). In addition, combined administration of
ketotifen plus IPZ-010 also induced a similar inhibitory action com-
pared with single administration of ketotifen or IPZ-010 (intestinal
manipulation + IPZ-010 + ketotifen; 79.09 ± 10.47 cells/mm2)
(Fig. 6). These results showed that combined administration of the mast
cell stabilizer, ketotifen, with IPZ-010 produced no synergistic anti-in-
flammatory effects.
4. Discussion
Recent studies from our group have shown that cytoplasmic free
H. Kimura, et al.
Zn2+ works as a second messenger in activated mast cells [17,20]. In
the present study, we used Newport green to monitor the cytosolic
Zn2+ movement, called “zinc waves”. IPZ-010 significantly inhibited
zinc waves elicited by antigen stimulation. In accordance with the in-
hibitory action of IPZ-010 on zinc waves, elevated IL-6 secretion and
degranulation were also inhibited by IPZ-010. In addition, IPZ-010 did
not alter cytosolic Ca2+ movement in BMDMs. Taken together it is
suggested that IPZ-010 is a strong pharmacological tool for stabilizing
mast cells by chelating cytosolic Zn2+.
IPZ-010 is synthesized based on the chemical structure of TPEN.
However, toxicity of IPZ-010 is weaker than that of TPEN. Kd of TPEN
for zinc ion is 10−16M [39]. Since the affinity of zinc finger motif for
zinc ion is well known to be strong with Kd value at 10−8–10−10M. In
addition, TPEN also can bind with other heavy metal such as Cu2+,
Fe2+ and Mn2+ [39]. In contrast, IPZ-010 is high selectivity for zinc
with a weak affinity (Kd value of 10−6M). Taken together, heavy metal
ion-required proteins such as Zn finger proteins may lose heavy metal
ion by TPEN but not IPZ-010, which in turn induces severe toxicity by
TPEN rather than IPZ-010. Further investigation will need to clarify the
point.
Here we demonstrated that IPZ-010 ameliorated inflammation in
postoperative ileus model mice. Subcutaneous or oral administration of
IPZ-010 significantly decreased infiltration of macrophages and neu-
trophils into the inflamed muscle layer induced by intestinal manip-
ulation. This result is clinically important because oral administration
of IPZ-010 is still effective against postoperative ileus after the first pass
effect.
In this animal model for postoperative ileus, mRNA expression of
6
Biomedicine & Pharmacotherapy 123 (2020) 109773
Fig. 2. Effect of IPZ-010 on CD68-positive mac-
rophages and MPO-stained neutrophils that have
infiltrated into the myenteric plexus region of
the small intestine in postoperative ileus.
IPZ-010 (30 mg/kg) was administered 1 h before
and 2 and 4 h after intestinal manipulation (IM)
via subcutaneous (s.c.) or peroral (p.o.) admin-
istration. Typical immunohistochemical images
of infiltration of CD68-positive macrophages (A)
and infiltration of MPO-stained neutrophils (C).
Scale bars =50 μm. Quantification of infiltration
of CD68-positive macrophages (B) and MPO-
stained neutrophils (D) into the myenteric
plexus region. **P < 0.01 vs. control.
##P < 0.01 vs. IM (n = 4–6 each).
inflammatory mediators is transiently increased at 3 h after intestinal
manipulation [7,40,41]. In our current study, IPZ-010 partially but
significantly inhibited mRNA expression of MCP-1, IL-1β, IL-6, and
TNF-α 3 h after intestinal manipulation. MCP-1 induces macrophage
recruitment into the inflamed muscle layer in endotoxemic ileus and
colitis [42,43], indicating that an IPZ-010-induced decrease in mRNA
expression of MCP-1 may inhibit leukocyte infiltration and decrease
inflammatory cytokine mRNA expression that is induced by intestinal
manipulation. Taken together, IPZ-010 has anti-inflammatory effects
against postoperative ileus.
Motility disorder is a main symptom of postoperative ileus, and
prolonged dysfunction may lead to adhesive intestinal obstruction and
paralytic ileus, suggesting that treatment to prevent gastrointestinal
motility disorder will be important for the prognosis of postoperative
ileus [2,44,45]. In this animal model for postoperative ileus, intestinal
manipulation induced delayed gastrointestinal transit, and the geo-
metric center value was decreased. Administration of IPZ-010 clearly
improved gastrointestinal transit and increased the geometric center
value, whereas administration of IPZ-010 alone to healthy mice had no
effect on intestinal transit. Thus, the ameliorative effects of IPZ-010
against inflammation also improved gastrointestinal transit. This may
occur by blocking the effects of activated resident macrophages and
recruited monocyte-derived macrophages and neutrophils. These cells
induce COX-2 to produce prostaglandin E2 [36,46], which turns on
iNOS expression via EP2 and EP4 receptors in an autocrine manner to
produce NO, which in turn induces the motility disorder of the gas-
trointestinal tract [7,9,46,47].
To establish the importance of zinc movement on the pathogenesis
H. Kimura, et al. Biomedicine & Pharmacotherapy 123 (2020) 109773

Fig. 3. Effect of IPZ-010 on mRNA expression of MCP-1, IL-1β, IL-6, and TNF-α in the intestinal muscle layer 3 h after intestinal manipulation.
IPZ-010 (30 mg/kg) was administered subcutaneously 1 h before and 2 h after intestinal manipulation (IM). *P < 0.05, **P < 0.01 vs. IM (n = 4–6 each).

Fig. 4. Effect of IPZ-010 on intestinal transit in control and postoperative ileus model mice.
IPZ-010 (30 mg/kg) was administered subcutaneously 1 h before and 2 and 4 h after intestinal manipulation (IM). Intestinal transit was examined 1 h after intake of
phenol red solution and 23 h after the intestinal manipulation. A: Distribution of phenol red in the gastrointestinal tract. Quantified results from 4 to 6 independent
experiments are shown. B: Effect of IPZ-010 on geometric center values. **P < 0.01 vs. control. ##P < 0.01 vs. IM (n = 4–6 each).

7
H. Kimura, et al.
Fig. 6. Effect of TPEN and ketotifen on infiltration of MPO-stained neutrophils
into the myenteric plexus region of the intestine of postoperative ileus model
mice.
IPZ-010 (IPZ: 30 mg/kg) was subcutaneously administered 1 h before and 2 and
4 h after intestinal manipulation (IM). TPEN (10 mg/kg, s.c.) and/or ketotifen
(1 mg/kg s.c.) was administered 1 h before intestinal manipulation.
Quantification of infiltration of MPO-positive neutrophils into the myenteric
plexus region. ##P < 0.01 vs intestinal manipulation (n = 4–6 each).
Combined application of IPZ and ketotifen was not significantly different from
TPEN, IPZ, ketotifen alone, respectively in mice with intestinal manipulation.
of postoperative ileus, we further investigated the effect of the com-
monly used zinc chelator TPEN on the inflammatory events following
intestinal manipulation as assessed with MPO-stained neutrophils.
Administration of TPEN significantly inhibited neutrophil infiltration
8
Biomedicine & Pharmacotherapy 123 (2020) 109773
Fig. 5. Effects of IPZ-010 on LPS- or ATP-in-
duced upregulation of TNF-α mRNA in BMMCs
and BMDMs.
BMDMs were treated with LPS (300 ng/mL) or
ATP (300 μM) for 2 h. BMMCs were treated with
LPS (1 μg/mL) or ATP (300 μM) for 2 h. IPZ-010
(10 μM) was added 30 min before LPS or ATP
treatment. Each column shows the
mean ± SEM (n = 4–6 each). **P < 0.01,
*** < 0.001 vs control. ###P < 0.001 vs LPS.
similar to the effect of IPZ-010. Taken together, the new zinc chelator
IPZ-010 appears to ameliorate the pathogenesis of postoperative ileus,
resulting in recovery of the motility disorder. Hence, this new zinc
chelator could be a new therapeutic strategy against postoperative
ileus.
Macrophages and neutrophils are candidate cells for mediating the
pathogenesis of postoperative ileus [5–7]. Mature mast cells located in
the intestine are also considered important immunoreactive cells that
induce postoperative ileus in humans [2,13,14]. In contrast, using the
mast cell-deficient Cpa3Cre/+ mouse strain, a recent study revealed that
mast cells play no role in the pathogenesis of postoperative ileus. They
argued against the use of mast cell inhibitors as a therapeutic approach
to ameliorate postoperative ileus [15]. Taken together, in the current
cognition, macrophages and neutrophils but not mast cells play a cru-
cial role to induce inflammation in postoperative ileus in mice.
In the present study, we propose that inhibition of zinc movement
may be a useful therapy for postoperative ileus. With our in vitro ex-
amination, we confirmed that the new zinc chelator IPZ-010 inhibits
zinc waves in activated mast cells in vitro, indicating that IPZ-010 may
be considered a new type of mast cell stabilizer. In contrast, zinc waves
are detected in human monocytes and RAW264.7 macrophages stimu-
lated with pathogen [18]. Thus, whether IPZ-010 inhibits zinc move-
ment in mast cells, macrophages, or both cell types is unclear. De-
monstrating which cells induce zinc waves that lead to the pathogenesis
of postoperative ileus will be difficult in vivo. We tried several ap-
proaches to clarify this postoperative ileus. Ketotifen is a traditional
mast cell stabilizer, although this compound has multiple noteworthy
effects. Treatment with ketotifen inhibited neutrophil infiltration due to
intestinal manipulation, similar to IPZ-010. In addition, combined ad-
ministration of ketotifen with IPZ-010 did not induce an additive anti-
inflammatory action against intestinal manipulation. In addition, IPZ-
H. Kimura, et al.
010 selectively inhibited TNF-α mRNA expression stimulated with LPS
or ATP in BMMCs but not in BMDMs. Taken together, we speculate that
IPZ-010 may act on mast cells to inhibit zinc movement and ameliorate
postoperative ileus, although we cannot rule out the possibility that
IPZ-010 will target macrophages and/or neutrophils. Further study will
need to clarify target cells of IPZ-010 on postoperative ileus.
Regarding to translation, many relations between human diseases
and zinc are reported [50]. For example, zinc can attenuate β-amyloid
protein-induced neurotoxicity. It is reported that Ca2+ channel activity
is recovered by o-phenanthroline, a zinc chelator [51]. As for POI, it is
reported that leucocytes such as neutrophils and monocytes are re-
cruited in both mice and human [52]. In addition, IPZ-010 can be
metabolized quickly (supplement Fig. 1), therefore it can be used safely.
These reports and data suggest that zinc chelator such as IPZ-010 may
be integrated into practice.
In conclusion, a new zinc chelator, IPZ-010, inhibited zinc waves in
activated mast cells in vitro. Administration of IPZ-010 significantly
ameliorated inflammation due to intestinal manipulation, improving
gastrointestinal transit, possibly by targeting immunoreactive cells.
Zinc movement is important for the pathogenesis of postoperative ileus,
and targeting zinc signaling could be a new therapeutic and/or pro-
phylactic strategy for postoperative ileus.
Author contributions
M.H. and K.N. designed the experiments. Y.Y., Y.T., S.M. performed
in vivo experiments, H. Kimura, K.N. and N.K. performed in vitro ex-
periments using BMMCs and BMDMs. H.I. and H. Komatsu performed
organic chemistry experiments of IPZ-010. T.M., H.O. and M.H. con-
firmed this study, and H. Kimura and M.H. wrote the manuscript.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgements
We thank Interprotein Co. Ltd. for supplying IPZ-010. This work was
supported by a Grants-in-Aid for Scientific Research from The Ministry
of Education, Culture, Sports, Science and Technology (No. 22658089
and No. 24248050 to M.H., No.25221205 to H.O.).
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.biopha.2019.109773.
References
[1] A.J. Bauer, G.E. Boeckxstaens, Mechanisms of postoperative ileus,
Neurogastroenterol. Motil. 16 (Suppl. 2) (2004) 54–60.
[2] G.E. Boeckxstaens, W.J. de Jonge, Neuroimmune mechanisms in postoperative
ileus, Gut 58 (9) (2009) 1300–1311.
[3] S. Iyer, W.B. Saunders, S. Stemkowski, Economic burden of postoperative ileus
associated with colectomy in the United States, J. Manag. Care Pharm. 15 (6)
(2009) 485–494.
[4] G. Matteoli, P.J. Gomez-Pinilla, A. Nemethova, M. Di Giovangiulio, C. Cailotto,
S.H. van Bree, K. Michel, K.J. Tracey, M. Schemann, W. Boesmans, P. Vanden
Berghe, G.E. Boeckxstaens, A distinct vagal anti-inflammatory pathway modulates
intestinal muscularis resident macrophages independent of the spleen, Gut 63 (6)
(2014) 938–948.
[5] J.C. Kalff, W.H. Schraut, R.L. Simmons, A.J. Bauer, Surgical manipulation of the gut
elicits an intestinal muscularis inflammatory response resulting in postsurgical
ileus, Ann. Surg. 228 (5) (1998) 652–663.
[6] J.C. Kalff, T.M. Carlos, W.H. Schraut, T.R. Billiar, R.L. Simmons, A.J. Bauer,
Surgically induced leukocytic infiltrates within the rat intestinal muscularis mediate
postoperative ileus, Gastroenterology 117 (2) (1999) 378–387.
[7] S. Wehner, F.F. Behrendt, B.N. Lyutenski, M. Lysson, A.J. Bauer, A. Hirner,
9
Biomedicine & Pharmacotherapy 123 (2020) 109773
J.C. Kalff, Inhibition of macrophage function prevents intestinal inflammation and
postoperative ileus in rodents, Gut 56 (2) (2007) 176–185.
[8] C. Kreiss, L.A. Birder, S. Kiss, M.M. VanBibber, A.J. Bauer, COX-2 dependent in-
flammation increases spinal Fos expression during rodent postoperative ileus, Gut
52 (4) (2003) 527–534.
[9] J.C. Kalff, W.H. Schraut, T.R. Billiar, R.L. Simmons, A.J. Bauer, Role of inducible
nitric oxide synthase in postoperative intestinal smooth muscle dysfunction in ro-
dents, Gastroenterology 118 (2) (2000) 316–327.
[10] Y. Tsuchida, F. Hatao, M. Fujisawa, T. Murata, M. Kaminishi, Y. Seto, M. Hori,
H. Ozaki, Neuronal stimulation with 5-hydroxytryptamine 4 receptor induces anti-
inflammatory actions via alpha7nACh receptors on muscularis macrophages asso-
ciated with postoperative ileus, Gut 60 (5) (2011) 638–647.
[11] M. Fujisawa, T. Murata, M. Hori, H. Ozaki, The 5-HT4 receptor agonist mosapride
attenuates NSAID-induced gastric mucosal damage, J. Gastroenterol. 45 (2) (2010)
179–186.
[12] J. Hallgren, M.F. Gurish, Mast cell progenitor trafficking and maturation, Adv. Exp.
Med. Biol. 716 (2011) 14–28.
[13] W.J. de Jonge, F.O. The, D. van der Coelen, R.J. Bennink, P.H. Reitsma, S.J. van
Deventer, R.M. van den Wijngaard, G.E. Boeckxstaens, Mast cell degranulation
during abdominal surgery initiates postoperative ileus in mice, Gastroenterology
127 (2) (2004) 535–545.
[14] F.O. The, R.J. Bennink, W.M. Ankum, M.R. Buist, O.R. Busch, D.J. Gouma, S. van
der Heide, R.M. van den Wijngaard, W.J. de Jonge, G.E. Boeckxstaens, Intestinal
handling-induced mast cell activation and inflammation in human postoperative
ileus, Gut 57 (1) (2008) 33–40.
[15] P.J. Gomez-Pinilla, G. Farro, M. Di Giovangiulio, N. Stakenborg, A. Nemethova,
A. de Vries, A. Liston, T.B. Feyerabend, H.R. Rodewald, G.E. Boeckxstaens,
G. Matteoli, Mast cells play no role in the pathogenesis of postoperative ileus in-
duced by intestinal manipulation, PLoS One 9 (1) (2014) e85304.
[16] A.S. Prasad, Discovery of human zinc deficiency: its impact on human health and
disease, Adv. Nutr. 4 (2) (2013) 176–190.
[17] S. Yamasaki, K. Sakata-Sogawa, A. Hasegawa, T. Suzuki, K. Kabu, E. Sato,
T. Kurosaki, S. Yamashita, M. Tokunaga, K. Nishida, T. Hirano, Zinc is a novel
intracellular second messenger, J. Cell Biol. 177 (4) (2007) 637–645.
[18] H. Haase, J.L. Ober-Blobaum, G. Engelhardt, S. Hebel, A. Heit, H. Heine, L. Rink,
Zinc signals are essential for lipopolysaccharide-induced signal transduction in
monocytes, J. Immunol. 181 (9) (2008) 6491–6502.
[19] M. Yu, W.W. Lee, D. Tomar, S. Pryshchep, M. Czesnikiewicz-Guzik, D.L. Lamar,
G. Li, K. Singh, L. Tian, C.M. Weyand, J.J. Goronzy, Regulation of T cell receptor
signaling by activation-induced zinc influx, J. Exp. Med. 208 (4) (2011) 775–785.
[20] K. Kabu, S. Yamasaki, D. Kamimura, Y. Ito, A. Hasegawa, E. Sato, H. Kitamura,
K. Nishida, T. Hirano, Zinc is required for Fc epsilon RI-mediated mast cell acti-
vation, J. Immunol. 177 (2) (2006) 1296–1305.
[21] S. Fukuyama, Y. Matsunaga, W. Zhanghui, N. Noda, Y. Asai, A. Moriwaki,
T. Matsumoto, T. Nakano, K. Matsumoto, Y. Nakanishi, H. Inoue, A zinc chelator
TPEN attenuates airway hyperresponsiveness and airway inflammation in mice in
vivo, Allergol. Int. 60 (3) (2011) 259–266.
[22] M. Adler, R.E. Dinterman, R.W. Wannemacher, Protection by the heavy metal
chelator N,N,N’,N’-tetrakis (2-pyridylmethyl)ethylenediamine (TPEN) against the
lethal action of botulinum neurotoxin A and B, Toxicon 35 (7) (1997) 1089–1100.
[23] M.P. Cuajungco, G.J. Lees, Diverse effects of metal chelating agents on the neuronal
cytotoxicity of zinc in the hippocampus, Brain Res. 799 (1) (1998) 97–107.
[24] M.L. Seta, P.B. Kale-Pradhan, Efficacy of metoclopramide in postoperative ileus
after exploratory laparotomy, Pharmacotherapy 21 (10) (2001) 1181–1186.
[25] A. Taguchi, N. Sharma, R.M. Saleem, D.I. Sessler, R.L. Carpenter, M. Seyedsadr,
A. Kurz, Selective postoperative inhibition of gastrointestinal opioid receptors, N.
Engl. J. Med. 345 (13) (2001) 935–940.
[26] B.G. Wolff, F. Michelassi, T.M. Gerkin, L. Techner, K. Gabriel, W. Du, B.A. Wallin,
Alvimopan, a novel, peripherally acting mu opioid antagonist: results of a multi-
center, randomized, double-blind, placebo-controlled, phase III trial of major ab-
dominal surgery and postoperative ileus, Ann Surg. 240 (4) (2004) 728–734 dis-
cussion 734–725.
[27] Camilleri M. Alvimopan, A selective peripherally acting mu-opioid antagonist,
Neurogastroenterol. Motil. 17 (2) (2005) 157–165.
[28] K. Narita, A. Tsunoda, K. Takenaka, M. Watanabe, K. Nakao, M. Kusano, Effect of
mosapride on recovery of intestinal motility after hand-assisted laparoscopic co-
lectomy for carcinoma, Dis. Colon Rectum 51 (11) (2008) 1692–1695.
[29] A. Tsukamoto, K. Ohno, S. Maeda, K. Nakashima, K. Fukushima, Y. Fujino, M. Hori,
H. Tsujimoto, Effect of mosapride on prednisolone-induced gastric mucosal injury
and gastric-emptying disorder in dog, J. Vet. Med. Sci. 74 (9) (2012) 1103–1108.
[30] K. Nishida, S. Yamasaki, Y. Ito, K. Kabu, K. Hattori, T. Tezuka, H. Nishizumi,
D. Kitamura, R. Goitsuka, R.S. Geha, T. Yamamoto, T. Yagi, T. Hirano, Fc{epsilon}
RI-mediated mast cell degranulation requires calcium-independent microtubule-
dependent translocation of granules to the plasma membrane, J. Cell Biol. 170 (1)
(2005) 115–126.
[31] T. Oka, M. Hori, H. Ozaki, Microtubule disruption suppresses allergic response
through the inhibition of calcium influx in the mast cell degranulation pathway, J.
Immunol. 174 (8) (2005) 4584–4589.
[32] G.M. Gersuk, L.W. Razai, K.A. Marr, Methods of in vitro macrophage maturation
confer variable inflammatory responses in association with altered expression of
cell surface dectin-1, J. Immunol. Methods 329 (1–2) (2008) 157–166.
[33] T. Oka, M. Hori, A. Tanaka, H. Matsuda, H. Karaki, H. Ozaki, IgE alone-induced
actin assembly modifies calcium signaling and degranulation in RBL-2H3 mast cells,
Am. J. Physiol., Cell Physiol. 286 (2) (2004) C256–263.
[34] M. Kiyosue, M. Fujisawa, K. Kinoshita, M. Hori, H. Ozaki, Different susceptibilities
of spontaneous rhythmicity and myogenic contractility to intestinal muscularis
H. Kimura, et al.
inflammation in the hapten-induced colitis, Neurogastroenterol. Motil. 18 (11)
(2006) 1019–1030.
[35] H.S. Sallam, H.M. Oliveira, H.T. Gan, D.N. Herndon, J.D. Chen, Ghrelin improves
burn-induced delayed gastrointestinal transit in rats, Am. J. Physiol. Regul. Integr.
Comp. Physiol. 292 (1) (2007) R253–257.
[36] N.T. Schwarz, J.C. Kalff, A. Turler, B.M. Engel, S.C. Watkins, T.R. Billiar, A.J. Bauer,
Prostanoid production via COX-2 as a causative mechanism of rodent postoperative
ileus, Gastroenterology 121 (6) (2001) 1354–1371.
[37] T. Hochdorfer, C. Tiedje, D.J. Stumpo, P.J. Blackshear, M. Gaestel, M. Huber, LPS-
induced production of TNF-alpha and IL-6 in mast cells is dependent on p38 but
independent of TTP, Cell. Signal. 25 (6) (2013) 1339–1347.
[38] S.H. Zuckerman, G.F. Evans, L. Guthrie, Transcriptional and post-transcriptional
mechanisms involved in the differential expression of LPS-induced IL-1 and TNF
mRNA, Immunology 73 (4) (1991) 460–465.
[39] K. Golovine, R.G. Uzzo, P. Makhov, P.L. Crispen, D. Kunkle, V.M. Kolenko,
Depletion of intracellular zinc increases expression of tumorigenic cytokines VEGF,
IL-6 and IL-8 in prostate cancer cells via NF-kappaB-dependent pathway, Prostate
68 (13) (2008) 1443–1449.
[40] B.A. Moore, L.E. Otterbein, A. Turler, A.M. Choi, A.J. Bauer, Inhaled carbon mon-
oxide suppresses the development of postoperative ileus in the murine small in-
testine, Gastroenterology 124 (2) (2003) 377–391.
[41] J. Schmidt, B. Stoffels, R.S. Chanthaphavong, B.M. Buchholz, A. Nakao, A.J. Bauer,
Differential molecular and cellular immune mechanisms of postoperative and LPS-
induced ileus in mice and rats, Cytokine 59 (1) (2012) 49–58.
[42] A. Turler, N.T. Schwarz, E. Turler, J.C. Kalff, A.J. Bauer, MCP-1 causes leukocyte
recruitment and subsequently endotoxemic ileus in rat, Am. J. Physiol. Gastrointest.
Liver Physiol. 282 (1) (2002) G145–155.
[43] M. Hori, H. Nobe, K. Horiguchi, H. Ozaki, MCP-1 targeting inhibits muscularis
macrophage recruitment and intestinal smooth muscle dysfunction in colonic
10
Biomedicine & Pharmacotherapy 123 (2020) 109773
inflammation, Am. J. Physiol., Cell Physiol. 294 (2) (2008) C391–401.
[44] E.H. Livingston, E.P. Passaro Jr., Postoperative ileus, Dig. Dis. Sci. 35 (1) (1990)
121–132.
[45] D. Menzies, Postoperative adhesions: their treatment and relevance in clinical
practice, Ann. R. Coll. Surg. Engl. 75 (3) (1993) 147–153.
[46] M. Hori, M. Kita, S. Torihashi, S. Miyamoto, K.J. Won, K. Sato, H. Ozaki, H. Karaki,
Upregulation of iNOS by COX-2 in muscularis resident macrophage of rat intestine
stimulated with LPS, Am. J. Physiol. Gastrointest. Liver Physiol. 280 (5) (2001)
G930–938.
[47] T. Tajima, T. Murata, K. Aritake, Y. Urade, M. Michishita, T. Matsuoka,
S. Narumiya, H. Ozaki, M. Hori, EP2 and EP4 receptors on muscularis resident
macrophages mediate LPS-induced intestinal dysmotility via iNOS upregulation
through cAMP/ERK signals, Am. J. Physiol. Gastrointest. Liver Physiol. 302 (5)
(2012) G524–534.
[48] K. Nishida, R. Uchida, Role of zinc signaling in the regulation of mast cell-,
Basophil-, and t cell-mediated allergic responses, J. Immunol. Res. (2018) 5749120.
[49] R. Uchida, H. Xiang, H. Arai, H. Kitamura, K. Nishida, L-type calcium channel-
mediated zinc wave is involved in the regulation of IL-6 by stimulating Non-IgE
with LPS and IL-33 in mast cells and dendritic cells, Biol. Pharm. Bull. 42 (1) (2019)
87–93.
[50] M. Kawahara, D. Mizuno, H. Koyama, K. Konoha, S. Ohkawara, Y. Sadakane,
Disruption of zinc homeostasis and the pathogenesis of senile dementia,
Metallomics 6 (2) (2014) 209–219.
[51] M. Kawahara, K.I. Tanaka, Kato-Negishi M. Zinc, Carnosine, and neurodegenerative
diseases, Nutrients 29 (2) (2018) 10.
[52] S. De Schepper, N. Stakenborg, G. Matteoli, S. Verheijden, G.E. Boeckxstaens,
Muscularis macrophages: key players in intestinal homeostasis and disease, Cell.
Immunol. 330 (2018) 142–150.