Genetic Engineering and Biotechnology Journal, Volume 2010: GEBJ-17 1

Molecular Cloning and Characterization of Dectin-1 Receptor cDNA Expressed on

Macrophages of Buffalo (Bubalus bubalis)
Abhijit K Barate, Brijesh Singh Yadav*, Ashok Kumar, Bhaskar Sharma
Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, Bareilly (UP) 243122, India

*Correspondence to: Brijesh Singh Yadav, brijeshbioinfo@gmail.com

Accepted: October 19, 2010; Published: December 23, 2010
Abstract

Dectin-1 a member of C-type lectin family of pathogen recognition receptor is primarily expressed on dendritic cells and macrophages. In this
study, dectin-1 receptor cDNA has been characterized using Bubalus bubalis macrophage RNA and primers designed from known dectin-1
sequences of cattle and sheep. cDNA was synthesized using reverse transcriptase and used for amplification of two Bubalus bubalis dectin-1
overlapping fragments of length 410 & 619 bp. The overlapping sequence from 189-410 was removed and the Open reading frame (ORF) was
analyzed. Analysis of dectin-1 ORF sequence reveals that it has 97.9 percent of homology at nucleotide level and 96.5, 96.0 percent homology at
amino acids level with Bos taurus dectin-1 AY937382, BC102340 congeners respectively. ORF of both species consist of 606 nucleotides encoding a
protein of 201 amino acids. Buffalo dectin-1 shows 13 nucleotide substitutions whereas 7 and 8 amino acid substitutions when compared with Bos
taurus AY937382, BC102340 congeners respectively. Phylogenetic tree analysis of the available dectin-1 sequences shows that the dectin-1 of
buffalo and cattle are closely related.

Keywords: Buffalo; Cloning; C-type lectin; cDNA; Dectin-1.

1. Introduction

The immune system protects an organism from infection by pathogens. This system consists of innate and adaptive immunity. In
innate immunity, the recognition of microbes is based on non-clonally distributed receptors that recognize certain molecular
patterns in microbes that are not found in self-tissues. These receptors are designated as pattern recognition receptors (PRR) and
the molecular patterns are designated as pathogen associated molecular patterns (PAMPs) [1]. One family of PRRs found on antigen
presenting cells is called as C-type lectins [2, 3]. The term CTLD (C-type lectin domain) was originally introduced to describe the
carbohydrate-binding module in these CTLs [4, 5]. These receptors are known to assist in microbe phagocytosis, antigen processing
and presentation [6].

Dectin-1 (CLEC7A, CLECSF12, glucan receptor; BGR), is a type II transmembrane receptor containing a single extracellular CTLD,
neck/stalk, transmembrane domain and an ITAM (Immunoreceptor tyrosine-based activation motifs) in its cytoplasm tail [7]. It is the
major receptor involved in the recognition of β-1, 3 linked glucans. Dectin-1 CTLD binds β-glucans through atypical interaction that
does not require calcium [8-11]. The β-glucan binding site of dectin-1 is a shallow groove located on protein surface, and it is defined
by Trp221 and His223 [8]. Recognition of pathogen by dectin-1 stimulates phagocytosis, oxidative burst, neutrophil degranulation,
production of cytokines and chemokines [12]. Additionally, dectin-1 is suggested to act as T-cell costimulator. It interacts with T-
lymphocytes at a site different from its β-glucan recognizing site. This binding stimulates production of IFN-γ, activation and
proliferation in T-cells [7, 14, 15]. Dectin-1 is expressed as alternatively spiced isoforms. Its expression on different myeloid cells
varies and is species specific [7, 10, 16-19]. In 2006, the expression pattern dectin-1 on cattle immune cells was reported [20]. Due to
the lack of information about this important antifungal PRR in buffalo, we report here characterization of dectin-1 receptor cDNA
expressed on macrophages from Buffalo (Bubalus bubalis).

2 . Methods

2.1 Lymphocyte culture

Blood was collected aseptically from apparently healthy Buffaloes. Lymphocytes were separated using Histopaque-1077 (Sigma-
Aldrich, USA) according to manufacturer’s protocol. The cells were reconstituted in RPMI-1640 (Sigma- Aldrich, USA) at density 2 x

http://astonjournals.com/gebj
2 Research Article

107 cells/ml medium supplemented with 15% FCS, penicillin (100 IU/ml) and streptomycin (100µg/ml). The cells were then dispensed
in 24 well culture plate (NUNC, USA). The plates were transferred to CO2 incubator at 37◦C and 5% CO2 for 18 hours. The
supplemented media was changed every 18 hours. On 6th day, majority of the cells were transformed into macrophages [21].

2.2 Total RNA isolation and analysis

Total RNA from macrophages was isolated using TRI REAGENT (MRC, USA) according to manufacturer’s protocol. Finally, pellet was
dissolved in 0.1% DEPC treated distilled water. The purity of isolated RNA was checked by A260 / A280 and quantification was done
on the basis of absorbance at 260 nm. The RNA was stored at -70◦C.

2.3 RT-PCR

RT-PCR was done for synthesis for first chain of cDNA using Revert AidTMRT-PCR kit (Fermentas, USA) according to manufacturer’s
protocol. Dectin-1 specific primers for first fragment (410bp) 5’GGAACTCAGTAGAACAATGGAATA3’, 5’AATGATCAGGCTGGGA
AGACAC3’ and second fragment (619bp) 5’GCTGTGAC TCTGGGCATTTT3’, 5’AAGT CTTCCATCCTGTTTCTCA3’ were designed by
comparing the published sequence of Bos taurus (Accession No- BC102340, Accession No- AY937382) and Ovis aries (Accession No-
AM167930) cDNA sequence. The desired products were amplified by 30 cycles of PCR using 3l synthesized cDNA as template in
50l reaction containing 5l 10x Taq buffer (containing Mg2+), 25pmol each primer and 5U Taq DNA Polymerase(Fermentas). The
PCR cycle consisted of 45 sec at 94◦C, annealing temperature of 50◦C for first fragment and 52◦C for second fragment and 1 min
extension at 72◦C. PCR reactions were undertaken on Eppendorf Mastercycler Personnal, Germany.

2.4 Cloning and sequence analysis

The amplified products were purified using DNA purification kit (QIAGEN, Germany). The purified PCR products were cloned in the
pGEMT-EasyTM cloning vector (Promega, USA at molar ration 3:1 at 4◦C and then transformed into freshly prepared E. coli strain
DH5α competent cells. Recombinant clones were selected using blue/white screening on Xgal (25µg/ml)/IPTG (25µg/ml)/Ampicillin
(50µg/ml) LB plates. The clones were confirmed by EcoRI restriction enzyme digestion. Three positive clones were picked up for
sequencing in both directions for each fragment. Dectin-1 cDNA sequence of buffalo was analyzed using Lasergene software (DNA
Star Inc., USA). Sequences used for comparison were retrieved from 'EMBL' data bank CDs as well as from NCBI website. Species
used in comparison and accession numbers of corresponding dectin-1 sequences are as follows: Cattle (AY937382 & BC102340),
sheep (AM167930), human (AF400596), monkey (NM_001032943), chimpanzee (XM_528732) and mouse (AY534909).

3. Results

3.1 RNA concentration, amplification

The concentration of total cellular RNA isolated from Buffalo macrophages was found to be 6.0 g from 15 x 105 cells. The A260 /
A280 was found to be 2.1 which indicated the high purity of RNA preparation. The integrity was checked on 1% agarose gel
electrophoresis and standard three-band pattern corresponding to 28, 18 and 5S was observed. The optimum PCR annealing
temperature for the dectin-1 primers was found to be 50◦C & 52◦C for first and second fragment respectively. The size of the PCR
product in 1% agarose gel submarine electrophoresis was found to be 410 & 619 bp (Fig: 1a & 1b).

E-ISSN: 21503516
 Genetic Engineering and Biotechnology Journal, Volume 2010: GEBJ-17 3

Fig. 1a 1% Agarose gel electrophoresis for first fragment, M: 100bp, L1: 410 bp PCR product, L2: 410 bp Purified PCR, L3: Undigested recombinant
plasmid, L4: EcoRI digested recombinant plasmid; Fig. 1b 1% Agarose gel electrophoresis for second fragment, M: 100 bp ladder L1: 619 bp PCR
product L2: 619 bp Purified PCR L3: Undigested recombinant plasmid, L4: EcoRI digested recombinant plasmid.

3.2 Sequence analysis

The pGEMT- EasyTM clones were sequenced for each fragment and the complete cDNA sequence of 773 (Fig.2) nucleotides was
formed after removal of overlapping sequence from 189-410. This was also confirmed by using SeqmanII programme of Lasergene
software (DNA Star Inc., USA) and Gene Tool lite 1.0.

GGAACTCAGTAGAACAATGGAATATCAATCTTCAGTGGAAAATTTGGATGAAGATGGATATA
M1 E Y Q S S V E N L10 D E D G Y

CTCAATTAGACTTCAGCTCTCGCAACATCACCAGGAGATCTATAGTCTCAGAGAAAGGGCTTT
T Q L D F20 S S R N I T R R S I30 V S E K G L

GTGCTGCATCCTCGCATTGGCGTCTGATTGCTGTGACTCTGGGCATTTTATGCTCAGTGATGCT
C A A S40 S H W R L I A V A L50 G I L C S V M L

GGTGGTAACTGTGGTCCTGAGTACCTCGGGAGTTTTCTCTAGCTCTTGTTCCCCTAACTGGATC
V V60 T V V L S T S G V F70 S S S C S P N W I

ACACATGAGGATAGCTGTTATCTATTTAGCACACTATTAGATTCCTGGGATGGAAGTAAAAGA
T80 H E D S C Y L F S T90 L L D S W D G S K R 100
β0 β1

CAATGCTTTCAACTGGGCTCTAATCTCCTGAAGATAGACAGCTCAAAAGAGTTGGAGTTTATA
Q C F Q L G S N L L110 K I D S S K E L E F I120
β1’
GCAAGGCAAGTGTCTTCCCAGCCTGATCATTCATTCTGGATAGGGCTTTCTCGCCGTCGGACA
A R Q V S S Q P D130 H S F W I G L S R R140 R T
β2

http://astonjournals.com/gebj
4 Research Article

GAAGAACCATGGCTCTGGGAGGATGGCTCCACCTTGTTGTCTAACCTGTTTCAAATCAGAAGT
E E P W L W E D 150 G S T L L S N L F Q160 I R S
β2’ β2’’
ACAGTTACCAAAAAAGACTCATCTCACAACTGTGCATGGATCCACGTGTCAGACATTTACGAC
T V T K K D S170 S H N C A W I H V S180 D I Y D
β3 β4
CAACTTTGTAGTGCGCATTCATACAGTATTTGTGAGAAGAAGTTGTCAGTATAATGGTGAGGA
Q L C S A H190 S Y S I C E K K L S200 V --
β5
GCAGAGAGATGTATGTAAGATACTAAGGAGGGTATAAATCCAAACAGAAAAGAGACATATTTGAGGTCAAAATAATT
GCTGAAAAAAATATCAGGAGAGCTCATCCCACTTCAATCTTAACTGAGAACAGGATGGAAGACTT

Fig. 2 cDNA sequence and the putative amino acid sequence of Dectin-1 from Bubalus bubalis. Cyteine residues are colored blue. The CTLD is
located between 68-197.

BLAST was performed for this sequence in NCBI database. The sequence showed resemblance with dectin-1 sequences from other
species, which suggested that the obtained sequence was of buffalo dectin-1. The sequence has been submitted to NCBI (Accession
number EF636900). ORF region of buffalo dectin-1 consists of 606 nucleotides and encodes a protein of 201 amino acids
(ABR24825). ORF was aligned using Megalign programme of Lasergene software (DNA Star Inc., USA), and Mega 3.1. Alignment in
Megalign program was done using ClustalW method.

Fig. 3 Dectin-1 orf alignment and phylogenetic tree at nucleotide level using Megalign programme of Lasergene software (DNA Star Inc., USA).

E-ISSN: 21503516
 Genetic Engineering and Biotechnology Journal, Volume 2010: GEBJ-17 5

Buffalo dectin-1 shows (Fig.3) 97.9% homology with the ORF of cattle dectin-1 sequences. Furthermore, the buffalo dectin-1 ORF
showed homology 51.2% homology with sheep dectin-1 ORF (AM167930). On the other hand, the buffalo dectin-1 ORF showed
homology 80.7% with human dectin-1 ORF (AF400596), 80.4% with monkey dectin-1 ORF (NM_001032943), 80.5% with chimpanzee
dectin-1 ORF (XM_528732) and 48.0% homology with mouse decin-1 ORF (AY534909).

Comparison of buffalo and cattle dectin-1 mRNA sequence shows that there are 13 substitutions. The calculated mass of the
encoded protein is 22.702 KDa with the isoelectric point of 5.82. There were 7 and 8 amino acid substitutions at different positions
in comparison to cattle amino acid sequence corresponding to AY937382, BC102340. 193 amino acids are conserved between cattle
and buffalo dectin-1 sequences. The eight cysteine residues of buffalo dectin-1 at position C37, C54, C74, C85, C102, C174, C187 and C195
were found to be inherent in all analyzed dectin-1 sequences from different species. The CTLD was sequence found to from 68-197
and with the conserved WIGL motif positioned from 134-137. The LLR (Long loop region) involved in carbohydrate binding and
139 173
domain-swapping dimerization [22-26] is located from Arg -Asn (Fig 2).

Fig. 4 Dectin-1 alignment and phylogenetic tree at amino acid level using Megalign programme of Lasergene software (DNA Star Inc., USA).

Dectin-1 at amino acid level showed (Fig. 4) 96.5, 96.0 percent homology with cattle dectin-1 (AY937382, BC102340) and 72.6, 72.6,
71.6,59.7 and 60.3 percent homology with chimpanzee, human, monkey, mouse and sheep dectin-1 respectively. The CTLD region
showed 96.2, 95.4 95.4, 76.2, 76.2, 76.2, 74.6, 58.9, 87.3, 75.4,75.4 percent identity with cattle protein sequence AY937382,
BC102340, NM_001031852, human sequence AF400596, AF400599, AY026770, Monkey sequence NM_001032943, mouse
sequence AY534909, sheep sequence AM167930 and chimpanzee sequences XM_528732.2, XM_001144825 respectively.

In the phylogenetic tree prepared on the basis of nucleotide sequence, buffalo dectin-1 was found to be in the group of cattle and
ovine sequences. Human and chimpanzee sequences each fall in one group and mouse sequence falls in separate group and is more

http://astonjournals.com/gebj
6 Research Article

distant than human group. Based on amino acid sequence, human, chimpanzee and monkey dectin-1 sequences fall in one group.
The buffalo sequence is closely related to cattle sequence AY937382, BC102340 while the sheep and mouse dectin-1 sequence each
fall in separate group.

4. Discussion

Macrophages represent a preexisting first line of defence against invading microorganism that express an array of pathogen-specific
receptors on their surface. These receptors help in phagocytosis and elimination of ligand-bearing molecules or organisms. C-type
lectins (CTLs) are expressed on macrophages and other antigen-presenting cells (APC). Dectin-1 a member of C-type lectin receptor
family has been shown to play an important role in fungal recognition and immunity against these pathogens. The kind of response
after pathogen recognition depends on the fungal stage, complexity of β-glucan and type of cell involved.

In the present study, the buffalo dectin-1 cDNA was successfully cloned and sequenced. In the current study the ORF region of
buffalo dectin-1 cDNA sequence have 97.9% homology with Bos taurus dectin-1 sequences (Accession No-AY937382, BC102340).
Thus, the buffalo dectin-1 cDNA was found closer to cattle dectin-1 sequences and distant from mouse sequence AY534909 that had
only 48.0% similarity. The buffalo dectin-1 ORF showed homology 51.2% homology with sheep dectin-1 ORF (AM167930). At amino
acid level the percent similarity was found to be 96.5, 96.0 with Bos taurus dectin-1 sequence AY937382, BC102340 respectively
distant from mouse sequence AY534909 which has 59.7% similarity. The buffalo dectin-1 showed homology of 60.3% with sheep
dectin-1 at amino acid level (AM167930). Out of 13 nucleotide substitutions between buffalo and cattle dectin-1, 8 nucleotide
substitutions resulted in amino acid substitution in corresponding proteins. The substitutions at position 21, 123, 321, 399, 477, 534
did not affect the final translated product, as these are the wobble positions. The positions which resulted in amino acid change –
cattle G88, A 178, C223, C322, T364, A 422 , A499 and T566 (only sequence BC102340) were replaced by buffalo A88, G178, T223, A 322, G364, G422 ,
499 566 30 60 75 108 122 141 167 189
G and C respectively. The change in amino acids was as follows cattle V , I , P , H , S , Q , E and V (only sequence
30 60 75 108 122 141 167 189
BC102340) was substituted by I , V , S , N , A , R , K and A in buffalo dectin-1. The hydrophobic amino acids Valine,
Isoleucine, valine at position 30, 60, 189 of cattle are replaced by hydrophobic amino acids Isoleucine, Valine and Alanine
respectively. Imino acid Proline at position 75 is replaced by polar serine. Proline is involved in the kink formation, and the replaced
serine may probably retain the kink by formation of hydrogen bond with some other amino acid. Two polar amino acids Serine and
Glutamine (122, 141) are replaced by hydrophobic Alanine and basic Arginine respectively. Basic amino acid histidine is replaced by
polar Aspargine (108) and acidic amino acid glutamate is replaced by basic Lysine (167). The CTLD which is involved in pathogen
recognition was sequence found from 68-197 [13] and LLR from Arg139-Asn173 [5]. The residues WIH that form the binding site are
found to be conserved at position 176-178. The CTLD region showed highest similarity 96.2 percent with cattle AY937382 and was
found to be less similar from mouse sequence AY534909 58.9 percent identity. 193 amino acids are conserved between cattle and
buffalo dectin-1sequences. The eight cysteine residues in buffalo dectin-1 including the C187 necessary for surface expression of this
molecule were found to be conserved [8]. Moreover, the conserved WIGL [5] is also found to be present in buffalo dectin-1 at
position 134-137. Phylogenetic tree also indicated that the buffalo dectin-1 falls in the cattle group. Dectin-1 is the major receptor
against fungal pathogens and this study provides the basic information for further studies concerning this receptor in buffalo.
Further studies directed against cell specific expression of dectin-1 and its response against different buffalo fungal infections are
required for development of immunomodulatory therapeutics for these species.

5. Conclusion

Analysis of dectin-1 ORF sequence reveals that it has 97.9 percent of homology at nucleotide level and 96.5, 96.0 percent homology
at amino acids level with Bos taurus dectin-1 AY937382, BC102340 congeners respectively. ORF of both species consist of 606
nucleotides encoding a protein of 201 amino acids. Buffalo dectin-1 shows 13 nucleotide substitutions whereas 7 and 8 amino acid
substitutions when compared with Bos taurus AY937382, BC102340 congeners respectively. Phylogenetic tree analysis of the
available dectin-1 sequences shows that the dectin-1 of buffalo and cattle are closely related.

Competing Interests

The authors declare that they have no competing interests.

E-ISSN: 21503516
 Genetic Engineering and Biotechnology Journal, Volume 2010: GEBJ-17 7

Authors’ Contributions

AKB drafted the manuscript under the supervision of BSY, AK and BS developed and supervised the project. AKB carried out the
entire work of this paper as part of his Master's dissertation.

Acknowledgement

The authors are thankful to Director, Indian Veterinary Research Institute, Izatnagar for providing necessary facilities and to the
Indian Council of Agricultural Research, New Delhi for the financial assistance.

References

1. Janeway CA, 2001. How the immune system works to protect the host from infection. Proceedings of National Academy of
Sciences USA, 98: 7461-7468.

2. McGreal EP, Miller JL, Gordon S, 2005. Ligand recognition by antigen-presenting cell C-type lectin receptors. Current Opinion in
Immunology, 17: 18-24.

3. Hollmig ST, Ariizumi K, Cruz PD, 2009. Recognition of non-self-polysaccharides by C-type lectin receptors dectin-1 and dectin-2.
Glycobiology, 19: 568-75.

4. Drickamer K, 1999. C-type lectin-like domains. Current Opinion in Structural Biology, 9: 585-590.

5. Zelensky AN, Gready JE, 2005. The C-type lectin-like domain superfamily. Federation of European Biochemical Societies Journal,
272: 6179-217.

6. Figdor CG, van Kooyk Y, Adema GJ, 2002. C-type lectin receptors on dendritic cells and Langerhans cells. Nature Reviews
Immunology, 2: 77-84.

7. Ariizumi K, Shen GL, Shikano S, Xu S, Ritter R, Kumamoto T, Edelbaum D, Morita A, Bergstresser PR, Takashima A, 2000.
Identification of a novel, dendritic cell-associated molecule, dectin- 1, by sub-tractive cDNA cloning. The Journal of Biological
Chemistry, 275: 20157–20167.

8. Adachi Y, Ishii T, Yoshihiko, Ikeda, Hoshino A, Tamura, H, Aketagawa J, Tanaka S, Ohno N, 2004.Characterization of β-Glucan
recognition site on C-type lectin, dectin 1. Infection and Immunity, 72: 4159-4171.

9. Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL, Martinez-Pomares L, Wong SY, Gordon S, 2002. Dectin-1 is a major β-
glucan receptor on macrophages. The Journal of Experimental Medicine, 196: 407–412.

10. Brown GD, 2006. Dectin-1: A signalling non-TLR pattern-recognition receptor. Nature Reviews Immunology, 6: 33-43.

11. Palma A, Feizi T, Zhang YB, Stoll M., Lawson AM, Diaz Rodriguez E, Campanero-Rhodes MA, Costa J, Gordon, S, Brown
GD, 2006. Ligands for the b-glucan receptor, dectin-1, assigned using ‘‘designer’’ microarrays of oligosaccharide probes
(neoglycolipids) generated from glucan polysaccharides. The Journal of Biological Chemistry, 281: 5771-5779.

12. Goodridge HS, Wolf AJ, Underhill DM, 2009. Beta-glucan recognition by the innate immune system. Immunological Reviews,
230: 38-50.

13. Brown J, O’callaghan CA, Marshall ASJ, Gilbert RJC, Siebold C, Gordon S, Brown GD, Jones EY, 2007. Structure of the fungal β-
glucan-binding immune receptor dectin-1: Implications for function. Protein Science, 16: 1042-1052.

14. Grunebach F, Weck MM, Reichert J, Brossart P, 2002. Molecular and functional characterization of human dectin-1.

http://astonjournals.com/gebj
8 Research Article

Experimental Hematology, 30: 1309–1315.

15. Willment JA, Gordon S, Brown GD, 2001. Characterization of the human beta-glucan receptor and its alternatively spliced
isoforms. The Journal of Biological Chemistry, 276: 43818–43823.

16. Fernandes MG, Finnegan AA, Siracusa LD, Brenner C, Iscove NN, Calabretta B, 1999. Characterization of a novel receptor that
maps near the natural killer gene complex: Demonstration of carbohydrate binding and expression in hematopoietic cells. Cancer
Research, 59: 2709–2717.

17. Yokota K, Takashima A, Bergstresser PR, Ariizumi K, 2001. Identification of a human homologue of the dendritic cell-associated
C-type lectin-1, dectin-1. Gene, 272: 51–60.

18. Taylor PR, Brown GD, Reid DM, Willment JA, Martinez-Pomares L, Gordon S, Wong SY, 2002. The beta-glucan receptor, dectin-
1, is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages. Journal of Immunology,
169: 3876–3882.

19. Willment JA, Marshall AS, Reid DM, Williams DL, Wong SY, Gordon S, Brown GD, 2005. The human beta-glucan receptor is
widely expressed and functionally equivalent to murine dectin-1 on primary cells. European Journal of Immunology, 35: 1539–1547.

20. Willcocks S, Yamakawa Y, Stalker A, Coffey TJ, Goldammer T, Werling D, 2006. Identification and gene expression of the bovine
C-type lectin, dectin-1. Veterinary Immunology and Immunopathology, 113: 234-42.

21. Wardley RC, Lawman MJ, Hamilton F, 1980. The establishment of continuous macrophage cell lines from peripheral blood
monocytes. Immunology, 39: 67-73.

22. Mizuno H, Fujimoto Z, Koizumi M, Kano H, Atoda H, Morita T, 1997. Structure of coagulation factors IX⁄X-binding protein, a
heterodimer of C-type lectin domains. Natural Structural Biology, 4: 438–441.

23. Feinberg H, Park-Snyder S, Kolatkar AR, Heise CT, Taylor ME, Weis WI, 2000. Structure of a C-type carbohydrate recognition
domain from the macrophage mannose receptor. The Journal of Biological Chemistry, 275: 21539–21548.

24. Mizuno H, Fujimoto Z, Atoda H, Morita T, 2001. Crystal structure of an anticoagulant protein in complex with the Gla domain of
factor X. Proceedings of National Academy of Sciences USA, 98: 7230–7234.

25. Hirotsu S, Mizuno H, Fukuda K, Qi MC, Matsui T, Hamako J, Morita T, Titani K, 2001. Crystal structure of bitiscetin, a von
Willebrand factor-dependent platelet aggregation inducer. Biochemistry, 40: 13592–13597.

26. Liu Y, Eisenberg D, 2002. 3D domain swapping: As domains continue to swap. Protein Science, 11: 1285–1299.

E-ISSN: 21503516