Sie sind auf Seite 1von 3

GROUP 3

Armstrong, Alexandra Emilia L.

Elizaga, Jhalen Ross L.

Laxamana, Martina Chantal B.

Lualhati, Alyssa Jane B.

Magpantay, Bea Trisha B.

Martinez, Gean Paolo G.

Moreno, Prince Kobe S.

Revadavia, Jessica Marie S.

CHAPTER 10 APPLIED QUESTIONS

1. Explain the genetic basis of the ability of lice to adapt to humans wearing clothing.

- By alternative splicing since it can generate new versions of genes in two ways. Introns can stay when
they should be thrown away or exons skipped. Alternative splicing enables the lice to adapt to a new
environment.
REFERENCE: Lewis, Ricky Ph.D. (2015, August 6). Gene Splicing in Lice and the Challenge of Clothing.
Retrieved from: https://blogs.plos.org/dnascience/2015/08/06/gene-splicing-lice-challenge-clothing/

2. List the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC.

- The RNA sequence transcribed from the DNA template sequence is AAUGUGAACGAACUCUCAG.

3. Reconstruct the corresponding DNA template sequence from the partial mRNA sequence
GCUAUCUGUCAUAAAAGAGGA.

-The corresponding DNA template sequence is CGATAGACAGTATTTTCTCCT

4. List three different mRNA sequences that could encode the amino acid sequence histidine-alanine-
arginine-serine-leucine-valine-cysteine.

CAU-GCU-CGU-AGU-CUU-GUU-UGU
CAC-GCC-CGC-AGC-CUC-GUC-UGC
CAU-GCA-CGA-UCA-CUA-GUA-UGU
5. Write a DNA sequence that would encode the amino acid sequence valine-tryptophan-lysine-proline-
phenylalanine-threonine.

- CAA- ACC- UUU- GGA- AAA- TGA

6. In the film Jurassic Park, which is about cloned dinosaurs, a cartoon character named Mr. DNA talks
about the billions of genetic codes in DNA. Why is this statement incorrect?

- Every dinosaur has a different DNA so it is impossible to be cloned and there is only one genetic code.

7. Titin is a muscle protein named for its size—its gene has the largest known coding sequence of 80,781
DNA bases. How many amino acids long is it?

- It is 26, 927 amino acids long

8. An extraterrestrial life form has a triplet genetic code with five different bases. How many different
amino acids can this code specify, assuming no degeneracy?

- 53 = 125

9. In malignant hyperthermia, a person develops a life-threateningly high fever after taking certain types
of anesthetic drugs. In one family, mutation deletes three contiguous DNA bases in exon 44. How many
amino acids are missing from the protein?

- One amino acid is missing from the protein.

10. The protein that serves as a receptor that allows insulin to enter cells has a different number of
amino acids in a fetus and an adult. Explain how this may happen.

- Alternative splicing of the insulin receptor pre-mRNA

11. In “hypomyelination with atrophy of the basal ganglia and cerebellum,” a mutation in a gene that
encodes a form of the cytoskeletal protein tubulin, TUBB4A, changes an aspartic acid (Asp) to an
asparagine (Asn). The resulting brain shrinkage causes seizures, developmental delay, and a spastic gait.
Only 22 cases are known.

a. Does the mutation involve synonymous or nonsynonymous codons?

- Mutation creates a nonsynonymous change at a highly conserved asparagine that sits at the intradimer
interface of α-tubulin and β-tubulin, and this change might affect tubulin dimerization, microtubule
polymerization, or microtubule stability. 

REFERENCE: Genet, Am J Hum. (2013, May 2). A de nove mutation in the β-tubulin gene TUBB4A results
in the leukoencopjalopathy hypomyelination with atrophy of the basal ganglia and cerebellum.
Retrieved from: https://www.ncbi.nlm.nih.gov/pubmed/23582646

b. Consult the genetic code table (table 10.3) and determine two mutations that could account for the
amino acid changes.
- The mutation that replaces the amino acid aspartate with the amino acid asparagines at protein
position 249 (Asp249Asn or D249N). It alters the structure of the β- tubulin protein. A mutation was
amplified with primers 5’-CAA-CGA-GGC-ACT-CTA-CGA-CA-3’ and 5’ –CTG-GTC-AGG-GGT-GCG-AAG-3’.

REFERENCE: Simons, C., Wolf. N.I., McNeil, N., Devaney, J.M., Takanohasi A., et al. (2013, April 11).
TUBB4A results in the leukoencephalopathy hypomyelination with atrophy of the basal ganglia and
cerebellum. Retrieved from: https://europepmc.org/article/pmc/pmc3644625
U.S. National Library of Medicine. Retrieved from: https://ghr.nlm.nih.gov/gene/TUBB4A#conditions

c. What might be the transcription pattern in the body for this gene?

- Tubulin is the major constituent of microtubules, a key component of the cytoskeleton. It binds two
molecules of GTP, one at an exchangeable site on the beta-chain and at the non-exchangeable site on
the alpha-chain. TUBB4A is preferentially and highly expressed in the central nervous system.

REFERENCES: https://en.wikipedia.org/wiki/Tubulin_beta-4A_chain

REFERENCES:

Lewis, R. (2018). Human Genetics: Concepts and Applications PDF. (12 th ed. Chapter 10: Gene Action:
From DNA to Protein Pp. 175-190) Penn Plaza, New York City. Mc-Graw Hill Education.

Das könnte Ihnen auch gefallen