Sie sind auf Seite 1von 64

HLA-Typisierungen

und Diagnostik von Immunisierungen

Berlin, 11.10.2019

PD Dr. med. Joannis Mytilineos


Abteilung Transplantationsimmunologie
IKT-Ulm, DRK-Blutspendedienst Baden-Württemberg - Hessen
und Institut für Transfusionsmedizin – Universitätsklinik Ulm
Ulm
Offenlegung Interessenskonflikte

1. Anstellungsverhältnis oder Führungsposition


- Priv. Doz. Für das Fach Immunologie an der Universität Heidelberg
- Leiter der Abteilung Transplantationsimmunologie, Institut für klinische Transfusionsmedizin und Immungenetik (IKT) Ulm
DRK-Blutspendedienst Baden-Württemberg – Hessen und Institut ´fürTransfusionsmedizin – Universitätsklinik Ulm
- Präsident der “European Federation of Immunogenetics” (EFI)
- 2. Vorsitzender des Deutschen Registers für Stammzelltransplantation (DRST)

2. Beratungs- bzw. Gutachtertätigkeit


keine

3. Besitz von Geschäftsanteilen, Aktien oder Fonds


keine

4. Patent, Urheberrecht, Verkaufslizenz


keine

5. Honorare
keine

6. Finanzierung wissenschaftlicher Untersuchungen


Zuwendung von Drittmitteln durch die:
- Jose Carreras-Leukämie Stiftung
- Else Kröner-Stiftung
- National Marrow Donor Program (NMDP)

7. Andere finanzielle Beziehungen


keine

8. Immaterielle Interessenkonflikte
keine
Ziele
▪ HLA-Genetik, Struktur und Funktion der HLA-Moleküle
▪ HLA-Nomenclatur
▪ HLA-Typisierungsmethoden
▪ HLA-Antikörper
▪ Klinische Anwendung der HLA-Testung

3
J. Mytilineos – Berlin 2019
HLA-Genetik, Struktur und
Funktion der HLA-Moleküle

4
J. Mytilineos – Berlin 2019
J. Mytilineos – Berlin 2019
Genetic Organisation of Human MHC

J. Mytilineos – Berlin 2019


HLA-Genes

J. Mytilineos – Berlin 2019


Annual increase of known HLA-Alleles
http://hla.alleles.org/nomenclature/index.html
http://hla.alleles.org/nomenclature/index.html

J. Mytilineos – Berlin 2019


Current Number of recognized HLA-Alleles
Jun 2019/(Dec. 2008) /http://hla.alleles.org/nomenclature/stats.html)

HLA-A 5.266 (733)


HLA-B 6.537 (1.115)
HLA-Cw 5.140 (392)
HLA-DRB 3.171 (697)
HLA-DQA1 183 (15)
HLA-DQB1 1.718 (95)
HLA-DPA1 132 (8)
HLA-DPB1 1.449 (132)
A total of 23.907 HLA Alleles as of June 2019

J. Mytilineos – Berlin 2019


Human MHC Diversity
 Because of Evolution MHC alleles and haplotypes vary in frequency among
various human populations
 MHC phenotype determines the “immunological” identity as well as immune competence of an
individual.

 Diversity of MHC molecules can recognize a greater number of potentially dangerous organisms
offering stronger immune protection to the population as a whole

Source: Goulder and Watkins, Nature Reviews Immunology 8, 619-630 (August 2008)
Inheritence of HLA Familienvererbungsschema

Mother Father

HLA-A: 01:01 29:01 HLA-A: 02:05 03:01

HLA-B: 08:01 35:03 HLA-B: 08:01 40:01

HLA-Cw: 07:01 04:01 HLA-Cw: 03:03 07:02

HLA-DRB1*: 07:01 03:01 HLA-DRB1*: 13:01 08:01

HLA-DQA1*: 02:01 05:01 HLA-DQA1*: 01:03 04:01

HLA-DQB1*: 03:03 02:01 HLA-DQB1*: 06:03 04:02

HLA-DPB1*: 09:01 04:01 HLA-DPB1*: 04:01 15:01


1 2 3 4

Child 1 Child 2 Child 3 Child 4

HLA-A: 29:01 03:01 HLA-A: 01:01 03:01 HLA-A: 29:01 03:01 HLA-A: 01:01 02:05

HLA-B: 35:03 40:01 HLA-B: 08:01 40:01 HLA-B: 35:03 40:01 HLA-B: 08:01 08:01

HLA-Cw: 04:01 07:02 HLA-Cw: 07:01 07:02 HLA-Cw: 04:01 07:02 HLA-Cw: 07:01 03:03

HLA-DRB1*: 03:01 08:01 HLA-DRB1*: 07:01 08:01 HLA-DRB1*: 03:01 08:01 HLA-DRB1*: 07:01 13:01

HLA-DQA1*: 05:01 04:01 HLA-DQA1*: 02:01 04:01 HLA-DQA1*: 05:01 04:01 HLA-DQA1*: 02:01 01:03

HLA-DQB1*: 02:01 04:02 HLA-DQB1*: 03:03 04:02 HLA-DQB1*: 02:01 04:02 HLA-DQB1*: 03:03 06:03

HLA-DPB1*: 04:01 15:01 HLA-DPB1*: 09:01 15:01 HLA-DPB1*: 04:01 15:01 HLA-DPB1*: 09:01 04:01
2 4 1 4 2 4 1 3
J. Mytilineos – Berlin 2019
J. Mytilineos – Berlin 2019
Genetic Organisation of HLA-Class I

J. Mytilineos – Berlin 2019


Genetic Organisation of HLA-Class II

J. Mytilineos – Berlin 2019


Expression of HLA-Antigens
HLA-Class I – Antigens • All nuclated Cells
• Platelets
• Sperms

HLA-Class II – Antigens • Macrophages


• Monocytes
• Activ. T-Lymphocytes
• B-Lymphocytes

J. Mytilineos – Berlin 2019


Physiological Functions of MHC
• Distinction between “self” and “non-self”

• Through their interaction with NK cells, they play a


significant role in the prevention of tumors and virus
infection

• Contribute to the maturation and expansion of T- and


B-cells

J. Mytilineos – Berlin 2019


Antigen Presentation

J. Mytilineos – Berlin 2019


HLA-Nomenklatur

18
J. Mytilineos – Berlin 2019
HLA-Nomenclature

J. Mytilineos – Berlin 2019


Problem: Ambiguities
Allele 1: (Maternal) AcgTTAAggTagcgcATcTgAcccAATCTT

Allele 2: (Paternal) AcgCTAAggTagcgcATcTgAgggTTACTT


Sequencing-Result: AcgYTAAggTagcgcATcTgASSSWWWCTT

J. Mytilineos – Berlin 2019


Problem: Ambiguities
Allele 1: (Maternal) AcgTTAAggTagcgcATcTgAcccAATCTT

Allele 2: (Paternal) AcgCTAAggTagcgcATcTgAgggTTACTT


Sequencing-Result: AcgYTAAggTagcgcATcTgASSSWWWCTT
Allele 3: (Maternal) AcgTTAAggTagcgcATcTgAgggAATCTT

Allele 4: (Paternal) AcgCTAAggTagcgcATcTgAcccTTACTT

J. Mytilineos – Berlin 2019


Problem: Ambiguities
Allele 1: (Maternal) AcgTTAAggTagcgcATcTgAcccAATCTT

Allele 2: (Paternal) AcgCTAAggTagcgcATcTgAgggTTACTT


Sequencing-Result: AcgYTAAggTagcgcATcTgASSSWWWCTT
Allele 3: (Maternal) AcgTTAAggTagcgcATcTgAgggAATCTT
Allele 4: (Paternal) AcgCTAAggTagcgcATcTgAcccTTACTT
Sequencing-Result: AcgYTAAggTagcgcATcTgASSSWWWCTT
Final Result: Allele 1 + Allele 2 or
= Ambiguities
Allele 3 + Allele 4
Ambiguities – Relevance:
Allele/Antigen – Exon2/3
• Example:
A*23:01, 02:05 or
A*23:07N, 02:05

• Clinical/Functional Consequence:
– Possibility of a Mistyping
– Risc for GvHD or Rejection

• Standard Requirements:
– ASHI/EFI Standards require resolution of ambiguities only if they
are due to nucleotide differences within exons 2/3 for Class I
Alleles or exon 2 for Class II Alleles!

J. Mytilineos – Berlin 2019


HLA Nomenclature
G and P Codes for Reporting Ambiguous Allele Typings
Exons 2 and 3 encode the domains alpha 1 and 2 of HLA molecules class I,
and Exon 2 encodes the beta 1 domain of HLA molecules class II, both forming a
peptide binding groove

The differences found in the various alleles outside this region are not considered
relevant in the donor-recipient selection for HSCTx purposes.

To define this type of ambiguity, the P and G codes were created.

J. Mytilineos – Berlin 2019


HLA Nomenclature
P Codes
Example: A*01:01P contains the following alleles which all share the same protein
sequence for the antigen recognition site (encoded by exons 2 and 3):
A*01:01:01:01/A*01:01:01:03/A*01:01:01:04/A*01:01:01:05/A*01:01:01:06/A*01:01:01:07/A*01:01:01:08/A*01:01:01:09/
A*01:01:01:10/A*01:01:01:11/A*01:01:01:12/A*01:01:01:13/A*01:01:01:14/A*01:01:01:15/A*01:01:01:16/A*01:01:01:17/
A*01:01:01:18/A*01:01:02/A*01:01:03/A*01:01:04/A*01:01:05/A*01:01:06/A*01:01:07/A*01:01:08/A*01:01:09/A*01:01:10/
A*01:01:11/A*01:01:12/A*01:01:13/A*01:01:14/A*01:01:15/A*01:01:16/A*01:01:17/A*01:01:18/A*01:01:19/A*01:01:20/
A*01:01:21/A*01:01:22/A*01:01:23/A*01:01:24/A*01:01:25/A*01:01:26/A*01:01:27/A*01:01:28/A*01:01:29/A*01:01:30/
A*01:01:31/A*01:01:32/A*01:01:33/A*01:01:34/A*01:01:35/A*01:01:36/A*01:01:37/A*01:01:38L/A*01:01:39/A*01:01:40/
A*01:01:41/A*01:01:42/A*01:01:43/A*01:01:44/A*01:01:45/A*01:01:46/A*01:01:47/A*01:01:48/A*01:01:49/A*01:01:50/
A*01:01:51/A*01:01:52/A*01:01:53/A*01:01:54/A*01:01:55/A*01:01:56/A*01:01:57/A*01:01:58/A*01:01:59/A*01:01:60/
A*01:01:61/A*01:01:62/A*01:01:63/A*01:01:64/A*01:01:65/A*01:01:66/A*01:01:67/A*01:01:68/A*01:01:69/A*01:01:70/
A*01:01:71/A*01:01:72/A*01:01:73/A*01:01:74/A*01:01:75/A*01:01:76/A*01:01:77/A*01:01:78/A*01:01:79/A*01:01:80/
A*01:01:81/A*01:01:82/A*01:01:83/A*01:01:84/A*01:01:85/A*01:01:86/A*01:01:87/A*01:01:88/A*01:01:89/A*01:32/
A*01:37/A*01:45/A*01:81/A*01:103/A*01:107/A*01:109/A*01:132/A*01:141/A*01:142/A*01:155/A*01:177/A*01:212/
A*01:217/A*01:234/A*01:237/A*01:246/A*01:248Q/A*01:249/A*01:251/A*01:252/A*01:253/A*01:261

J. Mytilineos – Berlin 2019


HLA Nomenclature
G Codes
Example: A*01:01:01G contains the following alleles which all have the same
nucleotide sequence for the exon(s) 2 (and 3):
01:01:01:01/01:01:01:02N/01:01:01:03/01:01:01:04/01:01:01:05/01:01:01:06/01:01:01:07/01:01:01:08/
01:01:01:09/01:01:01:10/01:01:01:11/01:01:01:12/01:01:01:13/01:01:01:14/01:01:01:15/01:01:01:16/
01:01:01:17/01:01:01:18/01:01:38L/01:01:51/01:01:83/01:01:84/01:04:01:01N/01:04:01:02N/01:22N/
01:32/01:37/01:45/01:56N/01:81/01:87N/01:103/01:107/01:109/01:132/01:141/01:142/01:155/01:177/
01:212/01:217/01:234/01:237/01:246/01:248Q/01:249/01:251/01:252/01:253/01:261

J. Mytilineos – Berlin 2019


HLA Nomenklatur
Nutzung von G und P Codes – Vor- und Nachteile
G-Codes:
Vorteil: Beschränken sich auf den Vergleich von Nukleotidsequenzen und geben die Sequenz
wieder, die man auch detektiert hat (Konzentrierung auf Exone 2 und 3)

Nachteil: Null-Allele müssten teilweise separat ausgeschlossen werden

P-Codes:
Vorteil:
- Konzentrieren sich auf die “funktionell-relevanten” Bereiche des HLA-Moleküls –
d.h. identische Proteinsequenz, welche aber aus DNA-Daten impliziert werden muss.
- Ausschluss von Null-Allelen ist impliziert

Nachteil: Es können nicht immer alle NULL-Allele ausgeschlossen werden – Unpräzise!

J. Mytilineos – Berlin 2019


Example of an HLA-Typing Report
(High Resolution)

xx.xx.xxxx
xx.xx.xxxx

J. Mytilineos – Berlin 2019


HLA-Typisierungsverfahren

29
J. Mytilineos – Berlin 2019
Methods for HLA-Typing
• Resolution degree
– Allelic Resolution = > 2 fields: e.g. A*02:01:01:01
– High Resolution with G-Codes: e.g. A*02:01:01G
– High Resolution = 2 fields: e.g. A*02:01
– Low Resolution = 1 field: e.g. A*02
• Method
– Serological
– Molecular
– Cellular
– Biochemical
J. Mytilineos – Berlin 2019
HLA-Typing Methodology Changes
in Clinical Diagnostics over the last Decades
• Serology - CDC
• 1- and 2D-Isoelectric Focussing (Biochemical typing)
• MLC (Mixed Lymphocyte Reaction)
• PLT (Primed Lymphocyte Typing/Testing)
• RFLP (Restriction Fragment Length Polymorphism)
• PCR-SSO (classical – „Dot blot“)
• PCR-SSO (reverse – Lipa, ELPHA etc)
• PCR-SSP
• PCR-SSO (Liquid Chip – Luminex)
• PCR-SSP (real time assays)
• Sanger-SBT
• NGS
J. Mytilineos – Berlin 2019
Molecular
Typing

Serological
Typing

J. Mytilineos – Berlin 2019


Quality Requirements in H&I Diagnostics
European Federation for Immunogenetics

STANDARDS FOR
HISTOCOMPATIBILITY
TESTING
Version 7.0 (Effective from January 1st, 2018)
J. Mytilineos – Berlin 2019
Molecular Methods

• PCR-SSP  NGS
• PCR-SSO
– Luminex
• SBT (Sanger-Seq)

J. Mytilineos – Berlin 2019


NGS – Next Generation Sequencing
• Principle:
– Massively Parallel Sequencing
– Different Plattforms and Technologies
(Illumina, PGM, PacBio, Nanopore etc)

• Resolution: High, Maximum

J. Mytilineos – Berlin 2019


NGS – Next Generation Sequencing
•Higher Resolution and avoidance of Ambiguities
• Detection of Null-Alleles
• Higher Throughput
• More Information (more Loci) per Test Run
– More HLA-Loci (HLA-E, HLA-DP, HLA-DRB3/4/5 etc)
– Other Genes (ABO, KIR, CCR5 etc)

J. Mytilineos – Berlin 2019


NGS Workflow Overview
1. DNA-Isolation

2. Locus specific Amplification (PCR)

3. PCR Control – Quantification steps

4.Library Preparation (differs dramaticaly between platforms)

5. Quantification - Purification

6. Pooling

7. Sequencing

7. Interpretation and Evaluation of the Sequences

J. Mytilineos – Berlin 2019


NGS Typing Approaches
Library Preparation

= Amplicon based

= „Shot gun“ based

J. Mytilineos – Berlin 2019


Shotgun Genome Sequencing

Complete genome copies


->Fragmented genome chunks

J. Mytilineos – Berlin 2019


Shotgun Genome Sequencing

Fragmented genome chunks

NOT REALLY DONE BY DUCK HUNTERS


Hydroshearing, sonication, enzymatic shearing

J. Mytilineos – Berlin 2019


Assembly
Consensus:
TAATGCGACCTCGATGCCGGCGAAGCATTGTTCCCACAGACCGTGTTTTCCGACCGAAATGGCTCC
ATTGTTCCCACAGACCG
CGGCGAAGCATTGTTCC ACCGTGTTTTCCGACCG
AGCTCGATGCCGGCGAAG TTGTTCCCACAGACCGTG TTTCCGACCGAAATGGC
ATGCCGGCGAAGCATTGT ACAGACCGTGTTTCCCGA
TAATGCGACCTCGATGCC AAGCATTGTTCCCACAG TGTTTTCCGACCGAAAT
TGCCGGCGAAGCCTTGT CCGACCGAAATGGCTCC

6x coverage
100% identity

Coverage: # of reads underlying the consensus

J. Mytilineos – Berlin 2019


Assembly

J. Mytilineos – Berlin 2019


NGS – Sequence Analysis
HLA-Typing in Future?
Nanopore Technology
• Nanopore Thechnology?
HLA-Antikörper

46
J. Mytilineos – Berlin 2019
Antibodies against HLA

Immune response and histology of humoral rejection in kidney transplantation - Scientific


Figure on ResearchGate.
Available from: https://www.researchgate.net/figure/Ligation-of-HLA-molecules-by-high-
titers-of-anti-HLA-antibodies-can-generate-1-Direct_fig4_303806555 [accessed 25 Mar,
2019]

J. Mytilineos – Berlin 2019


How do HLA Antibodies develop
▪ Pregnancies – Against the Spouse’s HLA-Antigens

▪ Blood transfusions – Against the Blood donor’s HLA-Antigens

▪ Previous Transplantations - Against the Organ donor’s HLA-Antigens

J. Mytilineos – Berlin 2019 48


Clinical Relevance of HLA Antibodies
▪ In Solid Organ Transplantation

▪ Platelet Substitution

▪ TRALI

▪ HSCT (in particular in the Haploidentical setting)

J. Mytilineos – Berlin 2019 49


TPL-Ulm 2012 – J. Mytilineos
HLA-Antibodies in HSCT
Cumulative incidence of neutrophil and platelets recovery.

Ansari M, Uppugunduri CRS, Ferrari-Lacraz S, Bittencourt H, Gumy-Pause F, et al. (2013) The Clinical Relevance of Pre-Formed Anti-HLA and
Anti-MICA Antibodies after Cord Blood Transplantation in Children. PLOS ONE 8(8): e72141. https://doi.org/10.1371/journal.pone.0072141
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0072141
HLA-Antinodies in HSCT
Cumulative incidence of acute GVHD (grade 1–4), event-free survival and overal survival.

Ansari M, Uppugunduri CRS, Ferrari-Lacraz S, Bittencourt H, Gumy-Pause F, et al. (2013) The Clinical Relevance of Pre-Formed Anti-HLA and
Anti-MICA Antibodies after Cord Blood Transplantation in Children. PLOS ONE 8(8): e72141. https://doi.org/10.1371/journal.pone.0072141
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0072141
Detection of HLA-Antibodies
▪ Screening LCT
▪ Identification via LCT
▪ LCT Crossmatch, Flow cytometry crossmatch
▪ ELISA Screening
▪ ELISA Identification
▪ Luminex Screening
▪ Identification vía Luminex Single Antigen Beads

J. Mytilineos – Berlin 2019 53


HLA-Antibody Detection via Luminex

J. Mytilineos – Berlin 2019


Luminex Principle

Alloantikörper

PE anti-IgG

HLA-Antigen

Luminex-Bead

J. Mytilineos – Berlin 2019


HLA-Antibody Detection via Luminex

HLA-A1, A2; B7, B8


1
HLA-A2, A3; B8, B27
2
HLA-A24, A68; B7, B51
3

100

J. Mytilineos – Berlin 2019


Luminex – Multiplex Detection

J. Mytilineos – Berlin 2019


TPL-Ulm 2012 – J.
Mytilineos
Klinische Anwendung der HLA-
Testung

59
J. Mytilineos – Berlin 2019
Why do we type for HLA
• Transplantation • Disease association
– Solid Organs – B27 with AS
• Kidney – DR4 with RA
• Pancreas – DR3, 4 & DQ2, 8 with
• Heart Diabetes and coeliac
• Cornea disease
– Bone Marrow + HSC
• Recurrent foetal loss
– HLA-A, B for platelet
transfusions • Paternity testing

J. Mytilineos – Berlin 2019


Match - Mismatch
Donor Recipient Type of Match
02:01 02:01
Allele Match
03:01 03:01
02:01 02:01 GvH-Only
02:01 03:01 Mismatch
02:01 02:01 HvG-Only
03:01 02:01 Mismatch
02:01 02:05 Biderectional
HLA-A*
03:01 03:01 Allele-Mismatch
02:01 02:01 Biderectional
03:01 24:01 Broad Antigen Mismatch

02:01 02:01 Biderectional


23:01 24:01 Antigen-Split Mismatch
HLA-Compatibility in HSCT
ULM-Study - Overall Survival (OS)
(p<0,001)

J. Mytilineos – London 2018


Many thanks for your Attention